RNA Drugs Informatics - 90 min lecture with questions

Drugs directed against RNA

- a bioinformatics perspective

Morten Lindow

Associate director, Informatics

Santaris Pharma A/S

Goals for today Have a general idea about bioinformatics and high-through-put data can be used in the

industry for drug development

Explain the rationale for RNA directed drugs Differences to traditional small molecule drugs

Roles of bioinformatic sequence analysis

Outline principles about how to detect the best target site on an mRNA

Describe what LNA is and how it improves properties of oligonucleotide drugs

The describe the differences between different RNA directed drugs: siRNA, gapmers, mixmers

Describe the pros and cons of a direct acting vs an indirect acting antiviral

Describe how in global expression analysis, statistical power can be increased by analysing groups of genes instead of single genes Combine expression data with microRNA target prediction

Combine expression data with pathway-information and pharmacological observations

Know about rna.dk and COAT

R&D productivity is falling

Sections Introduction to regulatory oligonucleotides

Locked nucleic acids with phosphorothioate backbones

Invention, affinity, PK

Targeting mRNAs

ApoB, PCSK9

Targeting microRNA

miR-122

Deciphering target biology

Clinical trials

Most drugs work on proteins

…GGGCGACACUCCACCAUGAAU……

translation

CGCUGUGAGGUG

GUA

|||||||||||||||

Chemically diverse

3D

Many types of interactions with ligands

Diverse cellular compartments

Hard to develop regulator

Chemically simple

1D

Fewer cellular compartments

Easy to develop regulator

RNAseHRISC

RISC

Enzyme-directing oligonucleotides

ASOs siRNA miRNA

+ Draw on the white board to explain different classes of regulatory oligonucleotides

Designing oligos as RNA regulators

miRNAssiRNAs

Natural selection

ASOs

Intelligent design

(oligoinformatics)

TargetSurveyor.pl

?

Lindow et al.,

PLoS Comput Biol. 2007

Plant genomes have

>2000 genomic pre-miR

structures with

complementarity to

mRNA. Just waiting for

the right niche to show up.

How to bioinformatically find the

best target site on a mRNA? Which attributes would you look for?

How would you implement them?

• Vast compound libraries

• Combinatorial chemistry

• High through put screening on

primary target

• Specificity screen on related

receptors

• Tolerability screen

Lead optimization

Clinical development

CGCUGUGAGGUGGUA

|||||||||||||||

CCCCCUGAUGGGGGCGACACUCCACCAUGAAUCACUCCCCUG

~2 m

onth

s

TargetSurveyor.pl

Automated oligosynthesis

qPCR

23 optimized leads

2 in pre-clinical dev

2 in phase 1

1 in phase 2

~2 y

ears

Both Nature and Business make

use of oligonucleotides

Take 2 minutes to talk to your

neighbour and update your notes Have a general idea about bioinformatics and high-through-put data can be used in the

industry for drug development

Explain the rationale for RNA directed drugs Differences to traditional small molecule drugs

Roles of bioinformatic sequence analysis

Outline principles about how to detect the best target site on an mRNA

Describe what LNA is and how it improves properties of oligonucleotide drugs

The describe the differences between different RNA directed drugs: siRNA, gapmers, mixmers

Describe the pros and cons of a direct acting vs an indirect acting antiviral

Describe how in global expression analysis, statistical power can be increased by analysing groups of genes instead of single genes Combine expression data with microRNA target prediction

Combine expression data with pathway-information and pharmacological observations

Know about rna.dk and COAT

LNA

Invention, structure, PK

Inventor Professor Jesper WengelUniversity of Southern Denmark

Exclusive worldwide rights fortherapeutic use

Owns the rights to everything else

LNA, Locked nucleic acid

In LNA ribose is locked in an RNA-like conformation

High stabilityHigh affinity

Take 2 minutes to talk to your

neighbour and update your notes Have a general idea about bioinformatics and high-through-put data can be used in the

industry for drug development

Explain the rationale for RNA directed drugs Differences to traditional small molecule drugs

Roles of bioinformatic sequence analysis

Outline principles about how to detect the best target site on an mRNA

Describe what LNA is and how it improves properties of oligonucleotide drugs

The describe the differences between different RNA directed drugs: siRNA, gapmers, mixmers

Describe the pros and cons of a direct acting vs an indirect acting antiviral

Describe how in global expression analysis, statistical power can be increased by analysing groups of genes instead of single genes Combine expression data with microRNA target prediction

Combine expression data with pathway-information and pharmacological observations

Know about rna.dk and COAT

Two metabolic targets for gapmers

ApoB-100

PCSK9

Low density lipoprotein

LDL in serumAtherosclerosisIncreases the risk of

apoB-100

is a component of

LDL-receptor

removes

PCSK9

enhances

degradation of

SPC3833

SPC4061downregulates

downregulates

ApoB mRNA reduction leads to lowering of total cholesterol

fat diet, saline treated

normal diet, saline treated

fat diet, anti-apoB-gapmers

Niels Fisker, Marie Lindholm, M. Hedtjärn, C. Rosenbohm and Ellen Marie Straarup

Low density lipoprotein

LDL in serumAtherosclerosisIncreases the risk of

apoB-100

is a component of

LDL-receptor

removes

PCSK9

enhances

degradation of

SPC3833

SPC4061downregulates

downregulates

PCSK9 in mice

PCSK9 mRNA is reduced

Mice were treated with a

single i.v. injection of 20 mg/kg

LDLR protein is reduced

Niels Fisker, Marie Lindholm, M. Hedtjärn, C. Rosenbohm and Ellen Marie Straarup

PCSK9 antagonism leads to lowered

LDL in mice

PCSK9 mRNA is reduced

LDLR protein is reduced

total cholesterol

is reduced

serum LDL is reduced treatment - +

Time for a break

Targeting microRNA

LNA-antimiR – miravirsen

- an oligo to regulate an oligo

RISC

miR-122

miravirsen

Inhibits expression

8 LNA,

7 DNA

Wienholds et al, Science (2005)

Antagonism of miR-122 leads to

reduced plasma cholesterol

Elmen&Lindow et al, Nature 2008

Esau et al, Cell Metab 2006

Kreutzfeldt et al. Nature 2005

Single i.v. injection of

miravirsen in mice

Three i.v. injections of miravirsen

in African green monkeys

miR-122 and hepatitis C virus

HCV is a single stranded RNA virus

HCV genome resembles an mRNA

170 million infected worldwide

Current treatment often ineffective and

with serious side effects

2x miR-122 binding

sites in 5’NTR Viral replication

Jopling et al, Science 2005

Elmen&Lindow et al., Nature 2008

HCV is the target indication for

miravirsen

Discuss (5 minutes):

advantages and disadvantages or targeting a host factor vs direct targeting

of viral molecules

?

?

?

?

Can miravirsen reduce HCV-load in vivo?

Can HCV mutate to escape miravirsen treatment?

What is the physiological role of miR-122?

Does miravirsen have any off-targets?

miravirsen reduces HCV in

chimpanzees

Lanford et al, Science 2010How would you spot viral escape mutants?

Can HCV mutate to escape

miravirsen treatment?

Cooper et al, J Hepat, 2009

Direct-acting small molecule inhibitor

of viral RNA polymerase

Period of treatment

Rebound during

treatment

Lanford et al, Science 2010

LNA-antimiR targeting the host factor

miR-122

Rebound 2 weeks after

end of treatment

Deep sequencing of virus from

treated animalsHCV specific primers to amplify miR-122 binding region

454 deep sequencing

73,000 to 214,000 reads at 4 time points

Does frequency of variants change?

No evidence of viral escape from

miravirsen!

What is the physiological role of miR-122?

Are miR-122 targets upregulated after miravirsen

treatment? Can this be used as an efficacy

endpoint?

Is there a non-sequence specific effect of treatment

with LNA-oligos?

Is there a sequence specific effect of treatment with

miravirsen? (off-target effect on mRNAs?)

Antagonism of miR-122:

Effects on gene expression

Distance between transcriptomes

Data from Elmen & Lindow et al, Nature 2008

5 fat mice treated with miravirsen

5 fat mice treated with 2 mismatch control

5 fat mice treated with saline

Are miR-122 targets upregulated

after miravirsen treatment?

RISC

miR-122

Inhibits expression

ProblemOn the level of the individual gene only a few targets are

significantly upregulated (n=5) and only with about 25%

How can we get more power, by utilizing the fact that

miR-122 regulates many (several hundred) genes?

Sequence and expression analysis

combined yields a miR-signature

All ~20 000 genes

mRNA changes

antimiR

Control

predicted miR-122 targets

log2(antimiR/control)0 means no change

for each gene:

Expression analysis Sequence analysis

Null-hypothesis:Are the distributions of background and predicted targets identical?

Test: two-sided Kolmogorov-Smirnov

Response to miravirsen treatment

log2(miravirsen/saline)

Density

14503

mRNAs with

no site

879 mRNA

with

miR-122 site

0 0

miR-signature is an efficacy endpoint

p=6.60E-27

Off-target effects?

RISCmiR

antimiR

Yes, the antimiR binds and

derepress targets of the miR

Direct effect on (partially)

complementary targets?

Experimental assessment of specificity

Does potential binding of tiny LNAs to

perfect match sites lead to off-target

effects at the mRNA or protein level?

Oligo Sequence Sites in human transcriptome Sites in mouse

transcriptome

Tiny antimiR-21 GATAAGCT 917 688

Tiny antilet-7 ACTACCTC 737 608

Tiny antimiR-122 CACACTCC 2416 2127

Control oligo TCATACTA 617 356

Assessment of off-target effect - mRNA

Sort according to t-statistics

Analyze all possible 8-mers

- Bin width: 100 genes

- Test for overrepresentation in

leading set

TTTTTTTT

TTTTTTTA

TTTTTTTC

...

TTTTTTGA...

GGGGGGGG

8-mer sequence wordsACACTCCA

AACACTCC

Assessment of off-target effect – mRNA from mouse livers

Sylamer, Enright lab, 2009

Strong evidence for miRNA-

antagonism

No evidence of direct regulation of

mRNAs by LNA-antimiRs!

Take 2 minutes to talk to your

neighbour and update your notes Have a general idea about bioinformatics and high-through-put data can be used in the

industry for drug development

Explain the rationale for RNA directed drugs Differences to traditional small molecule drugs

Roles of bioinformatic sequence analysis

Outline principles about how to detect the best target site on an mRNA

Describe what LNA is and how it improves properties of oligonucleotide drugs

The describe the differences between different RNA directed drugs: siRNA, gapmers, mixmers

Describe the pros and cons of a direct acting vs an indirect acting antiviral

Describe how in global expression analysis, statistical power can be increased by analysing groups of genes instead of single genes Combine expression data with microRNA target prediction

Combine expression data with pathway-information and pharmacological observations

Know about rna.dk and COAT

Time for a break?

Understanding miR-122 biology

through transcriptomics

Microarray data from four different experiments

Model Liver Northern Serum cholesterol levels

Monkey

Normal diet

Monkey

High-fat diet

Mouse

Normal diet

Mouse

High-fat diet

On gene level: only little consistency

between mice and primates

Pathway level changesUnbiased pathway analysis

!"#$%&

'%(%)*+,$

!"#$%&

-.$/0.1)*+,$

!"#$%&'()%#%(*"+,(-./#)%0(1#'"(2/'.3/4(!50-"&%0

-.$/0.1)2

3+(&45%&6

-.$/0.1)7

3*+'/$*1)#%-#%,,%&6

&"0(#%'4*.$+"()))))))))))))))))))))))))))))))))))))4-#%'4*.$+"(

#%-#%,,+"()))))))))))))))))+(&45$+"(

61$%&('&/#0-&12'(2&"*1+1#)(

.($+8+9)$#%.$%&

,.*+(%)$#%.$%&

.($+8+9):,),.*+(%

;"*&)5/.('%,

5"8-.#%)%<-#%,,+"()*%:%*,

!"#$%&

'%(%)*+,$

monkey mouse

high fat mRNA changes mRNA changes

normal mRNA changes mRNA changesHagedorn et al, unpublished

Pathways responding consistently

across diets and species

Cholesterol synthesis enzymes are

downregulated across diets and species

Hagedorn, et. al, unpublished

Systems biology successfully

explains pharmacology!

Take 2 minutes to talk to your

neighbour and update your notes Have a general idea about bioinformatics and high-through-put data can be used in the

industry for drug development

Explain the rationale for RNA directed drugs Differences to traditional small molecule drugs

Roles of bioinformatic sequence analysis

Outline principles about how to detect the best target site on an mRNA

Describe what LNA is and how it improves properties of oligonucleotide drugs

The describe the differences between different RNA directed drugs: siRNA, gapmers, mixmers

Describe the pros and cons of a direct acting vs an indirect acting antiviral

Describe how in global expression analysis, statistical power can be increased by analysing groups of genes instead of single genes Combine expression data with microRNA target prediction

Combine expression data with pathway-information and pharmacological observations

Know about rna.dk and COAT

★Preclinical tox: “SPC3649 (miravirsen) was tolerated at doses that far

exceed those intended for human clinical use”

★Phase Ia study completed: Single dose, dose-escalationin healthy

volunteers

★Phase Ib completed: Multiple ascending doses in healthy volunteers

★Phase II completed: Hepatitis C patients

miravirsen is in clinical trials

Phase 1a. Dose dependent reduction of plasma

cholesterol in humans

Phase 2 trials showed dose

dependent reduction of viremia

Variable response -> possibilities for stratification of patients

Acknowledgements

Santaris microRNA research group

Sakari Kauppinen

Susanna Obad

Joacim Elmen

Santaris Informatics group

Andreas Petri

Peter Hagedorn

Lena Hansson (now Intomics)

Elfar Torarinson (sysadm consult)

Center for biological sequence analysis, DTU

Henrik Bjørn Nielsen

RNA.dk

35M DKK strategic center to “enable RNA therapy”

State of the art proteomics, RNA-seq and other HTP-methods to:

Determine RNA accessibility

Find factors that influence:

RNA drug potency

RNA drug toxicity

Basic research translated to improve RNA drug design

Looking for a thesis-project?

Contact

Morten Lindow – mol@santaris.com or

Jeppe Vinther jvinther@bio.ku.dk

Wrap up Have a general idea about bioinformatics and high-through-put data can be used in the

industry for drug development

Explain the rationale for RNA directed drugs Differences to traditional small molecule drugs

Roles of bioinformatic sequence analysis

Outline principles about how to detect the best target site on an mRNA

Describe what LNA is and how it improves properties of oligonucleotide drugs

The describe the differences between different RNA directed drugs: siRNA, gapmers, mixmers

Describe the pros and cons of a direct acting vs an indirect acting antiviral

Describe how in global expression analysis, statistical power can be increased by analysing groups of genes instead of single genes Combine expression data with microRNA target prediction

Combine expression data with pathway-information and pharmacological observations

Know about rna.dk and COAT