View
184
Download
3
Category
Preview:
Citation preview
May 3, 2023 1
WELCOME
May 3, 2023 2
May 3, 2023 3
Efforts to produce more food for survival have never going to stop
BY the end of the 18th century, more than 1000 species of plants have been domesticated around the world, of which approximately 100-200 now constitute the major components of the human diet, such as rice, wheat, maize, yam,cocnut,banana, etc.
Domestication &Selection
Hybridization breeding
Mutation breeding
Transgenic breeding
Xiong et al.,(2015)
May 3, 2023 4
Hybridization breeding technology:Two compatible plants in the same or closely related species/genus.Undesirable traitsPerennial horticultural cropsMutation breeding
technology:
May not heritableChimeras and require ‘‘purification,’’Low frequency of chance mutations in nature.Transgenic technology in
horticultural crop breeding:Recalcitrant to genetic transformation and regeneration.Opposition in recent years
Xiong et al.,(2015)
5
Gene editing
Kittur rani channamma college of horticulture, Arabhavi
University of Horticultural Sciences, Bagalkot
Presented by: VEERESHA S M
UHS15PGM552Dept. of Biotechnology and Crop Improvement
Seminar- 1 on
May 3, 2023 6
What is gene editing?
Genome/gene editing is a type of genetic engineering in which precise genome modifications are brought about using artificially engineered nucleases in organisms.
Use of engineered nucleases to introduce DNA insertions, Deletions, or replacements at sequence specific sites in a genome
May 3, 2023 7
These engineered nucleases contains
1. A non specific DNA cleavage module ( Nucleases) 2. Sequence specific DNA binding domains ( ZFN or TALE
protein or CRISPR- gRNA)
May 3, 2023 8
May 3, 2023 9
May 3, 2023 10
Lotus Nelumbo nucifera 929 2013 (Ming et al., 2013)
Bladderwort plant Utricularia gibba 82 2013 (Ibarra-laclette et al.,2013)
Bladderwort plant Utricularia gibba 82 2013 (Ibarra-laclette et al.,2013)
Hot pepper Capsicum annuum 3480 2014 (Kim et al., 2014)
Pineapple Ananas comosus 526 2014 (Zhang et al., 2014)
Eucalyptus Eucalyptus gramdis 640 2014 (Muburg et al., 2014)
Wild tomato Soanum pennellii 1207 2014 (Bolger et al., 2004)
Tobacco Nicotiana tobacum 4500 2014 (Sierro et al., 2014)
Oilseed Brassica napus 1130 2014 (Chalhoub et al., 2014)
Sweet orange Citrus sinensis-2 319 2014 (wu et al., 2014)
May 3, 2023 11
As we already knowing the
DNA sequence of some
organism’s we can edit the
gene by using certain
techniques & tools
ZFNs
TALENs
CRISPR/cas9
Zinc finger nucleases
Transcription activator like effector nucleases
Clustered regularly interspaced short palindromic repeats
May 3, 2023 12
DSBs pose a uniquely high threat to the integrity of the genetic information of a cell. Not only can the unfaithful repair of a DSB result in unwanted modifications of genetic information, but a failure to repair such a break could also lead to the loss of larger chromosomal fragments (Agarwal et al. 2006). Thus, eukaryotic cells have evolved elaborate mechanisms to repair DSBs faithfully and efficiently. Two major mechanisms of DSB repair are known, NHEJ and HR. both of which can be exploited to achieve targeted genome engineering such as gene knockout and gene addition.
Principle
May 3, 2023 13
Breaks induce DNA repair and increases mutagenesis frequencies by >1000 folds
DSB
Donar DNA
NHEJ=Non-homologous end joiningTargeted mutagenesis/deletion
HDR=homology directed repairTargeted insertion /replacement
GENOME EDITING PROCESS:- Double strand breaks
Double stranded DNA
May 3, 2023 14
ZFNs: The pioneer of SSNsCys2-His2 zinc finger (ZF) domine is the most
abundant DNA-binding motif in eukaryotes
May 3, 2023 15
Structure of ZF
May 3, 2023 16
1. ZFNs
Hybrid nuclease Induces double strand break Function as site-specific endonucleases They specify 18bp of DNA per cleavage
ZFP DNA binding domain
Cleavage domain of Fok I Endonuclease
ZFN
May 3, 2023 17May 3, 2023 17
DSB
Donar DNA
NHEJ=Non-homologous end joiningTargeted mutagenesis/deletion
HDR=homology directed repairTargeted insertion /replacement
GENOME EDITING PROCESS:- Double strand breaks
Fok IZink-fingerZFNs
May 3, 2023 18
NNNNNNNNNNNNNNNNNNNCATCC
NNNNNNNNNNNNNNNNNNNGTAGG5’3’ 5’
3’
NucleaseDNA-binding
Fok I
Flavobacterium okeanokoites N-terminal: DNA-binding domain C-terminal: nonspecific DNA-cleavage activity
May 3, 2023 19
Fok I nucleases
May 3, 2023 20
Construction of ZFN
Randomized Library and a Phage DisplayBipartite Library and Two-Finger ArchiveModular AssemblyBacterial-Based SelectionContext-Dependent Assembly (CoDA)
May 3, 2023 21
1.Targeted gene (disruption) knockouts: Targeted induction of minor insertions and deletions
2. Targeted gene integration: To place exogenous genetic sequences precisely into targeted sites of the genome
3.Targeted gene correction: Transfer of single-nucleotide changes and short heterologous stretches from donor to the chromosome.
Mode of action
May 3, 2023 22
May 3, 2023 23
Figure 7: (A) ZFPAP3 target sequence (boxed) and its position in the AP3 5 UTR. Numbers indicate the distance from the ATG translation initiation codon. The arrowed boxes indicate the exon of AP3. (B) DNA recognition helix sequences of the ZFPAP3 protein. The underlined amino acids are the components of the new zinc fingers that provide specificity for the selected nucleotide sequences indicated in A. The recognition helices of fingers 1–6 (F1–F6) are underlined. Guan et al., 2002, San Diego, CA
May 3, 2023 24
Figure 8: Activation of the silenced endogenous AP3 gene in Arabidopsis leaf cells. RT-PCR was used to detect AP3 expression in Arabidopsis leaf protoplasts transformed with GFP (control), ZFPm4-VP64 (nonspecific activation control), and ZFPAP3-VP64 (AP3-specific activation). The last lane is no template control amplification.
Guan et al., 2002, San Diego, CA
May 3, 2023 25
Figure 9: GUS staining flowers of background plant with AP3::GUS only and double transgenic plant with both AP3::GUS and activation construct AP1::ZFPAP3-VP64 nos. (A). Predicted GUS staining patterns of AP3::GUS and AP1::GUS
Guan et al., 2002, San Diego, CA
May 3, 2023 26Guan et al., 2002, San Diego, CA
May 3, 2023 27
Figure 11: Floral phenotypic changes in double transgenic plant expressing AP3::GUS and AP1::ZFPAP3-VP64nos simultaneously. A seven-petal flower is shown here. Two extra petals are fully converted (f), and the third one is partially converted (p).
Guan et al., 2002, San Diego, CA
May 3, 2023 28
IN PLANTA REPRESSION OF ENDOGENOUS AP3
UBQ3 – Promoter was used to drive the expression of AP3 specific ZFP
UBQ3:: sid-ZFPAP3//nos
Guan et al., 2002, San Diego, CA
May 3, 2023 29
Figure 12: Repression of endogenous AP3 expression by the constitutive repression construct UBQ3::Sid-ZFPAP3nos in transgenic plant ND0052–2e. (A) RT-PCR identification of transgene ZFPAP3 in transgenic event ND0052–2e and wild-type control plant. (B) RT-PCR evaluation of endogenous gene AP3 expression level in transgenic event ND0052–2e and wild-type plant. In plant ND0052–2e, the expression of AP3 is significantly repressed by the expression of repressor Sid-ZFPAP3 fusion protein. Quantitative PCR indicated 46-fold repression. Guan et al., 2002, San Diego, CA
May 3, 2023 30Guan et al., 2002, San Diego, CA
AP3::GUS only AP3::GUS and UBQ3::Sid-ZFPAP3nos
May 3, 2023 46
32
2.TALENsTranscription activator-like effector nucleases
( Core genomic cruise missile for SSNs)
May 3, 2023
Alternative to ZFNs for gene editing
Since the discovery of “ the Code ’’ connecting the repetitive regions of transcription activation- like effector protiens with the DNA bases to which they bind ( Boch et al. 2009; Moscou and Bogdanove 2009), TALENs have become the current reagent of choice for efficiently modifying eukaryotic genomes in a targeted fashion ( Baker 2012).
Chen,K., & Gao C., 2014
May 3, 2023 33
Structure of TALENsN-terminal : Secretion and translocation signals
C- terminal : Nuclear localization signals (NLS) and an acidic transcription activation domine (AD), and @ central DBD
HD= CNG=TNI=ANN=G or A
NK & NH = Guanine
Chen,K., & Gao C., 2014
May 3, 2023 34
CONSTRUCTION METHODS
Standard cloning assembly methodsGolden gate assembly methodsSolid- phage assemble method
Chen,K., & Gao C., 2014
May 3, 2023 35Xiong et al, 2015
May 3, 2023 36Lor et al., 2014
May 3, 2023 37Lor et al., 2014
Strategy for regenerating pTAL425/6 TALEN- induced mutants
NO β-estradiol
Induced with β -estradiol
May 3, 2023 38
Characterization of TALEN-induced mutations
Lor et al., 2014
May 3, 2023 39
Figure S4. The coding region of PRO showing the sequences of the pro and one of the pro_7 alleles. The 88bp that are deleted in one of the pro_7 alleles (Figure 1B) are highlighted. The insertion sequence of pro allele is shown. TALEN_1 TALEN_1
Lor et al., 2014
May 3, 2023 40Lor et al., 2014
May 3, 2023 46
May 3, 2023 42
3.CRISPRClustered regularly
interspaced short palindromic repeats
CRISPRs: New SSN troops
May 3, 2023 44
Structure of CRISPR/Cas9
Guided RNA
Three types:Type I and type III involve multiple proteins forming large cas complex
Type II from Streptococcus pyogenes, which relies on a single endonucleage,Cas9
May 3, 2023 45Wang et al., 2015
May 3, 2023
List of Primers used in the experimentPrimer Name Gene Name Primer sequence(5’-3’) Application
GNbPDS-FNbPDS guide sequence
TCGGGCCGTTAATTTGAGAGTCCAGuide sequenceGNbPDS-R AAACTGGACTCTCAAATTAACGGC
GStIAA2-FStIAA2 guide sequence
TCGGGATGTTTAGCTCCTTTACTAGuide sequenceGStIAA2-R AAACTAGTAAAGGAGCTAAACATC
NbPDS-FNbPDS
GCTTTGCTTGAGAAAAGCTCTCPCR assay and sequencingNbPDS-R ACATAACAAATTCCTTTGCAAGC
Cas9ID-FCas9
ATGGCCCCTAAGAAGAAGAGRT-PCR assayCas9ID-R GAGATTCCCGAACAAGCCG
StIAA2-FPGSC0003DMB000000125
GTGTCAGAGGTCCATACGCTAGAACPCR assay and sequencingStIAA2-R CCTTGGGACCCATAATTACCTGC
StoffT-FPGSC0003DMB000000384
GGTAGGGCACAAGTTGTGGGTPCR assay and sequencingStoffT-R GGTGTCAACTGACTCTCCTTCG
StUbi3-FPGSC0003DMG400005199
AAAGAAACCCTAAAAGCCGCRT-PCR assayStUbi3-R TGTCGGAAGACTCAACCTCT
25296596FNiben.v0.3.Scf25296596
GTATCACCCCAAGACCAAGCPCR assay25296596R TGTTCAACTATGCTTGTTTATTCC
24888932FNiben.v0.3.Scf24888932
GCAACATGAAGTTAGTTTGAGCAPCR assay24888932R GGGGCAGAAGGTAATTAGCAG
23457768FNiben.v0.3.Ctg23457768
TCCTGTAATTTTCTTTGTGATTCGPCR assay23457768R TTCCCCTTTCTTGAGTTCCA
Wang et al., 201546
CRISPR/Cas9-mediated gene editing in stable transgenic potato plants.
a ) Schematic illustrating the engineered CRISPR/Cas9 vector. b ) Schematic illustrating the guide RNA (sgRNA, red arrows) targeting the
StIAA2 coding sequence. Black arrows indicate the PCR primers used to evaluate the mutation types.
c) RT-PCR for the transcripts of Cas9 in wild-type and transgenic potatoes.
Wang et al., 2015May 3, 2023 47
sgRNA – Targeting stIAA2
May 3, 2023 48
Target gene mutagenesis in N.benthamiana using CRISPR/Cas9 system
a. Schematic and sequence of the PHYTOENE DESATURASE(PDS) gene of N.benthamiana with one target(red) in it and primers(green) for PCR assay.
b. DNA gel detection amplificons using primers flanking the target site within the PDS gene. In lanes 1-6 the genomic DNA was digested with MlyI. Lane 7 shows the control genomic DNA. Wang et al., 2015
May 3, 2023 49
Alignment of reads in PDS obtained from lane 1 • The sequence of wild type is shown at the top. • The guide sequence is highlighted in red and the mutants in blue. • The changes in length and sequence are shown to the right. "G">"T" means that the
nucleotide G is converted to T, T(x4) indicates that four clones have this insertion.
Wang et al., 2015
May 3, 2023 50
Native U6 promoter of potato is efficient for targeted mutagenesis in N. benthamiana
stIAA2, CRISPR/cas9 construct was transferred To check induced knockouts in potato
stIAA2::CRISPR/cas9 POTATO
May 3, 2023 51
PCR genotyping of six representative StIAA2 mutation plants showing the types of DNA lesions generated
Wang et al., 2015
May 3, 2023 52
Complete sequence of potato U6 promoter and gRNA scaffold. The potato U6 promoter is highlighted in grey and the gRNA scaffold is highlighted in green. Two AarI sites are in red. The guide sequence can be inserted between the two AarI sites using annealed oligonucleotides.
Wang et al., 2015
May 3, 2023 46
May 3, 2023 54Brooks et al., 2015
May 3, 2023 55
CRISPR/Cas9-mediated gene editing in stable transgenic tomato plants. A Schematic illustrating two sgRNAs (arrows) targeting the SIAGO7 coding sequence. Cas9/sgRNA2 Were expressed from the same plasmid (Belhaj et al., 2013). Black arrows indicate PCR primers used to evaluate mutation type and efficiency.
B, A wild-type (WT) tomato plant at 9 weeks of age, and fourth produced leaf from the primary shoot (insect).
C, The strong wiry2-1 allele of slago7. First formed leaves have leaflets petioles (blue arrow), and later formed leaves are radialized (white arrows).
Brooks et al., 2015
May 3, 2023 56
D and E, a Representative crispr/Cas9-slago7 (CR-slago7) plant (D) and its first five leaves showing the distinctive loss-of-function recessive wiry syndrome (E). Bars=1cm.
Brooks et al., 2015
May 3, 2023 57Brooks et al., 2015
May 3, 2023 58
H .Germline transmission and heritability of the small and large deletions from plant 3 ( left) and 2 small deletions from plant 5 ( Right ) in the absence of inductive cas9 / sg RNA 1 /sgRNA 2 trasgene. All 4 progeny from plant 3 lacked the CRISPR/cas9 transgene, and all four were heterozygous for deletions, three of which were heterozygous for the large deletion and one heterozygous for the smaller deletion. of the 10 progeny from plant 5, 2 plants lacked the CRISPR/cas9 transgene, and sequencing showed that both were heterozygous for the wild type allele and one of the two deletions( bottom ). Brooks et al., 2015
May 3, 2023 46
May 3, 2023 60
Advantages
Speed
Simplicity
Acc
urac
y
or s
pecificit
y
Abse
nce
of tra
ns
ge
nes
May 3, 2023 61Song et al.,
May 3, 2023 62
ZFN TALEN CRISPR
Binding principle Protein-DNA Protein-DNA RNA-DNA
Core component ZFN-Fok1 fusion protein TALE-Fok1 fusion protein
sgRNA and Cas9
Work mode (pair) Pair Pair No
Construction Difficult Easy Very easy
Time construction (days)
5-7 5-7 1-3
Cost High Moderate Low
Efficiency Variable High High
Length of target ~18 to 24bp including 4-7 spacers
~30 to 60bp including 13-33 spacers
~20bp
Comparison between ZFN,TALEs and CRISPR/cas9 system of gene editing
Chen, K. & Gao,C.,2014
May 3, 2023 63
CONCLUSION
May 3, 2023 64
THANK YOU
Recommended