View
3.101
Download
0
Category
Preview:
Citation preview
Applications of molecular genetic techniques
Recombinant DNA – Fig 20.1, 20.2Gene Cloning – Fig 20.3, 20.4cDNA library (MaCS only) – Fig 20.5DNA Fingerprinting using:
RFLP (restriction enzyme) PCR (OSC lab)
Recombinant DNA
DNA in which genes from two different sources (often different species) are combined in vitro into the same molecule
Method: Restriction enzymes Sticky ends on restriction fragment can
form complementary basepairs with single-stranded stretches on other DNA molecules that have been cut with the same enzyme
Gene Cloning
Making multiple copies of a single gene
Step 1: Ligation Step 2: Transformation &
AmplificationStep 3: Selection
http://tainano.com/Molecular%20Biology%20Glossary.files/image053.gif
Gene cloning step 1 LigationForming Recombinant DNALigation: gene of interest
inserted into a vectorCloning vector: a
plasmid into which the gene of interest is introduced
Plasmid: small circular DNA found in bacterial cells that is not the chromosomal DNA
Fig. 20.3
Gene cloning step 1 LigationForming Recombinant DNASteps:Restriction enzyme digestion:
of cloning vector at cloning site to remove gene of interest
Insert gene of interest into vector add DNA ligase to bond gene with vector
Cloning vector components
Cloning site: Where gene of interest will be inserted Where transcription can occur because
contains an upstream promoter Usually found in the middle of the lacZ gene
which is responsible for making the enzyme β-galactosidase
Antibiotic resistance gene: Selection for host cells that have resistance
Replication origin: allows plasmid to replicate in the host cell
Example of a Cloning Vector
Ligate the gene of interest into the vector such that it interrupts the genes responsible for making the enzyme β–galactosidase.
Gene Cloning Step 2 TransformationAmplify the recombinant DNA in vivoSteps:Transform
recombinant DNA into bacterial cell
Grow bacteria in a large batches (flasks)
As bacterial cells multiply, the gene of interest will be replicated with each cell
Gene Cloning Step 3SelectionSelection: Identify colonies of bacteria
containing the recombinant DNA with gene of interest
Possible bacterial clone products: A. bacteria without vector B. bacteria with vector without the gene C. bacteria with vector with the wrong gene D. bacteria with vector with the correct
gene
Plating and selecting colonies
Plating: taking a sample of the bacteria and growing them on plates
Plates have a medium containing: Antibiotics X-gal
Gene Cloning Step 3Selection Mechanisms
A. Select for bacterial clones that contain a vector (select for proper transformation)
Vector confers antibiotic resistant to bacterial because the vector contains an antibiotic resistant gene
Cells that transformed the vector will live
Antibiotic Resistance Bacteria are
grown on Petri plate containing a specific antibiotic (e.g. amplicillin).
Only bacteria which properly transformed (accepted the vector) will grow.
Selection for properly transformed cells containing vector
http://www.biotechlearn.org.nz/var/biotechlearn/storage/images/themes/from_genes_to_genomes/images/bacterial_transformation/4063-1-eng-AU/bacterial_transformation_large.jpg
Gene cloning step 3Selection Mechanisms
B.Select for bacterial clones that contain a vector and an inserted gene (proper ligation)
plasmids contain lac Z gene that codes for the β-galactosidase (β-gal)
β-gal acts on X-Gal (a clear soluble substrate) to produce a blue precipitate
β-galactosidase Reaction
X-gal (colourless)
5-bromo-4-chloro-3-hydroxyindole galactose
5,5'-dibromo-4,4'-dichloro-indigo, an intensely blue product which is insoluble
Spontaneous dimerization & oxidation
hydrolysis
β-galactosidase Screening
Bacteria are grown on Petri plates containing X-Gal.
Plasmids that have a gene inserted into the right place won’t have a functional β-gal enzyme.
These bacteria, when grown in X-gal, cannot process it and stays white.
β-galactosidase Screening
Bacteria which did not accept the new plasmid will have a working β-gal that will process X-gal into a blue product.
Gene cloning step 3Selection Mechanisms
C.Select for bacterial clones that contain the vector with the gene of interest
Perform DNA hybridization Make a paper blot of the
clones add probes complementary to
the gene of interest Visualize blot to see which
clones “light up” Match blot with cells on Petri
dish to choose the appropriate clones
Cloning Applications
Transgenic plantsPlants cells can also take in bacterial
plasmids.
Flavr Savr TomatoesBt toxin – natural herbicide
Animation: Gene cloning
http://www.sumanasinc.com/webcontent/animations/content/plasmidcloning.html
http://highered.mcgraw-hill.com/olc/dl/120078/micro10.swf
Genomic Library A collection of genes A complete set of recombinant plasmids
clones each carrying copies of particular segment of the genome (comprehensive)
However process of generating library can cut up genes because restriction enzymes do not respect gene boundaries (shotgun approach)
Animation: http://www.sumanasinc.com/webcontent/animations/content/dnalibrary.html
cDNA Library
cDNA = complementary DNAReverse transcribed from mRNAAnimation: Making a cDNA
http://highered.mcgraw-hill.com/olc/dl/120078/bio_h.swf
Animation: Application of cDNA Chip technology
http://www.sumanasinc.com/webcontent/animations/content/dnachips.html
Microarrayhttp://highered.mcgraw-hill.com/olc/dl/120078/micro50.swf
Restriction Fragment Length Polymorphism (RFLP) An historic method for DNA fingerprinting Polymorphism:
Root word from Greek for “many forms” Differences in DNA sequences found among
the individuals in a population (e.g. alleles) Restriction fragment length
polymorphism: differences in DNA sequence on homologous
chromosomes that result in different DNA fragments when cut by a restriction enzyme
Most frequently found on noncoding regions
Polymorphism example Cut with EcoRI at restriction site: GAATTC Target sequence (probe): GCATGCATGCATGCATGCATG
Jack’s DNA sequence at a specific locus:First copy: Total length of fragment = ??? kb-GAATTC(8.2kb)GCATGCATGCATGCATGCATG(4.2kb)GAATTC-Second copy: Total length of fragment = ??? kb-GAATTC(3kb)GCATGCATGCATGCATGCATG(1.3kb)GAATTC-
Jill’s DNA sequence at the same specific locus:First copy: Total length of fragment = ??? kb-GAATTC(8.2kb)GCATGCATGCATGCATGCATG(4.2kb)GAATTC-Second copy: Total length of fragment = ??? kb-GAATTC(1.2kb)GCATGCATGCATGCATGCATG(1.3kb)GAATTC-
Polymorphism example Cut with EcoRI at restriction site: GAATTC Target sequence (probe): GCATGCATGCATGCATGCATG
Jack’s DNA sequence at a specific locus:First copy: Total length of fragment = 12.4kb-GAATTC(8.2kb)GCATGCATGCATGCATGCATG(4.2kb)GAATTC-Second copy: Total length of fragment = 4.3kb-GAATTC(3kb)GCATGCATGCATGCATGCATG(1.3kb)GAATTC-
Jill’s DNA sequence at the same specific locus:First copy: Total length of fragment = 12.4kb-GAATTC(8.2kb)GCATGCATGCATGCATGCATG(4.2kb)GAATTC-Second copy: Total length of fragment = 2.5kb-GAATTC(1.2kb)GCATGCATGCATGCATGCATG(1.3kb)GAATTC-
RFLP Analysis
Individuals can be identified by looking at the polymorphisms
method only works when the sequence you are looking for contains the restriction site
RFLP overview 1. Restriction enzyme digestion: cut DNA in small fragments
2. Gel electrophoresis: separate fragments by size
3. Southern blotting: immobilize fragments
4. Hybridization: radioactive probe binding to fragments of interest
5. Autoradiography: visualizing the fragments of interest
http://static.ddmcdn.com/gif/dna-profiling.jpg
Modern DNA Fingerprinting RFLP has disadvantages because you
can end up with too many fragments after cutting with the restriction enzyme
Modern approach is to use PCR to amplify the specific locus of interest E.g. OSC DNA Fingerprinting lab
Both require visualizing differences in fragment size by using gel electrophoresis
Using PCR to generate DNA Fingerprint
1. PCR: primers amplify the fragment of interest
2. Gel electrophoresis: separate fragments by size
3. No need to transfer to paper
4. Since PCR primers only amplifies fragment of interest, no need to hybridize a probe to locate fragment
5. Take a picture of the gel
XX
PCR
fewer bands
No x-ray film, just a picture
DNA Fingerprinting ApplicationPaternity testing: identifying the
father Animation:
http://www.sumanasinc.com/webcontent/animations/content/paternitytesting.html
Criminal cases: eliminating suspects Identifying a corpse
Ontario Science CentreDNA Fingerprinting LabGeneral ProceduresLab ReportThings you should know by the end
of the lab
General Procedures Isolate DNA from hair cells Use primers and PCR to amplify a specific
noncoding region on your chromosome Use gel electrophoresis to separate the
PCR fragment(s) by size Visualize the gel Determine whether you are homozygous
or heterozygous and the allele frequency (how “common or unique” you are relative to the general population)
DNA Isolation
Why take the hair sheath? What is the component of the shaft?
What is the function of Chelex? proteinase K?
Why incubate at 65oC? 100oC? What is vortexing? What was the
purpose for each time the sample was vortexed?
Why centrifuge? What is in the supernatant? pellet?
PCR
Why are certain items kept on ice? Which items are kept on ice?
What is the content of the master mix?
What is the function of MgCl2? buffer?
What is the name of the PCR machine?
Gel electrophoresis
What is the purpose of the buffer? Why is a polyacrylamide gel used
instead of agarose? What is resolving power? What are the components of the loading
dye? What are each of their functions? What is a DNA ladder? Why is it
necessary? Why is it necessary to stain the gel?
What was used as the stain?
Analysis What does D1S80 mean? How many repeats exist at this locus (it’s a
range)? How many bp make up the repeat? Given a sequencing gel, determine the
length and sequence of repeats. Given a gel and a DNA ladder, determine
the size of the DNA fragment. Given a gel, determine if an individual is
homozygous or heterozygous and their allele frequency.
Given allele frequencies, calculate genotypic frequencies. Express answers in fractions and in numbers of individuals.
General Why use disposable tips? When should a
tip be replaced with a new one? How do you read a micropipette? How do
you set the correct volume? What does the number at the top of the micropipette indicate?
How do you use a micropipette? What are the functions of the two stops?
What does aliquot mean? What is a VNTR? Describe at least 4 applications of DNA
fingerprinting.
Recommended