Warm Up: (11_5) ATGCGTCGT What is the complementary DNA strand? Based on this complementary strand...

Warm Up: (11_5)

ATGCGTCGT

What is the complementary DNA strand?

Based on this complementary strand what would the mRNA strand be?

Make your mRNAs!

• You are just making nucleotides!!! Do not link nucleotides together!

DNA to Protein Translation

• Initiation: The mRNA, ribosome and tRNA’s get together with the help of enzymes

• Initiation: The mRNA, ribosome and tRNA’s get together with the help of enzymes– tRNA contains an anticodon: three nucleotides on

the tRNA that are complementary (match up with) the mRNA

• Initiation: The mRNA, ribosome and tRNA’s get together with the help of enzymes– The start codon (methionine) is the first to go

through

• Elongation: A polypeptide chain is formed. – tRNA’s with the proper anticodon match up with

the mRNA. – They move through the ribosome,

• Termination – Process stops when a stop codon is reached

Termination – Process stops when a stop codon is reached

Disassembly Polypeptide (protein) is released as the three types of RNA separate

Protein Synthesis Videos

• https://www.youtube.com/watch?v=nHM4UUVHPQM

• https://www.youtube.com/watch?v=D3fOXt4MrOM

Reading a codon chart!

Use the Codon Chart to make the amino acid sequence

mRNA: AUG-CCA-GAU-GGA-UAA

DNA: TAC-CCG-GAT-GGG-ATC

Translation Practice Problems

1. What is a codon? What is an anticodon?2. How many amino acids are there?3. What three types of RNA are involved in translation, what

function does each play? 4. What is a polypeptide chain? What does it eventually turn into? 5. Explain how tRNA assists in building a protein 6. Explain how protein production is stopped.

7. Transcribe the following DNA Template strand to mRNA 3’ TACAATAGGGTCTCAGCACGCCCCATT 5’. Then decode the anti-codon sequence (hint: you need to use your mRNA sequence for

this). Last, translate the mRNA sequence to an amino acid sequence

Process: Where is this process located

(assuming eukaryote

cell)?

Is DNA directly involved in

process?

Which types of RNA are

involved?

End Result and Purpose

Transcription 1. 2. 3. 4.

Translation 5. 6. 7. 8.

Lets Practice Translation

• Take your mRNA strand and translate it! – Use the transfer RNA anticodons as a check

– If you cannot find the amino acid you are looking for you may have made a mistake….

Show Ms. Spencer the process when you have completed it!

Codon Bingo (Can Repeat!!!!)1. alanine 2. glutamate 3. leucine 4. serine 5. arginine 6. glutamine 7. lysine 8. tryptophan 9. asparagines 10.glycine 11.methionine

12.tyrosine 13.aspartate 14.histidine 15.phenylalanine 16.threonine 17.cysteine 18.isoleucine 19.proline 20.valine 21.stop

DNA ReplicationThink – Pair – Share

When do cells need to replicate their DNA?

DNA ReplicationThink – Pair – Share

When do cells need to replicate their DNA?

Cell Division! Prokaryotes: Binary Fission

Eukaryotes: Mitosis and Meiosis

DNA Replication 1. Helicases separate DNA strands, this creates

a replication fork

DNA Replication 1. Helicases separate DNA strands 2. DNA polymerase adds complementary

nucleotides to the strand

DNA Replication

1. Helicases separate DNA strands 2. DNA polymerase adds complementary

nucleotides to the strand 3. DNA polymerase finishes replicating and

falls off, two separate DNA molecules result

DNA Replication 1. Helicases separate DNA strands 2. DNA polymerase adds complementary

nucleotides to the strand 3. DNA polymerase finishes replicating and

falls off, two separate DNA molecules result 4. Each new DNA has one original DNA strand

and one new DNA strand, this is called semi-conservative replication

DNA is made in the 5’ to 3’ direction • That means that the leading stand can

copy uniformly, the lagging strand is copied in segments, these segments are called Okazaki fragments

DNA Replication 1. Helicases separate DNA strands, this creates

a replication fork

DNA Replication Videos https://www.youtube.com/watch?v=27TxKoFU2Nw

https://www.youtube.com/watch?v=5qSrmeiWsuc

https://www.youtube.com/watch?v=dKubyIRiN84

https://www.youtube.com/watch?v=5qSrmeiWsuc

Okazaki Fragments: https://www.youtube.com/watch?v=TEQMeP9GG6M

Warm Up: (11_5) ATGCGTCGT What is the complementary DNA strand? Based on this complementary strand...

Documents

Ozark School District€¦ · DNA has a sense strand and an antisense strand The antisense strand is complementary to the sense strand. It is also known as the template strand, as

Transcription Transcription of DNA into RNA DNA transcription produces a single-stranded RNA molecule that is complementary to one strand of DNA

PowerPoint Presentation › faculty › mishra › SCHEDULE › 07.04... · DNA fragment, known as the template, is anchored to surface the starting point of a complementary strand;

Strand: Listening and Responding Strand Unit: Exploring Sounds

Agenda 1-22-13 Bell work #30 Write the complementary DNA strand of the strand below. TTAAGCGCTAATCGTACT Notes: Translation and Transcription Practice

Transcription and Translation - danrogayan.weebly.com · Replication •DNA double helix unwinds DNA •DNA now single-stranded •New DNA strand forms using complementary base pairing

RNAi Haixia Wang ----03-5-26. RNAi--- The mechanism by which double strand RNA specifically suppresses the expression of a gene bearing its complementary

Instructions for DNA Model Model must include two complementary strands of DNA shaped into a double helix Each strand must be at least 10 nucleotides/base

TRANSCRIPTION : Prokaryote Eukaryote DNA : Template strand Coding strand

DNA (Test 1) 3. When DNA replicates, each strand of the original DNA molecule is used as a template for the synthesis of a second, complementary strand

ABCD FPV V3 2015 for web final 170915€¦ · tissues. Parvoviruses require cellular DNA polymerases to synthesize the complementary DNA strand, which is the first step in replication

Testing “technologies”...Bst DNA polymerase, 5´ → 3´ polymerase and strand-displacement activity Amplifies by “unzipping” DNA. Complementary sequences on primers form a

DNA replication, repair and recombination · DNA repair mechanisms all DNA repair mechanisms rely on the presence of an intact complementary strand, as a blue-print for repair •

core-docs.s3.amazonaws.com · Web viewSTRAND: reading. STRAND: reading. STRAND: reading. STRAND: writing. STRAND: writing. STRAND: writing. STRAND: Research. STRAND: Research. STRAND:

Year 7 Content matrix and Australian Curriculum mapping...Content Strand: Literacy Sub-strand Content descriptions Strand: Language Sub-strand Content descriptions Strand: Literature

6 Strands of Technology Strand 1: Toffler’s 3 Waves Strand 2: Technology Strand 3: Work Strand 4: Education Strand 5: Society and Culture Strand 6: Political

Cas9-Guide RNA Directed Genome Editing inlected from the sense DNA strand, and another site (DD43) was selected from the complementary strand slightlyupstreamofDD20(Fig.2).The20-bpsequences

Constructions for complementary and near-complementary

7.3 Australian Curriculum mapping: units 1–8...Content 16x16 32x32 Strand: Literacy Sub-strand Content descriptions Strand: Language Sub-strand Content descriptions Strand: Literature

doe.virginia.govdoe.virginia.gov/.../2017/cf/english-cf-2017.docx · Web viewstrand: writing . strand: writing . strand: writing . strand: research. strand: research. strand: research