View
216
Download
0
Category
Preview:
Citation preview
The Haemophilus Sap Transporter Mediates Bacterial-Epithelial Cell 1
Homeostasis 2
3
4
Forrest K. Raffel, Blake R. Szelestey, Wandy L. Beatty, Kevin M. Mason* 5
6
The Research Institute at Nationwide Children’s Hospital and The Ohio State University 7
College of Medicine, Department of Pediatrics, Center for Microbial Pathogenesis, 8
Columbus, OH, United States of America 9
10
Running Title: Sap-Mediated transport and Virulence 11
12
13
14
15
*Corresponding author: 16
Kevin M. Mason, Ph.D., The Research Institute at Nationwide Children’s Hospital, 17
Center for Microbial Pathogenesis, The Ohio State University College of Medicine, 18
Department of Pediatrics, Columbus, OH, United States of America 19
Phone: (614) 355-3534, Fax: (614) 722-2818, 20
E-Mail: Kevin.Mason@nationwidechildrens.org 21
22
23
Copyright © 2012, American Society for Microbiology. All Rights Reserved.Infect. Immun. doi:10.1128/IAI.00942-12 IAI Accepts, published online ahead of print on 15 October 2012
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
Abstract 24
Nontypeable Haemophilus influenzae (NTHI) is a commensal inhabitant of the 25
human nasopharynx, and causative agent of otitis media and other diseases of the 26
upper and lower human airway. During colonization within the host, NTHI must 27
acquire essential nutrients and evade immune attack. We previously demonstrated that 28
the NTHI Sap transporter, an inner membrane protein complex, mediates resistance to 29
antimicrobial peptides and is required for heme homeostasis. We hypothesized that 30
Sap transporter functions are critical for NTHI interaction with the host epithelium and 31
establishment of colonization. Thus, we co-cultured the parent or the sapA mutant on 32
polarized epithelial cells grown at an air-liquid interface, as a physiological model of 33
NTHI colonization, to determine the contribution of the Sap transporter on bacterial-host 34
cell interactions. Although SapA-deficient NTHI were less adherent to epithelial cells, 35
we observed a significant increase in invasive bacteria compared to the parent strain. 36
Upon internalization, the sapA mutant appeared free in the cytoplasm whereas the 37
parent strain was primarily found in endosomes, indicating differential subcellular 38
trafficking. Additionally, we observed reduced inflammatory cytokine production by the 39
epithelium to the sapA mutant strain compared to the parental strain. Furthermore, 40
chinchilla middle ears challenged with the sapA mutant demonstrated a decrease in 41
disease severity compared to ears challenged with the parental strain. Collectively, our 42
data suggest that NTHI sense host environmental cues via Sap transporter function to 43
mediate interaction with host epithelial cells. Epithelial cell invasion and modulation of 44
host inflammatory cytokine responses may promote NTHI colonization and access to 45
essential nutrients. 46
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
Introduction 47
Nontypeable Haemophilus influenzae (NTHI) is a commensal inhabitant of the 48
human nasopharynx, yet can cause opportunistic infections in compromised upper and 49
lower respiratory tracts. As such, NTHI is a leading cause of otitis media, sinusitis, and 50
community-acquired pneumonia and is also commonly associated with exacerbations of 51
chronic obstructive pulmonary disease and cystic fibrosis (23, 34, 47, 48, 62, 66, 71). 52
Commensal and opportunistic colonization of the host requires NTHI to overcome a 53
myriad of host defense mechanisms such as production of bactericidal proteins, 54
physical mucociliary clearance and sequestration of essential nutrients (5, 14, 16, 21, 55
30, 65, 80, 81). NTHI have developed several successful strategies to evade host 56
immunity and equip for survival in vivo including production of IgA1 protease, 57
expression of aggregative adhesins, formation of biofilms and modification of surface 58
lipooligosaccharide (LOS) (1, 3, 25, 27-29, 31, 40, 46, 49, 53, 63, 69). Gram negative 59
outer membrane components such as LOS can be potent stimulators of the host 60
inflammatory response and serve as binding targets for immunoprotective antibodies, 61
complement proteins and antimicrobial peptides (29, 61, 83). Modification of LOS 62
provides a first line of defense for NTHI, and as such, a mechanism to evade the host 63
innate immune system. For instance, addition of sialic acid to LOS prevents 64
complement deposition and phosphorylcholine (ChoP) modification inhibits the binding 65
of immunoprotective antibodies, further serving to mask bacterial surface charge and 66
minimize antimicrobial peptide binding (3, 76, 82, 83). In addition, LOS modifications 67
induce changes in host epithelial responses. ChoP decorated LOS facilitates 68
attachment to and invasion of the epithelium and signaling through the platelet 69
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
activating factor receptor (PAFr). ChoP activation of the PAFr signaling cascade down 70
regulates host expression of TLR-2, TLR4 and TLR-9 and promotes NTHI invasion of 71
host epithelial cells (28, 29, 74, 75). Traditionally, NTHI has been categorized as an 72
extracellular pathogen; however, invasion of host epithelial cells can offer a temporary 73
or long-term respite from the host immune response and counter active nutrient 74
depletion by the host. The process of active nutrient depletion, termed “nutritional 75
immunity”, is a host mechanism to inhibit microbial growth by sequestering essential 76
nutrients (i.e. iron, zinc, manganese) (14, 21, 30, 80, 81). Recalcitrance to antibiotic 77
therapy, persistence in the presence of protective antibodies and culture negative 78
clinical status suggest that biofilm formation and development of bacterial reservoirs 79
within host cells may contribute to the chronic nature of NTHI infections (10, 13, 23, 24, 80
41, 45, 48, 56). 81
Bacterial mechanisms to acquire essential nutrients and evade innate immune 82
responses are essential for NTHI survival as a commensal in the nasopharynx and 83
pathogen at privileged sites in the host. We have previously demonstrated an 84
essential role for the Sap transporter, a multifunctional inner-membrane ABC transport 85
complex, in resistance to antimicrobial peptide killing and the transport of the essential 86
heme-iron (36-39). Antimicrobial peptides are transported into the bacterial cytoplasm 87
in a Sap-dependent manner and are subsequently degraded by cytoplasmic peptidase 88
activity (68). Similarly, the Sap transporter functions in the uptake of heme-iron. First 89
bound by the SapA periplasmic binding protein, heme-iron is delivered for transport 90
across the cytoplasmic membrane through the SapBC permease complex (39). In 91
addition to the multifunctional roles of Sap transporter function in innate immune 92
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
resistance and nutrient acquisition, Sap transporter function influences NTHI biofilm 93
development and architecture. NTHI deficient in the SapF ATPase protein developed a 94
more robust biofilm compared to that of the parental strain, coincident with 95
morphological plasticity of NTHI, including increased chain length and filament 96
production within the biofilm architecture (79). We have further demonstrated that 97
neutralization of host antimicrobial peptides restores virulence to the sapA mutant in 98
vivo, suggesting an essential role for Sap-dependent antimicrobial peptide resistance 99
during acute phase of disease in the host (68). Sap transporter function thus serves to 100
maintain NTHI heme-iron homeostasis and persistence in the host, providing 101
mechanisms to resist antimicrobial peptides, aid in nutrient acquisition and influence 102
NTHI biofilm formation. 103
Due to these essential roles, we investigated the consequence of loss of Sap 104
transporter functions on colonization of epithelial cells. We determined that NTHI 105
deficient in SapA were less adherent to epithelial cells yet were associated with 106
membrane ruffling and epithelial cell destruction. In addition, we observed SapA-107
deficient NTHI were more invasive and had a decreased immune-stimulatory effect on 108
host epithelium compared to host responses induced by the parental strain. 109
Collectively, these data support an important role for Sap transporter function in NTHI 110
interaction with host epithelial cells. We propose that NTHI utilizes the Sap transporter 111
to sense microenvironmental cues such as heme-iron limitation and antimicrobial 112
peptide production to modulate the host environment, gain access to essential nutrients 113
and evade the innate immune system. Additionally these data suggest that NTHI 114
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
residence in the epithelial cytoplasm may function as a bacterial reservoir during chronic 115
infections. 116
117
Materials and Methods 118
Bacterial Strains and Growth Conditions 119
The parental NTHI strain 86-028NP::rpsLA128G is a streptomycin resistant strain 120
constructed as previously described (77). Construction of an unmarked, nonpolar 121
deletion mutant of the sapA gene was performed by the recombineering strategy as 122
previously described (77, 79). Briefly, primers 5'-AAGTGCGATGGTATTTTGACGAA-3' 123
and 5'-ACGAGTAATATGATCCGCCTTTGT-3' were used to amplify sapA and 1kb of 124
the flanking DNA both 5’ and 3’ to sapA. The subsequent amplicon was ligated into the 125
pGEM-T Easy vector (pFR001) and transformed into E. coli strain DY380. In parallel, 126
primers, 5’ TAATATGCCTTACAATTTGACACATAATTTATCACAATGCATTTGTTATG 127
3' and 5’ CAGAATATGGCGAAGAACCGACCAGAACATTAGTGTTTCTCCTGAATAAA 128
3’, each containing 50 base pairs of DNA homologous to the 5’ and 3’ ends of the sapA 129
gene were used to amplify the spec-rpsL cassette from pRSM2832 (77). This amplicon 130
was then electroporated into strain E. coli DY380/pFR001 to form strain 131
DY380/pFR002, in which the sapA gene in pFR001 has been replaced by the cassette. 132
The plasmid pFR002 was then used to transform NTHI 86-028NP::rpsLA128G and 133
transformants were selected by growth on spectinomycin-containing chocolate II agar 134
plates. To generate a nonpolar deletion mutant, the sapA mutant was transformed with 135
plasmid pRSM2947, grown at 32o C, and FLP expression was induced using 136
anhydrotetracycline. The cells were cured of the plasmid by growth at 37o C. GFP 137
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
expressing parent and sapA mutant strains were created by electroporation of pGM1.1 138
as published previously (38). 139
Bacterial strains were grown overnight on Chocolate II agar (Becton Dickinson, 140
Sparks, MD) and then subcultured into pre-warmed brain heart infusion broth 141
supplemented with 2 µg heme/mL (Becton Dickinson, Sparks, MD) and 1 µg NAD/mL 142
(Becton Dickinson, Sparks, MD) (sBHI). Cultures were normalized to OD490=0.65, 143
diluted 1:6 in sBHI and grown for three hrs to logarithmic phase at an OD490=0.65. 144
Logarithmic phase bacteria were inoculated onto epithelial cells at a MOI=50. 145
146
Epithelial Cell Adherence Assay 147
Adherence of the parent strain and the sapA mutant were determined on 148
epithelial cell monolayers in a 96 well plate. Two µl logarithmic phase bacteria (MOI 50) 149
were inoculated onto confluent monolayers of Chinchilla Middle Ear epithelial cells, 150
A549 human adenocarcinoma epithelial cells (American Type Tissue Collection, 151
Manassas, VA) or Normal Human Bronchial epithelial cells (American Type Tissue 152
Collection, Manassas, VA). After 30, 60, and 90 minutes the cell culture media was 153
removed and the epithelial cell layers were washed three times with 200ul Dulbecco’s 154
phosphate buffered saline (DPBS) (Mediatech, Manassas, VA) followed by a 3 minute 155
incubation with 0.25% Trypsin 2.21mM EDTA in HBSS (Mediatech, Manassas, VA). 156
Cell suspensions were serially diluted and adherent bacteria colony forming units were 157
determined by plating on Chocolate II agar. Adherent bacteria were calculated as a 158
percent of the inoculum. The adherence assay was repeated for a total of three 159
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
biological replicates on each cell type and significance for CMEE cells was determined 160
by a two-tailed Student’s T-test and two biological replicates for NHBE cells . 161
162
Transwell Model of Respiratory Epithelial cell Growth 163
Normal Human bronchial epithelial cells, Chinchilla Middle Ear epithelial cells and 164
Primary Human Airway epithelial cells were seeded onto transwell membranes and 165
grown to confluency. Confluent monolayers were determined by measuring a 166
resistance of greater than 1000 ohms/4.5 cm2 across the transwell membrane using an 167
Epithelial Voltohmmeter (World Precision Instruments, Sarasota, FL). After confluency, 168
cell culture media on the apical surface was removed and epithelial cell growth and 169
differentiation was monitored for two weeks prior to inoculation. Twenty eight point 170
three µl (MOI=50) of logarithmic phase bacteria were inoculated onto the apical surface 171
of the transwell grown epithelial cells in 300 µl DPBS for one hour after which non-172
adherent bacteria were removed and the epithelial cell surface was washed once with 173
500 µl DPBS. After 24 hrs, spent media was collected from the basolateral surface and 174
the apical surface was washed once with DPBS and collected. The transwells were 175
fixed for electron microscopy in 2.5% gluteraldehyde (Electron Microscopy Sciences, 176
Hatfield, PA) in DPBS for Scanning Electron Microscopy or 2.5% gluteraldehyde 2% 177
paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA) DPBS or treated with 178
TRIzol (Invitrogen, Carlsbad, cA) for RNA isolation. 179
180
Scanning Electron Microscopy 181
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
After fixation, cells were washed two times in 0.2M sodium cacodylate buffer, followed 182
by subsequent incubation with 1% osmium tetroxide (Electron Microscopy Sciences, 183
Hatfield, PA) for 2 hrs, 1% thiocarbohydrazide (Electron Microscopy Sciences, Hatfield, 184
PA) for 30 minutes, and 1% osmium tetroxide to enhance electron contrast of 185
osmiophilic structures on the cell’s surface. The samples were then dehydrated in a 186
graded series of ethanol, followed by critical point dehydration in hexamethyldisilazane 187
(Electron Microscopy Sciences, Hatfield, PA) for 15 and then 10 minutes. Between 188
each step the samples were washed 5 times with double distilled water. Samples were 189
air dried overnight and adhered to SEM specimen mount stubs with colloidal silver 190
(Electron Microscopy Sciences, Hatfield, PA). Images were obtained on a Hitachi 191
S4800 Scanning electron microscope at 3kV. 192
193
Transmission Electron Microscopy 194
For ultrastructural analysis, transwells were fixed in 2% paraformaldehyde/2.5% 195
glutaraldehyde in PBS for 1 hr at room temperature. Samples were washed in 196
phosphate buffer and postfixed in 1% osmium tetroxide (Polysciences Inc., Warrington, 197
PA) for 1 hr. Samples were then rinsed extensively in dH20 prior to en bloc staining 198
with 1% aqueous uranyl acetate (Ted Pella Inc., Redding, CA) for 1 hr. Following 199
several rinses in dH20, samples were dehydrated in a graded series of ethanol and 200
embedded in Eponate 12 resin (Ted Pella Inc.). Ulltrathin sections of 90 nm were 201
obtained with a Leica Ultracut UCT ultramicrotome (Leica Microsystems Inc., 202
Bannockburn, IL), stained with uranyl acetate and lead citrate, and viewed on a JEOL 203
1200 EX transmission electron microscope (JEOL USA Inc., Peabody, MA). 204
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
205
NTHI inoculation onto epithelial cell monolayers for microscopy 206
Normal Human Bronchial Epithelial cells and Chinchilla Middle Ear epithelial cells were 207
grown to confluence on a glass cover slip. Epithelial cells were inoculated with 3.3 µl of 208
mid-logarithmic phase bacteria (MOI 50) in 100μl DPBS. One hour after inoculation, the 209
coverslips were flooded with 1ml DPBS and replaced with cell culture medium. After 210
24, 72, or 96 hrs, the cells were fixed in 2.5% gluteraldehyde in DPBS for Scanning 211
Electron Microscopy or 2% paraformaldehyde in DPBS for fluorescence microscopy. 212
For fluorescence microscopy epithelial cell membranes were labeled with WGA-213
Alexafluor 594 (Life Technologies), DNA was counter stained with Hoescht 34580 (Life 214
Technologies. For immunofluorescence microscopy, NTHI was labeled with rabbit α-215
OMP and detected with α-rabbit GFP. 216
217
Cytokine Array 218
Spent media was collected from the basolateral surface of the transwell model 24 hrs 219
after inoculation with NTHI. Cytokine secretion into the spent media was measured 220
using the Proteome Profiler Human Cytokine Array Kit (R&D Systems, Minneapolis 221
MN). Briefly, media samples were incubated with biotinylated detection antibodies. The 222
cytokine and detection antibody complex was then bound to a cognate antibody 223
immobilized on a nitrocellulose membrane. Relative amounts of the cytokine were 224
detected by measuring streptavidin-HRP chemiluminecence and the fold change in 225
cytokine production was determined by measuring pixel density at each cognate 226
antibody spot. 227
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
228
Gentamycin Protection Assay 229
Invasion of the parent strain and the sapA mutant were determined on epithelial cell 230
monolayers grown to confluence in a 96 well plate. Two µl logarithmic phase bacteria 231
(MOI 50) were inoculated onto confluent monolayers of Normal Human Bronchial 232
epithelial cells. After adherence for one hour the cells were washed once with DPBS to 233
removed non-adherent bacteria. 24 hrs after inoculation the wells were washed once 234
with DPBS and then treated with 50µg/mL gentamycin (Sigma Aldrich) in tissue culture 235
media for one hour. Following gentamycin treatment, the epithelial cells were lysed in 236
0.1% Triton X-100 (Fischer Scientific, Fair lawn, NJ) in DPBS and number of invaded 237
bacteria were determined by protection from gentamycin killing and enumerated by 238
serial dilution and plating. The gentamycin protection assay was repeated for a total of 239
three biological replicates and significance was determined by a two-tailed Student’s T-240
test. 241
242
Animal Studies 243
Healthy adult chinchialls (Chinchilla lanigera) purchased from Rauscher’s 244
Chinchilla ranch (LaRue, OH) were used to assess disease progression after 245
inoculation with either the parent strain or the sapA mutant. Chinchillas were 246
anesthetized with xylazine (2mg/kg, Fort Dodge Animal Health, Fort Dodge, IA) and 247
ketamine (10mg/kg, Phoenix Scientific Inc., St. Joseph, MO) and middle ears were 248
challenged with 2500 CFU of either the parent strain or the sapA mutant by transbullar 249
inoculation. Three days post inoculation the animals were sacrificed and the middle 250
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
ears were fixed for histological examination. Middle ear samples were fixed in 4% 251
paraformaldehyde in DPBS, decalcified, paraffin embedded, section and stained with 252
hematoxylin and eosin. 253
254
Results 255
Loss of SapA decreases adherence to epithelial cells 256
Sap transporter function maintains NTHI heme-iron homeostasis and persistence 257
in the host, providing mechanisms to resist antimicrobial peptides, acquire heme and 258
influence NTHI biofilm formation (36-39, 68). The host microenvironment at the 259
mucosal surface challenges NTHI survival through nutrient limitation (i.e. heme-iron) 260
and bactericidal innate immune effectors (59), thus we hypothesized that Sap 261
transporter functions are critical for NTHI interaction with the host epithelial cells and 262
establishment of colonization. To investigate the influence of Sap transporter function 263
on this critical initial interaction we monitored NTHI adherence to anatomically and 264
species variant primary epithelial cells: normal human bronchial epithelial (NHBE) cells 265
and chinchilla middle-ear epithelium (CMEE). The chinchilla has been used extensively 266
as a model for NTHI-mediated otitis media and cells established from chinchilla middle 267
ear explants have been used to study NTHI-host epithelial interactions (8, 50). NHBE 268
cells are derived from donor epithelial tissue and used as a physiological model to study 269
upper respiratory tract infections (59). The parent and sapA mutant strains were 270
evaluated for adherence to epithelial cell monolayers. Independent of epithelial cell 271
source, we observed a reduction in the ability of a sapA mutant to adhere to epithelial 272
cells compared to adherence of the parent strain (Fig.1). NTHI has been shown to 273
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
preferentially adhere to non-ciliated cells of the respiratory tract, and utilize host 274
structures such as ICAM-1, CEACAM1, sialic acid-containing lactosylceramide, 275
glycoproteins related to heparan sulfate and mucin and plasma membrane receptors (1, 276
4, 8, 18, 20, 31, 35, 49, 53, 63, 69, 70, 74, 78). Therefore, the disparity in NTHI 277
adherence to these different cell types was not unexpected. In fact, the higher binding 278
efficiency to the CMEE cells may have allowed for better detection of changes in 279
adherence in the absence of SapA to these cells. These results demonstrate that the 280
Sap transporter function can influence adherence of NTHI to epithelial cells. 281
282
Loss of SapA perturbs NTHI-epithelial cell interaction 283
Since we observed a reduction in the adherence properties of a mutant deficient 284
in SapA, we sought to determine the effects of this mutation on colonization and biofilm 285
formation on the surface of host epithelial cells. The importance of biofilm formation in 286
the resistance to antimicrobial peptides and antibiotic therapy has been well established 287
and contributes to persistence in the host (9, 57, 76). In addition, biofilm formation is 288
influenced by host microenvironments limited in available iron, particularly important as 289
the host sequesters free iron as a means to limit bacterial growth (2, 7, 43, 51, 52, 54, 290
58, 60, 85). We have demonstrated that transient restriction of heme-iron enhances 291
biofilm structural complexity and peak height in wild-type NTHI (BRS and KMM, 292
unpublished observations). Since microenvironmental cues can influence biofilm 293
formation, we hypothesized that Sap transporter functions contribute to NTHI 294
colonization and biofilm formation on host epithelial cells. NTHI inhabits a number of 295
different types of epithelium in the host ranging from the oropharynx, middle ear and 296
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
lung epithelium. The best representative cultured cell condition to model the privileged 297
middle ear is CMEE cells. Since we observed a more pronounced adherence defect by 298
the sapA mutant on CMEE monolayers (Fig. 1), we examined colonization and biofilm 299
formation by the parental or sapA mutant strain on these cells. To that end, parent or 300
sapA mutant GFP reporter strains were co-cultured with CMEE cell monolayers for 72 301
hrs, washed to remove non-adherent bacteria, fixed, and monitored for community 302
development and epithelial cell membrane perturbations. Epithelial cell membranes 303
were labeled with wheat germ agglutinin (WGA) and visualized for bacterial interaction 304
by confocal microscopy. We observed that the parental strain was primarily cell-surface 305
associated as a biofilm (Fig. 1C). In addition, three-dimensional rendered optical 306
sections of the bacterial-epithelial cell interface revealed little perturbation of the 307
epithelial cell membrane as indicated by green (bacteria) and red (epithelial cell 308
membrane) pseudocolor in different focal planes (see orthogonal view, Fig. 1E) 309
supporting surface colonization by the bacteria. In contrast, the sapA mutant remodels 310
the epithelial cell surface resulting in membrane perturbations that enveloped the 311
bacteria (Fig. 1D). In fact, the sapA mutant was observed in the same focal plane as 312
the epithelial cell membrane, in many cases extending 20 microns above the planer 313
surface, suggestive of epithelial cell membrane ruffling and compromise of the epithelial 314
cell membrane integrity (see orthogonal view, Fig. 1F). We observed similar results 315
when the parent strain or sapA mutant was co-cultured with NHBE cell monolayers 316
(Supplemental Fig. 1). These observations were thus independent of epithelial cell type 317
and initial levels of adherence (compare Fig. 1A, B, and Supplemental Fig. 1). 318
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
The membrane changes associated with colonization by the sapA mutant 319
suggested the sapA mutant had penetrated the epithelial cell membrane and colonized 320
the cytoplasm. To more closely examine the cellular localization of NTHI on and within 321
epithelial cells, NTHI were co-cultured with NHBE monolayers for 24 hrs, washed to 322
remove non-adherent bacteria and surface exposed NTHI were immuno-labeled. 323
Invasive bacteria, which were inaccessible to immuno-labeling, were subsequently 324
identified by DNA counter labeling. Thus, surface-associated bacteria were detected by 325
punctate fluorescence (pseudocolored green), whereas internalized bacteria were 326
visualized as white. Epithelial cell membranes were labeled with WGA and visualized 327
for bacterial localization by immunofluorescence microscopy. We observed the parental 328
strain colonizing the surface of the epithelial cells, predominantly visualized by punctate 329
green fluorescence (Fig. 2B). In contrast, we observed that the sapA mutant localized 330
to both the surface and cytoplasm of the epithelial cells (Fig. 2C). Cytoplasmic 331
localization of the sapA mutant was indicated by white DNA counter labeling throughout 332
the cytoplasm of the epithelial cells. The fluorescence of the bacteria in the cytoplasm 333
in conjunction with the absence of antibody labeling is highly suggestive for 334
internalization of the sapA mutant. Moreover, the intensity and proximity of the signal is 335
indicative of bacterial microcolonies within the cytoplasm. Collectively, these data 336
suggest that Sap transporter function mediates NTHI adherence, influences colonization 337
of epithelial cells and maintains epithelial cell membrane homeostasis. 338
Next, we sought to better define bacterial-host interactions in conditions that 339
more closely mimic bacterial infections of the respiratory tract (59). Polarized, 340
differentiated NHBE cells were grown on semipermeable transwell membrane supports 341
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
at an air-liquid interface; similar to epithelial cells of the respiratory tract, the NHBE 342
formed polarized semi-stratified cell layers that produce mucus and express microvilli 343
and cilia. Therefore, bacteria co-cultured with the apical surface of the epithelial cells 344
must colonize at the air-exposed surface and acquire nutrients from the epithelial cell, 345
unlike colonization of epithelial cell monolayers which are submerged in nutrient rich 346
media (59). Thus, to determine the influence of the Sap transporter on colonizing the 347
nutrient limited, apical surface of epithelial cells we exposed polarized NHBE cells to 348
either the parental strain or the sapA mutant strain for 24 hrs and bacterial-host cell 349
interactions were visualized by SEM. The parental strain colonized the apical surface by 350
formation of microcolonies or larger biofilm communities (Fig. 3C, E). We typically 351
observed small clusters of the parent strain in patches on the epithelial cell surface; 352
these patches appear to form in minor lesions on the epithelial cell surface. The lesions 353
are absent in the control cells (Fig. 3A, B) suggesting that they are triggered by 354
colonization of the bacteria. Despite the presence of small lesions there was very little 355
disruption of the epithelial cell layer integrity (i.e. the surface appears relatively smooth). 356
In contrast, although able to colonize the apical surface, the biofilms formed by the sapA 357
mutant were more dense and coincided with evidence of epithelial cell destruction 358
associated with bacterial colonization (Fig. 3D, F). In contrast to the parental strain (Fig. 359
3G), populations of the sapA mutant were often associated with “honey comb”-like 360
structures which seemed to have been left behind by bacteria that were disassociated 361
during the processing of the samples (Fig. 3H). The “honey comb”-like structures 362
appeared to be epithelial cell in origin. Consistent with our observations with polarized 363
NHBE cells, we also observed enhanced biofilm formation and paracellular localization 364
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
by the sapA mutant on CMEE cells (Supplemental Fig. 2). Thus, our observations of 365
colonization on polarized NHBE cells were similar to our observations on epithelial cell 366
monolayers, both strains colonized the surface of the epithelial cells and the sapA 367
mutant modified the epithelial cell surface and was associated with epithelial cell 368
membrane perturbations. However, we observed small lesions induced by both the 369
parental strain and the sapA mutant in this nutrient restricted air exposed 370
microenvironment. Furthermore, the biofilms formed by the sapA mutant were 371
associated with epithelial cell destruction and invasion by the sapA mutant. Thus, the 372
polarized tissue culture model enabled us to study colonization of NTHI using a more 373
relevant, nutrient-restricted microenvironment. 374
375
Loss of SapA function results in a hyperinvasive phenotype 376
Although classically considered an extracellular, opportunistic pathogen, there is 377
increasing evidence of intracellular and intercellular niches for NTHI in vitro (13). 378
Further, the presence of NTHI within adenoids and bronchial epithelium suggests that 379
an invasive phenotype may coincide with the chronic nature associated with NTHI-380
mediated diseases (6, 19, 26, 42, 44). Invasion of epithelial cells could provide NTHI 381
with an environment rich in nutrients and a refuge from immune pressures. Our 382
previous data indicates an increased propensity for the sapA mutant to disrupt the 383
epithelial permeability barrier and invade bronchial epithelial cells (Fig. 2C). Therefore, 384
we sought to further investigate this hyper-invasive phenotype and determine the 385
ultrastructural localization of the parental strain or the sapA mutant following co-culture 386
on the apical surface of polarized NHBE cells by examining cross sections of the 387
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
epithelium by transmission electron microscopy. We observed that the parental strain 388
primarily colonized the apical surface of the epithelial cells with little evidence of 389
membrane perturbations (Fig. 4A,C), consistent with our previous results (Fig. 1C, 3C, 390
3E, 3G). This rather benign surface association did not preclude the ability of NTHI to 391
invade as the parent strain was also observed to localize to the cell cytoplasm, typically 392
in membrane enclosed vacuoles (Fig. 4C). Although the fate of these intracellular 393
bacteria appeared to be detrimental, as observed by loss of bacterial density and 394
membrane integrity within the presumed phagosomal vacuoles, these data are 395
consistent with previous observations of NTHI intracellular invasion (59). In contrast, 396
although the sapA mutant also colonized the apical surface, we observed enhanced 397
epithelial cell membrane perturbations, disruption of the epithelial membrane barrier and 398
populations of the sapA mutant in the cytoplasm of epithelial cells lacking intact cell 399
membranes or between the epithelial cell layers of bacteria in the cytoplasm of the 400
epithelial cells (Fig. 4B,D). Interestingly, these invasive bacteria did not appear 401
contained within a membranous compartment but appeared to colonize the host 402
cytoplasm, in most cases retaining bacterial density and membrane integrity (Fig. 4B,D). 403
Similarly, we observed invasive phenotypes of the parent and sapA mutant in primary 404
differentiated chinchilla nasopharyngeal epithelial cells (data not shown), suggesting 405
differential mechanisms of intracytoplasmic trafficking and survival of the sapA mutant 406
compared to the parental strain. The hyper-invasive phenotype of the sapA mutant was 407
confirmed by gentamycin protection demonstrating a significant increase in invasion by 408
the sapA mutant compared to the parental strain (Fig. 4E). In addition, we observed 409
outer membrane vesicle (OMV) production by NTHI at the epithelial cell surface (Fig. 410
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
4E) by the parent strain and both within and between NHBE cells by the sapA mutant 411
strain (Fig. 4F). These data are consistent with recent observations of NTHI OMV 412
production following long-term (5 day) colonization of EpiAirway cells, a commercially 413
available cell model system (59). However, our observations indicate that OMVs are 414
not only produced rapidly, one day following infection of polarized NHBE cells, but are 415
shed differentially at subcellular locations of NHBE cells. Previously, we demonstrated 416
that NTHI OMVs are internalized by host epithelial cells and trigger host cell signaling 417
and cytokine production (67). These data, in addition to observed hyper-vesiculation of 418
the SapA-deficient strain when compared to that of the parental strain in vitro (SWS and 419
KMM, unpublished), implicate an important role for OMV production in NTHI-host cell 420
interactions, currently under investigation in our laboratory. 421
Collectively, these data indicate that loss of Sap transporter function promotes a 422
hyper-invasive phenotype of NTHI, and further suggests a role for the function of the 423
Sap transporter in mediating a homeostatic interaction with host epithelial cells. 424
Invasion into epithelial cells may benefit survival of NTHI in nutrient restricted 425
microenvironments as a mechanism to gain access to available nutrients in the 426
cytoplasm of the host epithelium. Our observations suggest that invasion of the sapA 427
mutant may compensate for the loss of Sap transporter function to counter nutrient 428
starvation. 429
430
Sap transporter function mediates epithelial cell stimulation and cytokine 431
response to colonization 432
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
The epithelium provides the host with a first line defense to the external 433
environment (32). In addition to providing a selective barrier, the epithelium is capable 434
of mounting an inflammatory response by the secretion of antimicrobial molecules and 435
the production of cytokines after stimulation by conserved microbial structures. 436
Signaling pathways are often manipulated by bacteria to gain access to the cytoplasm 437
in non-phagocytic cells (17). Our data suggest that the sapA mutant compensates for 438
the loss of Sap transporter function via altered host cell membrane interactions and 439
invasion of epithelial cells. The epithelial cell membrane perturbations and hyper-440
invasion of the epithelial cells by the sapA mutant suggest and alteration in epithelial 441
cell homeostasis. To investigate this change in epithelial cell homeostasis we 442
monitored cytokine secretion by the epithelial cell in response to colonization by the 443
parent strain or the sapA mutant. Polarized epithelial cells were co-cultured with either 444
the parent strain or the sapA mutant strain at the air exposed apical surface of NHBE 445
cellsand assessed for fold change in basolateral cytokine production. . We observed a 446
decrease in pro-inflammatory cytokine and chemokine production by polarized normal 447
human bronchial epithelial cells when exposed to the sapA mutant strain for 24 hrs 448
compared to those exposed to the parental strain (Table 1). We extended our analysis 449
to other cell types including: CMEE cells, primary human alveolar epithelial (HAE) cells 450
from human lung explants. We again observed a decrease in pro-inflammatory cytokine 451
and chemokine production on these other primary cell types (Table 1). It is intriguing to 452
note that IL-25 was elevated due to exposure of the parental strain in all three cell types 453
tested. IL-25 stimulation of epithelial cells triggers the production of the type 2 cytokine 454
response, characterized by the secretion of IL-4, IL-5 and IL-13, which were also 455
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
increased in production in response to the parent strain (55). These data indicate that 456
loss of Sap transporter function decreases NTHI stimulation of epithelial cell cytokine 457
production. Further NTHI sensing of host microenvironmental cues (heme-iron or 458
antimicrobial peptides) via Sap transporter function may ultimately result in a decrease 459
in epithelial cell cytokine production and thus contribute to the chronicity of NTHI-460
mediated diseases. 461
462
Sap Transporter function modulates severity of experimental otitis media 463
The decrease in epithelial cytokine response to the sapA mutant suggested that 464
there would be an alteration in disease progression in the middle ear. To characterize 465
middle ear mucosal changes, chinchilla middle ear inferior bullae were examined 466
histologically four days following infection with either the parental strain or the sapA 467
mutant. We observed capillary dilation, erythema, hemorrhagic foci, host immune cell 468
infiltrate in middle ears inoculated with the parent strain (Fig. 5B) compared to naïve 469
middle ears (Fig. 5A). Upon closer examination of the middle ear mucosa, we observed 470
mucosal epithelial cell thickening and edema (Fig. 5D). Middle ears inoculated with the 471
sapA mutant also presented similar markers of middle ear disease; however, there is a 472
clear decrease in the disease severity compare to the middle ears inoculated with the 473
parent strain (Fig. 5C, E) despite no significant difference in bacterial burden compared 474
to the parental strain (data not shown). These observations, concurrent with diminished 475
cytokine production, suggest that the sapA mutant is less immunostimulatory than the 476
parent strain, likely compensating for the increased susceptibility to antimicrobial 477
peptides and thus, decreasing epithelial cell stimulation. 478
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
479
Discussion 480
Elucidation of NTHI pathogenic survival strategies will provide the necessary 481
platform for the development of novel treatment modalities that will ultimately reduce the 482
burden of NTHI-mediated diseases. NTHI is exposed to complex host 483
microenvironments that are typically nutrient-limited due to host sequestration 484
strategies, such as limitation of available iron, and are replete with bactericidal immune 485
molecules. Our previous work describes an essential role for Sap transporter function 486
in the acquisition of heme-iron and resistance to host antimicrobial peptides (36-39, 68, 487
79). Therefore, we exploited the use of NTHI deficient in Sap transporter function as a 488
means to elucidate the consequences of microenvironmental cues on NTHI-host 489
interactions that modulate disease severity. Here, we demonstrated increased ruffling of 490
the epithelial membrane when cells were co-cultured with NTHI deficient in SapA 491
indicating an altered interaction with the host cell surface. The increase in membrane 492
ruffling coincides with an increased propensity of the sapA mutant to invade the apical 493
layers of polarized, differentiated epithelial cells, in contrast to that of the parental 494
isolate which primarily associated with the cell surface and did not induce membrane 495
ruffling. This hyper-invasive phenotype was coincident with a dysregulation in epithelial 496
cell cytokine production, dampened in inflammatory cytokine production in vitro and 497
further, less inflammatory in vivo, compared to the responses observed to the parental 498
strain. Bacteria invasion has been shown to dysregulate epithelial cytokine production 499
(32, 33, 64, 72, 73, 84). Collectively, our data suggest a dynamic interplay between 500
NTHI and the host that is mediated, at least in part, by host microenvironmental cues. 501
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
Thus, microbial sensing of nutrient availability influences interactions with host cells. It 502
has previously been demonstrated that the Ami oligopeptide ABC transporter in 503
Streptococcus influences interaction with epithelial cells, hypothesized to be regulated 504
by oligopeptide uptake and contribution to global metabolic gene regulation, thus 505
dependent upon nutrient availability (12, 15). Our data are consistent with this 506
hypothesis suggesting that NTHI utilizes the Sap transporter to sense host-derived 507
molecules that can differ in availability in distinct microenvironments of the respiratory 508
tract. Our data further indicate that NTHI invades the epithelium, likely to gain access to 509
essential nutrients, evade the innate immune response and provide a bacterial 510
population that upon reemergence may seed recurrent infections that contribute to 511
chronic otitis media. 512
NTHI colonization is dependent on bacterial adherence to the mucosal surface. 513
Additionally, epithelial cell invasion has been shown to be mediated by Hap, Protein D, 514
and Protein E adhesins (1, 69, 74) and ChoP moieties on NTHI LOS (73, 74). Our 515
observations indicated that loss of SapA reduced initial adherence of NTHI, yet did not 516
affect colonization of the cell surface. In fact, loss of SapA promoted invasion of 517
epithelial cells. We do not observe alterations in ChoP expression in the LOS or 518
changes in the expression of known adhesins in the outer membrane of the sapA 519
mutant (FKR and KMM, unpublished observations). Thus, these data suggest a 520
previously uncharacterized mechanism for NTHI invasion. Further, the hyper-invasive 521
phenotype of the sapA mutant suggests that this process may be regulated by the 522
function of the Sap transporter and therefore influenced by host microenvironmental 523
cues such as heme limitation and antimicrobial peptide production during pathogenesis. 524
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
It is interesting to note, that although predominately surface associated, the parent 525
strain also invaded the epithelial cells. However, the parent strain was observed in 526
membrane bound vacuoles, in contrast to localization of the sapA mutant in the 527
cytoplasm suggesting differential trafficking once internalized by the epithelial cells. 528
Additionally, the fate of the internalized bacteria was different between the parent strain 529
and the sapA mutant. The parent strain lost electron density and membrane integrity 530
within the phagosomal vacuoles, consistent with previous observations of NTHI 531
intracellular invasion. In contrast, the sapA mutant invasive bacteria did not appear 532
contained within phagosome but appeared to colonize the host cytoplasm, in most 533
cases retaining bacterial density and membrane integrity. Invasion into epithelial cells 534
provides an additional mechanism for resisting host nutritional and innate immune 535
responses. It has been previously demonstrated that auxotrophic E. coli mutants are 536
unable to survive in the extracellular environment but were able to survive in the 537
cytoplasm of host epithelial cells (11, 22). The survival of auxotrophic E. coli in the 538
cytoplasm suggests increased access to nutrients in the cytoplasm compared to the 539
extracellular environment of the host. The clustering of the cytoplasmic NTHI that we 540
observed is suggestive of intracellular growth (Fig 2C, 4B, 4D). These data suggest 541
that exposure of NTHI to host immune pressures such as increased concentrations of 542
antimicrobial peptides or host sequestration of essential nutrients promotes epithelial 543
cell invasion and survival in the cytoplasm (13). Interestingly, NTHI does not have a 544
dedicated invasion or secretion system to initiate epithelial cell receptor independent 545
invasion which suggests that NTHI must exploit host cell signaling to gain access to the 546
cytoplasm, mechanisms currently under investigation in our laboratory. It is also 547
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
interesting to note the presence of NTHI membrane vesicles in our polarized NHBE 548
model (Fig. 4). We have previously determined that NTHI vesicles are able to stimulate 549
epithelial cells (67) and we are currently investigating their relevance in NTHI- epithelial 550
cell homeostasis. 551
We examined the contribution of Sap transporter function on NTHI colonization of 552
polarized, differentiated epithelial cells grown at an air-liquid interface, a physiological 553
model of epithelial cells of the upper respiratory tract. Here, we observed that the sapA 554
mutant formed a dense biofilm on the apical surface and invaded into the apical most 555
cell layers. Biofilms provide a mechanism for survival in a nutrient limited environment 556
and resistance to bactericidal molecules (9, 57, 76). Biofilm survival strategies are 557
mediated by the expression of quorum sensing regulated genes, increase in persister 558
cell formation, metabolic heterogeneity and secretion of extracellular polymeric 559
structures. This suggests that the sapA mutant may compensate for the inability to 560
acquire heme-iron and resist antimicrobial peptides by preferentially forming biofilms on 561
the epithelial cell surface to survive in the host epithelial cell microenvironment. Host 562
microenvironmental cues may influence a similar phenotype during NTHI colonization. 563
In fact, we have demonstrated that transient restriction of heme-iron mediates NTHI 564
morphological changes that influence biofilm architecture, attenuates the host response 565
and thus promotes NTHI persistence in the middle ear (BRS and KMM, unpublished 566
observations), suggesting that at least the heme-iron acquisition function of SapA 567
contributes to the phenotypes described here. Both the increased propensity for biofilm 568
formation and invasion of the epithelial cells could represent survival strategies utilized 569
by NTHI in vivo. 570
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
Epithelial cells respond to bacterial colonization and invasion by the secretion of 571
cytokines and chemokines that serve to initially attract innate immune leukocytes and 572
subsequently B-cells and T-cells to remove the invading pathogens. We determined 573
that epithelial cell colonization by the sapA mutant stimulated decreased production of 574
inflammatory cytokines compared to those produced in response to colonization by the 575
parent strain. In order to determine if this differential host response to colonization 576
would alter disease progression we monitored the middle ear mucosal of chinchillas 577
inoculated with either the parent strain or the sapA mutant. Histological analysis of 578
middle ears infected with parental strain demonstrated severe edema, capillary dilation, 579
erythema, hemorrhagic foci, host immune cell infiltrate and mucosal epithelial cell 580
destruction 3 days after inoculation. In contrast, middle ears inoculated with the sapA 581
mutant demonstrated a striking decrease in epithelial inflammation that maintained an 582
intact mucosal surface, despite no significant difference in bacterial burden compared to 583
the parental strain as evidenced by biofilm formation and leukocyte influx in the middle 584
ear. These data suggest that NTHI utilizes the Sap transporter to sense the host 585
microenvironment and mediate interactions with the host mucosal surface. In fact, we 586
have determined that transiently heme-iron restricted NTHI elicited a similar reduction in 587
inflammation and epithelial cell damage that enhanced NTHI persistence in the middle 588
ear (BRS and KMM, unpublished observations). Therefore, NTHI will decrease the 589
stimulation of epithelial cells resulting in a decreased expression and production of 590
cytokines and ultimately alter disease progression. 591
Our results highlight the delicate balance maintained between the host epithelium 592
and commensal bacteria at the epithelial cell interface. Here we demonstrated that the 593
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
Sap transporter function influenced NTHI interaction with host epithelium, revealing a 594
mechanism by which NTHI can sense the host epithelial cell microenvironmental cues 595
that impact NTHI behavior. Our data suggest that NTHI colonization of the 596
nasopharynx is dictated by host microenvironmental cues that limit host cell interaction 597
to thus establish a commensal relationship in this environment. However, upon 598
transition to other host sites, NTHI senses changes in nutrient availability and innate 599
immune pressures, which triggers a more pathogenic lifestyle which coincides with 600
enhanced biofilm community development, modulation of epithelial cell responses. The 601
lifestyle changes by NTHI in these environments will promote survival and resistance to 602
clearance mechanisms. The information gathered here provides new avenues of 603
investigation to determine the NTHI and epithelial cell factors that NTHI will decrease 604
stimulation of epithelial cells to diminish the immune response and alter disease. 605
606
Acknowledgements 607
This work was supported by R21 A1070825 from the NIAID/NIH to K.M.M. We 608
would like to thank Dr. S.S. Justice for assistance with microscopy and critical analysis 609
of the manuscript and Dr. M. Peeples and the Nationwide Children’s Hospital Cell Line 610
core for the HAE cells. 611
612
References 613
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
1. Ahren, I. L., H. Janson, A. Forsgren, and K. Riesbeck. 2001. Protein D 614
expression promotes the adherence and internalization of non-typeable 615
Haemophilus influenzae into human monocytic cells. Microb Pathog 31:151-158. 616
2. Andreini, C., L. Banci, I. Bertini, and A. Rosato. 2006. Counting the zinc-617
proteins encoded in the human genome. J Proteome Res 5:196-201. 618
3. Armbruster, C. E., W. Hong, B. Pang, K. E. Dew, R. A. Juneau, M. S. Byrd, C. 619
F. Love, N. D. Kock, and W. E. Swords. 2009. LuxS promotes biofilm 620
maturation and persistence of nontypeable haemophilus influenzae in vivo via 621
modulation of lipooligosaccharides on the bacterial surface. Infect Immun 622
77:4081-4091. 623
4. Avadhanula, V., C. A. Rodriguez, G. C. Ulett, L. O. Bakaletz, and E. E. 624
Adderson. 2006. Nontypeable Haemophilus influenzae adheres to intercellular 625
adhesion molecule 1 (ICAM-1) on respiratory epithelial cells and upregulates 626
ICAM-1 expression. Infect Immun 74:830-838. 627
5. Bals, R., and P. S. Hiemstra. 2004. Innate immunity in the lung: how epithelial 628
cells fight against respiratory pathogens. Eur Respir J 23:327-333. 629
6. Bandi, V., M. A. Apicella, E. Mason, T. F. Murphy, A. Siddiqi, R. L. Atmar, 630
and S. B. Greenberg. 2001. Nontypeable Haemophilus influenzae in the lower 631
respiratory tract of patients with chronic bronchitis. Am J Respir Crit Care Med 632
164:2114-2119. 633
7. Banin, E., M. L. Vasil, and E. P. Greenberg. 2005. Iron and Pseudomonas 634
aeruginosa biofilm formation. Proc Natl Acad Sci U S A 102:11076-11081. 635
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
8. Bookwalter, J. E., J. A. Jurcisek, S. D. Gray-Owen, S. Fernandez, G. 636
McGillivary, and L. O. Bakaletz. 2008. A carcinoembryonic antigen-related cell 637
adhesion molecule 1 homologue plays a pivotal role in nontypeable Haemophilus 638
influenzae colonization of the chinchilla nasopharynx via the outer membrane 639
protein P5-homologous adhesin. Infect Immun 76:48-55. 640
9. Byrd, M. S., B. Pang, W. Hong, E. A. Waligora, R. A. Juneau, C. E. 641
Armbruster, K. E. Weimer, K. Murrah, E. E. Mann, H. Lu, A. Sprinkle, M. R. 642
Parsek, N. D. Kock, D. J. Wozniak, and W. E. Swords. 2011. Direct evaluation 643
of Pseudomonas aeruginosa biofilm mediators in a chronic infection model. Infect 644
Immun 79:3087-3095. 645
10. Casey, J. R., and M. E. Pichichero. 2004. Changes in frequency and pathogens 646
causing acute otitis media in 1995-2003. Pediatr Infect Dis J 23:824-828. 647
11. Cersini, A., A. M. Salvia, and M. L. Bernardini. 1998. Intracellular multiplication 648
and virulence of Shigella flexneri auxotrophic mutants. Infect Immun 66:549-557. 649
12. Claverys, J. P., B. Grossiord, and G. Alloing. 2000. Is the Ami-AliA/B 650
oligopeptide permease of Streptococcus pneumoniae involved in sensing 651
environmental conditions? Res Microbiol 151:457-463. 652
13. Clementi, C. F., and T. F. Murphy. 2011. Non-Typeable Haemophilus 653
influenzae Invasion and Persistence in the Human Respiratory Tract. Front Cell 654
Infect Microbiol 1:1. 655
14. Corbin, B. D., E. H. Seeley, A. Raab, J. Feldmann, M. R. Miller, V. J. Torres, 656
K. L. Anderson, B. M. Dattilo, P. M. Dunman, R. Gerads, R. M. Caprioli, W. 657
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
Nacken, W. J. Chazin, and E. P. Skaar. 2008. Metal chelation and inhibition of 658
bacterial growth in tissue abscesses. Science 319:962-965. 659
15. Cundell, D. R., B. J. Pearce, J. Sandros, A. M. Naughton, and H. R. Masure. 660
1995. Peptide permeases from Streptococcus pneumoniae affect adherence to 661
eucaryotic cells. Infect Immun 63:2493-2498. 662
16. Diamond, G., D. Legarda, and L. K. Ryan. 2000. The innate immune response 663
of the respiratory epithelium. Immunol Rev 173:27-38. 664
17. Falkow, S., R. R. Isberg, and D. A. Portnoy. 1992. The interaction of bacteria 665
with mammalian cells. Annu Rev Cell Biol 8:333-363. 666
18. Fink, D. L., B. A. Green, and J. W. St Geme, 3rd. 2002. The Haemophilus 667
influenzae Hap autotransporter binds to fibronectin, laminin, and collagen IV. 668
Infect Immun 70:4902-4907. 669
19. Forsgren, J., A. Samuelson, A. Ahlin, J. Jonasson, B. Rynnel-Dagoo, and A. 670
Lindberg. 1994. Haemophilus influenzae resides and multiplies intracellularly in 671
human adenoid tissue as demonstrated by in situ hybridization and bacterial 672
viability assay. Infect Immun 62:673-679. 673
20. Foxwell, A. R., J. M. Kyd, and A. W. Cripps. 1998. Nontypeable Haemophilus 674
influenzae: pathogenesis and prevention. Microbiol Mol Biol Rev 62:294-308. 675
21. Glaser, R., J. Harder, H. Lange, J. Bartels, E. Christophers, and J. M. 676
Schroder. 2005. Antimicrobial psoriasin (S100A7) protects human skin from 677
Escherichia coli infection. Nat Immunol 6:57-64. 678
22. Goebel, W., and M. Kuhn. 2000. Bacterial replication in the host cell cytosol. 679
Curr Opin Microbiol 3:49-53. 680
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
23. Groeneveld, K., L. van Alphen, P. P. Eijk, G. Visschers, H. M. Jansen, and H. 681
C. Zanen. 1990. Endogenous and exogenous reinfections by Haemophilus 682
influenzae in patients with chronic obstructive pulmonary disease: the effect of 683
antibiotic treatment on persistence. J Infect Dis 161:512-517. 684
24. Hall-Stoodley, L., F. Z. Hu, A. Gieseke, L. Nistico, D. Nguyen, J. Hayes, M. 685
Forbes, D. P. Greenberg, B. Dice, A. Burrows, P. A. Wackym, P. Stoodley, J. 686
C. Post, G. D. Ehrlich, and J. E. Kerschner. 2006. Direct detection of bacterial 687
biofilms on the middle-ear mucosa of children with chronic otitis media. JAMA 688
296:202-211. 689
25. Hardy, G. G., S. M. Tudor, and J. W. St Geme, 3rd. 2003. The pathogenesis of 690
disease due to nontypeable Haemophilus influenzae. Methods Mol Med 71:1-28. 691
26. Hers, J. F., and J. Mulder. 1953. The mucosal epithelium of the respiratory tract 692
in muco-purulent bronchitis caused by Haemophilus influenzae. J Pathol 693
Bacteriol 66:103-108. 694
27. Hong, W., R. A. Juneau, B. Pang, and W. E. Swords. 2009. Survival of 695
bacterial biofilms within neutrophil extracellular traps promotes nontypeable 696
Haemophilus influenzae persistence in the chinchilla model for otitis media. J 697
Innate Immun 1:215-224. 698
28. Hong, W., K. Mason, J. Jurcisek, L. Novotny, L. O. Bakaletz, and W. E. 699
Swords. 2007. Phosphorylcholine decreases early inflammation and promotes 700
the establishment of stable biofilm communities of nontypeable Haemophilus 701
influenzae strain 86-028NP in a chinchilla model of otitis media. Infect Immun 702
75:958-965. 703
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
29. Hong, W., B. Pang, S. West-Barnette, and W. E. Swords. 2007. 704
Phosphorylcholine expression by nontypeable Haemophilus influenzae correlates 705
with maturation of biofilm communities in vitro and in vivo. J Bacteriol 189:8300-706
8307. 707
30. Hood, M. I., and E. P. Skaar. 2012. Nutritional immunity: transition metals at the 708
pathogen-host interface. Nat Rev Microbiol 10:525-537. 709
31. Jurcisek, J. A., J. E. Bookwalter, B. D. Baker, S. Fernandez, L. A. Novotny, 710
R. S. Munson, Jr., and L. O. Bakaletz. 2007. The PilA protein of non-typeable 711
Haemophilus influenzae plays a role in biofilm formation, adherence to epithelial 712
cells and colonization of the mammalian upper respiratory tract. Mol Microbiol 713
65:1288-1299. 714
32. Kagnoff, M. F., and L. Eckmann. 1997. Epithelial cells as sensors for microbial 715
infection. J Clin Invest 100:6-10. 716
33. Kaiser, P., L. Rothwell, E. E. Galyov, P. A. Barrow, J. Burnside, and P. 717
Wigley. 2000. Differential cytokine expression in avian cells in response to 718
invasion by Salmonella typhimurium, Salmonella enteritidis and Salmonella 719
gallinarum. Microbiology 146 Pt 12:3217-3226. 720
34. Klein, J. O. 1997. Role of nontypeable Haemophilus influenzae in pediatric 721
respiratory tract infections. Pediatr Infect Dis J 16:S5-8. 722
35. Krivan, H. C., D. D. Roberts, and V. Ginsburg. 1988. Many pulmonary 723
pathogenic bacteria bind specifically to the carbohydrate sequence GalNAc beta 724
1-4Gal found in some glycolipids. Proc Natl Acad Sci U S A 85:6157-6161. 725
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
36. Mason, K. M., M. E. Bruggeman, R. S. Munson, and L. O. Bakaletz. 2006. The 726
non-typeable Haemophilus influenzae Sap transporter provides a mechanism of 727
antimicrobial peptide resistance and SapD-dependent potassium acquisition. Mol 728
Microbiol 62:1357-1372. 729
37. Mason, K. M., R. S. Munson, Jr., and L. O. Bakaletz. 2005. A mutation in the 730
sap operon attenuates survival of nontypeable Haemophilus influenzae in a 731
chinchilla model of otitis media. Infect Immun 73:599-608. 732
38. Mason, K. M., R. S. Munson, Jr., and L. O. Bakaletz. 2003. Nontypeable 733
Haemophilus influenzae gene expression induced in vivo in a chinchilla model of 734
otitis media. Infect Immun 71:3454-3462. 735
39. Mason, K. M., F. K. Raffel, W. C. Ray, and L. O. Bakaletz. 2011. Heme 736
utilization by nontypeable Haemophilus influenzae is essential and dependent on 737
Sap transporter function. J Bacteriol 193:2527-2535. 738
40. Miyamoto, N., and L. O. Bakaletz. 1996. Selective adherence of non-typeable 739
Haemophilus influenzae (NTHi) to mucus or epithelial cells in the chinchilla 740
eustachian tube and middle ear. Microb Pathog 21:343-356. 741
41. Moller, L. V., A. G. Regelink, H. Grasselier, J. E. Dankert-Roelse, J. Dankert, 742
and L. van Alphen. 1995. Multiple Haemophilus influenzae strains and strain 743
variants coexist in the respiratory tract of patients with cystic fibrosis. J Infect Dis 744
172:1388-1392. 745
42. Moller, L. V., W. Timens, W. van der Bij, K. Kooi, B. de Wever, J. Dankert, 746
and L. van Alphen. 1998. Haemophilus influenzae in lung explants of patients 747
with end-stage pulmonary disease. Am J Respir Crit Care Med 157:950-956. 748
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
43. Moreau-Marquis, S., G. A. O'Toole, and B. A. Stanton. 2009. Tobramycin and 749
FDA-approved iron chelators eliminate Pseudomonas aeruginosa biofilms on 750
cystic fibrosis cells. Am J Respir Cell Mol Biol 41:305-313. 751
44. Morey, P., V. Cano, P. Marti-Lliteras, A. Lopez-Gomez, V. Regueiro, C. Saus, 752
J. A. Bengoechea, and J. Garmendia. 2011. Evidence for a non-replicative 753
intracellular stage of nontypable Haemophilus influenzae in epithelial cells. 754
Microbiology 157:234-250. 755
45. Moxon, E. R., W. A. Sweetman, M. E. Deadman, D. J. Ferguson, and D. W. 756
Hood. 2008. Haemophilus influenzae biofilms: hypothesis or fact? Trends 757
Microbiol 16:95-100. 758
46. Mulks, M. H., S. J. Kornfeld, and A. G. Plaut. 1980. Specific proteolysis of 759
human IgA by Streptococcus pneumoniae and Haemophilus influenzae. J Infect 760
Dis 141:450-456. 761
47. Murphy, T. F. 2003. Respiratory infections caused by non-typeable Haemophilus 762
influenzae. Curr Opin Infect Dis 16:129-134. 763
48. Murphy, T. F., A. L. Brauer, A. T. Schiffmacher, and S. Sethi. 2004. Persistent 764
colonization by Haemophilus influenzae in chronic obstructive pulmonary 765
disease. Am J Respir Crit Care Med 170:266-272. 766
49. Noel, G. J., D. C. Love, and D. M. Mosser. 1994. High-molecular-weight 767
proteins of nontypeable Haemophilus influenzae mediate bacterial adhesion to 768
cellular proteoglycans. Infect Immun 62:4028-4033. 769
50. Novotny, L. A., K. M. Mason, and L. O. Bakaletz. 2005. Development of a 770
chinchilla model to allow direct, continuous, biophotonic imaging of 771
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
bioluminescent nontypeable Haemophilus influenzae during experimental otitis 772
media. Infect Immun 73:609-611. 773
51. O'May, C. Y., K. Sanderson, L. F. Roddam, S. M. Kirov, and D. W. Reid. 2009. 774
Iron-binding compounds impair Pseudomonas aeruginosa biofilm formation, 775
especially under anaerobic conditions. J Med Microbiol 58:765-773. 776
52. Ojha, A., and G. F. Hatfull. 2007. The role of iron in Mycobacterium smegmatis 777
biofilm formation: the exochelin siderophore is essential in limiting iron conditions 778
for biofilm formation but not for planktonic growth. Mol Microbiol 66:468-483. 779
53. Pang, B., D. Winn, R. Johnson, W. Hong, S. West-Barnette, N. Kock, and W. 780
E. Swords. 2008. Lipooligosaccharides containing phosphorylcholine delay 781
pulmonary clearance of nontypeable Haemophilus influenzae. Infect Immun 782
76:2037-2043. 783
54. Papp-Wallace, K. M., and M. E. Maguire. 2006. Manganese transport and the 784
role of manganese in virulence. Annu Rev Microbiol 60:187-209. 785
55. Petersen, B. C., A. L. Budelsky, A. P. Baptist, M. A. Schaller, and N. W. 786
Lukacs. 2012. Interleukin-25 induces type 2 cytokine production in a steroid-787
resistant interleukin-17RB+ myeloid population that exacerbates asthmatic 788
pathology. Nat Med 18:751-758. 789
56. Post, J. C. 2001. Direct evidence of bacterial biofilms in otitis media. 790
Laryngoscope 111:2083-2094. 791
57. Prince, A. S. 2002. Biofilms, antimicrobial resistance, and airway infection. N 792
Engl J Med 347:1110-1111. 793
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
58. Reid, D. W., C. O'May, L. F. Roddam, and I. L. Lamont. 2009. Chelated iron as 794
an anti-Pseudomonas aeruginosa biofilm therapeutic strategy. J Appl Microbiol 795
106:1058. 796
59. Ren, D., K. L. Nelson, P. N. Uchakin, A. L. Smith, X. X. Gu, and D. A. Daines. 797
2012. Characterization of extended co-culture of non-typeable Haemophilus 798
influenzae with primary human respiratory tissues. Exp Biol Med (Maywood) 799
237:540-547. 800
60. Rhodes, E. R., C. J. Shoemaker, S. M. Menke, R. E. Edelmann, and L. A. 801
Actis. 2007. Evaluation of different iron sources and their influence in biofilm 802
formation by the dental pathogen Actinobacillus actinomycetemcomitans. J Med 803
Microbiol 56:119-128. 804
61. Risberg, A., H. Masoud, A. Martin, J. C. Richards, E. R. Moxon, and E. K. 805
Schweda. 1999. Structural analysis of the lipopolysaccharide oligosaccharide 806
epitopes expressed by a capsule-deficient strain of Haemophilus influenzae Rd. 807
Eur J Biochem 261:171-180. 808
62. Roman, F., R. Canton, M. Perez-Vazquez, F. Baquero, and J. Campos. 2004. 809
Dynamics of long-term colonization of respiratory tract by Haemophilus 810
influenzae in cystic fibrosis patients shows a marked increase in hypermutable 811
strains. J Clin Microbiol 42:1450-1459. 812
63. Ronander, E., M. Brant, H. Janson, J. Sheldon, A. Forsgren, and K. 813
Riesbeck. 2008. Identification of a novel Haemophilus influenzae protein 814
important for adhesion to epithelial cells. Microbes Infect 10:87-96. 815
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
64. Schilling, J. D., M. A. Mulvey, C. D. Vincent, R. G. Lorenz, and S. J. Hultgren. 816
2001. Bacterial invasion augments epithelial cytokine responses to Escherichia 817
coli through a lipopolysaccharide-dependent mechanism. J Immunol 166:1148-818
1155. 819
65. Selsted, M. E., and A. J. Ouellette. 2005. Mammalian defensins in the 820
antimicrobial immune response. Nat Immunol 6:551-557. 821
66. Sethi, S., and T. F. Murphy. 2001. Bacterial infection in chronic obstructive 822
pulmonary disease in 2000: a state-of-the-art review. Clin Microbiol Rev 14:336-823
363. 824
67. Sharpe, S. W., M. J. Kuehn, and K. M. Mason. 2011. Elicitation of epithelial 825
cell-derived immune effectors by outer membrane vesicles of nontypeable 826
Haemophilus influenzae. Infect Immun 79:4361-4369. 827
68. Shelton, C. L., F. K. Raffel, W. L. Beatty, S. M. Johnson, and K. M. Mason. 828
2011. Sap transporter mediated import and subsequent degradation of 829
antimicrobial peptides in Haemophilus. PLoS Pathog 7:e1002360. 830
69. St Geme, J. W., 3rd. 1994. The HMW1 adhesin of nontypeable Haemophilus 831
influenzae recognizes sialylated glycoprotein receptors on cultured human 832
epithelial cells. Infect Immun 62:3881-3889. 833
70. St Geme, J. W., 3rd. 2002. Molecular and cellular determinants of non-typeable 834
Haemophilus influenzae adherence and invasion. Cell Microbiol 4:191-200. 835
71. St Geme, J. W., 3rd. 2000. The pathogenesis of nontypable Haemophilus 836
influenzae otitis media. Vaccine 19 Suppl 1:S41-50. 837
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
72. Sugano, N., K. Ikeda, M. Oshikawa, Y. Sawamoto, H. Tanaka, and K. Ito. 838
2004. Differential cytokine induction by two types of Porphyromonas gingivalis. 839
Oral Microbiol Immunol 19:121-123. 840
73. Svanborg, C., G. Godaly, and M. Hedlund. 1999. Cytokine responses during 841
mucosal infections: role in disease pathogenesis and host defence. Curr Opin 842
Microbiol 2:99-105. 843
74. Swords, W. E., B. A. Buscher, K. Ver Steeg Ii, A. Preston, W. A. Nichols, J. 844
N. Weiser, B. W. Gibson, and M. A. Apicella. 2000. Non-typeable Haemophilus 845
influenzae adhere to and invade human bronchial epithelial cells via an 846
interaction of lipooligosaccharide with the PAF receptor. Mol Microbiol 37:13-27. 847
75. Swords, W. E., M. R. Ketterer, J. Shao, C. A. Campbell, J. N. Weiser, and M. 848
A. Apicella. 2001. Binding of the non-typeable Haemophilus influenzae 849
lipooligosaccharide to the PAF receptor initiates host cell signalling. Cell 850
Microbiol 3:525-536. 851
76. Swords, W. E., M. L. Moore, L. Godzicki, G. Bukofzer, M. J. Mitten, and J. 852
VonCannon. 2004. Sialylation of lipooligosaccharides promotes biofilm formation 853
by nontypeable Haemophilus influenzae. Infect Immun 72:106-113. 854
77. Tracy, E., F. Ye, B. D. Baker, and R. S. Munson, Jr. 2008. Construction of non-855
polar mutants in Haemophilus influenzae using FLP recombinase technology. 856
BMC Mol Biol 9:101. 857
78. van Alphen, L., L. Geelen-van den Broek, L. Blaas, M. van Ham, and J. 858
Dankert. 1991. Blocking of fimbria-mediated adherence of Haemophilus 859
influenzae by sialyl gangliosides. Infect Immun 59:4473-4477. 860
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
79. Vogel, A. R., B. R. Szelestey, F. K. Raffel, S. W. Sharpe, R. L. Gearinger, S. 861
S. Justice, and K. M. Mason. 2012. SapF-mediated heme-iron utilization 862
enhances persistence and coordinates biofilm architecture of Haemophilus. Front 863
Cell Infect Microbiol 2:42. 864
80. Weinberg, E. D. 2009. Iron availability and infection. Biochim Biophys Acta 865
1790:600-605. 866
81. Weinberg, E. D. 1975. Nutritional immunity. Host's attempt to withold iron from 867
microbial invaders. JAMA 231:39-41. 868
82. West-Barnette, S., A. Rockel, and W. E. Swords. 2006. Biofilm growth 869
increases phosphorylcholine content and decreases potency of nontypeable 870
Haemophilus influenzae endotoxins. Infect Immun 74:1828-1836. 871
83. Wong, S. M., F. St Michael, A. Cox, S. Ram, and B. J. Akerley. 2011. ArcA-872
regulated glycosyltransferase lic2B promotes complement evasion and 873
pathogenesis of nontypeable Haemophilus influenzae. Infect Immun 79:1971-874
1983. 875
84. Wongprompitak, P., S. Sirisinha, and S. C. Chaiyaroj. 2009. Differential gene 876
expression profiles of lung epithelial cells exposed to Burkholderia pseudomallei 877
and Burkholderia thailandensis during the initial phase of infection. Asian Pac J 878
Allergy Immunol 27:59-70. 879
85. Zaharik, M. L., V. L. Cullen, A. M. Fung, S. J. Libby, S. L. Kujat Choy, B. 880
Coburn, D. G. Kehres, M. E. Maguire, F. C. Fang, and B. B. Finlay. 2004. The 881
Salmonella enterica serovar typhimurium divalent cation transport systems MntH 882
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
and SitABCD are essential for virulence in an Nramp1G169 murine typhoid 883
model. Infect Immun 72:5522-5525. 884
885
886
887
888
Figure Legends 889
890
FIG. 1. Adherence and epithelial cell surface remodeling in the absence of SapA. 891
CMEE (A) and NHBE (B) cells were inoculated with either the parent strain (white bars) 892
or the sapA mutant strain (black bars). Numbers of bacteria adherent to the epithelial 893
cell monolayers were determined at each time point and depicted as the mean adherent 894
bacteria ± standard deviation of triplicate wells from three (B) or two (A) independent 895
experiments. The asterisk depicts a significant change in adherence between the sapA 896
mutant and the parent strain (P<0.05). The parent strain (C,E) or the sapA mutant 897
(D,F) GFP reporter strains (green) were inoculated onto CMEE cell monolayers (red), 898
incubated for 72 hrs and monitored for colonization and epithelial cell surface changes 899
by confocal microscopy. Panels E and F are three-dimensional rendered optical 900
sections of the bacterial-epithelial cell interface. 901
902
FIG. 2. Epithelial cell invasion in the absence of SapA. NHBE cell monolayers (A) were 903
inoculated with the parent strain (B) or the sapA mutant strain (C), incubated for 24 904
hours and monitored for colonization by fluorescence microscopy. NTHI cells were 905
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
labeled with a α-OMP antibody and detected by α-rabbit FITC antibody (green). 906
Epithelial cell membranes were stained with Wheat Germ Agglutinin conjugated to 907
Alexfluor-594 (red) and DNA was counter stained with Hoescht 34580 (white). White 908
arrows indicate cytoplasmic NTHI. 909
910
FIG. 3. SapA mediates epithelial cell surface colonization by NTHI. Polarized epithelial 911
cells grown at an air-liquid interface (A, B) were inoculated with the parent strain (C, E, 912
G) or the sapA mutant strain (D, F, H) and incubated for 24 hrs. NTHI-epithelial cell 913
interactions were monitored by scanning electron microscopy. 914
915
FIG. 4. Loss of SapA promotes a hyperinvasive phenotype. Polarize epithelial cells 916
grown at an air-liquid interface were inoculated with the parent strain (A,C) or the sapA 917
mutant strain (B,D) and incubated for 24 hours. The subcellular ultrastructural 918
localization of the parent strain or the sapA mutant was determined by transmission 919
electron microscopy. Black arrows indicate bacteria that colonized the epithelial cell 920
surface and white arrows indicate bacteria present in the cytoplasm of the epithelial 921
cells. (E) The parent strain produced outer membrane vesicle at the epithelial cell 922
surface and (F) the sapA mutant strain produced outer membrane vesicles both within 923
and between NHBE cells by. (G) Gentamycin protection assay depicts a ~2 fold 924
increase in invasion of the sapA mutant compared to the parent strain when comparing 925
the mean number of bacteria protected from gentamycin lethality ± standard deviation of 926
triplicate wells performed in three independent experiments. Asterisks indicates a 927
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
significant increase in survival of the sapA mutant compared to that of the parent strain 928
(P<0.05). 929
FIG. 5. Loss of SapA attenuates NTHI-induced disease severity. Naïve chinchilla 930
middle ears (A) were inoculated transbullarly with the parent strain (B) or the sapA 931
mutant strain (C). Three days after inoculation the middle ear inferior bullae were 932
excised, embedded and sectioned. Sections were H&E stained to monitor middle ear 933
mucosae inflammation and NTHI biofilm formation in the middle ear cavity. L, middle 934
ear lumen; I, infiltrating leukocyte; M, mucosa; B, bone; Bf, biofilm. 935
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
Table 1. Cytokine production by respiratory epithelial cells stimulated by NTHI.
Cytokine NHBE CMEE HAE G-CSF 2.21 ND ND I-309 3.37 2.56 ND IL-23 2.99 3.87 ND IL-16 1.95 ND 3.29
CD40 L 10.39 ND 2.08 IL-25 2.59 3.31 2.88 IL-1a ND 2.54 4.81 IL-1b ND 3.51 7.15 IL-2 ND 2.52 1.97
IFN-g ND 2.52 2.00 IL-17 ND 2.62 10.63 IL-4 ND 3.71 3.40 IL-13 ND ND 8.09
MCP-1 ND ND 3.68 GM-CSF ND 2.38 ND IL-12 p70 ND 2.86 ND
IL-5 ND 4.85 ND IL-6 ND 2.44 ND
IP-10 ND 4.05 ND MIP-1a ND 4.27 ND
sICAM-1 ND 5.74 ND Data represents the fold increase in production of the listed cytokines stimulated by the parent strain compared to the mutant strain; cytokines not listed had a fold change less than 1.5. ND indicates and no difference in cytokine production stimulated by the parent strain and the sapA mutant strain.
on April 8, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
Recommended