View
2
Download
0
Category
Preview:
Citation preview
Sensing of Bacterial Peptidoglycan by Peptidoglycan Recognition Molecules
by
Jooeun Lee, B.Sc., M.Sc.
A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy
Graduate Department of Laboratory Medicine and Pathobiology University of Toronto
© Copyright by Jooeun Lee 2013
ii
Sensing of Bacterial Peptidoglycan by Peptidoglycan Recognition
Molecules
Jooeun Lee
Doctor of Philosophy
Graduate Department of Laboratory Medicine and Pathobiology
University of Toronto
2013
Abstract
Peptidoglycan is an essential component of bacteria that provide structure and integrity of the
cell. The main goal of this thesis has been to study the innate immune molecules that recognize
bacterial peptidoglycan. In particular, the first three data chapters focus mainly on Nod1 and
Nod2, the intracellular innate immune receptors critical for peptidoglycan recognition. First, the
contribution of Rip2, the adaptor protein downstream of both Nod1 and Nod2 signaling, in innate
and adaptive immunity was investigated in vivo using Rip2-deficient mice. I demonstrated that
Rip2 was required and critical for triggering Nod1- and Nod2-driven Th2 immunity in vivo.
Second, the mechanism by which Nod1 and Nod2 ligands enter into epithelial cells was
investigated. Using biochemical approaches and molecular biology techniques in vitro, I
determined that the entry of these Nod1 and Nod2 ligands was mediated through clathrin-
dependent endocytosis, and the internalization of the ligands was dependent on pH. More
importantly, I identified a role for SLC15A4, an oligopeptide transporter expressed in early
endosomes, in Nod1-dependent signaling. The last chapter of this thesis focused on delineating
the role of the poorly characterized peptidoglycan binding and amidase protein PGLYRP2 in
innate immune responses to Salmonella enterica serovar Typhimurium infection. Although
PGLYRP2 did not seem to modulate Nod1- and Nod2-dependent early Th17 inflammatory
iii
responses during Salmonella colitis in vivo, the protein was shown to have a protective role in
the host defense against S. Typhimurium, and this role appeared to be independent of its amidase
activity. All together, the work presented in this thesis provides novel insights into various
aspects of signaling mechanisms dependent on Nod1, Nod2, as well as the poorly characterized
mammalian PGLYRP2 in mucosal innate immunity.
iv
Acknowledgments
I would like to dedicate this thesis to my parents, IL-Beom Lee and Young-Hee Lim, for their
unconditional love and support throughout the years.
Completing a PhD degree is no small feat. In my case, it was a particularly challenging journey,
compounded by the fact that I had to switch labs two years into my program. But there were
individuals whom I met along the way that believed in me, and gave me strength to continue my
study; and it is because of them, I am here today with a PhD in my pocket.
First and foremost, I am forever indebted to my amazing supervisor, Dr. Stephen Girardin, for
having the vision and taking me on as his graduate student. Five years ago, Steph saw something
in me that even I was not sure of, and took a big chance on me when it was probably not in his
favor to do so. Combined with his passion for science, Steph’s incredible mentorship provided
the perfect environment for me to grow tremendously not only as a scientist, but also as a better
person. When it comes down to it, I am where I am today because of Steph. Thank you for
believing in me all these years, Steph!
I would like to thank Dr. Dana Philpott who has also been instrumental to my success in
obtaining my degree. Her kind heart and compassion were what got me through during difficult
times, and I feel incredibly lucky to have had her as a mentor and a friend.
Many thanks to my committee members Dr. Ian Crandall and Dr. Jeremy Mogridge for their
guidance and constructive feedback of my research. The department of LMP has also been
wonderful to me throughout my graduate study. Especially, I am very greatful to Dr. Harry
Elsholtz, and Rama Ponda for their support.
I could not have survived graduate school without the support from past and present members of
both the Girardin and the Philpott lab. I am very fortunate to have met and shared a large part of
my degree with amazing group of people, especially Kavi Ramjeet, Sue Robertson, Fraser
Soares, Kaoru Geddes and Matt Sorbara. Thanks for all those long hours of interesting
conversations, whether it be about science or life in general, and thus, making my graduate
school life all the more exciting and enjoyable.
v
Ultimate Frisbee has played an integral part during my PhD. This sport provided a sanctuary for
me, a place where I could go and completely unwind myself. Through playing the sport, I also
met so many wonderful people, and some of the friendships I formed, I hope to continue for life.
I am grateful to have been a part of Tickle Me Stalin for a chance to meet fantastic group of
people, including Wes & Meech, and Melatron. Moreover, I am so thankful for my wonderful
group of four from Torontula, Nancy So, Kate Jardine, Michelle Po, and Melissa MacPherson;
you are not only amazing scientists, but also incredible atheletes who believe that hard work
always pays off in the end. You showed me how to stand tall as a woman in the field of science.
Last but not least, I cannot thank my parents enough. Without their support and encouragement
for so many years, I would not have a PhD today. I have the utmost respect for them, for having
the guts to leave behind a 16-year-old girl all by herself in Canada, because they believed she
could achieve anything she set her mind to it. I love you, mom and dad.
vi
Table of Contents
Acknowledgments .......................................................................................................................... iv
Table of Contents ........................................................................................................................... vi
List of Figures ................................................................................................................................ ix
List of Tables ................................................................................................................................ xii
Dissemination of Work Arising from this Thesis ........................................................................ xiii
List of Abbreviations .................................................................................................................... xv
Chapter 1 Introduction .................................................................................................................... 1
1.1 Peptidoglycan ...................................................................................................................... 1
1.1.1 General structure of peptidoglycan ......................................................................... 1
1.1.2 Adjuvant properties of muropeptides ...................................................................... 4
1.2 Nod1 and Nod2 as sensors of peptidoglycan ...................................................................... 4
1.2.1 Nod-like receptors (NLRs) ..................................................................................... 4
1.2.2 Structure of Nod1 and Nod2 ................................................................................... 5
1.2.3 Nod1 and Nod2 ligand specificity .......................................................................... 5
1.2.4 Cellular localization of Nod1 and Nod2 ................................................................. 7
1.2.5 Mechanism of the entry of Nod1 and Nod2 ligand ................................................. 7
1.2.6 Nod1 and Nod2 activation and signaling .............................................................. 12
1.2.7 Role of Nod1 and Nod2 in Host defense against pathogens at mucosal
surfaces ................................................................................................................. 15
1.2.7.1 Role in innate immunity ......................................................................... 15
1.2.7.2 Role in adaptive immunity ..................................................................... 16
1.2.7.3 Nod1 and Nod2 as modulators of Th17 response in the gut .................. 17
1.3 Peptidoglycan recognition proteins as sensors of peptidoglycan ..................................... 18
1.3.1 PGRPs in Drosophila innate immune system ....................................................... 18
1.3.2 Drosophila hydrolytic PGRPs in the gut innate immunity ................................... 19
vii
1.3.3 Mammalian PGRPs ............................................................................................... 20
1.3.3.1 Structure ................................................................................................. 21
1.3.3.2 Peptidoglycan binding ............................................................................ 23
1.3.3.3 Amidase activity ..................................................................................... 23
1.3.3.4 Bactericidal activity ................................................................................ 24
1.3.3.5 Role of mammalian PGRPs in innate immunity .................................... 26
1.4 Mucosal biology in the gut ............................................................................................... 27
1.4.1 Gut overview – intestinal epithelium .................................................................... 27
1.4.2 Inflammatory Bowel Disease ................................................................................ 30
1.4.3 Animal models of inflammatory bowel disease .................................................... 32
1.4.3.1 Salmonella enterica serova Typhimurium ............................................. 32
Chapter 2 Thesis Objectives ......................................................................................................... 34
Chapter 3 Essential Role of Rip2 in the modulation of innate and adaptive immunity
triggered by Nod1 and Nod2 ligands ....................................................................................... 35
3.1 Abstract ............................................................................................................................. 36
3.2 Introduction ....................................................................................................................... 36
3.3 Materials and Methods ...................................................................................................... 39
3.4 Results ............................................................................................................................... 42
3.5 Discussion ......................................................................................................................... 55
Chapter 4 pH-dependent Internalization of Muramyl Peptides from Early Endosomes Enables
Nod1 and Nod2 Signaling ........................................................................................................ 58
4.1 Abstract ............................................................................................................................. 59
4.2 Introduction ....................................................................................................................... 59
4.3 Materials and Methods ...................................................................................................... 62
4.4 Results ............................................................................................................................... 66
4.5 Discussion ......................................................................................................................... 85
viii
Chapter 5 Synthesis and Biological Evaluation of Biotinyl Hydrazone Derivatives of
Muramyl Peptides .................................................................................................................... 90
5.1 Abstract ............................................................................................................................. 91
5.2 Introduction ....................................................................................................................... 91
5.3 Materials & Methods ........................................................................................................ 92
5.4 Results & Discussion ........................................................................................................ 95
5.5 Conclusions & Future Directions .................................................................................... 104
Chapter 6 The Role of Mouse Peptidoglycan Recognition Protein PGLYRP2 in the Innate
Immune Response to Salmonella enterica serovar Typhimurium Infection in vivo ............. 106
6.1 Abstract ........................................................................................................................... 107
6.2 Introduction ..................................................................................................................... 107
6.3 Materials and Methods .................................................................................................... 110
6.4 Results ............................................................................................................................. 112
6.5 Discussion ....................................................................................................................... 128
Chapter 7 Discussion .................................................................................................................. 131
7.1 Thesis summary .............................................................................................................. 131
7.2 Revisiting the entry mechanism of Nod1 ligands ........................................................... 133
7.3 PGLYRP2 : unpublished observations & future directions ............................................ 134
7.4 Conclusions ..................................................................................................................... 144
ix
List of Figures
Figure 1.1. The Gram-negative and Gram-positive bacterial cell wall. .......................................... 2
Figure 1.2. (A) A schematic structure of peptidoglycan. (B) The basic structure of peptidoglycan.
......................................................................................................................................................... 3
Figure 1.3. The human NLR family. ............................................................................................... 6
Figure 1.4. The peptidoglycan minimal structures detected by Nod1 and Nod2. .......................... 8
Figure 1.5. Entry mechanism for extracellular peptidoglycan. ..................................................... 10
Figure 1.6 (A) The structure of mammalian PGRPs, (B) The host peptidoglycan hydrolases
PGLYRP2 and lysozyme. ............................................................................................................. 22
Figure 1.7. The gut epithelia. ........................................................................................................ 28
Figure 3.1. Comparison of cell populations of WT and Rip2/
mice. ......................................... 43
Figure 3.2. Rip2 is required for Nod1- and Nod2-induced inflammation in vivo. ....................... 44
Figure 3.3. Rip2 is required for macrophage activation and neutrophil recruitment upon Nod1
and Nod2 activation in vivo. ......................................................................................................... 46
Figure 3.4. Rip2 modulates the frequency and the activation of CD11cint
CD11b+ cells in the
spleen upon Nod1 and Nod2 activation. ....................................................................................... 49
Figure 3.5. Rip2 modulates the activation of T and B cells in the spleen upon Nod1 and Nod2
activation. ...................................................................................................................................... 51
Figure 3.6. Rip2 modulates the activation of CD4+ and CD8
+ T cells in the spleen upon Nod1
and Nod2 activation. ..................................................................................................................... 52
Figure 3.7. Rip2 is essential for Nod1- and Nod2-induced Th2 immunity. ................................. 54
Figure 4.1. Differential entry of Nod1 ligands into HEK293T cells. ........................................... 69
x
Figure 4.2 Nod1 ligands enter HEK293T cells by endocytosis. ................................................... 71
Figure 4.3. The internalization of Nod1 ligands is dependent on endosomal pH. ........................ 73
Figure 4.4. Extracellular acidification strongly potentiates endocytosis-mediated entry of iE-
DAP. .............................................................................................................................................. 76
Figure 4.5. The Nod2 ligand MDP enters HEK293T cells by endocytosis. ................................. 78
Figure 4.6. SLC15A4 is involved in Nod1 ligand-mediated NF-B activation in HEK293T cells.
....................................................................................................................................................... 81
Figure 4.7. SLC15A4 is expressed in early endosomes. ............................................................... 83
Figure 4.8. SLC15A4 mRNA expression levels are increased in inflamed colon of IBD patients.
....................................................................................................................................................... 84
Figure 4.9. Schematic representation of the model for the entry of Nod1 ligands into epithelial
cells. .............................................................................................................................................. 89
Figure 5.1 Preparation of hydrazone derivatives 1-10. See Table 1 for the nature of R1 ............ 96
Figure 5.2. Biotinylated and dansylated muramyl peptides are biologically active. .................... 99
Figure 5.3. Internalization of biotinylated muramyl peptides in HeLa cells. ............................. 102
Figure 5.4. Enforced internalization of biotinylated muramyl peptides is sufficient to activate
Nod1 and Nod2. .......................................................................................................................... 105
Figure 6.1. Analysis of PGLYRP2 expression in intestinal cellular subsets. ............................. 115
Figure 6.2. Pglyrp2 expression is increased in the cecum following Salmonella infection. ...... 118
Figure 6.3. PGLYRP2 does not modulate Nod-dependent early Th17 responses or inflammatory
cytokine responses to Salmonella infection. ............................................................................... 121
Figure 6.4. Pglyrp2/
mice have increased inflammation following SL1344 infection. ........... 124
xi
Figure 6.5. Nod2/
Pglyrp2/
mice have significantly increased inflammation at 24h following
SL1344 infection. ........................................................................................................................ 127
Figure 7.1. Summary of my thesis. ............................................................................................. 132
Figure 7.2. The neutrophil killing assay. .................................................................................... 136
Figure 7.3. Pglyrp1 expression in the cecum following Salmonella infection at 72h. ............... 137
Figure 7.4. Colonic pathology following 7-day infection with C. rodentium in WT and Pglyrp2-
deficient mice. ............................................................................................................................. 140
Figure 7.5. Intracellular cytokines, IL-17a and IFN- responses from cecal WT and Pglyrp2-
deficient mice during C. rodentium-induced colitis. .................................................................. 141
Figure 7.6. The microbiota composition of cecum content samples from WT and Pglyrp2-
deficient mice. ............................................................................................................................. 143
xii
List of Tables
Table 5.1 Yields and mass spectrometry analysis of hydrazone derivatives ................................ 97
Table 6.1. Detailed characterization of the cecal leukocyte population expressing reporter gene
carrying the GFP+ under the control of the Pglyrp2 promoter at steady-state. .......................... 116
xiii
Dissemination of Work Arising from this Thesis
Chapter 3 was published as:
Joao G. Magalhaes*, Jooeun Lee*, Kaoru Geddes, Stephen Rubino, Dana J. Philpott and
Stephen E. Girardin. Essential role of Rip2 in the modulation of innate and adaptive immunity
triggered by Nod1 and Nod2 ligands. European Journal of Immunology 2011; 41(5): 1445-55.
*these authors contributed equally to this manuscript.
Chapter 4 was published as:
Jooeun Lee, Ivan Tattoli, Kacper A. Wojtal, Stephan R. Vavricka, Dana J. Philpott, and Stephen
E. Girardin. pH-dependent Internalization of Muramyl Peptides from Early Endosomes Enables
Nod1 and Nod2 Signaling. The Journal of Biological Chemistry 2009; 284 (35): 23818-23829.
Chapter 5 was published as:
Didier Blanot*, Jooeun Lee* and Stephen E. Girardin. Synthesis and Biological Evaluation of
Biotinyl Hydrazone Derivatives of Muramyl Peptides. Chemical Biology & Drug Design 2012;
79:2-8. *these authors contributed equally to this manuscript.
Chapter 6 was published as:
Jooeun Lee, Kaoru Geddes, Catherine Streutker, Dana J. Philpott and Stephen E. Girardin. The
Role of Mouse Peptidoglycan Recognition Protein PGLYRP2 in the Innate Immune Response to
Salmonella enterica serovar Typhimurium Infection in vivo. Infection and Immunity 2012 May
21 (PMID: 22615249). *Selected as a Spotlight Article in the Issue 8, Volume 80, August 2012.
Additional publications arising during the course of graduate studies:
Frirdich, E., Adams, C., Biboy, J., Lee, J., Ellermeier, J., Davis, L., DiRita, V.J., Girardin, S.E.,
Vollmer, W., Gaynor, E.C. Peptidoglycan-modifying enzyme PGP1 is required for helical cell
shape and pathogenicity traits in Campylobacter jejuni. PLoS Pathogens 2012 Mar;8(3)
e1002602 Epub 2012 Mar 22
xiv
Rubino, S., Lee J., Girardin S.E. Mammalian PGRPs also mind the fort. Cell Host & Microbe
2010 8(2): 130-2.
xv
List of Abbreviations
AGS human gastric epithelial cells
ALRs absent-in-melanoma 2 (AIM2)-like receptors
APAF1 apoptotic protease activating factor 1
APCs antigen presenting cells
BIRs baculovirus inhibitor repeats
CARD caspase recruitment domain
CD Crohn’s diease
cIAP1/cIAP2 cellular inhibitor of apoptosis 1 and 2
CLRs C-type lectin receptors
CYLD Cylindromatosis
DAMPs danger-associated molecular patterns
DAP diaminopimelic acid
DGGE denaturing gradient gel electrophoresis
DKO double knockout
DMEM Dulbecco’s modified Eagle’s medium
DSS dextran sulfate sodium
ELISA Enzyme-linked immunosorbent assay
ELISPOT Enzyme-linked immunosorbent spot
ERK extracellular receptor kinase
FAE follicle-associated epithelium
FCA Freund’s Complete Adjuvant
FK156 D-lactyl-L-Ala-g-D-Glu-meso-DAP-Gly
GALT gut-associated lymphoid tissue
GlcNAc N-acetylyglucosamine
GWAS genome-wide association studies
IBD inflammatory bowel disease
IECs intestinal epithelial cells
IELs intraepithelial leukocytes
IFN interferon
IKK inhibitor of KappaB Kinase
IMD immune deficiency
ITCH atrophin-1 interacting protein 4, AIP4
JNK Jun N-terminal Kinase
KC keratinocyte-derived chemokine
Lcn2 lipocalin 2
LP lamina propria
LPLs lamina propria lymphocytes
LPS lipopolysaccharides
LRRs C-terminal leucine-rich repeats
LTA lipoteichoic acids
LUBAC the linear ubiquitin chain assembly complex
MAMPs microbial-associated molecular patterns
MAP mitogen-activated protein
xvi
M cell microfold cell
MDP muramyl dipeptide
MCP-1 monocyte chemotactic protein-1
MurNAc N-acetylmuramic acid
NACHT domain present in neuronal apoptosis inhibitor protein (NAIP), the major
histocompatibility complex (MHC) class II transactivator (CIITA), HET-E
and TP1
NBD nucleotide-binding domain
NEMO NFB essential modulator
NF-B nuclear factor-B
NLRs Nod-like receptors
Nod Nucleotide-binding oligomeriazation domain
OMVs outer membrane vesicles
OVA ovalbumin
PMNs polymorphonuclear leukocyte
PAI cag-pathogenicity island
PGRPs peptidoglycan recognition proteins
PPs Peyer’s Patches
PRMs pattern recognition molecules
PRRs pattern recognition receptors
PYD pyrin domain
qPCR Quantitative real-time PCR
RegIII regenerating islet-derived III
Rip2 receptor-interacting protein 2
RLRs retinoic acid-inducible gene-I (RIG)-like receptors
RNAi RNA interference
SLC the solute carrier
SPI-2 pathogenicity island 2
TAK1 transforming growth factor -activated kinase
TCT GlcNAc-AnhydroMurNAc-TetraDAP
TLRs Toll-like receptors
TNBS trinitrobenzene sulfonic acid
TRAF tumor necrosis factor receptor-associated factor
Tregs T regulatory cells
T-RFLP terminal restriction fragment length polymorphism
TTSS type III secretion systems
UC ulcerative colitis
XIAP X-linked inhibitor of apoptosis protein
XLP-2 X-linked lymphoproliferative syndrome type 2
1
Chapter 1 Introduction
1
1.1 Peptidoglycan
Peptidoglycan is an essential part of cell wall in almost all bacteria. Gram-positive bacteria have
a thick cell wall composed of 20 to 80 layers of peptidoglycan, as well as teichoic acids,
lipoteichoic acids, and lipoproteins (Figure 1.1). In Gram-negative bacteria, peptidoglycan is
found as a thin layer, located in the periplasmic space between the plasma membrane and the
outer membrane (Figure 1.1). Peptidoglycan not only preserves cell integrity and maintains a
defined cell shape, but also provides a scaffolding structure for anchoring other components such
as lipoproteins and teichoic acids (Vollmer et al., 2008). Interestingly, peptidoglycan is one of
the major components of bacteria readily detected by host pattern recognition receptors (PRRs),
along with other components such as lipopolysaccharides (LPS) of the outer membrane from
Gram-negative bacteria, and lipoteichoic acids (LTA) from Gram-positive bacteria.
1.1.1 General structure of peptidoglycan
Peptidoglycan is composed of glycan chains that are made up of alternating, (-1-4)-linked N-
acetylglucosamine (GlcNAc) and N-acetylmuramic acid (MurNAc) sugar residues linked to a
short peptide chain at the lactyl group of MurNAc. Subtle changes in the peptide chain
composition can occur between species (Schleifer and Kandler, 1972), however, this peptide
stem is typically composed of four to five amino acids starting with L-Ala and D-Glu as the first
and the second amino acids, respectively. In contrast, the third residue of the stem peptide is a
lysine in coccoid Gram-positive bacteria such as Staphylococcus and Streptococcus species, but
a meso-diaminopimelic acid (DAP) residue in both Gram-negative and several rod-shaped Gram-
positive bacteria such as Listeria and Bacillus species (Boneca, 2005; Girardin et al., 2003c). The
two tetrapeptides (L-Ala--D-Glu-meso-DAP (or L-Lys)-D-Ala) subunits are linked to each other
through the branching diamino group containing residue to the D-Ala residue (Mengin-Lecreulx
and Lemaitre, 2005) (Figure 1.2). Interestingly, the peptide stem mostly found in Gram-negative
bacteria is a perfect example of a microbial-derived molecular signature, since it has features that
are absent in eukaryotes: a D-form amino acid, a -type peptide bond, and meso-DAP. Moreover,
2
Figure 1.1. The Gram-negative and Gram-positive bacterial cell wall.
The Gram-negative cell wall is composed of a thin layer of peptidoglycan and an outer
membrane embedded with molecules such as phospholipids, LPS, and lipoproteins. The Gram-
positive cell wall is a dense layer typically composed of multiple layers of peptidoglycan, and
molecules of lipoteichoic acid, teichoic acid and surface proteins. Adapted, with permission,
from Dr. Kaiser’s microbiology website (http://student.ccbcmd.edu/~gkaiser/goshp.html).
3
A.
B.
Figure 1.2. (A) A schematic structure of peptidoglycan. (B) The basic structure of
peptidoglycan.
The chemical structure of DAP-type peptidoglycan, common in Gram-negative bacteria is
shown. The red inset shows the changes in structure common in Gram-positive bacteria,
including the change of m-diaminopimelic acid to L-Lysine, and D-glutamic acid to D-iso-
glutamine. (B) Adapted, with permission, from Immunological Reviews (Sorbara and Philpott,
2011).
4
the sugar group, MurNAc, is a hexose, which is only present in bacteria (Vollmer et al., 2008).
1.1.2 Adjuvant properties of muropeptides
Long before the discovery of peptidoglycan recognition molecules such as Nucleotide-binding
oligomeriazation domain 1 (Nod1) and Nod2, smaller components of peptidoglycan containing
MurNAc (also called muropeptides) were shown to be biologically active (Adam et al., 1974;
Ellouz et al., 1974). DAP-containing tetrapeptides and muramyl dipeptide (MDP), which is
composed of MurNAc and two amino acids, L-Ala and D-Glu (or D-isoGln), were initially
discovered to act as adjuvants, an agent that enhances the immune-stimulatory response elicited
by compounds having few effects on their own (Adam et al., 1974; Ellouz et al., 1974). Further,
MDP was found to be the minimal peptidoglycan-derived structure required for eliciting
adjuvant activity and could therefore replace Freund’s Complete Adjuvant (FCA), one of the
most potent adjuvants and yet a highly toxic compound, for its ability to induce both humoral
and cellular activity (Adam et al., 1981). Indeed, these muropeptides are effective adjuvants and
thus, may be used for boosting the potency of drugs and vaccines. In particular, MDP and other
muropeptides (tri- and tetrapeptides) enhance the expression of surface markers necessary for
cell adhesion and antigen presentation, which leads to increased phagocytic and antimicrobial
activity (Darcissac et al., 1996; Heinzelmann et al., 2000; O'Reilly and Zak, 1992). Furthermore,
they elicit immune responses by increasing production of cytokines such as interferon (IFN)-,
thereby stimulating lymphocyte activation (Saiki and Fidler, 1985; Souvannavong et al., 1990;
Traub et al., 2006). Muropeptides have also been shown to display strong synergy with other
ligands, such as lipopolysaccharide (LPS), thus eliciting a greater immune response in vitro in
human primary cells (Vermeulen et al., 1987; Wang et al., 2001; Yang et al., 2001).
1.2 Nod1 and Nod2 as sensors of peptidoglycan
1.2.1 Nod-like receptors (NLRs)
Innate immune system is activated when danger- and microbial-associated molecular patterns
(DAMPs and MAMPs) are detected by pattern recognition molecules (PRMs) on cells including
epithelial cells, macrophages, and dendritic cells. Several families of secreted or cellular PRMs
have been identified, and among these, cellular PRMs can be grouped into Toll-like receptors
(TLRs), C-type lectin receptors (CLRs), Nod-like receptors (NLRs), retinoic acid-inducible
5
gene-I (RIG)-like receptors (RLRs), and a new family termed absent-in-melanoma 2 (AIM2)-like
receptors (ALRs) (Huysamen and Brown, 2009; Kumar et al., 2009; Schroder et al., 2009;
Schroder and Tschopp, 2010; Wilkins and Gale, 2010). The membrane-bound TLRs, the first
class of cellular PRMs to be identified, have been extensively studied in the last fifteen years;
they are involved in the recognition of MAMPs such as LPS, flagellin, lipoproteins, DNA and
RNA. On the other hand, the NLRs and the RLRs are intracellular cytosolic sensors, which are
critical at monitoring DAMPs and MAMPs when insults evade extracellular surveillance.
1.2.2 Structure of Nod1 and Nod2
The Nod domain was first found in apoptotic protease activating factor 1 (APAF1) and its
nematode homologue CED-4, which are regulators of developmental and p53-dependent
programmed cell death (Derry et al., 2001; Inohara et al., 1999). Subsequently, two Nod
containing molecules, Nod1 (Card4) and Nod2 (Card15), were identified through database
searches for APAF1/CED4 homologues. The human NLR family consists of 22 proteins that can
be subdivided into five subfamilies, NLRA, NLRB, NLRC, NLRX, and NLRP, according to the
nature of their N-terminal effector domain (Figure 1.3) (Werts et al., 2011). NLRs are multi-
domain proteins composed of a variable N-terminal effector region consisting of caspase
recruitment domain (CARD), pyrin domain (PYD), acidic domain, or baculovirus inhibitor
repeats (BIRs), a centrally located NACHT domain [domain present in neuronal apoptosis
inhibitor protein (NAIP), the major histocompatibility complex (MHC) class II transactivator
(CIITA), HET-E and TP1] that is critical for activation, and C-terminal leucine-rich repeats
(LRRs) that senses MAMPs. Nod1 and Nod2 belong to NLRC family; Nod1 (NLRC1) has a
single amino-terminus CARD domain, whereas Nod2 (NLRC2) has two amino-terminus CARD
domains, followed by a central NACHT domain, and a C-terminal LRR domain (Figure 1.3).
1.2.3 Nod1 and Nod2 ligand specificity
Initially Nod1 and Nod2 were thought to recognize LPS intracellularly (Girardin et al., 2001;
Inohara et al., 2001; Ogura et al., 2001), but it was soon discovered that LPS preparations were
contaminated with other bacterial products. Subsequently, Nod1 and Nod2 were shown to detect
specific motifs from bacterial peptidoglycan. Nod1 recognizes meso-DAP-containing
peptidoglycan fragments (Chamaillard et al., 2003; Girardin et al., 2003a), to detect Gram-
negative bacteria and certain Gram-positive bacteria, including Listeria and Bacillus species
6
Figure 1.3. The human NLR family.
Organization of the human NLR family according to structural similarities of their proteins.
Adapted, with permission, from Nature Immunology (Kufer and Sansonetti, 2011).
7
(Girardin et al., 2003c). On the other hand, Nod2 recognizes MDP, which is the minimal
structural component commonly found in peptidoglycan of both Gram-positive and Gram-
negative bacteria (Girardin et al., 2003b; Inohara et al., 2003) (Figure 1.4).
Nod1 is ubiquitously expressed in many cell types including stromal and hematopoietic cells
while Nod2 expression is believed to be mainly restricted to leukocytes. However, expression of
Nod2 is induced by inflammatory signals in paneth cells (Ogura et al., 2003), and epithelial cells
of the intestine (Hisamatsu et al., 2003), suggesting that Nod2 is important for mucosal
homoeostasis.
1.2.4 Cellular localization of Nod1 and Nod2
Nod1 and Nod2 lack transmembrane domains and therefore, are considered cytoplasmic
proteins. Although the exact location of these receptors in the cytoplasm is not clear, Nod1
(Kufer et al., 2008) and Nod2 (Barnich et al., 2005) have been shown to be associated with
plasma membrane. Nod2 3020insC mutant, a truncated form of Nod2 associated with Crohn’s
disease, was defective in sensing MDP (Girardin et al., 2003b; Inohara et al., 2003), and
remained in the cytoplasm (Barnich et al., 2005). Further studies have linked membrane targeting
of Nod2 and NF-B activation (Lecine et al., 2007; Legrand-Poels et al., 2007), and also showed
that localization of Nod2 to the plasma membrane promotes membrane recruitment of its adaptor
protein, Rip2 (Lecine et al., 2007). Similar results were also reported for Nod1, as endogenous
Nod1 was found in both the cytoplasm and the plasma membrane of AGS gut epithelial cells, at
the site of bacterial entry (Kufer et al., 2008). Interestingly, it is likely that a correlation between
host endomembrane targeting and innate immune function represents a general feature for not
only Nod1 and Nod2, but also many NLR proteins (Philpott and Girardin, 2010).
1.2.5 Mechanism of the entry of Nod1 and Nod2 ligand
Entry of Nod1 and Nod2 ligands into the cytosol is essential for activation of Nod1 and Nod2.
Supporting this, Nod1 in epithelial cells was shown to be activated by invasive Shigella flexneri,
but not non-invasive strains (Girardin et al., 2001). In agreement, Nod1 and Nod2 have been
shown to be critical at mounting immune responses against invasive bacteria, such as Shigella
flexneri (Girardin et al., 2001), Listeria monocytogenes (Boneca et al., 2007; Opitz et al., 2006),
Streptococcus pneumonia (Opitz et al., 2004), and Salmonella enterica serovar Typhimurium
8
Figure 1.4. The peptidoglycan minimal structures detected by Nod1 and Nod2.
Nod1 detects muramyl tripeptides in which the third amino acid is a meso diaminopimelic acid
(mesoDAP), a structure found in most Gram-negative bacteria. In contrast, Nod2 detects MDP,
which is composed of a MurNAc sugar linked to the dipeptide L-Ala-D-Glu. While Nod2 can also
detect muramyl tripeptides if the third amino acid is a lysine (found in Gram-positive bacteria),
MDP is the minimal structure detected by Nod2. The difference between mesoDAP and lysine
lies in a single carboxy group (highlighted in an ellipse). Contrary to Nod2, Nod1 detection does
not require the presence of the sugar moiety. Also, even the first amino acid, L-Ala, is not
absolutely critical. Thus, the minimal motif detected by Nod1 is the dipeptide D-Glu-mesoDAP
(also known as iE-DAP).
9
(Geddes et al., 2010; Le Bourhis et al., 2009). In addition, Nod1 and Nod2 have been shown to
detect non-invasive bacterial pathogens (Viala et al., 2004). In these cases, several mechanisms
account for the delivery of extracellular peptidoglycan to the cytosolic compartment where Nod1
and Nod2 reside (Figure 1.5).
SLC15 family of peptide transporters
SLC family proteins, with over 300 transporters, transport short chain peptides and other organic
small molecules from the extracellular space to the cytosol (Hediger et al., 2004). Based on the
solute specificity, only a few out of the 46 SLC sub-families (from SLC1 to SLC46) could be
potentially implicated in the transport of peptidoglycan-derived peptides. Among these are the 4
members of SLC15 family (H+-coupled oligopeptide transporter), the 20 members of SLC21
(organic anion transporting family) and the 18 members of SLC22 (organic
anion/zwitterions/cation transporting family) proteins (Hediger et al., 2004). SLC15 family
proteins, namely SLC15A1 (PepT1), SLC15A2 (PepT2), SLC15A3 (PHT2) and SLC15A4
(PHT1), deliver short-chain peptides by utilizing proton-motive force (Hediger et al., 2004).
Human SLC15A1 and SLC15A2 have very broad substrate specificity, and are known to mediate
the active translocation of di- or tri-peptides across epithelial tissues (Biegel et al., 2006;
Meredith and Price, 2006). The poorly studied SLC15A3 and SLC15A4 have been shown to
transport free histidine and certain oligopepetides (Hediger et al., 2004). SLC15A1 is highly
expressed in gut epithelial cells (Fei et al., 1994; Ismair et al., 2006), particularly in the proximal
small intestine, whereas SLC15A2 is abundantly expressed throughout the epithelial cells in the
lung and kidney (Biegel et al., 2006). Both SLC15A3 and SLC15A4 are widely expressed in
various tissues, including tissues in the human gastrointestinal tract (Bhardwaj et al., 2006;
Herrera-Ruiz et al., 2001). Interestingly, the expression of colonic SLC15A1 and SLC15A4 is
upregulated in patients with ulcerative colitis and Crohn’s diease (CD) (Lee et al., 2009; Merlin
et al., 2001). Studies have shown that SLC15A1 mediates the transport of Tri-DAP and MDP to
activate Nod1-, and Nod2-dependent NF-B signaling respectively, in human colonic Caco2/bbe
epithelial cells (Dalmasso et al., 2010; Vavricka et al., 2004), although SCL15A1 does not
transport Nod1 ligands in oocytes from Xenopus laevis (Ismair et al., 2006). Moreover, in human
lung epithelial cells, SLC15A2 was shown to mediate the uptake of Nod1 ligand, iE-DAP
(Swaan et al., 2008). In addition, we have recently showed that the oligopeptide transporter
SLC15A4 expressed in the early endosome, was implicated in the transport of Nod1 ligands
10
Figure 1.5. Entry mechanism for extracellular peptidoglycan.
Several mechanisms have been proposed for the entry into epithelial cells, including clathrin-
mediated endocytosis, oligopeptide transporters (hPepT1 and SLC15A4), bacterial Type IV
secretion systems, and outer membrane vesicles (OMVs). Refer to the text for detail. Adapted,
with permission, from Immunological Reviews (Sorbara and Philpott, 2011).
11
from the endosome to the cytoplasm in HEK293T cells (Lee et al., 2009) (Chapter 4). This
result was further supported by a more recent study, which showed that cytokine production in
response to the Nod1 ligand Tri-DAP, was impaired in Slc15a4/
mice in vivo (Sasawatari et al.,
2011).
Endocytosis
Endocytosis is a fundamental process that is used by eukaryotic cells to internalize molecules
(Doherty and McMahon, 2009). Several entry mechanisms have been observed, including the
most studied clathrin-mediated endocytosis, as well as caveolae-mediated endocytosis,
phagocytosis and macropinocytosis (Doherty and McMahon, 2009). Two reports have
demonstrated that Nod1 and Nod2 ligands were internalized via clathrin-mediated endocytosis in
macrophages and epithelial cells (Lee et al., 2009; Marina-Garcia et al., 2009). In macrophages,
Marina-Garcia et al. showed that MDP uptake occurred through clathrin-dependent endocytosis
(Marina-Garcia et al., 2009), and trafficking of MDP required V-ATPases and endosomal
acidification for Nod2 activation. In contrast, Lee et al. showed that the late-stage endosome
maturation was not required in epithelial cells, since inhibiting the action of V-ATPases did not
diminish Nod1 or Nod2 activation (Lee et al., 2009) (Chapter 4). Interestingly, a recent report
demonstrated that intact polymeric peptidoglycan, rather than monomeric MDP or soluble
peptidoglycan, can also be taken up into the innate immune cells (not nonphagocytic epithelial
cells) by phagocytosis, and undergoes lysosomal degradation to be transported to the cytosol to
activate Nods (Iyer and Coggeshall, 2011).
Bacterial secretion system
Another mechanism, used by Helicobacter pylori, to deliver peptidoglycan into the cell, is
through bacterial secretion system. Helicobacter pylori is a Gram-negative bacteria that
colonizes human gastric mucosa (Watanabe et al., 2010b). Infection with H. pylori is associated
with gastric inflammation and ulceration, often resulting from the interplay between bacterial
virulence factors and host immune responses. The cag-pathogenicity island (PAI) is one of the
key virulence factors of H. pylori that encodes a type IV secretion system, through which
effectors, such as CagA (Odenbreit et al., 2000) and peptidoglycan (Viala et al., 2004), are
translocated into the host cell. Although H. pylori is an extracellular pathogen, epithelial
12
infection with the organism results in Nod1 activation (Allison et al., 2009; Viala et al., 2004).
The mechanism by which H. pylori peptidoglycan enters epithelial cells is through type IV
secretion system. Indeed, Viala et al. found that H. pylori expressing functional cag-PAI
efficiently delivered radio-labeled peptidoglycan into the gastric epithelial cells, whereas H.
pylori strain harboring nonfunctional cag-PAI failed to deliver radio-labeled peptidoglycan. The
cag-dependent Nod1 activation plays an important role in host defense, since Nod1-deficient
mice had higher bacterial loads during infection with cag-positive H. pylori strains. Moreover,
Grubman et al. further supported these findings by showing that infection with H. pylori induced
Interleukin (IL)-8 production by the gastric epithelial cell line, AGS cells, in a Nod1/cag-PAI-
dependent manner (Grubman et al., 2009).
Outer membrane vesicles (OMVs)
Another mechanism, used predominantly by Gram-negative bacteria, to deliver peptidoglycan
into the environment, is the release of outer membrane vesicles containing secreted products of
the periplasm (Clarke et al., 2011). Recent studies provide evidence that peptidoglycan can also
be delivered to epithelial cells by bacterial OMVs (Allison et al., 2009; Bielig et al., 2011;
Kaparakis et al., 2010). OMVs are shed by Gram-negative bacteria during normal growth
(Kuehn and Kesty, 2005), and contain numerous components of the bacterial cell wall including
peptidoglycan (Zhou et al., 1998). Kaparakis et al. showed that OMVs from Helicobacter pylori,
Pseudomonas aeruginosa, and Neisseria gonorrhea enter epithelial cells via lipid rafts to
transport their peptidoglycan to Nod1 and to trigger Nod1-dependent NF-B activation.
Similarly, Bielig and colleagues demonstrated that Vibrio cholera OMVs are taken up by
epithelial cells and induce Nod1-dependent inflammatory responses, although the mechanism by
which OMVs enter the cell is not clear (Bielig et al., 2011).
1.2.6 Nod1 and Nod2 activation and signaling
In the absence of ligands, Nod1 and Nod2 are thought to be kept in an inactive state by intra-
molecular interactions (Hsu et al., 2008; Tanabe et al., 2004). Although the exact mechanism of
peptidoglycan detection is unclear, direct binding of Nod1 and Nod2 to their ligand, Tri-DAP
and MDP, respectively, has been recently demonstrated using purified recombinant proteins
(Askari et al., 2012; Laroui et al., 2011; Mo et al., 2012). Specifically, Nod1 ligand, Tri-DAP,
has been shown to interact with the C-terminal leucine-rich repeat (LRR) domain of Nod1
13
(Askari et al., 2012; Laroui et al., 2011), which supports a previous study suggesting that Tri-
DAP associates with the LRR of Nod1 (Girardin et al., 2005). Interestingly, the binding to MDP
was recently shown to be dependent on the nucleotide-binding domain (NBD) of Nod2 (Mo et
al., 2012), rather than the LRR domain, where the binding had been thought to take place
previously (Tanabe et al., 2004). Upon ligand recognition, Nod1 and Nod2 undergo
conformational changes (Inohara et al., 2005) leading to self-oligomerization mediated through
the central NACHT domain. This is followed by the recruitment and activation of the serine
threonine kinase RICK (Rip2), which associates with Nod1 or Nod2 through CARD-CARD
interaction. The central pathway of Nod1 and Nod2 signaling involves this adaptor protein, Rip2,
which is essential for initiating ubiquitin-dependent signaling events that activate pro-
inflammatory pathways such as NF-B and the mitogen-activated protein (MAP) kinases p38,
JNK and ERK (Girardin et al., 2001; Inohara et al., 2000; Kobayashi et al., 2002).
Activation of Rip2 is controlled by ubiquitination, which requires three enzymatic steps
performed by E1, E2, E3 enzymes (Chen, 2005). Upon ligand binding, the recruitment of the E3-
ubiquitin ligases including TRAF2/TRAF5 (Hasegawa et al., 2008), cIAP1/cIAP2 (Bertrand et
al., 2009), and XIAP (Krieg et al., 2009) take place. This induces conjugation of K63-linked
ubiquitin chains on Rip2 (Hasegawa et al., 2008; Yang et al., 2007), reportedly mediated by
cIAP1/2 (Bertrand et al., 2009). The Rip2 poly-ubiquitin chains serve as a scaffold to recruit and
activate the downstream signaling complexes such as IKK kinase (Hasegawa et al., 2008;
Inohara et al., 2000). Recently, it was shown that XIAP ubiquitylates Rip2 after Nod2
stimulation to facilitate the linear ubiquitin chain assembly complex (LUBAC) recruitment,
which regulates Nod2-dependent immune signaling (Damgaard et al., 2012), a process abrogated
by mutations in XIAP in patients suffering from X-linked lymphoproliferative syndrome type 2
(XLP-2) (Marsh et al., 2010; Rigaud et al., 2006). ITCH, another E3-ligase, is also involved in
poly-ubiquitinating Rip2 through K63 linkages although, unlike other E3 ligases, it acts to
negatively regulate Rip2-driven NF-B responses while promoting the MAPK responses (Tao et
al., 2009). Similarly, A20, a de-ubiquitinating enzyme, cleaves activating poly-K63-ubiquitin
chains from Rip2 leading to an inhibition of NF-B activation (Hitotsumatsu et al., 2008).
Cylindromatosis (CYLD), another de-ubiquitinating enzyme that targets members of the TRAF
family and acts as a negative regulator of NF-B activation (Trompouki et al., 2003), has
14
recently been shown to be upregulated in a Nod1-dependent manner as part of a subversion
mechanism by Klebsiella pneumoniae (Regueiro et al., 2011).
Initiation of NF-B signaling occurs when activation of Rip2 leads to its poly-ubiquitination
(Hasegawa et al., 2008; Hitotsumatsu et al., 2008; Krieg et al., 2009; Yang et al., 2007), as well
as triggering activation of NFB essential modulator (NEMO), the regulator of the IKK subunit,
to promote activation of the catalytic subunits IKKα and IKK (Abbott et al., 2004). In addition,
Rip2 mediates the recruitment of transforming growth factor -activated kinase (TAK1), which
is essential for IKK activation (Hasegawa et al., 2008; Kim et al., 2008a). Once activated, IKK
phosphorylates the inhibitor IB targeting it for degradation, thereby releasing NF-B and
allowing it to translocate to the nucleus (Hayden and Ghosh, 2004). Similar to the NF-B
pathway, TAK1 and Rip2 are required for Nod1- and Nod2-mediated MAPK activation,
although the link between Nod activation and MAPK activation is less clear (da Silva Correia et
al., 2007; Park et al., 2007a; Windheim et al., 2007). Nod activation leads to activation of JNK
(Girardin et al., 2001; Hsu et al., 2007; Kim et al., 2008b), ERK1/ERK2 (Kim et al., 2008b;
Kobayashi et al., 2005; Windheim et al., 2007), and p38 (Hsu et al., 2007; Kim et al., 2008b;
Kobayashi et al., 2005; Opitz et al., 2006). The activation of these MAPK and NF-B pathways
induce the expression of several cytokines, such as IL-6, IL-10, and chemokines, such as IL-8,
monocyte chemotactic protein (MCP)-1, and keratinocyte-derived chemokine (KC), as well as
antimicrobial peptides, mainly α defensins (Kersse et al., 2011).
Recent reports also provide evidence for additional pathways originating from Nod1 and Nod2.
Both Nod1 and Nod2 have been shown to induce type I IFN production (Sabbah et al., 2009;
Watanabe et al., 2010a), although the triggers and the molecular mechanisms differ significantly.
Nod1 activation is initiated by Nod1 ligand, iE-DAP, leading to downstream signaling involving
Rip2 interacting with TRAF3 to induce type 1 IFN production (Watanabe et al., 2010a). On the
other hand, Nod2 induces type I IFN production in response to viral ssRNA, through a
peptidoglycan-independent, Rip2-independent mechanism involving mitochondrial signaling
complex (Sabbah et al., 2009).
Autophagy is a highly conserved recycling process where damaged organelles or pathogens can
be degraded through the lysosomal machinery (Deretic and Levine, 2009). Nod1 and Nod2 have
also been linked to autophagy signaling, by recruiting ATG16L1, one of the key components of
15
autophagy machinery, to the plasma membrane at bacterial entry sites (Cooney et al., 2010;
Homer et al., 2010; Travassos et al., 2010). The involvement of Rip2 in Nod1/2-mediated
autophagy is debatable since one study found this process to be Rip2 independent (Travassos et
al., 2010) whereas another group found Rip2 essential for the process (Cooney et al., 2010).
1.2.7 Role of Nod1 and Nod2 in Host defense against pathogens at mucosal surfaces
Mucosal surfaces are the place where epithelial cells come in contact with resident microbiota or
potentially harmful pathogens. This is especially true in the case of gut as well as vaginal
epithelium as these surfaces experience constant exposure to microorganisms. Pattern
recognition receptors such as Nod1 and Nod2 are found within epithelium to help the detection
of microorganisms.
1.2.7.1 Role in innate immunity
Nod1 and Nod2 are involved in sensing of numerous pathogenic bacteria. In vitro studies reveal
that Nod1 detects Shigella flexneri (Girardin et al., 2001), enteroinvasive Escherichia coli (Kim
et al., 2004), Chlamydia (Buchholz and Stephens, 2008; Opitz et al., 2005; Welter-Stahl et al.,
2006), Pseudomonas aeruginosa (Travassos et al., 2005), Campylobacter jejuni (Zilbauer et al.,
2007), and Helicobacter pylori (Boughan et al., 2006; Viala et al., 2004). Similarly, Nod2 is
involved in the recognition of Listeria monocytogenes (Kobayashi et al., 2005), Staphylococcus
aureus (Girardin et al., 2003b), Streptococcus pneumonia (Opitz et al., 2004), and
Mycobacterium tuberculosis (Ferwerda et al., 2005). Although these data support the role of
Nod1 and Nod2 in host defense against pathogens in vitro, in vivo evidence using Nod1/
and
Nod2/
mice is not as abundant. While in vitro infection of primary cells with Chlamydia
trachomatis suggests Nod1 is involved in detecting the organism, vaginally infected Nod1/
mice showed normal pathology, suggesting no critical role for Nod1 in vivo (Welter-Stahl et al.,
2006). Similarly, Nod2/
mice was slightly more susceptible to oral infection with Yersinia
pseudotuberculosis (Meinzer et al., 2008), and yet, no difference was observed in cytokine
responses of wild-type and Nod2-deficient macrophages to in vitro infection with Yersinia (Kim
et al., 2008b). Nevertheless, several in vivo studies have clearly demonstrated a key role for
Nod1 and Nod2 in host defense against pathogens such as H. pylori, L. monocytogenes, and
Staphylococcus aureus (Hruz et al., 2009; Kobayashi et al., 2005; Viala et al., 2004). For
16
example, Nod1/
mice had higher bacterial loads following intragastric infection with H. pylori
(Viala et al., 2004), and had impaired expression of the antimicrobial peptide -defensin 4
(Boughan et al., 2006), suggesting that Nod1 plays an important role in the induction of
antimicrobial peptides following infection with this pathogen. Likewise, Nod2/
mice infected
orally with L. monocytogenes were more susceptible to infection, and demonstrated low level of
certain antimicrobial α-defensin peptides compared to wildtype controls (Kobayashi et al., 2005).
In addition to inducing antimicrobial peptides, Nod1 and Nod2 induce the production of nitric
oxide, a molecule that is known to be directly microbicidal (Magalhaes et al., 2005; Park et al.,
2007b; Totemeyer et al., 2006). Moreover, activation of Nod1 and Nod2 by live bacteria triggers
pro-inflammatory responses leading to the induction of cytokine and chemokines (Opitz et al.,
2005; Opitz et al., 2006). Interestingly, Nod1 was also recently demonstrated to provide
protection against the intracellular parasite Trypanosome cruzi (Silva et al., 2010), which is the
etiological agent of Chagas disease (Silva et al., 2010), despite the lack of peptidoglycan in this
pathogen. Nod1-deficient mice were highly susceptible to T. cruzi infection in vivo, and it was
suggested the underlying mechanism for Nod1-dependent resistance appeared to be independent
of cytokine production and dependent on the impaired killing ability of macrophages (Silva et
al., 2010).
1.2.7.2 Role in adaptive immunity
Nod1 and Nod2 have also been implicated in the induction of adaptive immune responses.
Indeed, as mentioned in section 1.1.2, earlier studies identified Nod1 (tri-, tetrapeptides) and
Nod2 ligand (MDP) as adjuvants (Adam et al., 1974; Ellouz et al., 1974). Prior to the
identification of Nod2 as the sensor for MDP, it was known that MDP was a crucial component
of Freund’s Complete Adjuvant (Adam et al., 1981), and its adjuvanticity suggested that Nod2
might play a role in the induction of adaptive immunity. This appears to be true, as the injection
of MDP with a model protein ovalbumin (OVA) in mice induces an adaptive response that is
completely abrogated in Nod2-deficient animals (Kobayashi et al., 2005). In addition, recent
studies have shown that in vivo immunization of OVA with either the Nod1 or Nod2 ligand
results in a Th2-skewed antigen-specific adaptive immunity, characterized by IL-4 and IL-5
producing T cells and IgG1 antibodies (Fritz et al., 2006; Magalhaes et al., 2008), providing
further evidence of the role of these NLR proteins in adaptive immunity. More recently, Nod2
17
activation through MDP was shown to induce Th2-driven allergic inflammation in mice by
altering the balance between antigen-specific regulatory T cells (CD4+Foxp3
+) and IL-4-
producing CD4 T cells (Duan et al., 2010). These studies suggest that Nod2 activation may lead
to Th2 immunity, suggesting a possible role of Nod2 in allergic inflammation.
Interestingly, CD4+ T cells express Nod2, and several groups suggested a role for Nod2 in T-cell
function (Rahman et al., 2010; Shaw et al., 2009). Shaw et al. observed that Nod2 was involved
in host defense to intraperitoneal challenge with Toxoplasma gondii through a mechanism
involving CD4+ T cells (Shaw et al., 2009). Nod2-deficient T cells were defective in their
induction of IL-2, which is necessary for the generation of both Th1 and Th2, and Nod2 was
shown to act downstream of the co-stimulatory molecule CD28, leading to IL-2 transcription.
This finding, however, was recently challenged by another group, who found no role for Nod2 in
the activation and Th1 differentiation of CD4+ T cells (Caetano et al., 2011). On the other hand,
recent work from Rahman et al. demonstrated that FoxP3+ T regulatory cells (Tregs) express
Nod2 and activate NFB in response to MDP stimulation (Rahman et al., 2010). Moreover,
Crohn’s disease patients with Nod2 mutations had fewer lamina propria Tregs (Rahman et al.,
2010). Thus, although it is clear that Nod1 and Nod2 contribute to adaptive immunity, it is still
not known whether these receptors contribute by having a direct effect on T cells, or indirectly
through interaction with antigen presenting cells (APCs). Further studies are required to
delineate the precise mechanism by which Nod1 and Nod2 contribute to adaptive immunity.
1.2.7.3 Nod1 and Nod2 as modulators of Th17 response in the gut
Th17 cells are a subset of differentiated CD4+ T helper cells that produce a group of distinct
cytokines including IL-17, and IL-22, which participate in inducing tissue inflammatory
response (Korn et al., 2009). The Th17 response plays a crucial role in mucosal immunity to
enteric bacterial pathogens. In the gastrointestinal tract, IL-17 and IL-22 were shown to confer
protection against various enteric pathogens such as Helicobacter pylori, Citrobacter rodentium
and Salmonella enterica serovar Typhimurium (Raffatellu et al., 2008; Velin et al., 2009)
(Godinez et al., 2009; Raffatellu et al., 2009). For example, Salmonella enterica serovar
Typhimurium induces an acute inflammatory response in the cecum of mice, with early (24-48h)
production of IL-17 by T cells (Godinez et al., 2008; Godinez et al., 2009; Raffatellu et al.,
2009). Interestingly, a recent work by our group identified redundant but critical roles for Nod1
18
and Nod2 in driving innate Th17 responses during early stages of infection with enteric bacterial
pathogens (Geddes et al., 2011). The authors found that mice deficient for both Nod1 and Nod2
showed a blunted early inflammation in both the S. Typhimuruim and C. rodentium colitis
models, with significantly reduced amounts of IL-17A, and IL-22 in cecal tissue during early
infection. The contribution of Nod1 and Nod2 to host protection was achieved through the
induction of IL-17A and IL-22, which were produced by CD4+TCR
+Th17 cells in the cecal
lamina propria at early times post infection. In addition, Nod expression by both myeloid and
somatic cells was required, and dendritic cells were identified as a major source for Nod1/Nod2
dependent production of IL-6, which seemed to be central to this “innate Th17” (iTh17)
response. Finally, the presence of the microbiota was essential for priming iTh17 cells, as germ-
free mice showed no iTh17 response. Taken together, these findings highlight that Nod1 and
Nod2 are critical in the innate activation of Th17 response during early stages of bacterial colitis.
1.3 Peptidoglycan recognition proteins as sensors of peptidoglycan
Aside from Nod1 and Nod2, several other mammalian molecules recognize peptidoglycan
including soluble CD14, C-type lectins, lysozymes and peptidoglycan recognition proteins
(PGRPs). Among these, PGRPs were first identified in the haemolymph of a silkworm (Bombyx
mori) as proteins that could bind to bacterial peptidoglycan and activate antimicrobial host
defense mechanism in insects (Yoshida et al., 1996). The cloning of PGRP genes from the
fruitfly, Drosophila melanogaster, led to the discovery of mouse and human PGRP orthologs
(Kang et al., 1998), which indicated that PGRPs were highly conserved from insects to
mammals. PGRPs from D. melanogaster are by far the most extensively studied PGRPs where
the central role of these proteins in innate immunity was demonstrated.
1.3.1 PGRPs in Drosophila innate immune system
D. melanogaster does not have an adaptive immunity, and relies heavily on their PGRPs to
detect bacterial and fungal pathogens. D. melanogaster has 13 PGRP genes that are transcribed
into 19 proteins (Kang et al., 1998; Werner et al., 2000). These proteins can be classified into
two subclasses; one subclass of PGRPs can bind and recognize peptidoglycan triggering host
defense pathways that generate antibacterial products, whereas the other subclass can hydrolyze
pro-inflammatory peptidoglycan and thereby reducing inflammation. PGRPs such as PGRP-SA,
19
PGRP-SD, PGRP-LC and PGRP-LE fall into the PGRP subclasses involved in peptidoglycan
recognition, but not hydrolysis. The subclass of PGRPs that displays N-acetylmuramoyl-L-
alanine amidase enzymatic activity includes PGRP-SC1, PGRP-SC2, PGRP-SB1/2, and PGRP-
LB (Tanji and Ip, 2005). These proteins participate in two distinct signaling pathways: while the
Toll pathway responds to Gram-positive bacteria and fungal pathogens, the IMD (immune
deficiency) pathway responds to Gram-negative bacteria. Detection of Gram-positive bacteria
upstream of the Toll pathway involves a specific PGRP, PGRP-SA, as its mutant form was
impaired in its ability to active the Toll pathway, and was highly susceptible to infection by
Gram-positive bacteria (Michel et al., 2001). Similarly, studies demonstrated that PGRP-LC is
the main transmembrane receptor that activates the IMD pathway, since a mutation in the PGRP-
LC gene hinders activation of the IMD pathway, rendering the fly highly susceptible to infection
with Gram-negative bacteria specifically (Choe et al., 2002; Gottar et al., 2002; Ramet et al.,
2002). Moreover, it was later identified that PGRPs in D. melanogaster detect specific forms of
peptidoglycan; Lys-type peptidoglycan in Gram-positive bacteria favors interaction with PGRP-
SA, and activates Toll, whereas mesoDAP in Gram-negative peptidoglycan leads to activation of
the IMD pathway through an interaction with PGRP-LC (Leulier et al., 2003).
1.3.2 Drosophila hydrolytic PGRPs in the gut innate immunity
Although the key role of non-hydrolytic PGRPs in innate immunity was demonstrated early on,
the function of hydrolytic PGRPs was unknown for many years. Mellroth and collegues
performed the first in vitro study to demonstrate that one of the hydrolytic PGRPs, PGRP-SC1B,
hydrolyzed Gram-negative peptidoglycan, resulting in a digested molecule that no longer
triggered activation of immune system (Mellroth et al., 2003). Based on this finding, the authors
postulated that hydrolytic PGRPs may play a role as scavenger molecules, preventing the
activation of inflammatory pathways. Supporting this, others demonstrated that GlcNAc-
AnhydroMurNAc-TetraDAP (also known as TCT or tracheal cytotoxin), the minimal
peptidogylcan motif that fully activated IMD pathway, became completely inactive in its
TetraDAP form (the peptidic product released by hydrolytic PGRPs) (Kaneko et al., 2004;
Stenbak et al., 2004). An in vivo validation of the above findings came with a study by Zaidman-
Remy and colleagues who demonstrated the key role of an amidase, PGRP-LB, using RNA
interference (RNAi) technology to specifically knock down expression of PGRP-LB in adult
flies (Zaidman-Remy et al., 2006). This group found that PGPR-LB knockdown flies exhibited
20
higher expression of the IMD-specific antimicrobial peptides diptericin in response to bacteria
and this response was also lasting longer compared to that of wild-type flies. These findings
suggest that PGRP-LB acts as a scavenger molecule to down-regulate the IMD pathway by
degrading peptidoglycan. Interestingly, the study also revealed that PGRP-LB was important in
controlling IMD pathway activation both in the gut and systemically during homeostasis as well
as during bacterial infection; at homeostatic level, PGRP-LB knockdown files had enhanced
expression of local antimicrobial peptide in the gut, indicating that peptidoglycan fragments
released by bacteria present in the digestive tract is normally hydrolyzed by PGPR-LB to inhibit
IMD activation. Further, PGPR-LB was shown to prevent systemic immune responses following
oral challenge of Gram-negative bacteria or peptidoglycan. All together, this study demonstrated
that PGRP-LB has not only a scavenger function in vivo, but also a role as a master regulator of
immune homeostasis at epithelial surfaces. Despite the fact that the role of PGRP-LB in
regulation of the IMD pathway is clear, the function for other hydrolytic PGRPs, such as PGRP-
SCs and PGRP-SB1 and SB2, is not clear. There is conflicting evidence for roles of PGRP-SCs
(Bischoff et al., 2006; Garver et al., 2006) and no overt phenotype was shown in PGRP-SB1 and
SB2 mutant flies (Zaidman-Remy et al., 2011). Recent study on a systematic analysis of amidase
PGRP using gene deletions still support the role of PGRP-LB as a negative regulator of the IMD
pathway both locally and systemically (Paredes et al., 2011). Moreover, this group identified a
new role of PGRP-LB in downregulating the IMD pathway triggered by commensals in the adult
gut, under unchallenged conditions. Further, PGRP-SC family seems to have a role in negatively
regulating the IMD pathway during systemic infection only and synergizes with PGRP-LB in the
systemic immune response to ingested bacteria (Paredes et al., 2011). The authors also concluded
that PGRP-SB1 and SB2 do not seem to play a major role in the regulation of the IMD pathway.
Nevertheless, these in vivo studies firmly established that some of these amidases are important
to down-modulate the IMD pathway, both systemically and in the gut (Bischoff et al., 2006;
Zaidman-Remy et al., 2006).
1.3.3 Mammalian PGRPs
Mammalian PGRPs consist of four members, namely PGLYRP1, PGLYRP2, PGLYRP3, and
PGLYRP4, which were initially named PGRP-S, -L, Iα, and I, respectively (on the basis of
their short (S), long (L), and intermediate (I) transcript lengths). Three of them (PGLYRP1,
PGLYRP3 and PGLYRP4) are known to have bactericidal properties against both Gram-positive
21
and Gram-negative bacteria, but no known amidase activity, whereas PGLYRP2 is a
peptidoglycan-hydrolytic enzyme known to have the N-acetylmuramoyl-L-alanine amidase
activity, which is the only conserved common function of insect and mammalian PGRPs (Royet
et al., 2011).
1.3.3.1 Structure
Mammalian PGRPs have at least one C-terminal PGRP domain that comprises approximately
165 amino acids. PGRP domain is structurally homologous to bacteriophage and bacterial type 2
N-acetylmuramoyl-L-alanine amidases (Dziarski and Gupta, 2006; Kang et al., 1998; Kiselev et
al., 1998; Liu et al., 2001), which suggests that PGRPs and prokaryotic type 2 amidases may
have evolved from the same ancestral gene. Mammalian PGLYRP1 is ~200 amino acids long,
has one PGRP domain and a molecular mass of 18-20 kDa (Dziarski and Gupta, 2006) (Figure
1.6a). PGLYRP2 has one C-terminal PGRP domain, a molecular mass of 64-80 kDa, and a very
long unique N-terminal sequence that does not resemble PGRP domain or any other proteins
(Zhang et al., 2005). PGLYRP3 and PGLYRP4 both have two PGRP domains, and a molecular
mass of ~35 kDa and ~40 kDa, respectively (Royet et al., 2011).
Initially, mammalian PGRPs were thought to be transmembrane proteins due to their predicted
transmembrane domains (Liu et al., 2001; Wang et al., 2003), which were later found to be
hydrophobic domains (Zhang et al., 2005), likely with some other function. Indeed, all
mammalian PGRPs are secreted (Guan et al., 2004; Zhang et al., 2005) and, in the case of
PGLYRP1, PGLYRP3, and PGLYRP4, form disulfide-linked homodimers (Lu et al., 2006; Xu
et al., 2004; Zhang et al., 2005). In addition, PGLYRP3 and PGLYRP4 almost always form
disulfide-linked heterodimers if they are expressed in the same cells (Lu et al., 2006). On the
other hand, PGLYRP2 form dimers that are not disulfide-linked (De Pauw et al., 1995).
The crystal structure of PGRPs reveals that the general structural design of the PGRP domain is
similar to type 2 bacteriophage amidases, which has three α-helices and several central -sheet
strands (Guan et al., 2004; Kim et al., 2003). PGRP domain contains a peptidoglycan-binding
groove, and a PGRP-specific segment, not present in type 2 amidases (Dziarski and Gupta, 2006;
Kim et al., 2003; Royet and Dziarski, 2007). The peptidoglycan-binding groove of PGLYRP2
has a Zn2+
-binding site, which consists of conserved amino acids including one Cys (C530)
residue critical for Zn2+
-binding and amidase activity. This Cys is substituted with Ser in the
22
A.
B.
Figure 1.6 (A) The structure of mammalian PGRPs, (B) The host peptidoglycan hydrolases
PGLYRP2 and lysozyme.
(A) The figure shows diagrams of the domain structure of mammalian PGRPs (adapted from
Nature Reviews Immunology (Royet et al., 2011)). (B) PGLYRP2 and lysozyme are the two
unique host enzymes known to hydrolyze peptidoglycan. Lysozyme cleaves the sugar group
between MurNAc (M) and GlcNAc (G), while PGLYRP2 hydrolyzes the lactyl bond between M
and the peptides.
23
catalytic site in PGLYRP1, PGLYRP3, and PGLYRP4 (Gelius et al., 2003; Wang et al., 2003)
and thus, these PGRPs do not have amidase activity.
1.3.3.2 Peptidoglycan binding
Based on the crystal structure of PGRPs, peptidoglycan-binding groove in PGRP domain is
shown to be specific for muramyl tripeptide (Chang et al., 2004; Guan et al., 2004; Kim et al.,
2003), whereas it does not bind an MDP or a peptide without MurNAc (Guan et al., 2006;
Kumar et al., 2005; Swaminathan et al., 2006). It binds muramyl tetrapeptide and muramyl
pentapeptide with higher affinity (Kumar et al., 2005; Swaminathan et al., 2006). Indeed, the
crystal structure of C-terminal PGRP domain of PGLYRP3 indicates that binding of muramyl
pentapeptide to this region induces a conformational change in the PGRP domain locking the
ligand in the binding groove (Guan et al., 2006).
Mammalian PGRPs bind to both Gram-positive and Gram-negative bacteria and some fungi (Lu
et al., 2006; Tydell et al., 2006). Crystallographic studies also suggest that these PGPRs can
discriminate between Lys-type and DAP-type peptidoglycans (Chang et al., 2006; Kumar et al.,
2005; Lim et al., 2006; Swaminathan et al., 2006). For example, human PGLYRP3 was shown to
bind Lys-type peptidoglycan with higher affinity than DAP-type peptidoglycan, whereas human
PGLYRP1 was shown to favor DAP-type peptidoglycan over Lys-type. Although human and
mouse PGRPs have a high affinity for peptidoglycan, some mammalian PGRPs such as bovine
PGLYRP1 have been shown to bind other microbial molecules, including LPS and LTA with
high affinity (Tydell et al., 2006). Moreover, bovine PGLYRP1 and human PGLYRP3 and
PGLYRP4 can also bind fungi-derived molecules (Lu et al., 2006; Tydell et al., 2006).
1.3.3.3 Amidase activity
There are two known host peptidoglycan-degrading enzymes in mammals. The first, lysozyme,
has been studied extensively since its discovery 90 years ago, and is known for its role as an
antimicrobial molecule (Fleming, 1922). Lysozyme is found in the serum, body fluid (such as
tears, sweat, saliva), the granules of neutrophils, and intestinal paneth cells (Chipman and
Sharon, 1969; Ganz et al., 2003). Lysozyme cleaves the -1-4 linkage between the N-
acetylmuramic acid (MurNAc) and the N-acetylglucosamine (GlcNAc) of peptidoglycan,
releasing glycopeptides. The other enzyme, PGLYRP2, cleaves the lactyl bond between the
24
MurNAc and L-Ala in bacterial peptidoglycan (Figure 1.6b). PGLYRP2 is constitutively
expressed in the liver, and secreted into bloodstream (Wang et al., 2003). Indeed, PGLYRP2
from the liver was identified to be the same enzyme as serum N-acetylmuramoyl-L-alanine
amidase which was identified earlier but, at the time, was not cloned (Zhang et al., 2005).
Moreover, PGLYRP2 not only is expressed in various parts of oral cavities and intestinal
epithelial cells (Saha et al., 2010) but also its expression is induced in keratinocytes and other
epithelial cells and fibroblasts by exposure to bacteria and cytokines (Li et al., 2006; Saha et al.,
2009; Uehara et al., 2005; Wang et al., 2005). In addition, Pglyrp2 expression was recently
characterized in small intestinal intraepithelial leukocytes (IELs), with the majority of its
expression in T lymphocytes (Duerr et al., 2010).
In contrast to the other three mammalian PGRPs, PGLYRP2 does not function as an
antimicrobial protein (Gelius et al., 2003). Instead, it hydrolyzes the bond between the sugar
group and the peptide stem in peptidoglycan. The minimum peptidoglycan fragment hydrolyzed
by PGLYRP2 is muramyl tripeptide (containing either mesoDAP or Lys), similar to the minimal
PGRP-binding fragment (Chang et al., 2004; Guan et al., 2004; Kim et al., 2003). MDP, a typical
Nod2 ligand, is therefore not cleaved by PGLYRP2 (Wang et al., 2003). Serum PGLYRP2 might
function as a scavenger molecule similar to amidase-active insect PGRPs, as it was shown to
inactivate inflammatory peptidoglycan by lowering its cytokine-inducing properties (Hoijer et
al., 1997b). However, in tissues, PGLYRP2 seems to participate in induction of inflammatory
response, although this response is independent of its amidase and peptidoglycan-binding
activities (Saha et al., 2009). Thus, the role of the amidase-active mammalian PGLYRP2 remains
unclear and will be discussed in detail in chapter 5.
1.3.3.4 Bactericidal activity
PGLYRP1 is highly expressed in polymorphonuclear leukocyte (PMNs) granules, especially in
the secretory granules of neutrophils (Tydell et al., 2002). PGLYRP1 is also found in intestinal
M (microfold) cells (Lo et al., 2003) and in many non-immune cells, such as epithelial cells and
fibroblasts (Saha et al., 2009; Uehara et al., 2005). PGLYRP3 and PGLYRP4 proteins are
selectively expressed in tissues that come into contact with the environment (Lu et al., 2006;
Mathur et al., 2004), such as skin, eyes, oral cavity and intestinal tract. The expression of
PGLYRP3 and PGLYRP4 were shown to be up-regulated by bacteria and their products in
25
keratinocytes (Lu et al., 2006), fibroblasts (Saha et al., 2009), and oral epithelial cells (Uehara et
al., 2005).
PGLYRP1, PGLYRP3, PGLYRP4 are bactericidal or bacteriostatic for many pathogenic and
non-pathogenic Gram-positive and Gram-negative bacteria (Lu et al., 2006; Wang et al., 2007) in
vitro. In vivo, Pglyrp1-deficient mice were found to be susceptible to infections with some
Gram-positive bacteria (Dziarski et al., 2003). Similarly, using recombinant PGLYRP3 in wild-
type mice, PGLYRP3 was shown to play a bactericidal role, thus preventing S. aureus lung
infection in mice (Lu et al., 2006).
Interestingly, these mammalian bactericidal proteins have very distinct characteristics that
separate them from the currently known mammalian antimicrobial peptides. Indeed, mammalian
constitute a new class of bactericidal proteins; PGRPs are much larger than vertebrate
antimicrobial peptides; PGLYRPs are disulfide-linked dimers, 44-115kDa in size (Lu et al.,
2006), whereas vertebrate antimicrobial peptides are typically 3-15kDa. The expression patterns
of mammalian PGRPs and antimicrobial peptides are different, and mammalian PGRPs are not
expressed by some cells that produce large amounts of antimicrobial peptides such as Paneth
cells (Ganz et al., 2003; Lu et al., 2006; Zasloff, 2002). Moreover, PGRPs kill bacteria probably
by interacting with peptidoglycan whereas antimicrobial peptides kill bacteria by permeabilizing
bacterial membranes (Ganz et al., 2003; Zasloff, 2002).
The mechanism underlying bacterial killing by mammalian PGRPs was completely unknown
until recently, although it was previously proposed that PGPRs kill bacteria by inhibiting
peptidoglycan synthesis (Dziarski and Gupta, 2010). Kashyap and colleagues recently
demonstrated that PGPRs kill bacteria by exploiting bacterial two-component stress response
systems, designed to respond quickly to environmental stress. If stress is sustained or its level is
too high, the bacterial two-component systems will be over-activated and bacteria will die. Thus,
the mammalian PGRPs trigger this bacterial defense/suicide mechanism to kill bacteria (Kashyap
et al., 2011).
26
1.3.3.5 Role of mammalian PGRPs in innate immunity
As discussed above, Drosophila PGRPs have many functions in the host response to infection,
mostly involved in activating or downregulating their immune pathways following microbial
sensing (Royet and Dziarski, 2007). In contrast, the role of mammalian PGRPs remains largely
unknown, especially in vivo, despite the fact that PGRPs specifically bind bacterial
peptidoglycan and that some of them display antibacterial activity in vitro (Lu et al., 2006;
Tydell et al., 2002; Tydell et al., 2006; Wang et al., 2007).
Initial study with Pglyrp2-deficient mice showed a normal response intraperitoneal infection
with Gram-positive or Gram-negative bacteria (Xu et al., 2004), suggesting no role for
PGLYRP2 in mammalian immunity. Subsequently, PGLYRP2 was shown to play a role in local
tissue inflammation and acute arthritis: because insect amidase-active PGRPs have anti-
inflammatory properties and hydrolyze pro-inflammatory peptidoglycan, Saha and colleagues
tested whether amidase active PGLYRP2 played a smilar anti-inflammatory role in vivo in a
peptidoglycan-induced arthritis model (Saha et al., 2009). Surprisingly, this group found that
PGLYRP2 was required for the induction of peptidoglycan-induced local inflammation and
arthritis as Pglyrp2-deficient mice were resistant to peptidoglycan-induced arthritis. Moreover,
this phenotype was dependent on Nod2, and independent of PGLYRP2 amidase activity.
Interestingly, the other three mammalian PGRPs were shown to have an opposite anti-
inflammatory effect in the same model, with Pglyrp1-deficient mice exhibiting arthritis of the
highest severity. Moreover, although the protein is secreted, the effect of PGLYRP2 was local in
the site of injection and not systemic.
Recently, the same group further demonstrated that all four mammalian PGRPs were implicated
in host protection in a dextran sulfate sodium (DSS)-induced colitis model (Saha et al., 2010).
Using all four individual PGRP knockout mice, they showed that these mice displayed relatively
similar increased sensitivity to DSS and altered immune responses as compared to wild-type
mice. This increased sensitivity to DSS-induced colitis was due to the presence of a more
inflammatory gut microbiota, higher production of interferon-, and an increased number of NK
cells in the colon. This finding perhaps suggests a role of mammalian PGRPs in the maintenance
of proper gut homeostasis by having a direct effect on the microbiota composition. More studies
27
will be required to delineate the exact mechanism through which individual PGPRs confer
protection in mucosal immunity.
1.4 Mucosal biology in the gut
1.4.1 Gut overview – intestinal epithelium
The human intestinal tract is continuously exposed to a wide range of food antigens and other
antigens from the external environment. Moreover, unlike epithelial surfaces such as the lung or
bladder, which are sterile under non-pathological conditions, the gut epithelium harbors the
greatest number of resident bacteria (commensals) in the body, with 1011
(per gram of intestinal
content) bacteria in the large intestine (Ley et al., 2006). Thus, the gut epithelium has a
formidable task to maintain a physical and immunological barrier, especially in the presence of
enormous quantities of luminal bacteria. The innate immune system at the gut barrier must keep
a fine balance between the need to tolerate the potentially pro-inflammatory commensals in the
lumen and the need to protect the host from invading enteric pathogens. This is achieved by
components of the innate sensing system such as NLRs and TLRs present at the intestinal barrier
in various cell types where they influence every level of the immune response.
Physical barriers
The physical barrier of intestinal mucosal surface is maintained by complex mechanism acting
on several levels. The intestinal epithelial cells (IECs) are a single layer of interconnected,
polarized cells, composed of several specialized cell subsets including M cells, goblet cells,
Paneth cells, and columnar epithelial cells (Goto and Kiyono, 2012) (Figure 1.7). Goblet cells are
secretory epithelial cells that produce mucins, which are highly glycosylated macromolecules
that form the the mucus, a gel-like physical barrier between the gut contents and epithelial cells
(McGuckin et al., 2011). Paneth cells, another type of secretory epithelial cells, are specific to
the small intestine at the basal sites of crypts, although Paneth cell-related cells are recently
observed in colon crypt region (Sato et al., 2011). These cells produce antimicrobial peptides
such as defensins, lysozymes, and RegIII (Mukherjee et al., 2008), which contribute to keeping
the crypts sterile of commensals and enteric pathogens. The production of antimicrobial peptide
is regulated by several PRMs, including TLR adaptor, MyD88, and Nod2 (Kobayashi et al.,
2005; Vaishnava et al., 2008). For example, Nod2 is prominently expressed in Paneth cells
28
Figure 1.7. The gut epithelia.
The intestinal epithelial cells consist of several specialized cells including M cells, goblet cells,
Paneth cells, and columnar epithelial cells. M cells sample antigens within the lumen and deliver
these antigens to the initiation compartment of the organized lymphoid tissues, namely the
Peyer’s patches and the mesenteric lymph nodes (MLNs). Goblet cells secrete mucins, which
provide a physical barrier between the gut contents and epithelial cells. Paneth cells are typically
found in the crypts of the small intestine, and secrete antimicrobial peptides, contributing to keep
the crypts sterile. Intestinal lamina propria lymphocytes (LPLs) are found scattered within the
subepithelial lamina propria (LP), and the intraepithelial lymphocytes (IELs) are embedded in
the epithelial-cell layer.
29
and the expression of defensins by Paneth cells is impaired in Nod2-deficient mice (Kobayashi et
al., 2005; Petnicki-Ocwieja et al., 2009). M cells predominantly reside in the regions of follicle-
associated epithelium (FAE) covering Peyer’s Patches (PPs), and act to sample antigens within
the lumen and present antigens to APCs initiating mucosal immune responses (Hathaway and
Kraehenbuhl, 2000).
Immunological barriers
With regards to immune function, the intestinal structures that contain lymphocytes are typically
divided into three different anatomical compartments. The gut-associated lymphoid tissue
(GALT) includes the mesenteric lymph nodes (MLNs), the PPs of the small intestine and similar
follicular aggregates of the large intestine and cecum (Cheroutre and Madakamutil, 2004). The
lamina propria (LP), a connective tissue that underlines the epithelium of the mucosa, contains
various myeloid and lymphoid cells, including macrophages, dendritic cells, T cells and B cells
(Cheroutre et al., 2011). Lymphocytes localized within the subepithelial LP are called lamina
propria lymphocytes (LPLs) (Figure 1.7). Additionally, numerous IELs reside on the other side
of the basement membrane from the LP, interspersed among the luminal epithelial cells (Figure
1.7).
IELs/LPLs
T cells residing in the GALT have the most in common with peripheral T cells (Cheroutre et al.,
2011). On the other hand, intestinal LPLs and IELs display a number of unique characteristics
that distinguish them from conventional T cell pools in the periphery. IELs comprise mostly T
cells belonging to both the T cell receptor (TCR)- and TCR-α lineages (Cheroutre et al.,
2011). Unlike conventional T cells, however, IELs are antigen-experienced T cells that do not
require priming, and immediately release cytokines and cytotoxic granules to kill infected cells
(Cheroutre et al., 2011). These IELs typically express activation markers, such as CD44 and
CD69, as well as CD103 (also known as the αE integrin), which interacts with E-cadherin on
intestinal epithelial cells (Cepek et al., 1994; Kilshaw and Murant, 1990). Furthermore, most
IELs express effector cytokines, such as IFN-, IL-2, IL-4 or IL-17 (Cheroutre et al., 2011). IELs
are extremely heterogeneous with regard to their function and phenotype and are represented by
conventional and nonconventional T cell subsets. Many TCR-α IELs express CD8αα together
30
with CD4 or CD8α, however, a large fraction expresses CD8αα alone (Guy-Grand et al., 1991).
In contrast to TCR- T cells located in lymphoid tissues that predominantly lack CD8
expression, the vast majority of TCR- IELs express the CD8αα co-receptor (Leishman et al.,
2001; Pardigon et al., 2004).
Similar to IELs, LPLs are antigen-experienced T cells that mostly express TCR-α together with
one of the co-receptors, CD4 or CD8α. In the small intestine, LPLs express more CD8α
whereas LPLs of the large intestine is slightly skewed towards CD4 expression (Cheroutre and
Madakamutil, 2004). These LPLs also have unique characteristics that set them apart from the
conventional T cells (Kim et al., 1999; Masopust et al., 2001; Zeitz et al., 1991; Zeitz et al.,
1994). Together, the distinct nature and complexity of these IELs/LPLs is well suited for coping
with infections while simultaneously maintaining tolerance to innocuous antigens from the diet
or from non-invasive resident bacteria at the critical interface between the intestinal epithelial
barrier and the gut lumen.
1.4.2 Inflammatory Bowel Disease
Crohn’s disease (CD) and ulcerative colitis (UC) make up inflammatory bowel disease (IBD),
and these represent lifelong chronic, relapsing inflammatory conditions that can manifest as
disease restricted to the colonic mucosa in UC patients, or disease affecting the mucosa,
epithelium, and mucosal layer throughout the entire gastrointestinal tract in CD patients
(Baumgart and Sandborn, 2007). Although the etiology of IBD is not completely understood, it
is believed to involve genetic, immunological, environmental and microbial aspects (Kaser et al.,
2010). IBD have been intensively studied genetically, including genome-wide association studies
(GWAS). Indeed, recent GWAS reveal 99 unique IBD susceptibility associations, 71 for CD and
47 for UC (Anderson et al., 2011; Franke et al., 2010; Rivas et al., 2011; Van Limbergen et al.,
2011).
Among a number of NLR family members whose genes have been identified as susceptibility
loci for CD, Nod2 was the first identified susceptibility gene for CD within an IBD susceptibility
locus on chromosome 16 (Hugot et al., 2001; Ogura et al., 2001), and is the locus most strongly
linked to the disorder. A recent GWAS revealed five new rare variants of Nod2 (R311W, S431L,
R703C, N852S and M863V) at higher frequencies in CD patients versus controls and UC
31
patients, two of which displayed impaired localization to the membrane and MDP-driven NF-B
activation (Rivas et al., 2011). Unlike the results obtained for Nod2, studies that were conducted
to investigate the association of Nod1 polymorphism with IBD reported conflicting results
(Franke et al., 2006; Lu et al., 2010; McGovern et al., 2005; Van Limbergen et al., 2007).
The altered composition of the microbiota, also known as dysbiosis, is a hallmark of IBD. The
importance of the microbiota in IBD has been highlighted as several studies in human patients
with IBD have shown severely altered intestinal microbial community structure, compared to
healthy controls (Eckburg and Relman, 2007; Frank et al., 2007; Ott et al., 2004). Moreover, the
function of a number of genes associated with IBD could affect microbial community structure
and predispose to inflammation. Indeed, Nod2 was recently found to be an important regulator of
the commensal gut microbiota in mice (Petnicki-Ocwieja et al., 2009; Rehman et al., 2011).
Nod2-deficient mice display diminished bacterial killing ability, increased loads of commensal
bacteria and are less effective in preventing the colonization of pathogenic bacteria (Petnicki-
Ocwieja et al., 2009). Further, compared with wild-type mice, Nod2-deficient mice display
substantially elevated numbers of Firmicutes and Bacteroidetes, which are the two main
commensal phyla in the gut microbiota (Petnicki-Ocwieja et al., 2009; Rehman et al., 2011).
Interestingly, a similar shift in commensal phyla is observed in CD patients homozygous for the
Nod2 frameshift (FS) mutation (Rehman et al., 2011), in that these Nod2 FS CD patients had
increased abundance of the phyla Firmicutes and Bacteroidetes.
Dysbiosis in IBD has also been linked to the altered expression of Paneth cell defensins in
patients with CD in relation to Nod2 genotype. Nod2-deficient mice show a blunted production
of α-defensin in Paneth cells, suggesting that murine Nod2 is required for the intestinal
expression of antimicrobial peptides (Kobayashi et al., 2005). Consistent with these data, the
expression of α-defensin in Paneth cells is impaired in CD patients carrying the Nod2 mutation
(Wehkamp et al., 2004). The same group demonstrated that the reduced expression of the α-
defensin, HD5, was linked to the Nod2 FS mutation (Bevins et al., 2009; Wehkamp et al., 2005),
although this finding was challenged by another group (Simms et al., 2008). Despite the
controversy, these findings may suggest a possible mechanism by which the Nod2 mutation
affects the production of antimicrobial peptides in Paneth cells, thereby predisposing the host to
the development of the CD as a result of the colonization of aberrant microbiota.
32
1.4.3 Animal models of inflammatory bowel disease
Over the years, several animal models of colitis, including chemically induced models, and
bacterially induced models have been generated to study IBD. Although no animal model can
completely recreate the full spectrum of intestinal pathology observed in either CD or UC, these
models can exhibit some of the pathogenic hallmarks of IBD. The most commonly used
chemical models are the DSS and trinitrobenzene sulfonic acid (TNBS)-induced models, where
the chemical insult damages the epithelial layer leading to acute infiltration of inflammatory
cells. Two intestinal infection models, employing Citrobacter rodentium in normal mice and
Salmonella enterica serova Typhimurium in antibiotic-pretreated mice, have been widely used
over the last few years, because infections are robust, and cause significant intestinal
inflammation (Eckmann, 2006). The next section will provide some insights into the
streptomycin-treated Salmonella colitis model, which will also be covered in detail in Chapter 6.
1.4.3.1 Salmonella enterica serova Typhimurium
Salmonella is a Gram-negative bacterium in the family of the Enterobacteriaceae (Kaiser et al.,
2012). Although many different species exist, Salmonella are classified into two major groups:
Salmonella typhi is responsible for a systemic invasive disease (typhoid fever) in humans, and it
does not colonize mice by oral challenge. Non-typhoid Salmonella, such as Salmonella enterica
serovar Typhimurium, evokes nonsystemic gastroenteritis in humans and cattle, a diarrheal
disease characterized by acute neutrophilic intestinal inflammation (Eckmann, 2006). In contrast,
oral infection of mice with these bacteria causes no major intestinal disease, but rather systemic
infection resembling typhoid fever in humans (Santos et al., 2001). This colonization resistance
to Salmonella enteropathogenesis can be partly overcome by treating mice with an oral
antibiotic, such as streptomycin or kanamycin (Endt et al., 2010; Sekirov et al., 2008), before
oral infection with the organism engineered to become resistant to the particular antibiotic. The
antibiotics diminish the normal intestinal microbiota, likely allowing the inoculated Salmonella
to colonize the lumen of cecum and colon more effectively than without antibiotic conditioning.
Streptomycin treatment leads to a transient clearance of the normal intestinal microbiota (>10-
fold reduced in density and composition) (Stecher et al., 2007), allowing the orally inoculated
streptomycin-resistant Salmonella to colonize the cecum and colon (108 – 10
10 cfu/g stool)
effectively (Bohnhoff et al., 1964a, b). Consequently, Salmonella establishes intestinal infection,
which is accompanied by marked mucosal inflammation within the first day after oral infection.
33
Similar results have been obtained after infection of germ-free mice with S. typhimurium,
underlining the importance of the normal microbiota in limiting Salmonella-induced intestinal
inflammation in mice (Stecher et al., 2005).
Intestinal inflammation in this streptomycin-treated Salmonella mouse model is characterized by
rapid crypt loss, epithelial erosions and goblet cell loss, mucosal and submucosal infiltration with
acute inflammatory cells, particularly neutrophils, and marked edema, in the cecum and, to a
lesser degree, in the colon (Barthel et al., 2003; Coombes et al., 2005). This model has been
useful for dissecting both bacterial and host factors that modulate inflammation (Hapfelmeier
and Hardt, 2005), especially in the early (4-72h) intestinal events that occur after oral Salmonella
infection. For example, the adaptor protein MyD88, which is required for signaling through most
TLRs (Hapfelmeier et al., 2005), was shown to be important for inducing colitis after infection
with S. Typhimurium mutant strain lacking the Salmonella pathogenicity island 2 (SPI-2)-
encoded type III secretion systems (TTSS), but not those lacking the SPI-1 system (Hapfelmeier
et al., 2005). Previously, our group and others showed that host responses to Salmonella
infection are influenced by Nod1 and Nod2 (Hisamatsu et al., 2003; Le Bourhis et al., 2009)
although these reports did not provide in-depth analysis of the role of Nod1/Nod2 in mediating
inflammation during Salmonella colitis. Recently, a closer examination for a role of Nod1 and
Nod2 by our group revealed that mice lacking both Nod1 and Nod2 (Nod double knockout
(NodDKO)) have reduced cecal inflammation by histopathology and cytokine production,
coinciding with an increased bacterial burden (Geddes et al., 2010). Furthermore, Nod1 and
Nod2 signaling from both hematopoietic and nonhematopoietic cells contributed to the
inflammatory response to Salmonella infection. In agreement with our previous findings (Le
Bourhis et al., 2009), the authors also demonstrated that Rip2, the adaptor protein for both Nod1
and Nod2 signaling, was critical during infection with Salmonella cultured under SPI-2-inducing
conditions, but not SPI-1-inducing conditions. Thus, these findings support a role for Nod
proteins in the responses to infection with Salmonella enterica serova Typhimurium.
34
Chapter 2 Thesis Objectives
2
The goal of my thesis was to provide in depth examination of cellular or secreted innate immune
molecules that recognize bacterial peptidoglycan. An important part of the thesis focused on the
intracellular innate immune receptors, Nod1 and Nod2, with a closer look at their common
signaling component, Rip2, as well as at the mechanism by which Nod1 or Nod2 ligand enters
the epithelial cells. The objective for the last section was to examine the in vivo role of
PGLYRP2, a secreted peptidoglycan recognition protein, in a murine bacterial colitis model, and
further, investigate its relationship with Nod1 and Nod2 in this model.
My PhD thesis addressed three specific aims:
1. Investigate the role of Rip2, the common adaptor protein in Nod1 and Nod2 signaling, in
modulating adaptive immunity triggered by Nod1 and Nod2 ligands in vivo (Chapter 3).
2. Determine the entry mechanisms of Nod1 and Nod2 ligands into epithelial cells using in vitro
biochemical assays (Chapter 4). Further, design synthetically labeled muramyl peptides to track
their trafficking within cells by immunofluorescence (Chapter 5).
3. Determine the role of mouse peptidoglycan recognition protein, PGLYRP2, in the innate
immune response to Salmonella enterica serovar Typhimurium infection in vivo (Chapter 6).
35
Chapter 3 Essential Role of Rip2 in the modulation of innate and adaptive
immunity triggered by Nod1 and Nod2 ligands
This chapter was published as
Joao G. Magalhaes*, Jooeun Lee*, Kaoru Geddes, Stephen Rubino, Dana J. Philpott and
Stephen E. Girardin. Essential role of Rip2 in the modulation of innate and adaptive immunity
triggered by Nod1 and Nod2 ligands. European Journal of Immunology 2011; 41(5): 1445-55
* These authors contributed equally to the experimental design of this research and the writing of
the publication.
Contribution of Data
All experiments/analyses were performed by Jooeun Lee, unless noted otherwise;
Figure 3.1, Figure 3.4, and 3.6 – the quantitative data were provided by Joao G. Magalhaes.
36
3
3.1 Abstract
Muramyl peptides are the building blocks of bacterial peptidoglycan, and their biological
functions in mammals have been extensively studied. In particular, muramyl peptides trigger
inflammation, contribute to host defense against microbial infections, and modulate the adaptive
immune response to antigens. These bacterial molecules are detected by Nod1 and Nod2, and
recent evidence suggests that muramyl dipeptide also activates NLRP3 and NLRP1
inflammasomes. Here, we investigated the role of Rip2, the adaptor for Nod1- and Nod2-
dependent signalling, in multiple aspects of the host response to muramyl peptides in vivo, such
as inflammatory cytokine secretion, activation and recruitment of macrophages and neutrophils
to the site of injection, systemic activation of myeloid, T and B cells in the spleen, adjuvanticity
and capacity to polarize the adaptive response to ovalbumin. Our results demonstrate that Rip2
was crucial for all the biological functions studied. We also identified CD11cint
CD11b+
inflammatory dendritic cells as a major myeloid cell population responding to Nod stimulation in
vivo. Together, our results highlight the importance of Rip2 for Nod-dependent induction of
innate and adaptive immunity.
3.2 Introduction
The innate immune system plays a crucial role in host defense against invading pathogens, and
relies on pattern recognition molecules (PRMs), which detect conserved microbial- and danger-
associated molecular patterns (MAMPs or DAMPs). The best studied PRMs are the Toll-like
receptors (TLRs), which localize either at the cell surface or within endosomes. More recently,
intracellular cytosolic PRMs, such as the nucleotide oligomerization domain (Nod)-like receptors
(NLRs) and the retinoic acid-inducible gene I (RIG-I)-like receptors (RLRs), have been
identified.
Nod1 and Nod2 are NLR proteins that trigger nuclear factor-B (NF-B) signalling in response
to bacterial peptidoglycan. Specifically, Nod1 recognizes muramyl peptides containing meso-
DAP (diaminopimelic acid) found in the peptidoglycan of most gram-negative bacteria and
certain gram-positive bacteria (Chamaillard et al., 2003; Girardin et al., 2003a), whereas Nod2
recognizes muramyl dipeptide (MDP) produced in all bacteria (Girardin et al., 2003b; Girardin et
37
al., 2003c). Upon peptidoglycan detection, Nod1 and Nod2 recruit and associate with the adaptor
protein Rip2, triggering pro-inflammatory pathways such as NF-B and the mitogen-activated
protein (MAP) kinases p38, JNK and ERK (Inohara et al., 2000; Kobayashi et al., 2002).
Importantly, mutations in Nod2 are associated with increased risk to develop Crohn’s disease
(Hugot et al., 2001; Ogura et al., 2001), an inflammatory disorder that affects the gastro-
intestinal tract.
The role of Nod1 and Nod2 in innate immunity has been extensively studied. Various epithelial
cell lines have been shown to produce antimicrobial peptides following Nod1 (Sugawara et al.,
2006) and Nod2 (Uehara et al., 2007) stimulation in vitro. Nod1 and Nod2 play a key role in the
induction of antimicrobial peptides following infection with Helicobacter pylori, and Listeria
monocytogenes (Boughan et al., 2006; Kobayashi et al., 2005). Moreover, Nod1 and Nod2
induce the production of nitric oxide, a molecule that is known to be directly microbicidal
(Magalhaes et al., 2005; Park et al., 2007b; Totemeyer et al., 2006). Activation of Nod1 and
Nod2 by live bacteria triggers pro-inflammatory responses leading to the induction of cytokine
and chemokines (Opitz et al., 2005; Opitz et al., 2006). Using Nod-deficient mice, several in
vivo studies have demonstrated a key role for Nod1 and Nod2 in host defence against pathogens
such as H. pylori, L. monocytogenes, and Staphylococcus aureus (Hruz et al., 2009; Kobayashi et
al., 2005; Viala et al., 2004).
In addition to contributing to innate immunity, Nod1 and Nod2 have been implicated in the
induction of adaptive immune responses. Over two decades ago, pioneer studies already
demonstrated that MDP and peptides containing DAP modulate adaptive immune responses to
antigens by acting as a potent adjuvants (Adam et al., 1974; Kotani et al., 1975). The adjuvant
activity of MDP was later found to be mediated via Nod2, since potentiation of the IgG response
to ovalbumin (OVA) by MDP was abrogated in Nod2-deficient mice (Kobayashi et al., 2005).
Moreover, recent studies by our group have shown that in vivo stimulation with Nod1 or Nod2
ligands results in a Th2-dependent antigen-specific adaptive immunity (Fritz et al., 2006;
Magalhaes et al., 2008), providing further evidence of the role of these NLR proteins in adaptive
immunity.
Rip2 was originally identified as a protein implicated in NF-B activation and apoptosis
induction (Inohara et al., 1998; McCarthy et al., 1998; Thome et al., 1998). Biochemical analyses
38
further demonstrated that Rip2 acts as an adaptor protein downstream of Nod1 and Nod2
(Inohara et al., 1999; Inohara et al., 2000). Initial studies using Rip2-deficient mice suggested
that Rip2 was implicated in the responses to TLR ligands, as well as to Nod1 and Nod2 over-
expression (Chin et al., 2002; Kobayashi et al., 2002; Lu et al., 2005). However, these initial
observations linking Rip2 to TLR signalling have been strongly refuted by the use of
backcrossed Rip2−/−
mice. It is now clear, as demonstrated Park et al. that Rip2 deficiency affects
cellular signalling and cytokine responses triggered by Nod1 and Nod2 ligands, but not TLR
ligands (Park et al., 2007a).
While the role of Rip2 in mediating Nod1- and Nod2-dependent inflammatory signalling is clear,
the implication of this adaptor protein in adaptive immunity is poorly understood. The two initial
reports on Rip2−/−
mice mentioned above suggested that these mice had intrinsic defective Th1
immune responses and that Rip2 was required for optimal activation of NF-B and T cell
proliferation upon TCR stimulation (Chin et al., 2002; Kobayashi et al., 2002). Rip2 was shown
to associate with Bcl10, a signaling molecule of the TCR-induced NF-B pathway, after T cell
stimulation (Ruefli-Brasse et al., 2004). The same group also reported a delayed allograft
rejection of neonatal heart tissue in Rip2-deficient mice, suggesting impaired adaptive immunity
in the absence of Rip2 (Ruefli-Brasse et al., 2004). More recently, using fully backcrossed
animals, other reports failed to identify intrinsic defects of the adaptive immune system in Rip2-
deficient mice (Hall et al., 2008; Nembrini et al., 2008). Consistent with these results, Rip2 was
recently found to be dispensable for the induction of an effective type 1 immune response during
Toxoplasma gondii infection (Shaw et al., 2009). Moreover, using a vascularized transplant
model, Fairhead et al. also reported that Rip2-deficient mice were fully able to mount Th1-
mediated alloresponses to reject vascularized allografts (Fairhead et al., 2008).
Two recent reports have also provided evidence that Nod signaling could occur in a Rip2-
independent manner. First, Shaw et al. observed that Nod2, but not Rip2, was involved in host
defense to intraperitoneal challenge with Toxoplasma gondii, through a mechanism involving
CD4+ T cells (Shaw et al., 2009). Second, Travassos et al. demonstrated that Nod-dependent
induction of bacterial autophagy was Rip2-independent, and required direct interaction between
Nod proteins and the autophagy protein ATG16L1 (Travassos et al., 2010). In addition, several
lines of evidence indicate that MDP is also detected by NLRP3 and NLRP1, resulting in Rip2-
independent activation of caspase-1 inflammasomes (Hsu et al., 2008; Martinon et al., 2004).
39
Therefore, considering the debatable role of Rip2 in adaptive immunity and the emerging
concept that Nod-dependent or muramyl peptides-dependent pathways could be Rip2-
independent, we sought to investigate, using in vivo models, the role of Rip2 in innate and
adaptive immunity to the Nod1- and Nod2-activating muramyl peptides FK156 and MDP,
respectively. Our results establish that Rip2 is absolutely required for all aspects of the
inflammatory, innate and adaptive immune functions of muramyl peptides that we analyzed.
3.3 Materials and Methods
Mice
All animal experiments were approved by the Animal Ethics Review Committee of the
University of Toronto. C57BL/6 mice were purchased from Charles River Laboratories
(Wilmington, MA). Rip2-deficient mice were obtained from Dr. Flavell, Yale University school
of Medicine, and have been backcrossed thirteen times to C57BL/6 background. The animals
were submitted to sanitary control tests and used at the age of 6–8 weeks. All animal
experiments were performed according to local guidelines.
Reagents
MDP was purchased from EMD Biosciences (San Diego, CA) and synthetic FK156 (D-lactyl-L-
Ala-g-D-Glu-meso-DAP-Gly) was obtained from Fujisawa Inc. (Japan). Specificity and purity of
MDP, and FK156 were ensured as previously described (Magalhaes et al., 2005). Ovalbumin
was purchased from Worthington-Biochemical Corporation (Lakewood, NJ), and the purity was
ensured as recently reported (Fritz et al., 2007). Alum was obtained from Thermo Scientific
(Waltham, MA) and ultrapure LPS was purchased from InvivoGen (San Diego, CA). Beside
Alum and LPS, all reagents were free of endotoxin as determined by the Limulus Amebocyte
Lysate Test (BioWhittaker).
Cytokine and chemokines dosage
Enzyme-linked immunosorbent assay (ELISA) for KC, MCP-1, and IL-6 were carried out
according to the manufacturer's recommendations (Duoset R&D Systems, Minneapolis, MN)
40
FK156 and MDP injection. For analysis of cytokine and chemokine responses, C57BL/6 (WT)
or RIP2−/−
mice (6–8 weeks old) were injected intraperitoneal (i.p.) with endotoxin-free 1X PBS
as a control, MDP, FK156 (both at 50µg in 100 µl per mouse diluted with endotoxin-free 1X
PBS) or LPS (1μg in 100μl per mouse). At indicated time points, blood was collected at the tail
vein (100 μl per sample), and serum was isolated from blood after coagulation (2h at RT) and
centrifugation (10000rpm, 5 minutes). Subsequently, serum cytokines/chemokines were
measured by standard ELISA procedures.
Cell activation and recruitment
Mice were injected with PBS, FK156 or MDP at 50µg/100µl/mouse i.p. and 24h after injection
cell from the PC and spleen were isolated for recruitment and activation. For the isolation of PC
cells, 5 ml of PBS-EDTA (0.5mM) was injected in the PC and the content was removed to
collect intraperitoneal cells. Spleens were cut in small pieces, digested first with collagenase D
(1mg/ml) and DNase I (200g/ml) in RPMI supplemented with 2 mM L-glutamine, 1 mM
sodium pyruvate, 1x non-essential amino acids and 50 mM β-mercaptoethanol (all purchased
from Invitrogen) and 10% fetal calf serum (Hyclone) for 30 minutes at 37ºC, and then passed
through a 100m cell strainer. To remove red blood cells (RBC), each spleen was incubated with
1ml of RBC buffer (Sigma) for 5 minutes to lyse RBC. Cells were then washed with PBS, and
spun twice to remove residual RBC buffer. Isolated splenocytes were used for FACS analysis.
Flow cytometry
Flow cytometry was performed as described previously (Fritz et al., 2007; Magalhaes et al.,
2005). Briefly, single cell suspension were resuspended in FACS buffer (1x PBS containing
0.5% FCS, 0.05% sodium azide) and incubated with Mouse BD Fc Block™ purified anti-mouse
CD16/CD32 mAb 2.4G2 (BD Biosciences, Mississauga, ON,) to block unspecific staining.
Subsequently, the cells were incubated with antibodies obtained from BD Biosciences:
Fluorescein isothiocyanate (FITC)-labelled antibodies for CD19, CD11b, NK1.1, CD4; biotin-
labeled antibodies specific for CD69, MHC class II; phycoerythrin-(PE)-labelled antibodies
specific for CD8, F4/80, CD62L, CD44, CD40; PerCP-Cy5.5-labelled antibodies specific for
CD69; allophycocyanin-(APC)-labelled antibodies specific for TCR, CD11c, CD86 and APC-
Cy7 Gr1 and matching isotype controls were used during staining. After staining, cells were
41
washed twice with FACS buffer and analyzed by FACS (FACSCalibur™ flow cytometer, BD
Biosciences). FlowJoTM
software was used for the analysis of the results. Data were collected on
approximately 100,000 cells.
Induction and analysis of antigen-specific T- and B-cell response
For B-cell Ag-specific response, mice were immunized in a prime-boost protocol at day 0 and
day 21, intraperitoneally with a mixture of OVA (50 µg/mouse) and adjuvant (MDP, FK156
(50µg/100µl/mouse) and Alum (1:1 ratio with OVA)) in a final volume of 100 µl sterile
endotoxin-free PBS. Blood from tail veins was collected at 21 days after the prime and 14 days
after the boost immunization (35 days after the prime), and sera of individual mice were
analyzed. For T-cell-specific response, 10 days after immunizations, splenocytes of
immunization groups were re-stimulated ex vivo, and ELISPOT analysis were performed.
ELISPOT
Multiscreen plates (S2EM004M99 IL-4 and IL-5; Millipore, MA, USA) were coated (100
µl/well) with capture antibodies (IL-4 [clone: 11B11] at 2 mg/ml; IL-5 [clone: TRFK5] at 2
mg/ml; all purchased from Becton Dickinson, Mississauga, ON) and the assay was carried out as
described previously (Fritz et al., 2007; Magalhaes et al., 2008). Results are expressed as the
number of IL-4-, or IL-5-producing cells per 106 splenocytes ± standard deviation of duplicates.
Analysis of B-Cell Responses
Ig isotypes were analyzed by sandwich ELISA comparing serially diluted serum samples with an
assay-intrinsic isotype-specific standard (capture Ab: goat anti-mouse Ig (H+L) was purchased
from SouthernBiotech; IgG1 standard (15H6) was obtained from SouthernBiotech and IgG2c
was obtained from Bethyl Laboratories Inc. (Montgomery, TX). Finally, biotinylated detection
Abs for IgG1 and IgG2c were purchased from SouthernBiotech. For analysis of Ag-specific Ig
isotypes against OVA, plates were coated with 10 µg/ml OVA in PBS in 0.1 M NaHCO3
(pH.9.5). ELISAs were performed by coating standard Ig capture antibodies or the OVA antigen
to 96-well plates (MaxiSorp; Nalgene Nunc, Rochester, NY). After washing and incubation with
the isotype-control Abs for the standard or the serially diluted serum samples, the detection was
performed by sequential incubation with biotinylated secondary Abs, HRP-conjugated
42
streptavidin (R&D Systems), and TMB (Sigma-Aldrich). The reaction was stopped with 2
NH2SO4 (Sigma-Aldrich) and absorbance was read at 450 nm using a victor plate reader (Perkin
Elmer).
Statistical analysis
The results are given as mean ± standard error of the mean (SEM) with the exception of
ELISPOT. Statistical analysis was performed with Graphpad Prism 5 software using a Mann-
Whitney test; p<0.05 was considered significant.
3.4 Results
Rip2 is required for Nod1- and Nod2-induced inflammation in vivo
We first demonstrated that Rip2-deficient (Rip2 KO) and WT mice displayed similar numbers
and proportions of the major immune cells (macrophages, neutrophils, conventional dendritic
cells (DCs), B cells, naive and activated T cells, natural killer and natural killer T cells) in the
peritoneal cavity (PC) and spleen (Figure 3.1). To assess the contribution of Rip2 to Nod-
mediated inflammation in vivo, cytokine and chemokine levels in the serum were measured by
ELISA following a 2h, 6h or 24h i.p. injection of WT and Rip2-deficient mice with PBS, FK156,
or MDP. Injection of the Nod1 agonist, FK156, into WT mice resulted in a transient release of
proinflammatory mediators, KC and IL-6, in the bloodstream peaking at 2h, while returning to
nearly steady-state levels 24h after injection as previously shown (Magalhaes et al., 2005)
(Figure 3.2A). This response was Rip2-mediated, since these cytokines were not detected in the
serum of Rip2 KO mice (Figure 3.2A). Similarly, the Nod2 agonist MDP induced KC and IL-6
release in the serum of WT mice at 2h, whereas this response was again abrogated in Rip2-
deficient mice (Figure 3.2A). In addition, FK156 and MDP induced a Rip2-dependent release of
the pro-T helper 2 (Th2) chemokine MCP-1 in the serum of WT mice 2 and 6h following
injection (Figure 3.2B). To demonstrate there is no intrinsic defect of Rip2 KO mice in mounting
inflammatory responses in vivo, we also injected LPS into both WT and Rip2 mice to stimulate
the TLR4 pathway, and found no difference in the production of cytokines (Figure 3.2A and
3.2B). Together, these results demonstrate that the release of both pro-inflammatory and pro-Th2
chemokines following intra-peritoneal stimulation with Nod ligands was fully Rip2-dependent.
43
Figure 3.1. Comparison of cell populations of WT and Rip2/
mice.
Macrophage and neutrophil population from the PC of WT and Rip2/
mice were stained with
(A) antibodies specific for F4/80 and Gr1 and were analyzed by flow cytometry. Splenocytes
from WT and Rip2−/−
mice were stained with antibodies specific for (B) conventional DC
population MHCII+CD11c
hi, (C) B cell population CD19
+MHCII
+, (D) Naive T cell
(CD62L+CD44
), activated T cell (CD62L
+CD44
+) and effector memory T cell
(CD62LCD44
+), (E) NK (NK1.1
+), NKT (NK1.1
lowTCR
+) and T cell (TCR
+) and (F) CD4
and CD8 T cell population. The data are represented as the mean ± SEM of 3 independent
experiments (n=4-6).
44
Figure 3.2. Rip2 is required for Nod1- and Nod2-induced inflammation in vivo.
C57BL/6 (WT) or Rip2−/−
mice were injected i.p. with endotoxin-free PBS, FK156
(50µg/100µl/mouse), MDP (50µg/100µl/mouse) or LPS (1μg/100μl/mouse). At 2, 6 and 24h
post-injection, (A) inflammatory cytokines (KC and IL-6) and (B) pro-Th2 mediators (MCP-1)
were measured in the serum of those mice by ELISA. Data are represented as the means ± SEM
of three independent experiments (n=8-10). Significant differences between groups are indicated.
* p<0.05 using a Mann-Whitney test.
45
Rip2 is required for macrophage activation and neutrophil recruitment in vivo upon Nod1 and
Nod2 activation
It has been previously demonstrated that Nod1 activation in vivo leads to macrophage activation
and neutrophil recruitment (Magalhaes et al., 2005; Masumoto et al., 2006). However, the
implication of Rip2 in the process is not defined. To this end, WT and Rip2-deficient mice were
injected i.p. with Nod1 and Nod2 agonists and the activation of macrophages and the recruitment
of neutrophils were analyzed by flow cytometry 24h post-injection. We observed that the total
numbers of macrophages in the peritoneal cavity did not change upon Nod ligand stimulation,
and were comparable between WT and Rip2-deficient mice injected with FK156 and MDP
(Figure 3.3A). However, MDP and FK156 both triggered the activation of WT but not Rip2 KO
peritoneal macrophages, as observed by flow cytometry using the surface marker MHC class II,
whose cell surface expression increases in activated macrophages (Figure 3.3B). Next, the
numbers of neutrophils (Gr1+CD11b
+) were measured in the PC (Figure 3.3C) and spleen
(Figure 3.3D) of WT and Rip2-deficient mice following ligand stimulation. A significant amount
of neutrophils were recruited to the PC and the spleen of WT mice but not Rip2 KO mice
following stimulation with Nod ligands (Figure 3.3C and D). Therefore, our results demonstrate
that Rip2 plays a crucial role in the activation of inflammatory cells triggered by Nod1 and Nod2
ligands in vivo.
46
Figure 3.3. Rip2 is required for macrophage activation and neutrophil recruitment upon
Nod1 and Nod2 activation in vivo.
C57BL/6 (WT) or Rip2−/−
mice were injected i.p. with endotoxin-free PBS, FK156 or MDP at
50µg/100µl/mouse. At 24h post-injection, cells from PC and spleen were isolated, counted, and
analysed by flow cytometry. (A) Total cell numbers of macrophages (CD11b+F4/80
+) present in
the PC were evaluated in each condition. (B) Mean fluorescence intensity (MFI) of cell-surface
expression of major histocompatibility complex II (MHC II) on macrophage population present
in the PC. (C, D) Total cell numbers of neutrophils (CD11b+Gr1
+) present in the PC (C) and in
the spleen (D) were evaluated in each condition. Data are represented as the means ± SEM of
two independent experiments (n=4-6). Significant differences between groups are indicated. *
p<0.05 using a Mann-Whitney test.
47
Rip2 modulates the activation of CD11cint
CD11b+ dendritic cells in the spleen upon Nod1/2
activation
We next aimed to identify the role of Rip2 in the activation of splenic antigen-presenting cells
(APCs) by i.p.-injected Nod1 and Nod2 ligands. Splenocytes from WT and Rip2-deficient mice
injected with PBS, FK156 or MDP were isolated after 24h, and stained with antibodies to
CD11c, CD8 and CD11b. Using flow cytometry, cells were gated to identify
macrophages/neutrophils/monocytes (CD11b+CD11c
gate R1), inflammatory CD11c
intCD11b
+
dendritic cells (gate R2) and conventional DCs, CD11chi
(gate R3) (Figure 3.4A). The
conventional DCs, CD11chi
, were further classified as CD8+DCs (gate R4) and CD8
DCs (gate
R5) (Figure 3.4A). We first noticed that i.p. injection of Nod1 and Nod2 ligands did not modify
the numbers of CD11b+ CD11c
Gr1
macrophages (data not shown) and CD11c
hi cells (Figure
3.4B and C) in both WT and Rip2 KO mice. Interestingly, we observed in contrast that the
numbers of CD11cint
CD11b+ DCs in the spleen of WT but not Rip2-deficient mice strongly
increased following injection with FK156 (1.49% ± 0.20) and MDP (1.09% ± 0.10) compared to
the PBS control (0.66% ± 0.16) (Figure 3.4B and C). This result is of particular interest, given
the fact that CD11cint
CD11b+ DCs have been implicated in several aspects of inflammation and
host defense following bacterial infection (see Discussion).
The cell-surface expression of the co-stimulatory molecules CD40 and CD86 is up-regulated on
APCs following activation and maturation of these cells (Rydstrom and Wick, 2007; Sundquist
and Wick, 2005). We observed that the R2-gated CD11cint
CD11b+ population of inflammatory
DCs displayed up-regulated expression of CD40 and CD86 in WT mice following FK156 and
MDP stimulation, whereas this response was absent in Rip2-deficient mice (Figure 3.4DG). On
the contrary, no significant change in the expression of CD40 and CD86 in conventional DCs
(CD11chi
CD8+CD11b
and CD11c
hiCD8
CD11b
+) was observed in the spleen of WT or Rip2-
deficient mice i.p. injected with Nod1 and Nod2 ligands (Figure3.4DG). Overall, we describe
here for the first time that Nod1 and Nod2 ligands trigger the recruitment and the activation of
CD11cint
CD11b+ inflammatory DCs in vivo and further demonstrate that this process is
dependent on Rip2.
48
49
Figure 3.4. Rip2 modulates the frequency and the activation of CD11cint
CD11b+ cells in the
spleen upon Nod1 and Nod2 activation.
C57BL/6 (WT) or Rip2−/−
mice were injected i.p. with endotoxin-free PBS, FK156 or MDP at
50µg/100µl/mouse. 24h post-injection spleen cells were stained with Abs to CD11c, CD8 and
CD11b. (A) Representative dot plots from WT splenocytes are shown here with different
gatings. The R1 gate (CD11b+CD11c
) represents monocytes/macrophages and neutrophils, the
R2 gate contains the inflammatory CD11cint
CD11b+ DCs and the R3 gate (CD11c
hi) shows
conventional DCs. The conventional DC subsets were further identified as gate R4
CD11chi
CD11bCD8
+ (CD8
+ DCs) and gate R5 CD11c
hiCD11b
+CD8
(CD8
DCs containing
CD4+ and CD4
populations). (B) The frequencies of inflammatory CD11c
intCD11b
+ DCs are
shown in the dot plots at 24h post-injection. (C) The absolute number of R2, R4 and R5
populations in the spleen of C57BL/6 and Rip2−/−
mice at 24h post-injection. (D and F)
Expression of CD40 and CD86 co-stimulatory molecules on R2, R4 and R5 populations isolated
from the spleen of C57BL/6 or Rip2−/−
mice at 24h after i.p. injection of endotoxin-free PBS,
FK156 or MDP at 50µg/100µl/mouse. (E and G) MFI of cell-surface expression of CD40 and
CD86 on R2, R4 and R5 populations. Isotype controls are shown in (DG). For all panels, data
are represented as the means ± SEM of three to four independent experiments (n=810).
Significant differences between groups are indicated. * p<0.05 using a Mann-Whitney test.
50
Rip2 modulates the activation of T and B cells in the spleen upon Nod1 and Nod2 activation
FK156 has been shown to have a costimulatory signal after TCR engagement by increasing the
capacity of T cells to proliferate following concanavalin A (ConA) stimulation in vitro (Weston
et al., 1991). Another report described similar results by showing that intestinal T cells,
restimulated in vitro with phytohaemagglutinin or ConA, displayed increased proliferation in
mice that had received MDP intragastrically compared with vehicle control (Zunic et al., 1996).
Here, we examined whether i.p. injection of FK156 or MDP could activate splenic T cells in
vivo, using the CD69 activation marker and whether this process was dependent on Rip2. Flow
cytometry data showed a significant upregulation of CD69 cell-surface expression on WT
splenic T cells following i.p. injection with FK156, and this response was abrogated in Rip2-
deficient mice (Figure 3.5A). Moreover, we further showed that FK156 injection resulted in the
activation of both CD4+ and CD8
+ splenic T cells, thus showing that the activation was not
restricted to a particular type of T cells (Figure 3.6). On the contrary, i.p.-injected MDP failed to
stimulate splenic T cells in vivo (Figures 3.5A and 3.6). Interestingly, FK156 and MDP induced
strong activation of CD19+CD69
+ B cells in the spleen of WT but not Rip2-deficient mice
(Figure 3.5B). In addition, we observed a significant increase in B-cell numbers in the spleen of
WT mice but not of Rip2-deficient mice injected with FK156 and MDP, whereas T-cell numbers
appeared to remain constant (Figure 3.5C). In conclusion, our results demonstrate that Nod1 and
Nod2 ligands trigger a systemic response that results in splenic lymphocyte recruitment and
activation, and that these responses are dependent on Rip2.
51
Figure 3.5. Rip2 modulates the activation of T and B cells in the spleen upon Nod1 and
Nod2 activation.
C57BL/6 (WT) and Rip2−/−
mice were injected i.p. with FK156, MDP, or PBS as a control. After
24h, splenocytes were isolated, stained with markers for T cell (TCR) and B cell (CD19) and
analyzed by flow cytometry. The frequencies of activated (A) T cell (TCR+CD62L
+CD69
+) and
(B) B cell (CD19+CD69
+) are shown in the dot plots at 24h post-injection. (C) The absolute
number of activated T- and B-cell populations in the spleen of C57BL/6 and Rip2−/−
mice at 24h
post-injection. For all panels, data shown are represented as the means ± SEM of three
independent experiments (n=6-8). Significant differences between groups are indicated. * p<0.05
using a Mann-Whitney test.
52
Figure 3.6. Rip2 modulates the activation of CD4+ and CD8
+ T cells in the spleen upon
Nod1 and Nod2 activation.
C57BL/6 (WT) and Rip2−/−
mice were injected i.p. with FK156, MDP, or PBS as a control. After
24h, splenocytes were isolated and stained with markers for CD4 T cell (TCR+CD4
+) and CD8
T cell (TCR+CD8
+)) and analysis by flow cytometry. The frequencies of activated (A) CD4 T
cell (TCR+CD4
+CD69
+) and (B) CD8 T cell (TCR
+CD8
+CD69
+) are shown in the dot plots at
24h post-injection. The data are represented as the mean ± SEM of two independent experiments
(n=45). The asterisk indicates statistically significant differences (p<0.05) using a Mann-
Whitney test.
53
Rip2 is essential for Nod1- and Nod2-induced Th2 immunity
Our recent findings show that Nod1 and Nod2 activation drives a Th2-biased immune response
(Fritz et al., 2007; Magalhaes et al., 2008). To determine if Rip2 was required for the induction
of antigen (Ag)-specific Th2 immune response upon Nod1 and Nod2 activation, we immunized
WT and Rip2-deficient mice i.p. with OVA plus FK156 or MDP, used as a adjuvant. Compared
with the effect of immunizations with OVA only, WT mice given a mixture of OVA plus FK156
or OVA plus MDP elicited markedly higher numbers of IL-4- and IL-5-producing splenocytes
upon restimulation with OVA protein (Figure 3.7A), confirming our previous results (Fritz et al.,
2007; Magalhaes et al., 2008). Importantly, the Th2 response elicited upon coinjection of OVA
plus FK156 or OVA plus MDP was strictly Rip2-dependent, as no significant production of Ag-
specific IL-4- and IL-5-producing cells over background levels could be detected in Rip2-
deficient mice (Figure 3.7A). Moreover, analysis of the B-cell population revealed that in WT
mice, OVA-specific Ig, IgG1, was predominantly induced after immunizations with FK156 or
MDP, whereas the induction of IgG1 was abrogated in Rip2-deficient animals (Figure 3.7B). As
a control, both WT and Rip2-deficient mice were injected with OVA or OVA plus aluminum
hydroxide (Alum), a strong Th2-inducing adjuvant, which showed equivalent IgG1 production in
these mice (Figure 3.7C). Our results therefore show that FK156 and MDP elicit priming of Th
cell immune responses with a Th2 polarization profile and subsequent IgG1 production in a
Rip2-dependent manner. In summary, we demonstrated that Rip2 is required and critical for
Nod1- and Nod2-driven Th2 immunity in vivo.
54
Figure 3.7. Rip2 is essential for Nod1- and Nod2-induced Th2 immunity.
(A) WT or Rip2−/−
mouse were injected i.p. with OVA, OVA+FK156 or OVA+MDP. Ten days
after immunization, splenocytes from immunized animals were restimulated ex vivo with
medium or OVA. The frequencies of OVA-specific producing IL-4 or IL-5 per million
splenocytes were determined by ELISPOT analysis. A prime-boost immunizations (day 0 and
day 21, respectively) protocol was carried out on WT or Rip2−/−
injected i.p. with (B) OVA,
OVA+FK156 or OVA+MDP and (C) OVA or OVA+Alum. Serum of each animal was taken on
day 21 (prime) and day 35 (boost), and OVA-specific IgG1 was analyzed by ELISA. Data shown
are representative of three independent experiments for both (A) and (B). The bar represents the
means ± SEM of each cohort (n=23 for (A), n=34 for (B) and n=23 for (C)). The asterisk
indicates statistically significant differences (p<0.05) using a Mann-Whitney test.
55
3.5 Discussion
In this study, we aimed to analyze in detail the contribution of Rip2 to the immune responses
triggered by the Nod ligands FK156 and MDP in vivo. To this end, we investigated in WT and
Rip2-deficient mice a number of host responses to these bacterial molecules: inflammatory
cytokine secretion; activation and recruitment of macrophages and neutrophils to the site of
injection; systemic activation of APCs, T and B cells in the spleen; adjuvanticity; and capacity to
polarize the adaptive response to OVA. Strikingly, we demonstrated that all aspects of the
immune response to FK156 and MDP studied here were fully Rip2-dependent. In addition, our
results also identified CD11cint
CD11b+ inflammatory monocytes as a major myeloid cell
population responding to Nod stimulation in vivo, again in a fully Rip2-dependent manner.
Rip2 is an adaptor protein of Nod1- and Nod2-dependent signalling, which was initially shown
by biochemical analyses to bridge Nod proteins to the IB kinase (IKK) complex, leading to NF-
B activation (Inohara et al., 2000). Recent results in Rip2-deficient mice further established that
Rip2 played a critical role not only in NF-B, but also in mitogen-activated protein kinase
signalling, in macrophages stimulated with Nod ligands, which correlated with an absolute
requirement for Rip2 in mediating inflammatory cytokine secretion following in vivo injection of
Nod1 ligands (Kobayashi et al., 2002). However, recent evidence suggests that Nod-dependent
but Rip2-independent signalling also exists. Indeed, Nod-dependent induction of autophagy was
shown to occur in Rip2-deficient cells, and this involves the direct recruitment of the autophagy
protein ATG16L1 to the activated Nod complex (Travassos et al., 2010). Moreover, host
response to T. gondii infection requires Nod2 and not Rip2, and this seems to be associated with
the induction of Nod2-dependent and Rip2-independent pathway in the CD4+ T cells of infected
mice (Shaw et al., 2009). Therefore, and because autophagy and T-cell signalling are both crucial
elements of the immune response, we aimed to identify if specific aspects of the host response to
the muramyl peptides FK156 and MDP could occur in Rip2-deficient mice. Our data establish
that Rip2-independent pathways, including the ones discussed above, do not significantly
contribute to the modulation of immune responses triggered by the Nod ligands FK156 and
MDP.
The host NLR proteins Nod1 and Nod2 play key roles in the host response to muramyl peptides.
However, several lines of evidence suggest that MDP can also trigger NLRP3- and NLRP1-
56
dependent activation of caspase-1 inflammasomes, resulting in the induction of IL-1 and IL-18
secretion (Hsu et al., 2008; Martinon et al., 2004). Importantly, these two cytokines control
numerous aspects of innate and adaptive immunity, and inflammasome induction is believed to
occur in a Rip2-independent manner. Therefore, an interesting possibility is that muramyl
peptide-triggered inflammasome signalling could still occur in Rip2 KO mice, and participate in
the host immune response to these bacterial molecules. In agreement with this idea is the fact
that full MDP-induced IL-1 secretion has been shown to require NLRP3 (Martinon et al.,
2004). Our data, however, failed to identify Rip2-independent roles for the muramyl peptides
FK156 and MDP in immune regulation. This suggests that MDP-triggered NLRP3 or NLRP1
signalling is not, in itself, sufficient to significantly contribute to innate or adaptive immune
responses to this muramyl peptide. It remains possible, however, that both Rip2- and NLRP-
dependent signalling could cooperate to generate a full-blown host immune response to muramyl
peptides. This interesting possibility could not be tested in Rip2 KO mice only, and awaits
further studies in NLRP3- and NLRP1-deficient mice.
An unexpected result from our studies was the discovery of a specific cell population of the
myeloid lineage, the CD11cint
CD11b+ inflammatory cells, that was recruited and activated in the
spleen of animals i.p. injected with Nod1 and Nod2 ligands, whereas macrophages and
conventional DCs populations were not. Previous studies have identified that these cells have
phenotypic characteristics of both macrophages and DCs, that they are recruited and activated in
inflammatory conditions in both draining lymph nodes and the spleen, and play a role in host
defense against bacterial pathogens, including Salmonella (Sundquist and Wick, 2005, 2009).
Interestingly, these CD11cint
CD11b+ inflammatory cells, also known as inflammatory
monocytes, are likely to be equivalent to the TNF/iNOS-producing DCs (Tip-DCs), originally
described by the group of Pamer (Serbina et al., 2003). Indeed, while studying the host response
to systemic Listeria infection, Serbina et al. observed that Listeria infection triggered the CCR2-
dependent recruitment and activation of TNF- and iNOS-producing myeloid cells into the spleen
of infected animals. These cells were the major source of TNF and iNOS in the spleen following
infection, and therefore were critical for host resistance to this bacterial pathogen. Interestingly,
the authors also demonstrated that the recruitment of Tip-DCs to the spleen occurred in a
MyD88-independent manner, but required secretion of MCP-1 and the expression of the
chemokine receptor CCR2. Moreover, they showed that these events required the cytosolic
57
escape of the bacterium, thus suggesting that cytosolic PRMs likely contribute to their
recruitment into the spleen. Therefore, our results fully support these original observations, by
showing that the intracellular PRM proteins Nod1 and Nod2 trigger MCP-1 secretion and play a
key role in the splenic recruitment and activation of cells that share phenotypic characteristics
with Tip-DCs. Further study is required to demonstrate that the CD11cint
CD11b+ inflammatory
cells identified here in the spleen of mice injected with Nod ligands indeed produce TNF and
iNOS, and that they are recruited in a CCR2-dependent manner.
In summary, our work highlights the critical role played by the adaptor molecule Rip2 in all
aspects of the immune response to Nod1 and Nod2 ligands. These observations imply that
recently identified Nod- or muramyl peptide-triggered Rip2-independent pathways do not
significantly contribute, on their own, to the immune response to these bacterial molecules.
Further study is needed to decipher how Nod1 and Nod2, which both rely extensively on the
same downstream adaptor protein, can nonetheless trigger nonoverlapping functions, as
illustrated, for instance, by the implication of Nod2 mutations in Crohn’s disease.
58
Chapter 4 pH-dependent Internalization of Muramyl Peptides from Early
Endosomes Enables Nod1 and Nod2 Signaling
This chapter was published as
Jooeun Lee, Ivan Tattoli, Kacper A. Wojtal, Stephan R. Vavricka, Dana J. Philpott, and Stephen
E. Girardin. pH-dependent Internalization of Muramyl Peptides from Early Endosomes Enables
Nod1 and Nod2 Signaling. The Journal of Biological Chemistry 2009; 284 (35): 23818-23829.
Contribution of Data
All experiments/analyses were performed by Jooeun Lee, unless noted otherwise;
Figure 4.6, panel A – SLC15 expression analysis by RT-PCR was provided by Ivan Tattoli.
Figure 4.8 was obtained from Kacper A. Wojtal as part of a larger study, which was reported
elsewhere (Wojtal et al., 2009)
59
4
4.1 Abstract
Nod1 and Nod2 are members of the Nod-like receptor family that detect intracellular bacterial
peptidoglycan-derived muramyl peptides. The biological effects of muramyl peptides have been
described for over three decades, but the mechanism underlying their internalization to the
cytosol remains unclear. Using the human epithelial cell line HEK293T as a model system, we
demonstrate here that Nod1-activating ligands entered cells through endocytosis, most likely by
the clathrin-coated pit pathway, as internalization was dynamin-dependent but not inhibited by
methyl--cyclodextrin. In the endocytic pathway, the cytosolic internalization of Nod1 ligands
was pH-dependent, occurred prior to the acidification mediated by the vacuolar ATPase and was
optimal at pH ranging from 5.5 to 6. Similarly, the Nod2 ligand MDP was internalized into host
cytosol through a similar pathway with optimal pH for internalization ranging from 5.5 to 6.5.
Moreover, Nod1-activating muramyl peptides likely required processing by endosomal enzymes,
prior to transport into the cytosol, suggesting the existence of a sterically gated endosomal
transporter for Nod1 ligands. In support for this, we identified a role for SLC15A4, an
oligopeptide transporter expressed in early endosomes, in Nod1-dependent NF-B signaling.
Interestingly, SLC15A4 expression was also up-regulated in colonic biopsies from patients with
inflammatory bowel disease, a disorder associated with mutations in Nod1 and Nod2. Together,
our results shed light onto the mechanisms by which muramyl peptides get access to the host
cytosol, where they are detected by Nod1 and Nod2, and might have implications for the
understanding of human diseases, such as inflammatory bowel disease.
4.2 Introduction
Innate immunity relies on the detection of conserved microbial- or danger-associated molecular
patterns (MAMPs or DAMPs), by pattern-recognition molecules. In mammals, several families
of pattern-recognition molecules have been recently identified, including the transmembrane
Toll-like receptors (TLRs), cytosolic Nod-like receptors (NLRs) and RIG-I-like receptors
(RLRs) (Akira et al., 2006). NLR proteins include Nod1 and Nod2, which trigger pro-
inflammatory pathways such as NF-B and mitogen-activated protein kinases, in response to
bacterial peptidoglycan (Fritz et al., 2006), and NLRPs (also known as Nalps), such as NLRP1
60
and NLRP3, which induce the activation of caspase-1 inflammasomes in response to various
MAMPs and DAMPs (Benko et al., 2008).
In the case of TLRs, there is accumulating evidence that the subcellular localization and the
function of these pattern-recognition molecules is tightly associated, at multiple levels, with
endocytosis and phagocytosis, which represent evolutionary conserved mechanisms for the
internalization of small (<0.5m) and large (>0.5m) particles, respectively. Indeed, whereas
some TLRs are expressed at the plasma membrane, others (such as TLR3, -7 and -9) are found
predominantly associated with the endoplasmic reticulum and endosomal compartments, where
they detect their respective microbial-derived nucleic acid MAMPs (Akira and Takeda, 2004). In
particular, TLR9 has been shown to move from the endoplasmic reticulum to CpG DNA-
containing endosomes, concurrent with the accumulation of MyD88, thus showing that
endosomes represent the physiological location where TLR9-dependent signaling arises (Latz et
al., 2004). In addition, studies on TLR4 have demonstrated that lipopolysaccharide (LPS) is
endocytosed by a receptor-mediated mechanism dependent on dynamin and clathrin and co-
localized with TLR4 on early/sorting endosomes (Husebye et al., 2006). In the case of this TLR,
it is believed that endosomal trafficking is associated with termination of the MyD88-dependent
pro-inflammatory signal (Husebye et al., 2006). In contrast, TLR4 in early endosomes has been
shown recently to engage TRAM and TRIF adaptors, resulting in the ignition of type I interferon
signaling in response to LPS (Kagan et al., 2008). Therefore, the nature of the cellular response
to LPS is dependent upon the subcellular localization of TLR4, thus reinforcing the importance
of the interplay between TLR signaling and endosomal trafficking.
A number of studies have also linked TLR signaling with phagosome maturation. While it
remains controversial whether TLR-dependent signaling actually drives phagosomal maturation
(Blander and Medzhitov, 2004; Yates and Russell, 2005), it is clear that the processing of
engulfed microbes within phagosomes regulates the availability of MAMPs within this
compartment. Accordingly, Herskovits et al. have recently demonstrated that, in interferon -
activated macrophages, the degradation of Listeria monocytogenes in the phagolysosome
generates bacterial molecules, which could specifically trigger type I interferon responses
through a Nod2-dependent pathway (Herskovits et al., 2007). This interesting observation
suggests that innate immune signaling and microbial degradation within the phagolysosome are
61
processes that are intimately linked. It also provides support to the concept that Nod-dependent
signaling is associated with intracellular vesicular trafficking.
Nod1 and Nod2 both detect specific structures from bacterial peptidoglycan (Girardin et al.,
2003c). While Nod2 detects muramyl dipeptide (MDP) (Girardin et al., 2003b; Inohara et al.,
2003), a motif found in almost all bacteria, Nod1 specifically senses diaminopimelic acid (DAP)-
containing muramyl peptides (Chamaillard et al., 2003; Girardin et al., 2003a). In particular,
human Nod1 preferentially detects N-acetylmuramyl-L-Ala-D-Glu-mesoDAP (M-Tri-DAP)
(Magalhaes et al., 2005), and the minimal motif for Nod1-dependent sensing is the dipeptide D-
Glu-mesoDAP (iE-DAP) (Chamaillard et al., 2003; Girardin et al., 2003c). Interestingly, long
before the identification of Nod1 and Nod2 as sensors of muramyl peptides and bacterial
peptidoglycan, the biological activities of these bacterial-derived molecules had been studied
extensively (Lederer, 1980, 1986). It is well documented that these muramyl peptides trigger a
multitude of immune responses, such as the induction of cytokines/chemokines, the production
of nitric oxide and reactive oxygen species and the clearance of microbes by phagocytic cells
(Lederer, 1980, 1986). A considerable literature also demonstrated that these muramyl peptides
synergize with MAMPs detected by TLRs, such as LPS (Traub et al., 2004). Although the
identification of Nod1 and Nod2 as sensors of muramyl peptides has provided an acceleration in
this field of investigation, it also brought the question of how such microbial molecules could get
access to the host cytosol, where Nod1 and Nod2 reside. Interestingly, research aiming at
improving the biological activities of these muramyl peptides demonstrated early on that the
addition of lipophilic groups to these molecules enhanced their activity considerably, suggesting
that their internalization was likely a key factor in determining their efficiency (Fogler and
Fidler, 1987; Mehta et al., 1982; Nayar et al., 1986; Schroit and Fidler, 1982).
The mechanisms by which muramyl peptides get access to the host cytosol remain unclear. This
question is of fundamental importance for our understanding of Nod-dependent signaling, and
potentially holds broad therapeutic implications. Indeed, mutations in Nod1 and Nod2 have been
associated with inflammatory bowel disease (IBD) in humans (Le Bourhis et al., 2007). In
particular, Nod2 has been identified as the first susceptibility gene for Crohn’s disease (Hugot et
al., 2001; Ogura et al., 2001).
62
In this report, we used the HEK293T epithelial cell line to study the mechanism of
internalization of Nod1 ligands. We demonstrated that these peptidoglycan-derived molecules
enter cells by endocytosis, and that the composition of the Nod1-activating molecules
dramatically affected their intrinsic uptake capacity. Our data also suggested that this
internalization was mediated by clathrin-dependent endocytosis, as internalization of Nod1
ligands required dynamin and was independent from caveolae. Further, we showed that, within
endosomes, the internalization of Nod1 ligands was critically dependent on pH, and was optimal
at pH ranging from 5.5 to 6, which are characteristic of early endosomes. Accordingly,
internalization of Nod1-activating molecules did not require the action of the vacuolar ATPase
(V-ATPase) complex. We also provide evidence that the Nod2 ligand MDP enters cells through
a similar endocytic process. Our results also show that the internalization of Nod1 ligands is a
process that is sterically gated, and likely requires the action of hydrolytic endosomal enzymes
prior to transport into the cytosol, thus suggesting the existence of one or several specific
transporters for Nod1 ligands in early endosomes. Using knockdown assays, we identified
SLC15A4 as a putative transporter for Nod1 ligands in early endosomes. SLC15A4 expression
was found to be significantly upregulated in tissue biopsies from IBD patients, therefore
highlighting a potential role for the modulation of peptidoglycan access to the cytosol in IBD
etiology. Together, our results uncover the mechanism by which Nod ligands traffic into cells
and get access to the cytosol where they are detected by Nod1 and Nod2. Our observations also
highlight the previously unappreciated link between endosomal acidification/maturation and
Nod-dependent signaling.
4.3 Materials and Methods
Cell culture and reagents
Human embryonic kidney epithelial cell line HEK293T (American Type Culture Collection) was
cultured in Dulbecco’s modified Eagle’s medium (DMEM), supplemented with 5% fetal calf
serum and 1% penicillin/streptomycin. Cells were maintained in 95% air, 5% CO2 at 37ºC.
Endotoxin-free fetal calf serum and phosphate buffer saline were from Wisent (St-Bruno,
Quebec). Fetal calf serum was used after heat inactivation at 56ºC for 30 min. All cell culture
reagents and antibiotics were also from Wisent.
63
Nod1 ligands, iE-DAP (-D-Glu-mesoDAP), Tri-DAP (L-Ala-D-Glu-mesoDAP), M-Tri-DAP
(MurNAc-L-Ala-D-Glu-mesoDAP), C12-iE-DAP, were from InvivoGen. iE-DAP, Tri-DAP and
M-Tri-DAP were used at concentrations ranging from 1 to 10 g/ml whereas C12-iE-DAP was
used from 0.01 to 1 g/ml. Nod2 ligand, MDP was also from InvivoGen and used at a
concentration of 10 g/ml.
The inhibitors of endocytosis were purchased from Sigma and used at the following
concentrations : valinomycin (1-10 M), bafilomycin A1 (10-50 nM), dynasore monohydrate (80
M), nocodazole (1 g/ml), cytochalasin D (1 g/ml), carbonyl cyanide m-
cholorophenylhydrazone (CCCP) (1-10 M), methyl--cyclodextrin (2.5 to 10 mM).
Extracellular acidification assays
To examine the effect of extracellular pH on ligand uptake, isotonic buffer (IB) (50 mM HEPES,
pH 7, 100 mM KCl, 3 mM MgCl2, 0.1 mM dithiothreitol, 85 mM sucrose, 0.2% bovine serum
albumin, 1 mM ATP and 0.1 mM GTP) was prepared with pH modified to 5, 5.5, 6, 6.5, or 7,
and ATP, dithiothreitol and GTP were added freshly for each experiment. Cells were then
incubated for 1 hour at 37ºC with the respective ligands in 500 l IB at varying pH.
Subsequently, IB was removed and replaced with DMEM plus 5% fetal-calf serum for 5 h before
performing luciferase measurements.
NF-B activation assays
Transfections were carried out using polyethylenimine (Polysciences Inc., Warrington, PA) in
HEK293T according to the manufacturer’s instructions. Briefly, cells were transfected overnight
with 75 ng of NF-B luciferase reporter plamid (Ig-luc, Invitrogen). The empty vector
(pcDNA3.1, Invitrogen) was used to balance the transfected DNA concentration. The expression
vector for human Nod2 (0.2 ng/well) was a kind gift from Dr. Nunez (University of Michigan,
Ann Arbor, MI). Following transfection, Nod1 or Nod2 ligands were added the next day for 6
hours (unless specified) before performing luciferase measurements. For NF-B activation
assays in digitonin-permeabilized cells, HEK293T were incubated for 10 min at 37ºC with Nod1
ligands in isotonic digitonin buffer (DB) (500 l) with or without 10 g/ml digitonin (Sigma),
and then placed in DMEM for 6 h, as previously described (Girardin et al., 2003a).
64
As a control for the possible toxicity of the trafficking inhibitors used towards NF-B activation,
we systematically transfected over-night the Ig-luci reporter vector together with 50 ng of
expression vector encoding for Rip2 (from Dr Thome, UNIL, Lausanne), the Nod1 adaptor
protein acting downstream of the detection of peptidoglycan by Nod1. In all the experiments
presented in this study, the doses of the drugs used had no effect on Rip2-mediated activation of
NF-B (data not shown). NF-B-dependent luciferase assays were performed in duplicate, and
data represent at least three independent experiments. Data show mean ± S.E.
Immunofluorescence
HEK293T cells were incubated in DMEM without fetal calf serum for 1 h prior to incubation in
IB at pH 5.5 or 7 plus transferrin conjugated to Alexa Fluor 568 (10 g/ml, Molecular Probes
Inc.) for 1 h at 37ºC. Rab5-RFP expression vector was a kind gift from Dr. John Brumell (the
Hospital for Sick Children, Toronto). SLC15A4-V5 was obtained from Dr. Knipp (The State
University of New Jersey). Cells were co-transfected with either Rab5-RFP (500 ng) or
SLC15A4-V5 (500 ng) or both overnight, and incubated in IB at pH 5.5 or 7 for 1 h at 37ºC the
next day. Cells were then washed with cold phosphate-buffered saline, fixed for 15 min at room
temperature with paraformaldehyde (3.7% w/v in phosphate-buffered saline), permeabilized with
0.1% TritonX-100 for 5 min, stained with anti-V5 (anti-mouse-fluorescein isothiocyanate) for 1
h and mounted with Vectashield (Vector Laboratories, Burlingame, CA). Coverslips were
visualized on a Carl Zeiss Axiovert 200M microscope with a 63X oil fluorescence objective.
Semi-quantatative PCR
Total RNA samples from untreated cells were prepared according to the manufacturer’s
protocols (Qiagen). After genomic DNA elimination with RNase-free DNase, the
complementary DNA was generated from 1 g RNA using a mixture of oligo(dT) and random
primers and Omniscript Reverse Transcriptase (Qiagen). PCR was performed with Taq
polymerase (Invitrogen) using the following primers: 5’-TTGCTTCTGGTCGTCTGTG3’, 5’-
GCCCCTGACATGAAATATGG 3’ for SLC15A1, 5’-GCCCTGTCTTGAAGCATTTT- 3’, 5’-
AGAGTCTCTGGGGCCTTGTT-3’ for SLC15A2, 5’-GCTTAAGCTCGCTCTCCAAA-3’,5’-
GCAAGATCTTCACCAGCAC-3’ for SLC15A3, 5’-AGCGATCCTGTCGTTAGGTG-3’, 5’-
AGGAGGCTTGGTGATGAAAA-3’ for SLC15A4.
65
Design and construction of siRNA sequences against human SLC15A4
The sequences of the siRNA specifically targeting SLC15A4 gene were purchased from Ambion
(Silencer Pre-designed siRNA) siRNA ID # S42440 and siRNA ID #S42441 or designed through
siRNA Wizard v3.0 (InvivoGen). The sequences were the following: 5’
CGGCTGCTATTTGAACTAT 3’ for #B, 5’GCAGACAACATATGTTTTA 3’ for #A,
5’GAGTCTTTCAGCAATCTTCTA 3’ for #C, 5’ GATTCATGTAAGATGTCTCAT 3’ for #D
5’GTGGAGAGCGCCAGAGTAA 3’ for #E, 5’ GATTCATGTAAGATGTCTCAT 3’ for #F,
and 5’ CGGCTGCTATTTGAACTAT 3’ for scrambled. Two different vectors were used to
generate shRNA against SLC15A4; pLKO.1 vector (Addgene, Cambridge, MA) for lentiviral
knockdown system, and psiRNA-h7SK-GFPzeo transient knockdown of SLC15A4 expression.
For both vectors, positive clones were identified by restriction digestion and confirmed by
sequencing.
Lentiviral vector cloning
The sense and anti-sense oligonucleotides were resuspended in water at 20 M, and annealed by
incubating at 95ºC for 4 min, 70ºC for 10 min, then decreasing the temperature to room
temperature slowly (0.1ºC/min). The resulting lentiviral shRNA vector was confirmed by
restriction enzyme digestion with Agel/EcoRI. The constructed vector was also confirmed by
DNA sequencing with pLKO.1 sequencing primer (5’- CAA GGC TGT TAG AGA GAT AAT
TGG A-3’).
Lentivirus packaging
Packaging, and purification of the lentivirus were performed according to classical procedures.
Briefly, HEK293T cells were seeded 1.5 x 106 in a 10-cm culture dish, in DMEM supplemented
with 10% fetal bovine serum without antibiotics. The following day, cells were co-transfected
with the lentiviral vector (1 g), and the lentiviral packaging/envelope vectors psPAX2 (750 ng),
pMD2.G (250 ng). Viruses were collected from the culture supernatant 48h post-transfection,
spun at 1250 rpm for 5 min, and the media passed through a 0.45-m filter.
Lentiviral transduction in HEK293T cells
66
Cells were seeded in either 6-well plates or 24-well plates, and then incubated with lentivirus for
3 days. Polybrene (10 g/ml) was added to increase the efficiency of lentiviral transduction.
Following transduction, cells were co-transfected with NF-B luciferase contructs and luciferase
assays were performed as above.
Western blotting
HEK293T cells were centrifuged, and the pellet was lysed with radioimmune precipitation assay
buffer (0.5M Tris-HCl pH 7.5, 150 mM NaCl, 1% Nonidet P-40, 0.5% deoxycholic acid,
protease inhibitor mixture (Sigma P8340)). Total cell lysates were boiled for 10 min, and
subsequently subjected to SDS-PAGE. Western blot was performed according to a standard
protocol, using a rabbit polyclonal anti-SLC15A4 (Santa Cruz Biotechnology, dilution 1:500),
followed by incubation with a secondary anti-rabbit horseradish peroxidise antibody (Thermo
Scientific, 1:10,000) and an enhanced Chemiluminescence Kit (PerkinElmer, Life Sciences).
Mouse monoclonal anti-tubulin (Sigma, T9026, 1:10,000) was used as loading control.
SLC15A4 expression in IBD patients
The analysis of SLC15A4 expression in 49 CD patients and 53 UC patients was performed in the
context of a larger study, which was reported elsewhere (Wojtal et al., 2009).
4.4 Results
HEK293T cells transfected overnight with an expression vector encoding for luciferase under the
control of an NF-B-responsive promoter (Ig-luci) were stimulated with increasing
concentrations of the Nod1 ligands iE-DAP, Tri-DAP or M-Tri-DAP for 6 h. iE-DAP represents
the minimal peptide activating Nod1, whereas Tri-DAP is the minimal naturally occurring Nod1
ligand, and M-Tri-DAP is the minimal muramyl peptide stimulating Nod1 (Chamaillard et al.,
2003; Girardin et al., 2003c) (Figure 4.1A). Although Tri-DAP and M-Tri-DAP activated cells
comparably, iE-DAP appeared to be a very poor agonist, even at the highest dose tested (10
g/ml) (Figure 4.1B). We next stimulated cells for 16 h with 10 g/ml of Tri-DAP or M-Tri-
DAP, and observed that these Nod1 ligands required at least 34 h of stimulation to induce
measurable activation of the NF-B reporter gene (Figure 4.1C). We and others have previously
67
demonstrated that iE-DAP was able to trigger Nod1-dependent NF-B activation in a setting
where the ligands were added overnight together with a liposomal transfection reagent
(Chamaillard et al., 2003; Girardin et al., 2003c). Therefore, the results above likely reflect the
fact that iE-DAP, contrary to Tri-DAP or M-Tri-DAP, is inefficiently internalized by HEK293T
cells. In order to study this question further, we used a derivative iE-DAP that contains a lauroyl
(C12) group attached to the glutamic residue of iE-DAP (see Figure 4.1A). The rationale for
such a modification is that the fatty acids may form micelle-like structures and display enhanced
internalization. We observed that the addition of the fatty acid moiety to iE-DAP enhanced >100
fold the capacity of the Nod1 ligand to trigger NF-B (Figure 4.1D). This suggests that iE-DAP
activated cells poorly as a result of defective trafficking, rather than because of an intrinsic
inefficiency to stimulate Nod1. Next, we questioned if the Nod1 ligands actually needed to get
access to the host cytosol to trigger cellular responses, or if trafficking and targeting to a specific
subcellular compartment were the only requirement for Nod1-dependent activation. To answer
this question, we pulsed HEK293T cells with iE-DAP, Tri-DAP or M-Tri-DAP for 10 min in the
presence of digitonin, a membrane-permeabilizing toxin, then replaced back the cell culture
medium to neutralize the action of digitonin, and lysed cells 6 h post-stimulation. Interestingly,
in this experimental setting, all Nod1 ligands potently stimulated cells (Fig. 1E), therefore
showing that presentation to the host cytosol is the limiting factor for their activating capacities.
It must be noted, however, that in this context, iE-DAP remained a weaker agonist than Tri-DAP
or M-Tri-DAP (Figure 4.1E), which correlates well with our previous observations using a
different experimental setting (Girardin et al., 2003c), and may reflect a difference in the
intrinsic capacity of this dipeptide to trigger Nod1, as compared with the naturally occurring
tripeptide forms. Together, these results show that epithelial cells have the capacity to internalize
Nod1 ligands, that these molecules display different trafficking abilities, and demonstrate that
these agonists must reach the host cytosol to trigger Nod1-dependent responses.
68
69
Figure 4.1. Differential entry of Nod1 ligands into HEK293T cells.
A, Nod1- and Nod2-activating molecules used in this study. The four Nod1-activating molecules
contain the minimal motif D-Glu-mesoDAP (iE-DAP) that triggers Nod1. C12-iE-DAP contains
a fatty acid moiety (lauroyl group) linked to the D-Glu. MDP stimulates Nod2 activity. All these
molecules are synthetic and therefore do not contain any microbial contaminant. B, HEK293T
cells were transfected overnight with the NF-B reporter plasmid Ig-luci. The following day,
increasing concentrations of Nod1 ligands iE-DAP, Tri-DAP or M-Tri-DAP were added to the
cell culture medium for 6h before cell lysis. C, HEK293T cells were transfected with Ig-luci
overnight and Tri-DAP or M-Tri-DAP were added to the cell culture medium for 16h on the
following day, as indicated. D, same as B, but comparing the responses to increasing
concentrations of iE-DAP and C12-iE-DAP. E, HEK293T cells were transfected overnight with
Ig-luci in DMEM cell culture medium. The following day, cell culture medium was replaced to
an isotonic digitonin buffer (DB) and iE-DAP, Tri-DAP or M-Tri-DAP (all at either 1 g/ml or 5
g/ml) were added to the cells in the presence of digitonin for 10 min. Then, cell culture medium
was replaced to DMEM for 6h, before cell lysis. NS, non stimulated.
70
We next investigated the cellular pathways responsible for the internalization of Nod1 ligands
into HEK293T cells. Nocodazole and cytochalasin D, two drugs that block macropinocytosis by
disrupting microtubules and actin cytoskeleton, respectively, did not affect the capacity of Tri-
DAP or M-Tri-DAP to stimulate cells (Figure 4.2A). In contrast, Dynasore, a highly specific
inhibitor of dynamin (Macia et al., 2006), potently blocked Tri-DAP- and M-Tri-DAP-dependent
activation of NF-B (Figure 4.2A). We next took advantage of the fact that Dynosore blocks
dynamin in seconds or minutes (Macia et al., 2006), to study further the kinetics of dynamin-
dependent entry of Nod1 ligands into cells, by adding the drug at various times before or after
the addition of Nod1 ligand. Using this technique, we observed that the endocytosis of Nod1
ligands is a slow and continuous process that occurs in a linear fashion over time (Figure 4.2B).
Because dynamin is known to be crucial for both clathrin-coated and caveolae vesicular
endocytic pathways (Drubin et al., 2005; Kaksonen et al., 2006), we aimed to distinguish
between these two potential entry mechanisms. Intracellular potassium depletion specifically
blocks clathrin-dependent endocytosis (Drubin et al., 2005; Kaksonen et al., 2006). Therefore,
we dissipated K+ gradients by treating cells with valinomycin, a K
+ ionophore, and observed that
this drug potently blunted the cellular response to Nod1 ligands (Figure 4.2C). Moreover, we
used methyl--cyclodextrin (MCD), a molecule that alters the fluidity of the plasma membrane
by depleting cholesterol, and known to perturb caveolae vesicular endocytic pathways
(Kaksonen et al., 2006). Strikingly, we observed that MCD actually potentiated the cellular
response to Nod1 ligands (Figure 4.2D), thus excluding a role for caveolae in mediating the entry
of Nod1 ligands into HEK293T cells. Together, these results identify clathrin-dependent
endocytosis as the mode of entry of Nod1 ligands into HEK293T epithelial cells.
71
Figure 4.2 Nod1 ligands enter HEK293T cells by endocytosis.
In all experiments below, HEK293T cells were first transfected overnight with Ig-luci. A, cells
were stimulated for 6h with 5 g/ml Tri-DAP or M-Tri-DAP in the absence or presence of the
cellular trafficking inhibitors nocodazole (Noc; 1g/ml), cytochalasin D (CyD; 1 g/ml) and
Dynasore (Dyn; 80 M). B, cells were stimulated for 6h with 5 g/ml Tri-DAP, in the presence
or absence of dynasore (80 M) added either prior to the Nod1 ligand (-30’), or at various times
after the addition of Tri-DAP, as indicated. C, cells were stimulated for 6h with 5 g/ml Tri-DAP
in the absence or presence of valinomycin (Valino; 1 M or 10 M). D, cells were stimulated for
6h with 1 g/ml Tri-DAP in the absence or presence of methyl--cyclodextrin (MCD; 2.5 mM
or 10 mM). NS, non stimulated.
72
Endosomal maturation results in progressive acidification of the vesicular lumen, through a
series of events, involving first the action of proteins such as the Na+/H
+ exchangers, followed by
further acidification mediated by the V-ATPase complex in late endosomes and lysosomes
(Steinberg et al., 2007). We aimed to identify if endosomal acidification played a role in the
ability of Nod1 ligands to get exported to the cytosol. Cells treated with carbonyl cyanide m-
chlorophenylhydrazone, a H+ ionophore, displayed blunted responses to Nod1 ligands (Figure
4.3A), thus suggesting that cellular proton gradients are critical for the trafficking and/or
internalization of Nod1 ligands into host cytosol. Using bafilomycin A1, a specific inhibitor of
V-ATPases, we observed that the acidification induced by this pump was not required for
optimal trafficking of Nod1 ligands (Figure 4.3B), therefore showing that these agonists likely
exit the endocytic pathway in early/sorting endosomes. Of note, we noticed that bafilomycin A1
actually increased cellular responses to Nod1 ligands, which might be explained by the fact that
early endosomes, stalled at a mildly acidified stage, are blocked at a pH close to the one optimal
for transport of Nod1 ligands out of the endocytic machinery.
73
Figure 4.3. The internalization of Nod1 ligands is dependent on endosomal pH.
In the experiments below, HEK293T cells were first transfected overnight with Ig-luci. A, cells
were stimulated for 6h with 5 g/ml Tri-DAP in the absence or presence of carbonyl cyanide m-
cholorophenylhydrazone (CCCP; 110 M). B, cells were stimulated for 6h with 5 g/ml Tri-
DAP or M-Tri-DAP in the absence or presence of bafilomycin A1 (Baf; 1050 nM). NS, non-
stimulated.
74
Our last results suggested that an optimal luminal pH might exist for the efficient transport of
Nod1 ligands to the cytosol. In order to study this question further, we developed a procedure,
relying on the transient (60 min) acidification of the extracellular milieu in an isotonic buffer in
the presence of Nod1 ligands (Figure 4.4A). Strikingly, we observed that, although this
procedure did not affect clathrin-mediated endocytosis in general (Figure 4.4B), it altered greatly
the cellular response to the Nod1 ligand iE-DAP. In particular, we identified that an optimal pH
for triggering Nod1-dependent responses existed, and was around pH 5.56 (Figure 4.4C), which
is a level of acidification commonly observed in early endosomes (Steinberg et al., 2007). The
fact that, through this experimental procedure, we could observe considerable cellular activation
by iE-DAP reinforces the idea that this ligand is not intrinsically a poor Nod1 ligand, but rather
is impaired in its capacity to reach endosomes acidified to 5.56. Through titration (Figure 4.4D)
and kinetics (Figure 4.4E) experiments, we refined our observations and noticed that as little as 1
g/ml of iE-DAP, and a transient extracellular acidosis for 20 min or more, induced measurable
iE-DAP-dependent cellular responses. More importantly, we demonstrated that the procedure of
transient extracellular acidosis that we developed likely bypassed normal endosomal maturation,
but still relied on dynamin-dependent pinching off of endosomes from the plasma membrane, as
it was fully blocked by Dynasore (Figure 4.4F). Next, we used this procedure of transient
extracellular acidosis to compare the relative capacities of distinct Nod1 ligands to trigger
cellular NF-B responses. We first noticed that the tripeptide ligand Tri-DAP displayed more
potent activating capacities than iE-DAP (Figure 4.4G), in agreement with our previous
experiments using different experimental systems (see above). Surprisingly, we observed in this
experimental setting that M-Tri-DAP was almost completely unable to trigger cellular responses
(Figure 4.4G), while M-Tri-DAP and Tri-DAP displayed similar activating capacities in normal
stimulating conditions (see Figure 4.1B). These results suggest that a processing of M-Tri-DAP
into Tri-DAP likely occurs in normally maturing endosomes, which is bypassed in our
experimental system where endosomal acidification is artificially provoked by transient acidosis
(see also below Figure 4.9). These observations also provide evidence that the exit of Nod1
ligands from early endosomes is a process that is sterically gated, thus indirectly suggesting the
existence of a specific transport system for Nod1 ligands within the early endosome.
75
76
Figure 4.4. Extracellular acidification strongly potentiates endocytosis-mediated entry of
iE-DAP.
A, schematic representation of the experimental procedure followed to study the influence of
extracellular pH on NF-B activation by Nod1 ligand iE-DAP. The acidification was maintained
for only 1h, in a specific isotonic buffer (IB), a period when the ligand was added. Cell medium
was replaced to DMEM, pH 7, for the last 5h, before cell lysis. B, uptake of transferrin-Alexa
Fluor 568 (10 g/ml) by HEK293T cells for 1h in IB buffer pH 7 (left) or pH 5.5 (right) was
followed by fluorescence microscopy. Overlay with differential interference contrast is also
shown. For the experiments below (CG), HEK293T cells were first transfected overnight with
Ig-luci, and transient acidosis in IB was performed, as described in A. C, cells were stimulated
for 1h with iE-DAP (10 g/ml) in IB buffer at different pH, as indicated. D, Cells were
stimulated for 1h with various concentrations of iE-DAP (0.1 to 10 g/ml) in IB buffer pH 5.5.
E, cells were stimulated for various times (060 minutes) with iE-DAP (10 g/ml) in IB buffer,
pH 5.5. F, cells were stimulated for 1h with iE-DAP (5 g/ml) in IB buffer, pH 5.5, in the
presence or absence of Dynasore (Dyn; 80 M). G, cells were stimulated for 1h with iE-DAP (5
g/ml), Tri-DAP (1 g/ml) or M-Tri-DAP (1 g/ml) in IB buffer, pH 5.5. NS, non-stimulated.
77
We then aimed to identify if the internalization of the Nod2 ligand, MDP, displayed similar
characteristics than that of Nod1 ligands in HEK293T cells. When added extracellularly for 26
h, we observed that MDP triggered only minimal NF-B-dependent cellular responses (Figure
4.5A), which is in agreement with previous reports on Nod2-dependent responses in epithelial
cells (Girardin et al., 2003a). Indeed, it has been reported by several groups that the levels of
Nod2 expression in most epithelial cells, including HEK293T, is minimal or absent in normal
conditions (Gutierrez et al., 2002; Rosenstiel et al., 2003). Therefore, we co-transfected
overnight minimal amounts of a Nod2 expressing vector (0.2 ng) together with our Ig-luci
reporter construct, and then stimulated cells with MDP for increasing periods the following day.
Using this procedure, we noticed an increase in the overall sensitivity of HEK293T cells to MDP
(Figure 4.5B), which prompted to select this experimental setting for further studies. Next, we
observed that MDP, like Nod1 ligands, entered cells through dynamin-dependent and
caveosome-independent endocytosis (Figure 4.5, C and D), and that the export out of the
endocytic machinery occurred prior to acidification dependent on the action of the V-ATPase, as
it was not blocked by bafilomycin A1 (Figure 4.5C). Finally, using the transient extracellular
acidosis procedure described above, we observed that MDP internalization also required an
optimal pH in HEK293T cells, but that it exhibited a broader range of pH 5.5 to 6.5 (Figure
4.5E) than that of Nod1 ligands.
78
Figure 4.5. The Nod2 ligand MDP enters HEK293T cells by endocytosis.
In all experiments below, HEK293T cells were first transfected overnight with Ig-luci. A, cells
were stimulated for various times (26 h) with muramyl dipeptide (MDP; 10 g/ml). For the
next experiments (BE), cells were co-transfected with an expression vector encoding for hNod2
(0.2 ng/well). B, cells were stimulated for various times (26 h) with MDP (10 g/ml). C and D,
cells were stimulated for 6 h with MDP (10 g/ml) in the presence or absence of bafilomycin A1
(Baf ; 50 nM), Dynasore (Dyn ; 80 M) (C) or (D) MCD (2.5 mM or 10 mM) (D). E, cells were
stimulated for 1h with MDP (10g/ml) in IB buffer at different pH, similarly to Figure 4.4C.
NS1, non-stimulated; NS2, non-stimulated but overexpressing hNod2 (0.2 ng/well).
79
Next, we aimed to identify the nature of the putative transporter, expressed in early endosomes,
which was responsible for the sterically gated internalization of Nod1 ligands to the cytosol. Out
of the 46 families of solute carrier (SLC) proteins, only SLC15 proteins are known to transport
di- or tri-peptides. Moreover, SLC15 proteins co-transport oligopeptides together with H+ and
have an optimal pH for transport around pH 5.56 (Daniel and Kottra, 2004). Therefore, we
reasoned that the putative transporter for Nod1 ligands in HEK293T cells might be a member of
the SLC15 family. We first analyzed the expression of SLC15 proteins in HeLa, HEK293T and
MCF-7 human epithelial cell lines by semi-quantitative PCR. The SLC15 family is composed of
four members SLC15A1 to SLC15A4 in mammals. SLC15A3 was not detected in these samples
and SLC15A1 was expressed at low levels in HEK293T cells but not HeLa or MCF-7 (Figure
4.6A). In contrast, transcripts for SLC15A2 and SLC15A4 were strongly expressed in the three
cell lines tested (Figure 4.6A). We first investigated the potential role of SLC15A2 in mediating
the transport of Nod1 ligands by using Lys[Z(NO2)]-Val, a highly specific inhibitor of this
transporter (Ki=0.097 M) (Biegel et al., 2006). Even at the highest non-cytotoxic dose tested
(50 M), the inhibitor failed to inhibit Nod1 ligand-mediated NF-B activation (Figure 4.6B),
therefore suggesting that SLC15A2 was not required in our experimental system. Similarly,
cefadroxil, an antibiotic that inhibits both SLC15A1 and SLC15A2 (Biegel et al., 2006), had no
effect on Nod1 ligand-mediated NF-B activation (data not shown). We then hypothesized that
SLC15A4 could be implicated in the transport of Nod1 ligands. A polyclonal antibody raised
against human SLC15A4 revealed multiple forms both at the endogenous level and in SLC15A4-
V5 overexpressed cells, migrating at ~60 kDa and higher (Figure 4.6C), suggesting the existence
of extensive post-transcriptional modifications of SLC15A4 in unstimulated conditions. Similar
results were obtained using another anti-SLC15A4 polyclonal antibody (data not shown). Next,
we tested a number of siRNA constructs designed to knock down endogenous SLC15A4
expression by transient transfection, and identified duplex B as the most effective one (Figure
4.6D), which was used for functional studies. Interestingly, lentiviral-mediated knockdown of
SLC15A4 in HEK293T cells resulted in significant decrease of NF-B activation by the Nod1
ligands Tri-DAP and C12-iE-DAP in luciferase assay (Figure 4.6E), thus demonstrating that
SLC15A4 was critical for Nod1 ligand-mediated signaling in HEK293T cells. In the case of
MDP, the results were inconclusive because of the low level of NF-B activation triggered by
this muramyl peptide in our experimental system.
80
81
Figure 4.6. SLC15A4 is involved in Nod1 ligand-mediated NF-B activation in HEK293T
cells.
A, the expression of SLC15 was determined by RT-PCR in HeLa, HEK293T and MCF-7 human
epithelial cell lines. B, HEK293T cells were transfected overnight with Ig-luci, and transient
acidosis in IB was performed. Cells were stimulated for 1 h with M-Tri-DAP (1 g/ml) in IB
buffer pH 5.5 in the presence or absence of increasing concentration of the SLC15A2 inhibitor
Lys[Z(NO2)]-Val. C, HEK293T cells were transfected with increasing concentration of
SLC15A4-V5 expression vector, and cell lysates analyzed by western blotting using anti-
SLC15A4 antibody. * indicates a non-specific band. D, HEK293T cells were transfected for 72 h
with various siRNA duplexes (constructs AF) against human SLC15A4 or a control non-
targetting siRNA duplex (Ctr siRNA) and cell lysates analyzed by western blotting using anti-
SLC15A4 antibody. * indicates a nonspecific band. The membrane was stripped and blotted
against tubulin for loading control. E, HEK293T cells transduced for 72 h with lentiviral
particles expressing shRNAs against SLC15A4 or a non-targetting sequence were transfected
overnight with Ig-luci and stimulated for 1 h with Nod1 ligands (iE-DAP, Tri-DAP, M-Tri-
DAP) or Nod2 ligand MDP in acidosis conditions (IB pH 5.5), or with C12-iE-DAP normal
(non-acidified) conditions, and luciferase activity was measured 6 h post-stimulation in cell
lysates. Statistical analysis was perfomed using a two-tailed unpaired t test, and conditions for
which p<0.05 were IB, pH 5.5/Tri-DAP (p=0.002) and C12-iE-DAP (p=0.035). NS1, non-
stimulated; NS2, non-stimulated in IB, pH 5.5.
82
We next investigated the subcellular localization of SLC15A4 by immunofluorescence in
HEK293T cells. First, we observed that over-expressed SLC15A4-V5 colocalized with Rab5-
RFP, thus showing that this transporter was expressed in early endosomes (Figure 4.7A).
Interestingly, transient extracellular acidosis (pH 5.5), similar to the procedure performed above
in luciferase assays, resulted in elongation of the cells and relocalization of SLC15A4 to the
cellular poles (Figure 4.7B), where it partially colocalized with Rab5 (Figure 4.7C). It is possible
that the cellular redistribution of SLC15A4 in early endosomes at mildly acidic pH may
contribute to the enhancement of Nod1-dependent signaling that was observed in luciferase
assays.
Recent studies have linked IBD to either polymorphisms in genes encoding SLC15 family
members (Zucchelli et al., 2009) or changes in the intestinal expression of SLC15 proteins
(Wojtal et al., 2009). Because of the implication of Nod1 and Nod2 in IBD, we aimed to identify
if the mRNA expression levels of SLC15A4 was altered in the intestine of IBD patients. We
analyzed by real-time PCR the expression of SLC15A4 mRNA in colonic biopsies from 53
ulcerative colitis (UC) and 49 Crohn’s disease (CD) patients, and inflamed versus non-
inflammed sections were analyzed separately. For CD patients, inflamed versus non-inflamed
sections of the terminal ileum were also analyzed. Interestingly, SLC15A4 expression was
significantly upregulated in inflamed areas of the colon in CD (p<0.05) and UC (p<0.001)
patients, but not in the terminal ileum of CD patients (Figure 4.8).
83
Figure 4.7. SLC15A4 is expressed in early endosomes.
A, HEK293T cells were transfected with SLC15A4-V5 and Rab5-RFP and visualized by
immunofluorescence using an anti-V5 antibody. B, HEK293T cells were transfected with
SLC15A4-V5, cultured for 1 h in IB pH 7 or pH 5.5, before fixation, and visualized by
immunofluorescence using an anti-V5 antibody. C, HEK293T cells were transfected with
SLC15A4-V5 and Rab5-RFP were cultured for 1 h in IB pH 5.5, before fixation, and visualized
by immunofluorescence using an anti-V5 antibody. Arrows indicate localization of SLC15A4
and Rab5-RFP at cellular poles.
84
Figure 4.8. SLC15A4 mRNA expression levels are increased in inflamed colon of IBD
patients.
SLC15A4 expression levels in biopsies from colon and terminal ileum of CD and UC patients
were determined by absolute quantification of SLC15A4 copy numbers and normalized to
mRNA copy numbers of villin. The bars represent average values of mRNA expression levels of
subgroups of IBD patients. Error bars represent SD. *, p<0.05; ***, p<0.0001.
85
4.5 Discussion
The results that we have presented here establish that, in epithelial cells, muramyl peptides get
internalized and traffic via the endocytic machinery, and most likely rely solely on the clathrin-
dependent coated pit pathway. This entry pathway is the one generally used for receptor-
mediated endocytosis, and this raises the possibility that a cell surface receptor might be
involved in the optimal uptake of either muramyl peptides or peptidoglycan-derived di- or
tripeptides. In such a scenario, the interaction of these Nod agonists with the cell surface could
be either achieved through specific recognition of a peptidic motif by a receptor, or occur non-
specifically via electrostatic interactions. It must be noted that our results demonstrated that iE-
DAP and Tri-DAP trigger cellular responses in a very different fashion, and that this likely
results from an inability of iE-DAP to travel down the endocytic pathway to mildly acidified
endosomes. It is possible that these observations reflect a differential capacity of these peptides
to form interactions with cell surface receptors/proteins, prior to the invagination of the
endocytic cup.
Our results showing that Nod ligands are internalized into host cells via endocytosis are
consistent with a number of indirect observations of the biological activity of these molecules. In
particular, we and others have repeatedly shown that the efficiency of Nod ligands is greatly
boosted by “co-transfecting” those ligands overnight together with plasmidic DNA into cationic
liposomes (Girardin et al., 2003b; Inohara et al., 2003). Because liposome-DNA complexes are
known to traffic mostly via receptor-mediated endocytosis, these initial observations suggested
that: (i) the entry of Nod ligands into host cells can be potentiated if these molecules traffic
through this pathway and (ii) endocytosis is likely the most critical limiting factor for the
stimulating capacities of Nod-activating molecules. In agreement with this, early studies aiming
at increasing the stimulating capacities of peptidoglycan-derived peptides or muramyl peptides
demonstrated that the covalent addition of lipophilic groups to these structures could greatly
enhance cellular responses. For instance, the tumoricidal activity of a lipophilic derivative of
MDP on endothelial cells has been found to be enhanced 100- to 1000-fold as compared to MDP
(Phillips et al., 1994). Moreover, studies with 6-O-acyl derivatives of MDP revealed that 6-O-(2-
tetradecylhexadecanoyl)-MDP and 6-O-(3-hydroxy-2-tetradecyl-octadecanoyl)-MDP exhibited
stronger macrophage-stimulating effects than MDP (Takada et al., 1979). Together, a number of
convergent studies demonstrated that delivering muramyl peptides via liposomal or fatty acid-
86
containing formulations greatly improved the immunogenicity and adjuvanticity of these
bacterial molecules (Fogler and Fidler, 1987; Mehta et al., 1982; Nayar et al., 1986; Schroit and
Fidler, 1982). Therefore, understanding how Nod ligands enter into cells will help design novel
rational strategies aiming at increasing their biological activity. Moreover, it must be noted that
in natural conditions, muramyl peptides are rarely found free in the extracellular milieu, and are
commonly associated with other bacterial cell wall components that carry fatty acid groups.
These include lipoproteins, lipoteichoic acid, mycolic acids or LPS, and might play a crucial role
in the potentiation of endocytosis-mediated entry of Nod ligands.
A recent report has demonstrated that MDP was internalized by macrophages through clathrin-
dependent endocytosis (Marina-Garcia et al., 2009), which supports our findings in HEK293T
cells. However, MDP entry in macrophages appeared to require V-ATPase-dependent endosomal
acidification, contrasting with our observations in HEK293T cells. This might be due to
differences in the endocytic trafficking machineries of phagocytic versus non-phagocytic cells.
Alternatively, it is possible that macrophages and epithelial cells rely on different transporters for
Nod ligands, which would be expressed in distinct sub-cellular compartments, such as early
endosomes or lysosomes. Indeed, a number of muramyl peptide transporters could exist and be
differentially expressed in specific cell types and/or sub-cellular compartments. This hypothesis
is supported by the fact that SLC15A1 was identified as an MDP transporter in Caco-2/bbe
epithelial cells (Vavricka et al., 2004), but found to be dispensable for mediating MDP entry in
macrophages (Marina-Garcia et al., 2009). Similarly, SLC15A2 has been shown to trigger
transport of the Nod1 ligand iE-DAP in human upper airway epithelial cells (Swaan et al., 2008),
but was found to be dispensable in our assays. Finally, it must be noted that the knockdown of
SLC15A4 expression in HEK293T cells did not result in a complete ablation of NF-B
activation induced by Nod1 ligands. This suggests that other transporters might contribute to the
transport of these peptidoglycan-derived peptides in HEK293T cells and possibly other cell
populations.
An interesting question that emerges from our studies is to determine if the limiting factor for
Nod-dependent activation is solely the cytosolic presentation of its ligands, or if endocytosis in
itself participates in driving NF-B-dependent activation of Nod1 and Nod2. Indeed, an
argument in favor of the latter hypothesis comes from the fact that membrane targetting of Nod2
87
is required for its ability to trigger NF-B (Barnich et al., 2005). Moreover, studies on TLR4
argue that the subcellular localization of this protein to early endosomes is required to drive type
I interferon responses, through the specific engagement of the adaptor protein TRAM (Kagan et
al., 2008). However, our results demonstrate that the sole presentation of Nod ligands to the host
cytosol (using the membrane permeabilizing toxin digitonin) is sufficient to recapitulate Nod-
dependent activation of NF-B. This strongly suggests that endocytosis of Nod ligands is the
most efficient means for allowing access of these molecules to the cytosol, but appears
dispensable, provided that these molecules could access the cytosol through other means. This
observation is of importance since it implies that Nod proteins could detect free muramyl
peptides generated by pathogenic bacteria that would have gained access to the host cytosol,
such as Shigella or Listeria, long after these bacteria would have ruptured the phagosome.
Our results demonstrated that an optimal luminal pH was required for efficient delivery of
muramyl peptides into the cytosol, and this correlates with the identification of SLC15A4 as a
transporter for Nod1 ligands in early endosomes. Indeed, SLC15 proteins have been shown to
display optimal transport properties at mildly acidic pH (ranging from 5.5 to 6) (Daniel and
Kottra, 2004). We have also observed that the transport of Nod1 ligands from early endosomes
was sterically gated, as iE-DAP and Tri-DAP, but not M-Tri-DAP, were efficiently internalized
in our experimental setting of transient acidosis. Again, these results are in agreement with the
current knowledge on the steric constraints for SLC15-mediated transport of oligopeptides;
indeed, studies on SLC15A1 (Fei et al., 1994) and SLC15A2 (Boll et al., 1996) have
demonstrated that these transporters have a much greater affinity for di- or tripeptides than other
oligopeptides. In this regard, cleavage of the muramyl group by endosomal hydrolytic enzymes
such as PGRP-L/PGLYRP2 might represent a prerequisite to SLC15A4-mediated transport of
Nod1 ligands to the cytosol. Consequently, we hypothesize that naturally-occurring muramyl
peptides (such as M-Tri-DAP) are likely processed by endosomal hydrolytic enzymes, which are
progressively acquired during normal endosomal maturation (Figure 4.9). Therefore, the lack of
some critical enzymes from our artificially acidified endosomes likely accounts for the
incapacity to process M-Tri-DAP adequately.
Together, our observations characterized the mechanism by which Nod ligands access the host
cytosol in human epithelial cells, and demonstrated a crucial role for endosomal uptake and pH-
dependent transport of these molecules to the cytosol by SLC15A4. Our results provide new
88
avenues for the development of therapeutic strategies aiming at either improving the uptake of
muramyl peptides, or targeting the pathway responsible for the cytosolic transport of these
bacterial molecules. A better understanding of how Nod proteins detect intracellular bacterial
peptidoglycan will provide insights into the etiology of inflammatory diseases such as asthma
and Crohn’s disease, which are associated with mutations in Nod1 and Nod2.
89
Figure 4.9. Schematic representation of the model for the entry of Nod1 ligands into
epithelial cells.
The normal entry pathway for Nod1 ligands is presented on the left, while extracellular acidosis-
induced entry is displayed on the right. We speculate that acidosis-mediated entry allows
bypassing the progressive acidification normally observed in maturing endosomes, resulting in a
different vesicular content. In particular, our results suggest that the putative M-Tri-DAP
hydrolase, which is normally present in early endosomes, would be absent from experimentally
acidified endosomes.
90
Chapter 5 Synthesis and Biological Evaluation of Biotinyl Hydrazone
Derivatives of Muramyl Peptides
This chapter was published as
Didier Blanot*, Jooeun Lee* and Stephen E. Girardin. Synthesis and Biological Evaluation of
Biotinyl Hydrazone Derivatives of Muramyl Peptides. Chemical Biology & Drug Design 2012;
79:2-8
*These authors contributed equally to this work.
Contribution of Data
All experiments/analyses were performed by Jooeun Lee, unless noted otherwise;
Figure 1 & Table 1: all of the preparation and designing hydrazone derivatives were performed
by Didier Blanot.
91
5
5.1 Abstract
Muramyl peptides derived from bacterial peptidoglycan have long been known for their ability to
trigger host innate immune responses, including inflammation and antimicrobial defense.
Muramyl peptides have also been widely studied for their role as immune adjuvants. In
mammals, the nucleotide-binding oligomerization domain (Nod) proteins Nod1 and Nod2 detect
distinct muramyl peptide structures and mediate their biological activity. Because of the poor
immunogenicity of these small peptidoglycan derivatives, research in this field is currently
limited by the lack of reagents to track or immobilize specific muramyl peptides. We present
here the generation and initial biological characterization of synthetic muramyl peptides
covalently coupled to dansyl or biotinyl derivatives, and demonstrate that biotinyl coupling on
the muramyl moiety results in derivatives that can be tracked by immunofluorescence and
maintain full biological activity, as observed by their capacity to trigger Nod signaling.
Moreover, using digitonin-mediated permeabilization techniques on live cells, we also
demonstrate that biotinylated muramyl peptides efficiently reach the host cytosol, where they
activate Nod signaling. Therefore, these derivatives represent useful probes to study the cell
biology and the biochemistry of host responses to muramyl peptides.
5.2 Introduction
It is now well established that the innate immunity system acts through detection of microbial
motifs known as PAMPs (pathogen-associated molecular patterns) (Philpott and Girardin, 2004).
Among these, peptidoglycan and its hydrolysis products, muramyl peptides, are sensed by the
intracellular Nod proteins Nod1 and Nod2. While Nod2 is a general sensor for all peptidoglycans
since it recognizes the common muramyl dipeptide (MurNAc-L-Ala-D-Glu) motif (Girardin et
al., 2003b; Girardin et al., 2003c; Inohara et al., 2003), Nod1 senses the -D-Glu-meso-A2pm
dipeptide motif found in the peptidoglycan of most Gram-negative bacteria, and the meso-A2pm
amino acid must be in terminal position for Nod1-mediated detection (Chamaillard et al., 2003;
Girardin et al., 2003a; Girardin et al., 2003c). Following detection of specific muramyl peptides,
Nod proteins trigger a wide array of inflammatory, antimicrobial and immune adjuvant responses
(Geddes et al., 2009). Using indirect approaches, we and others recently demonstrated that
muramyl peptides are efficiently internalized by mammalian cells through clathrin-mediated
92
endocytosis (Lee et al., 2009; Marina-Garcia et al., 2009). However, the lack of suitable labeled
muramyl peptides prevents direct analysis of their trafficking by immunofluorescence. In the
present work, we have synthesized and used derivatives consisting of these compounds linked
with a dansyl (Dns) or a biotinyl-6-aminohexanoyl (Bio-Ahx) probe through a hydrazone
functionality. Dansylated muramyl peptides did not display strong enough emission capacity for
the use in immunofluorescence on live cells. By contrast, biotinylated muramyl peptides with the
biotinyl group covalently linked to the muramyl group were endowed with interesting properties
since i) they demonstrated good biological activity for both Nod1 and Nod2 agonists in
luciferase assays; ii) in association with streptavidin-coupled fluorochromes, they proved to
display sensitivity compatible with their use in immunofluorescence. Using digitonin-mediated
permeabilization techniques on live cells, we also demonstrated that biotinylated muramyl
peptides efficiently reach the host cytosol, where they activate Nod signaling. Together,
biotinylated muramyl peptides appear to display an interesting versatility for their use in
different cellular assays. These molecules will therefore prove to be useful for studying the cell
biology and biochemistry of Nod signaling.
5.3 Materials & Methods
Compounds. Dansyl hydrazine (Dns-NHNH2), N-biotinyl-6-aminohexanoyl hydrazine (Bio-
Ahx-NHNH2), and L-Ala--D-Glu-meso-A2pm (Tri-A2pm) were purchased from Fluka, Pierce,
and InvivoGen, respectively.
Muramyl peptides. MurNAc and MDP were purchased from Sigma and InvivoGen,
respectively. MurNAc-L-Ala and MurNAc-L-Ala-D-Glu were synthesized according to the
published procedures (Kusumoto et al., 1976; Lefrancier et al., 1977). The other muramyl
peptides were obtained from the corresponding UDP-MurNAc-peptides (Babic et al., 2007) by
mild acid hydrolysis (0.1 M HCl, 100°C, 10 min) (Girardin et al., 2003c). The residue resulting
from the evaporation of the reaction mixture was used without purification for hydrazone
formation.
Synthesis of dansyl hydrazones. To muramyl peptide (100 nmol) dissolved in water (10 µl),
3% (w/v) trichloracetic acid (10 µl) and 1% (w/v) Dns-NHNH2 in acetonitrile (20 µl) were
added. The mixture was stirred for 20 min at 65°C and evaporated in vacuo. The product was
purified by RP-HPLC.
93
Synthesis of biotinylated hydrazones. To dry muramyl peptide (150 nmol), 7.5 mM Bio-Ahx-
NHNH2 in 30% acetonitrile (100 µl) were added. The mixture was evaporated to dryness, then
dissolved in methanol/water/acetic acid 95:4:1 (50 µl; v/v). The mixture was stirred overnight at
60°C and evaporated in vacuo. The product was purified by RP-HPLC.
Purification of hydrazone derivatives. The reaction mixture was taken up in 20% (v/v)
methanol and injected onto a column (250 4.6 mm) of Econosphere C18 (5 µm; Alltech France)
equipped with a guard column of ODS-Hypersil (Thermo-Fisher Scientific). Elution was
performed at a flow rate of 0.6 ml.min-1
with a gradient of methanol (eluent A: 20 mM
ammonium acetate in water/methanol 4:1; eluent B, 20 mM ammonium acetate in
water/methanol 1:4; gradient: 0% B from 0 to 10 min, 0 to 60% B from 10 to 50 min, 60 to
100% B from 50 to 55 min, 100% B from 55 to 60 min). The compounds were detected at either
247 nm (Dns derivatives) or 220 nm (Bio-Ahx derivatives). Peaks were collected manually,
evaporated, taken up in water and lyophilized. The compounds were finally dissolved in
water/methanol 2:1 (225 µl; v/v) and stored at -20°C.
Amino acid analysis. Samples were hydrolyzed in 6 M HCl at 95°C for 16 h. After evaporation
of the acid, the hydrolyzates were dissolved in 67 mM trisodium citrate-HCl (pH 2.2) and
injected into a Hitachi L8800 analyzer equipped with a 2620MSC-PS column (ScienceTec).
MALDI-TOF mass spectrometry. Positive spectra were recorded in the reflectron mode with
delayed extraction on a Perseptive Voyager-DE STR instrument (Applied Biosystems) equipped
with a 337-nm laser. The compound (0.5 or 1 µl) was deposited on the plate, followed by 2,5-
dihydroxybenzoic acid (1 µl at 10 mg.ml-1
in 20 mM diammonium citrate). After evaporation of
the solvents, spectra were recorded at an acceleration voltage of +20 kV and an extraction delay
time of 200 ns. External calibration was performed using the calibration mixture of the
SequazimeTM
peptide mass standard kit (Applied Biosystems).
Cell culture and reagents. Human HEK293T and HeLa epithelial cell lines (American Type
Culture Collection) were cultured in Dulbecco’s modified Eagle’s medium (DMEM),
supplemented with 5% fetal calf serum (FCS) and 1% penicillin/streptomycin. Cells were
maintained in 95% air, 5% CO2 at 37ºC. Endotoxin-free FCS and phosphate buffer saline were
from Wisent (St-Bruno, Quebec). FCS was used after heat inactivation at 56ºC for 30 min. All
94
cell culture reagents and antibiotics were also from Wisent. Dynasore (3-hydroxy-naphthalene-2-
carboxylic acid (3,4-dihydroxy-benzylidene)-hydrazide monohydrate) and digitonin were from
Sigma.
NF-B activation assays. Transfections were carried out using polyethylenimine (PEI,
Polysciences Inc., Warrington, PA) in HEK293T according to the manufacturer’s instructions.
Briefly, cells were transfected overnight with 75 ng of NF-B luciferase reporter plasmid (Ig-
luc, Invitrogen). The empty vector (pcDNA3, Invitrogen) was used to balance the transfected
DNA concentration. The expression vector for human Nod2 (0.2 ng/well) was a kind gift from
Dr. Nuñez (University of Michigan, Ann Arbor, MI). Following transfection, biotinylated
ligands were added the next day for 6 h (unless specified) before performing luciferase
measurements. For NF-B activation assays in digitonin-permeabilized cells, HEK293T were
incubated for 10 min at 37C with Nod1 ligands in isotonic digitonin buffer (Girardin et al.,
2003a) (500 l) with or without 10 g/ml digitonin, and then placed in DMEM for 6 h. The dose
of 50 nM was used for modified muramyl peptides because our previous results (Magalhaes et
al., 2005) have demonstrated that this dose typically gives a non-saturated and close to maximal
(usually from 50% to 100%) activation of Nod1 or Nod2. For positive controls (MDP and Tri-
A2pm), the dose of 10 g/ml (ca. 20 µM) was used, as it typically provides maximal response in
our assays.
Immunofluorescence. HeLa cells grown on glass coverslips were stimulated for 30 min with
biotinylated muramyl peptide or biotinylated transferrin, as indicated. Next, 2 g/ml
Streptavidin-Alexa488 (Invitrogen) was added for 30 min. In some conditions, 1 g/ml of
directly coupled Transferrin-Alexa568 (Invitrogen) was added as a positive control, as indicated.
Finally, cells were washed, fixed (4% paraformaldehyde, 15 min) and stained with DAPI to
visualize nuclei. Images were taken using Zeiss Z-1 epifluorescence microscope with a 63 oil
fluorescence objective and deconvolved using Volocity software (Quorum Technologies)
95
5.4 Results & Discussion
Muramyl peptides, obtained either by chemical synthesis or by mild acid hydrolysis of the
corresponding UDP-MurNAc-peptides, were reacted either with Dns-NHNH2 or Bio-Ahx-
NHNH2 (Fig. 1). For Dns hydrazones 1, 3 and 5, a procedure adapted from those of Mopper and
Johnson (Mopper and Johnson, 1983) and Hull and Turco (Hull and Turco, 1985) was used. For
Bio-Ahx hydrazones 2, 4 and 6-10, the method of Leteux et al. (Leteux et al., 1998) was
followed. The compounds were purified by RP-HPLC. Theoretically, such hydrazones are
mixtures of 4 isomers, two syn/anti isomers of the acyclic form and two / anomers of the
cyclic form (Shinohara et al., 1995) (Fig. 1). As a matter of fact, the desired compound appeared
as a dissymmetrical peak, or even as 2-3 overlapping peaks. The identity of the hydrazones was
established by MALDI-TOF mass spectrometry: the positive-ion spectra displayed protonated
or/and sodiated molecular ions (M+H)+ and (M+Na)
+ consistent with the calculated molecular
masses (Table 1). Yields, determined by quantitative amino acid analysis, were in general
moderate; they were higher for the biotinyl derivatives (21-95%) than for the dansyl ones (10-
21%) (Table 1).
We next tested the biological activity of these muramyl peptides and, to do so, first performed
luciferase assays in HEK293T cells. In this cellular system, HEK293T cells were first transfected
overnight with the Ig-luci reporter plasmid, which encodes for the luciferase gene whose
expression is driven by NF-B elements on its promoter. Along with the Ig-luci plasmid, cells
were transfected with expression vectors encoding either Nod1 or Nod2, in order to potentiate
the cellular responses through these Nod-like receptor proteins. Next, cells were stimulated for 6
hours with 50 nM biotinylated muramyl peptides and lysed for luciferase analysis. We observed
that only compound 7 (R1= L-Ala--D-Glu-meso-A2pm) was able to stimulate Nod1-dependent
responses (Fig. 2A), in agreement with the previously reported requirement of Nod1-activating
muramyl peptides to contain a terminal meso-A2pm (Chamaillard et al., 2003; Girardin et al.,
2003a; Girardin et al., 2003c). Indeed, compound 9 (R1= L-Ala--D-Glu-meso-A2pm-D-Ala-D-
Ala), which also has a meso-A2pm, but not in terminal position, was unable to trigger Nod1, as
we previously observed (Girardin et al., 2003c). Compound 6 (R1= L-Ala-D-Glu) was able to
trigger Nod2-dependent responses (Fig. 2B), which is in agreement with the known capacity of
MurNAc-L-Ala-D-Glu (Girardin et al., 2003c) or MurNAc-L-Ala-D-Glu-NH2 (MDP)
96
Figure 5.1 Preparation of hydrazone derivatives 1-10. See Table 1 for the nature of R1
97
Table 5.1 Yields and mass spectrometry analysis of hydrazone derivatives
aCalculated from the amount of starting material (isolated muramyl derivative for compounds 1-
6, or UDP-MurNAc-peptide for hydrazones 7-10) by quantitative amino acid analysis.
bMonoisotopic molecular mass.
cMain Peak.
98
99
Figure 5.2. Biotinylated and dansylated muramyl peptides are biologically active.
(A-B) HEK293T cells were transfected overnight with the reporter gene Ig-luci to monitor NF-
B activation, together with either of the peptidoglycan sensors Nod1 (A) or Nod2 (B). The
following day, cells were either left unstimulated or stimulated for 6 h with biotinylated muramyl
peptides (compounds are the following: 2, Bio-Ahx-MurNAc; 9, Bio-Ahx-MurNAc-L-Ala--D-
Glu-meso-A2pm-D-Ala-D-Ala; 7, Bio-Ahx-MurNAc-L-Ala--D-Glu-meso-A2pm; 6, Bio-Ahx-
MurNAc-L-Ala-D-Glu), or with the positive controls Tri-A2pm (for Nod1, in (A)) or MDP (for
Nod2, in (B)). (C) HEK293T cells were transfected overnight with Ig-luci, together with Nod2.
The following day, cells were either left unstimulated or stimulated for 6 h with dansylated
muramyl peptides (compounds are the following: 1, Dns-MurNAc; 3, Dns-MurNAc-L-Ala; 5,
Dns-MurNAc-L-Ala-D-Glu). All muramyl peptides used (biotinylated or dansylated) were added
at the final concentration of 50 nM, and positive controls were at 10 g/ml. NS, non stimulated.
100
(Girardin et al., 2003b; Inohara et al., 2003) to activate Nod2. Biotinylated compounds 4 (R1= L-
Ala), 8 (R1= L-Ala--D-Glu-L-Lys) and 10 (R
1= L-Ala--D-Glu-L-Lys-D-Ala-D-Ala) were
unable to stimulate either Nod1 or Nod2 (data not shown), in keeping with our previous results
on unmodified muramyl peptides (Girardin et al., 2003c). Moreover, in dose-response
experiments, we noted that compounds 7 and 6 were able to activate Nod1 and Nod2,
respectively, with efficiencies that were similar to the ones of the non modified muramyl
peptides, thus showing that the addition of the biotinyl group to muramyl peptides does not
significantly affect the stimulatory activity of these molecules (data not shown). Finally, we also
noted that the dansylated compound 5 (R1=L-Ala-D-Glu), but not the dansylated compounds 1
(R1= OH) and 3 (R
1= L-Ala), was able to stimulate Nod2 activity in the luciferase assay (Fig.
2C). Together, these assays demonstrate that our modified muramyl peptides are biologically
active, that the additional moiety (Dns or Bio-Ahx) does not hamper their Nod-stimulating
capacity, and that they activate Nod proteins with the same peptidic sequence requirements as
the natural muramyl peptides.
We next investigated if dansylated or biotinylated muramyl peptides could be used for direct
fluorescence or immunofluorescence, respectively, to follow their delivery and trafficking within
host cells. HeLa cells grown on coverslips were first stimulated for 30 min with dansylated
muramyl peptides. Since the dansyl group is intrinsically fluorescent (excitation = 336 nm;
emission = 531 nm), direct visualization can be achieved using an epifluorescence microscope.
Unfortunately, the fluorescence emitted by the muramyl peptides internalized into HeLa cells
was under the detection limit (data not shown), probably due to the absence of an amplification
step (typically provided by the sequential use of two antibodies).
We therefore repeated these studies using a biotinylated muramyl peptide, which has the
advantage of allowing an amplification step through the use of fluorescent streptavidin-
conjugated molecules interacting with the biotin group. HeLa cells were stimulated with
compound 7 or Biot-transferrin as a control, followed by Streptavidin-Alexa488 together with
Transferrin-Alexa568. Using this technique, we successfully detected Bio-Ahx-MurNAc-
tripeptide inside HeLa cells and demonstrated that the molecule was colocalized with transferrin,
a marker of early and recycling endosomes (Fig. 3), in agreement with previous reports showing
101
102
Figure 5.3. Internalization of biotinylated muramyl peptides in HeLa cells.
(A-C) HeLa cells grown on coverslips were first stimulated for 30 min with either medium (A), 1
g/ml Bio-Ahx-MurNAc-L-Ala--D-Glu-meso-A2pm 7 (B) or 1 g/ml Biot-Transferrin (C).
Next, 2 g/ml Streptavidin-Alexa488 (Invitrogen) were added together with 1 g/ml Transferrin-
Alexa568 (Invitrogen) for 30 min. Finally, cells were washed, fixed (4% paraformaldehyde, 15
min) and stained with DAPI to visualize nuclei. Images were taken using Zeiss Z-1
epifluorescence microscope with a 63 oil fluorescence objective and deconvolved using
Volocity software (Quorum Technologies). Transferrin-Alexa568 was used as a positive control
in our experiments. Arrows indicate biotinylated muramyl peptide-containing vesicles. Tfn,
transferrin. Biot, biotin. MP, compound 7. Strep, streptavidin.
103
that muramyl peptides are internalized into mammalian cells through clathrin-mediated
endocytosis (Lee et al., 2009; Marina-Garcia et al., 2009).
We previously demonstrated that, following internalization into endosomes, Nod1-activating
muramyl peptides were likely processed by host hydrolases in the lumen of early endosomes in
order to generate muramyl-free peptides that can be transported to the cytosol through the
oligopeptide transporter SLC15A4, and possibly other transporters (Lee et al., 2009). Therefore,
when using a biotinylated muramyl peptide to stimulate host cells, the molecule would be
cleaved in the early endosome to generate Bio-Ahx-MurNAc and free peptide, with the former
remaining in the lumen of the endosome and only the latter reaching the cytosol. We reasoned
that this could be a major limitation of the use of biotinylated muramyl peptides for projects
aiming to study the fate of muramyl peptides in the host cytosol (such as the identification of
muramyl peptide-interacting proteins by immunoprecipitation). Consequently, it was important
to demonstrate that a procedure could be used, in which delivery of the biotinylated muramyl
peptide to cytosolic Nod proteins would occur independently from endocytosis.
To circumvent this potential limitation to the use of muramyl peptides derivatives in live cells
because of endosomal processing, we stimulated HEK293T cells with biotinylated muramyl
peptides using a modified procedure that we have used previously for unmodified muramyl
peptides (Girardin et al., 2003a), in which cytosolic delivery is direct and does not require
endocytic trafficking. In this experimental set-up, HEK293T cells were first transfected
overnight with the Ig-luci reporter plasmid, along with either pcDNA3, or expression vectors
encoding for Nod1 or Nod2. The following day, biotinylated muramyl peptides were added
together with digitonin, a plant-derived toxin that destabilizes and permeabilize host membranes,
thus allowing direct delivery of molecules to the cytosol. Accordingly, cells were pulsed for 10
min in a permeabilization medium containing digitonin plus biotinylated muramyl peptides,
before replacing this buffer with regular cell culture medium for another 6 h prior to cell lysis
and luciferase measurement. Of note, we first verified in our assays that digitonin-mediated
delivery of the muramyl peptides was independent from endosomal trafficking, by showing that
activation of Nod1-dependent signaling in digitonin-permeabilized cells by MurNAc-L-Ala--D-
Glu-meso-A2pm was insensitive to dynasore, a drug that efficiently inhibits clathrin-mediated
endocytosis (data not shown).
104
Interestingly, we observed that these experimental conditions were also suitable for allowing
delivery of biotinylated muramyl peptides to the cytosol, where compounds 7 and 6 could trigger
activation of Nod1 and Nod2, respectively (Fig. 4). This demonstrates that the addition of the
biotin-hydrazone arm to muramyl peptides does not affect the capacity of the molecules to access
the cytosol through digitonin-mediated membrane permeabilization. Of note, in this experimental
system, compound 7 was able to stimulate HEK293T cells endogenously (Fig. 4A), which likely
explains why this compound also displayed activity in Nod2-overexpressing cells (see Fig. 4C).
We did not observe such a capacity of biotinylated muramyl peptides to stimulate Nod pathways
endogenously when trafficking through the endocytic machinery (see Fig. 2), even though
similar concentrations of muramyl peptides were used, which suggests that digitonin-mediated
delivery allows for a more efficient internalization of muramyl peptides than natural endocytosis.
Together, these data demonstrate that biotinylated muramyl peptides can be delivered to the host
cytosol where they efficiently trigger Nod activation. This digitonin-based procedure will
therefore be useful to study biochemical aspects of the activation of host cells by muramyl
peptides, such as the nature of the protein complexes interacting with these bacterial molecules.
Indeed, an important open question in the field of Nod biology is to determine if Nod proteins
directly interact with muramyl peptides, or if yet unknown adaptor molecules are required for
detection and activation.
5.5 Conclusions & Future Directions
These experiments validate the approach of coupling muramyl peptides to the biotin probe.
Using the biotin group as a bait, it can also be envisioned to use such derivatives to perform
biochemical analyses of the proteins interacting with these bacterial molecules. Therefore,
biotinylated muramyl peptides represent useful derivatives of Nod1/2 ligands, which will be
critical for the understanding of how muramyl peptides activate the host innate immune system.
105
Figure 5.4. Enforced internalization of biotinylated muramyl peptides is sufficient to
activate Nod1 and Nod2.
(A-C) HEK293T cells were transfected overnight with the reporter gene Ig-luci to monitor NF-
B activation, together with the empty vector pcDNA3 (A) or either of the peptidoglycan sensors
Nod1 (B) or Nod2 (C). The following day, cells were transiently permeabilized using digitonin,
in the presence or absence of biotinylated muramyl peptides (2, Bio-Ahx-MurNAc; 9, Bio-Ahx-
MurNAc-L-Ala--D-Glu-meso-A2pm-D-Ala-D-Ala; 7, Bio-Ahx-MurNAc-L-Ala--D-Glu-meso-
A2pm; 6, Bio-Ahx-MurNAc-L-Ala-D-Glu), or with the positive controls Tri-A2pm (for Nod1, in
(A-B)) or MDP (for Nod2, in (C)), as indicated, and luciferase activity was measured 4 h post-
stimulation (B-D). All biotinylated muramyl peptides used were added at the final concentration
of 50 nM, and positive controls were at 10 g/ml. NS, non stimulated.
106
Chapter 6 The Role of Mouse Peptidoglycan Recognition Protein PGLYRP2 in the Innate Immune Response to Salmonella enterica serovar
Typhimurium Infection in vivo
This chapter was published as
Jooeun Lee, Kaoru Geddes, Catherine Streutker, Dana J. Philpott and Stephen E. Girardin. The
Role of Mouse Peptidoglycan Recognition Protein PGLYRP2 in the Innate Immune Response to
Salmonella enterica serovar Typhimurium Infection in vivo. Infection and Immunity 2012 May
21 (PMID: 22615249). *Selected as a Spotlight Article in the Issue 8, Volume 80, August 2012
Contribution of Data
All experiments/analyses were performed by Jooeun Lee, unless noted otherwise;
Figure 5.4 and 5.5 – histological scoring of cecum samples was performed by Catherine
Streutker. The subsequent analysis of the data was performed by Jooeun Lee.
107
6
6.1 Abstract
Peptidoglycan recognition proteins (PGRPs or PGLYRPs) are a family of innate pattern
recognition molecules that bind bacterial peptidoglycan. While the key role of PGRPs in
Drosophila innate immunity has been extensively studied, how the four mammalian PGLYRP
proteins (PGLYRP1-4) contribute to host defense against bacterial pathogens in vivo remains
poorly understood. PGLYRP1, PGLYRP3 and PGLYRP4 are directly bactericidal in vitro
whereas PGLYRP2 is an N-acetylmuramyl-L-alanine amidase that cleaves peptidoglycan
between the sugar backbone and the peptide stem. Because PGLYRP2 cleaves muramyl peptides
detected by host peptidoglycan sensors Nod1 and Nod2, we speculated that PGLYRP2 may act
as a modifier of Nod1/Nod2-dependent innate immune responses. We investigated the role of
PGLYRP2 in Salmonella enterica serovar Typhimurium induced colitis, which is regulated by
Nod1/2 through the induction of an early Th17 response. PGLYRP2 did not contribute to
expression of Th17-associated cytokines, IL-22-dependent antimicrobial proteins, or
inflammatory cytokines. However, we found that Pglyrp2-deficient mice displayed significantly
enhanced inflammation in the cecum at 72h post-infection, reflected by increased
polymorphonuclear leukocyte infiltration and goblet cell depletion. Pglyrp2 expression was also
induced in the cecum of Salmonella-infected mice. Furthermore, expression of green fluorescent
protein under control of Pglyrp2 promoter was increased in discrete populations, including
intraepithelial lymphocytes, in response to infection. Lastly, Nod2/
Pglyrp2/
mice displayed a
more severe early susceptibility to infection at 24h post-infection than Pglyrp2/
mice, which
correlated with increased PMN infiltration and submucosal edema. Thus, PGLYRP2 plays a
protective role in vivo in the control of S. Typhimurium infection through a Nod1/2-independent
mechanism.
6.2 Introduction
Innate immunity, the first line of defense against microorganisms, relies on pattern recognition
molecules (PRMs), such as Toll-like receptors (TLRs) or nucleotide-binding and oligomerization
domain (Nod)-like receptors (NLRs), which initiate protective responses against pathogens by
detecting microbe-associated molecular patterns (MAMPs) (Fritz et al., 2006). In the intestine,
mucosal defense against enteric pathogens critically depends on the expression of TLRs and
108
NLRs (Uematsu and Fujimoto, 2010), and these PRMs also contribute to the establishment of a
homeostatic control of the intestinal microbiota (Magalhaes et al., 2007; Rakoff-Nahoum et al.,
2004).
Peptidoglycan is an essential component of the cell wall of virtually all bacteria, and is sensed
by a variety of PRMs in the mammalian host, including Nod1, Nod2 and peptidoglycan
recognition proteins (PGRPs or PGLYRPs) (Girardin and Philpott, 2004; Royet and Dziarski,
2007). Nod1 and Nod2 are two well characterized members of the NLR family that detect
peptidoglycan-derived muramyl peptides (Geddes et al., 2009). Specifically, Nod1 detects
mesoDAP (diaminopimelic acid)-containing muramyl tripeptides found mostly in Gram-negative
bacteria (Chamaillard et al., 2003; Girardin et al., 2003a) whereas Nod2 recognizes muramyl
dipeptide (MDP), a peptidoglycan motif found in both Gram-negative and Gram-positive
bacteria (Girardin et al., 2003b; Inohara et al., 2003). PGRPs, first identified in silkworm
(Yoshida et al., 1996), are conserved from insects to mammals, and are characterized by their
ability to bind peptidoglycan (Royet and Dziarski, 2007). In mammals, there are four PGRPs,
namely PGLYRP1, PGLYRP2, PGLYRP3, and PGLYRP4 (initially named PGRP-S, -L, Iα, and
I, respectively). PGRPs are all capable of binding peptidoglycan (Royet and Dziarski, 2007);
PGLYRP1, PGLYRP3, and PGLYRP4 are directly bactericidal (Kashyap et al., 2011; Lu et al.,
2006; Tydell et al., 2006; Wang et al., 2007), but have no amidase activity (Kashyap et al., 2011;
Lu et al., 2006; Wang et al., 2003), whereas PGLYRP2 is a N-acetylmuramyl-L-alanine amidase
that hydrolyzes peptidoglycan between the sugar backbone and the peptide chain (Gelius et al.,
2003; Wang et al., 2003).
PGLYRP2 is constitutively expressed in the liver where it is secreted into the blood (Xu et al.,
2004; Zhang et al., 2005), and its expression is induced by bacteria and cytokines in the skin and
in epithelial cells including those that line the intestinal tract (Uehara et al., 2005; Wang et al.,
2005). Interestingly, based on the fact that PGLYRP2 cleaves muramyl peptides that are also
detected by Nod1 and Nod2, it is possible that this PGRP protein could act as a modulator of
Nod-dependent responses. In Drosophila, PGRP-LB also has amidase activity, which was shown
to protect the host from excessive immune responses by reducing the biological activity of
peptidoglycan (Paredes et al., 2011; Zaidman-Remy et al., 2006). However, it remains unclear
whether the amidase activity of mammalian PGLYRP2 plays a similar anti-inflammatory
scavenger function in vivo, in response to bacterial pathogens.
109
Despite the fact that PGRPs specifically bind bacterial peptidoglycan and that some of them
display antibacterial activity in vitro (Lu et al., 2006; Tydell et al., 2002; Tydell et al., 2006;
Wang et al., 2007), the in vivo role of these molecules in host defense against bacterial
pathogens remains poorly understood in mammals. One study showed a requirement for
PGLYRP1 in resistance to some infections in mice, as Pglyrp1-deficient mice showed increased
susceptibility to systemic infection with Bacillus subtilis and Micrococcus luteus, but not with
other Gram-positive bacteria (Staphylococcus aureus) and Gram-negative bacteria (Escherichia
coli) (Dziarski et al., 2003). More recently, another study suggested a role of PGLYRP1 in host
resistance against Listeria monocytogenes through the induction of TNF (Osanai et al., 2011).
Similarly, using recombinant PGLYRP3 in wild-type mice, a bactericidal role of PGLYRP3 in
preventing S. aureus lung infection in mice has also been suggested (Lu et al., 2006). In contrast,
PGLYRP2 was suggested to be redundant for immunity in mice, on the basis of the fact that
Pglyrp2-deficient mice had a normal response to intraperitoneal infection with Gram-positive (S.
aureus) or Gram-negative (E. coli) bacteria (Xu et al., 2004). It is possible that the four
mammalian PGRP proteins display some redundant functions in innate immunity, thus resulting
in mild phenotypes for mice lacking any of these molecules. In support for this, in a dextran
sulfate sodium (DSS)-induced colitis model, all four individual PGRP knockout mice displayed
relatively similar increased sensitivity to DSS and altered immune responses (Saha et al., 2010).
However, PGLYRP2 is unique among mammalian PGRP proteins in that it is the only
mammalian protein known to have N-acetylmuramyl-L-alanine amidase activity against
peptidoglycan, and this protein is one of the most abundantly secreted enzymes in the body fluids
of mammals (Vanderwinkel et al., 1995). We therefore speculated that PGLYRP2 might have a
unique role in host defense that had not been identified previously using in vitro assays or
intraperitoneal infection models, such as a role in mucosal innate immune defense.
Salmonella enterica serovar Typhimurium (SL1344) causes acute colitis in humans while the
same organism causes a systemic disease with little or no intestinal inflammation in mice
(Hapfelmeier and Hardt, 2005). However, when mice are pre-treated with the antibiotic
streptomycin prior to infection with S. Typhimurium, they develop an acute inflammatory
response in the cecum (Hapfelmeier and Hardt, 2005). Recently, Nod1 and Nod2 have been
shown to modulate inflammation in the streptomycin-treated mouse model of Salmonella colitis
(Geddes et al., 2010). Given that PGLYRP2 recognizes and hydrolyzes peptidoglycan fragments
110
that are also detected by Nod1 and Nod2, and because mammalian PGLYRP2 is expressed in the
intestine (Duerr et al., 2010; Saha et al., 2010), we hypothesized that PGLRYP2 may play an
important role in modulating Nod1 and Nod2 dependent inflammation in the gut. Therefore, we
investigated the role of PGLYRP2 in a murine model of S. enterica serovar Typhimurium colitis.
6.3 Materials and Methods
Mice. Pglyrp2-deficient (Pglyrp2/
) mice were originally obtained from Dr. Richard Locksley
and C57BL/6 (wild-type) mice were purchased from Charles River Laboratories (Wilmington,
MA). All mice were bred and housed under specific-pathogen-free conditions in the animal
facility of the Center for Cellular and Biomolecular Research, Toronto, Canada. All animal
experiments were approved by the Animal Ethics Review Committee of the University of
Toronto. In order to minimize variables affecting the outcome of this study, C57BL/6 WT mice
were first crossed with fully backcrossed Pglyrp2/
mice (Xu et al., 2004) to generate
heterozygous F1 littermates and subsequently, these F1 mice were crossed again to generate F2
littermates. Genotyping F2 littermates was performed using the following primer sets: for WT;
5’-GGCTCTCTACTCCCACACAACC-3’, 5’- GCAGCAATCCAAGCACGATCC-3’, and for
Pglyrp2; 5’-GGCTCTCTACTCCCACACAACC-3’, 5’-GCCGGACACGCTGAAC TTGTGG-
3’. WT and Pglyrp2/
mice generated from littermates were used in all our infection studies, and
Pglyrp2+/
mice were used to study GFP+ PGLYRP2 expression by flow cytometry.
Nod1/
Pglyrp2/
DKO and Nod2/
Pglyrp2/
DKO mice were generated by crossing either
Nod1/
(Millennium Pharmaceuticals) or Nod2/
mice (Prof. Jean-Pierre Hugot, (Barreau et al.,
2007)) with Pglyrp2/
mice littermates generated from above. Genotyping was carried out using
the following primer sets: for Nod1; 5’-CTTAGGCATGACTCCCTCCTGTCG-3’, 5’-
GATCTTCAGCAGTTTAATGTGGGAG TGAC-3’, 5’-CCATTCAGGC TGCGCAA
CTGTTG-3’, and for Nod2; 5’-AACCGCATT ATTCGATGGGGC-3’, 5’-GTCATTTCC
TGACCTCTGACC-3’, 5’-GCCTGCTCTTTA CTGAAGGCTC-3’.
Bacterial infections. 8 to 10 week-old WT and Pglyrp2/
mice were fasted for 3h prior to oral
administration of 20mg of streptomycin. Mice were again fasted for 3h after twenty-one hours
following streptomycin treatment, and then infected via oral gavage with 5 x 107 CFU of
SL1344, a streptomycin-resistant strain of Salmonella enterica serovar Typhimurium. Overnight
111
cultures of SL1344 were washed with phosphate-buffered saline (PBS), diluted to the desired
CFU level based on optical density readings at 600nm and used for infections.
Pathological scoring. The distal half of cecum samples were collected for histology after mice
were sacrificed, fixed in 10% formalin and then stained with hematoxylin and eosin (H/E) at the
Toronto Center of Phenogenomics by standard histological staining procedures. H/E-stained
cecum samples were then analyzed in blinded manner by a pathologist specializing in intestinal
inflammation. The scoring system was based on a previous publication (Barthel et al., 2003) that
was slightly modified to make the scoring of neutrophil (PMN) recruitment and goblet cell
depletion more empirical (Geddes et al., 2010).
Bacterial load quantification. The spleen and cecal tissue samples were collected from infected
mice and placed in PBS containing 1% Triton X-100 or PBS, respectively, and then
homogenized using a rotor homogenizer. A small (10l) cecal sample was further diluted in PBS
containing 1% Triton X-100. Both splenic and cecal samples were then serially diluted in PBS
and plated on MacConkey agar containing 50g/ml streptomycin.
Quantitative real-time PCR. Cecum samples for qRT-PCR were collected and stored in
RNAlater (Sigma), then RNA was extracted with Qiagen RNeasy Extraction kits. Genomic DNA
was digested with Turbo DNase (Ambion) before reverse transcription to cDNA with
SuperScript RTIII (Invitrogen). qRT-PCR was performed with SYBR Green (Applied
Biosystems). The following primer sequences, which have been described elsewhere, were used
in the current study: Il17a, forward, 5’-GCTCCAGAAGGCCCTCAGA-3’, reverse, 5’-
CTTTCCCTCCGCATTGACA-3’; Il22, forward, 5’- TCCGAGGA GTCAGTGCTAAA-3’,
reverse, 5’-AGAACGTCTTCCAGGGTGAA-3’; housekeeping gene Rpl19, forward, 5’-
GCATCCTCATGGAGCACAT-3’, reverse, 5’-CTGGTCAGC CAGGAGCTT-3’; RegIII,
forward, 5’-ATGGCTCCTATTGCTATGCC-3’, reverse, 5’-GATGTCCTGAGGGCCTCTT-3’;
Lcn2, forward, 5’-ACATTTGTTCCAAGCTCCAG GGC-3’, reverse, 5’-
CATGGCGAACTGGTTGTAGTCCG-3’; Il1, forward 5’-TTGACGGACCCCAAAAGATG-
3’, reverse 5’- AGAAGGTGC TCATGTCCTCAT’; KC, forward 5’-
ACTGCACCCAAACCGAAGTC-3’, reverse 5’-CAAGGGAGCTTCA GGGTCAA-3’;
Pglyrp2, forward, 5’-ACCAGGATGTGCGCAAGTGGGAT-3’ reverse, 5’-
112
AGTGACCCAGTGTAGTTGCCCA-3’. Values were calculated using the Ct method and were
normalized to the housekeeping gene Rpl19.
Lamina propria lymphocyte and intraepithelial leukocyte isolation. Cecal IELs and LPLs
were prepared using a previously established protocol (Geddes et al., 2011). Briefly, cecal tissues
were extracted, washed and cut into 1 to 2cm segments which were incubated three times (37C,
10min, shaking) in stripping buffer (PBS, 1% FBS, 5mM EDTA, 1mM DTT). After each
incubation, the buffer was filtered through a 100-m cell strainer and then allowed to settle.
Supernatants (IELs) were then collected, washed twice in DMEM (20% FBS) and passed
through a 40-m cell strainer. For LPLs extraction, the tissue segments following stripping were
minced and put in digestion buffer (DMEM, 20% FBS, 2mg/ml collagenase D (Roche), 20g/ml
DNase I (Sigma)) for two 30-min incubations with shaking at 37C. Digested material was
passed through a 100-m cell strainer, and the cells were collected by centrifugation (5min,
1200rpm), washed twice in DMEM and then passed through a 40-m cell strainer to obtain
LPLs.
Flow cytometry. Dead cells were stained with Live/Dead Aqua (Invitrogen), and then LPLs and
IELs were stained for surface antigens, CD8, CD4, TCR, TCR, CD11c, CD11b, MHCII,
CD19, NK1.1, and Gr1 and analyzed for GFP expression. All flow cytometric analyses were
performed using a LSR II (BD Bioscience) flow cytometer, and analyzed with FlowJo software
(TreeStar).
Statistical analyses. The results are given as means ± standard error of mean. Student’s t tests
were performed using Graphpad (Prism), and P values < 0.05 using a 95% confidence interval
were considered significant.
6.4 Results
PGLYRP2 is constitutively expressed in some subsets of IEL and LPL in the cecum.
Pglyrp2 mRNA expression in the total intestinal tissues has been previously described (Saha et
al., 2010). In addition, Pglyrp2 expression was recently characterized in small intestinal
intraepithelial leukocytes (IELs), with the majority of its expression in T lymphocytes (Duerr et
al., 2010). Here, we focused on the cecum, since this portion of the intestine was recently found
113
to be critical for Nod1/2-dependent control of enteric bacterial pathogens (Geddes et al., 2010;
Geddes et al., 2011). The Pglyrp2-deficient (Pglyrp2/
) mice used in this study express green
fluorescent protein (GFP) under the control of the Pglyrp2 promoter (Xu et al., 2004), and
therefore, we used flow cytometry to monitor PGLYRP2 expression in cecal IELs and lamina
propria lymphocytes (LPLs) by tracking GFP expression in Pglyrp2/
mice (to avoid a possible
effect on immune cell populations that may occur due to loss of PGLYRP2 expression in
Pglyrp2/
mice). At steady-state, we confirmed the previously reported high expression of
PGLYRP2 in lymphocytes from liver and spleen (data not shown) (Duerr et al., 2010). We also
detected strong expression of GFP cells in the IELs of the cecum, mainly in CD4+TCR+
(49.7%), CD8+TCR+ (73.5%) lymphocytes, natural killer cells (NK1.1+TCR, 76.2%) and
natural killer T cell (NK1.1+TCR+, 71.4%) populations (Fig. 5.1A, Table 5.1). In contrast to a
previous report where PGLYRP2 expression was found to be restricted to T lymphocytes from
intestinal IELs (Duerr et al., 2010), we observed that dendritic cells (CD11c+MHCII+, 49.7%),
and inflammatory monocytes (CD11b+CD11c+, 23.5%) from the cecal IEL compartment also
exhibited a varying degree of GFP+ PGLYRP2 expression (Fig. 5.1A, Table 5.1). Conversely,
minimal GFP+ PGLYRP2 expression was observed on CD19+ (3.9%) subset from IELs,
indicating absence of reporter gene expression by B lymphocytes. Moreover, no significant
GFP+ PGLYRP2 expression was noted in CD11b+CD11c
(granulocytes/macrophage/neutrophil) cells (data not shown), and further staining with Gr1
marker indicated that neither neutrophils (CD11b+CD11cGr1+, 1.7%) nor macrophages
(CD11b+CD11cGr1, <1.0%) expressed significant level of GFP+ PGLYRP2 at baseline
(Table 5.1). Similar results were obtained for cecal LPLs, except in NK1.1+TCR+ (1.95%),
CD11c+MHCII+ (<1.0%), and CD11b+CD11c+ (<1.0%) where no significant GFP+ expression
was detected (Fig. 5.1B, Table 5.1). Overall, PGLYRP2 is constitutively expressed by various
leukocytes from the cecum.
114
115
Figure 6.1. Analysis of PGLYRP2 expression in intestinal cellular subsets.
Intraepithelial leukocytes (IEL) and lamina propria lymphocytes (LPL) were prepared from cecal
samples of wild-type and Pglyrp2+/
mice, stained with various surface markers (CD4+, TCR+,
CD8+, CD19+, NK1.1+, CD11c+) and analyzed by flow cytometry for GFP expression.
Histograms show expression of GFP+ cells on gated subsets (CD4+TCR+, CD8+TCR+,
CD19+, NK1.1+TCR+, NK1.1+TCR, CD11c+MHCII+) from IEL (A) and LPL (B). The
percentage of GFP-expressing cells in Pglyrp2+/
mice was determined using wild-type cells as a
baseline (shaded area). One representative of three experiments is shown, three mice were
pooled for each group.
116
Table 6.1. Detailed characterization of the cecal leukocyte population expressing reporter
gene carrying the GFP+ under the control of the Pglyrp2 promoter at steady-state.
The data shown is the average of three independent experiments as mean ± s.e.m.
117
PGLYRP2 expression is increased in the cecum during late inflammatory responses against
SL1344 infection.
PGLYRP2 expression is induced in intestinal epithelial cells and fibroblasts by bacteria and
cytokines (Ma et al., 2010; Uehara et al., 2005; Wang et al., 2005). Thus, we aimed to analyze
whether PGLYRP2 expression changed following oral infection with S. enterica serovar
Typhimurium SL1344. To this end, C57BL/6 wild-type (WT) mice were treated with
streptomycin and infected with 5 x 107 CFU of the streptomycin-resistant Salmonella strain,
SL1344. We performed quantitative real-time PCR (qRT-PCR) on the cecum samples from the
WT mice following SL1344 infection to determine Pglyrp2 mRNA expression. Although no
difference in expression was observed at 24h, the level of Pglyrp2 showed approximately 1.7-
and 2.3-fold increase at 48h (p=0.02) and 72h (p=0.03) post-infection, respectively, compared to
the uninfected controls (Fig. 5.2A). In order to determine which cell types contributed to the
increase in Pglyrp2 expression, we analyzed IELs and LPLs from Pglyrp2+/
ceca infected with
Salmonella at 48h by flow cytometry. The analysis of GFP expression in CD8+TCR+ cells
from the IEL compartment showed a significantly increased expression of PGLYRP2 (p=0.04)
following infection (Fig. 5.2B). A similar increase in expression (p= 0.05) was noted in
CD8+TCR+ cells, although this corresponded to a minor IEL population (Fig. 5.2B). On the
other hand, no significant difference in the GFP+/PGLYRP2 expression was observed in cells
from LPL compartment (Fig. 5.2C). It appears that IEL CD8+TCR+ lymphocytes, the most
abundant subset found among cecal leukocyte populations, also displayed the most prominent
increase in the expression of PGLYRP2 following Salmonella infection. Together, these results
establish that PGLYRP2 is readily induced in specific immune cell subsets of the intestinal
mucosa, in response to enteric infection with Salmonella, thus suggesting a role for this
peptidoglycan-interacting molecule in host defense in vivo.
118
Figure 6.2. Pglyrp2 expression is increased in the cecum following Salmonella infection.
qRT-PCR was used to measure the expression of Pglyrp2 in the cecum from uninfected and
infected WT mice at 24h, 48h and 72h (A). The expression is normalized to the housekeeping
gene Rpl19 (six to eight mice per group per experiment. n=3. *P<0.05). Bar graph (A) shows
average fold change over uninfected controls (n=3). The average relative number of GFP+ cells
in different populations (CD4+TCR+, CD8+TCR+, CD8+TCR+, NK1.1+TCR,
NK1.1+TCR+, CD19+, CD11c+MHCII+, Gr1+CD11b+) in cecal IELs (B) and LPLs (C) from
Pglyrp2/
mice uninfected or 48h after infection with SL1344, as quantified by flow cytometry
analysis (n=3, three mice pooled per group, *P<0.05).
119
PGLYRP2 does not play a role in early Nod1/2-dependent Th17 response to Salmonella
infection. As shown above, PGLYRP2 is expressed in immune cell population of the intestinal
mucosa, and Pglyrp2 mRNA levels are significantly elevated in this tissue in response to
Salmonella infection (Figs. 5.1 and 5.2). We then speculated that PGLYRP2, through its capacity
to bind or to hydrolyze peptidoglycan, may serve as a modulator of Nod1/2-dependent host
defense in response to Salmonella infection. Therefore, we investigated the putative role of
PGLYRP2 in Th17-dependent inflammation in Salmonella colitis, because this arm of the host
response to Salmonella was shown to depend on Nod1 and Nod2 (Geddes et al., 2010; Geddes et
al., 2011). To this end, WT and Pglyrp2/
mice were treated with streptomycin and infected with
5 x 107 CFU of SL1344. Mice were sacrificed at 24h, 48h or 72h following infection, and then
their ceca were homogenized for analysis. qRT-PCR analysis of Il17a, and Il22 from WT and
Pglyrp2/
cecum revealed no significant changes in their expression over the period of infection
(Fig. 5.3A). Moreover, the expression of Lcn2 (encoding lipocalin 2) and RegIII (encoding
regenerating islet-derived III), the antimicrobial proteins important for IL-22-dependent
mucosal defense against enteric bacteria (Raffatellu et al., 2009), did not change significantly in
the cecum of Pglyrp2/
mice compared to that of WT mice (Fig. 5.3B).
Nod1 and Nod2 regulate the levels of key inflammatory cytokines such as the keratinocyte-
derived chemokine (KC) and IL-1 during Salmonella colitis (Geddes et al., 2010). Therefore,
we assessed the impact of PGLYRP2 on the expression of the cytokines KC and Il1 during
infection. qRT-PCR analysis from WT and Pglyrp2/
cecal samples showed no significant
differences in the mRNA level of these inflammatory cytokines (Fig. 5.3C), suggesting that,
unlike Nod1 and Nod2, PGLYRP2 expression does not have an impact on the level of these
inflammatory cytokines during Salmonella infection. Overall, these findings indicate that
PGLYRP2 does not modulate Nod1-, and Nod2-dependent early Th17 inflammatory responses
during Salmonella colitis.
120
121
Figure 6.3. PGLYRP2 does not modulate Nod-dependent early Th17 responses or
inflammatory cytokine responses to Salmonella infection.
qRT-PCR was used to measure the mRNA level of (A) Il17a, Il22, (B) Lcn2, RegIII, and (C)
KC, Il1 in cecal samples from streptomycin-treated WT and Pglyrp2/
mice infected with 5 x
107 CFU of SL1344 for 24 to 72h. Line graphs show the average expression levels of Il17a and
Il22 in infected samples over time (A). Bar graphs depict the average expression levels of
antimicrobial peptides, Lcn2, RegIII (B) and inflammatory cytokines, KC, and Il1 (C) in both
uninfected and infected samples at 72h. The expression is normalized to the housekeeping gene
Rpl19 (six to eight mice per group per experiment. One representative of three experiments is
shown). Error bars represent 1 standard error of the mean (s.e.m). NS: not significant.
122
Pglyrp2-deficient mice have increased inflammation in the cecum following Salmonella
infection. Although PGLYRP2 does not appear to affect the Nod1/2-dependent Th17
inflammatory responses, this does not exclude a possibility that PGLYRP2 may still play a role
independent of Nod1 and Nod2 in Salmonella colitis. To test this hypothesis, we stained cecum
samples from uninfected and infected WT and Pglyrp2/
mice and performed histological
analysis. The analyzed features included polymorphonuclear leukocyte (PMN) accumulation,
goblet cell depletion, edema, and epithelial erosion, which were blindly scored using a
previously established scoring system (see Materials and Methods) (Fig. 5.4A). Although
infected Pglyrp2/
mice displayed no change in cecal inflammation compared to that of infected
wild-type mice at early stages of infection (24-48h) (Fig. 5.4A-B), we noticed that the level of
infiltrating PMNs was significantly higher in Pglyrp2/
mice than WT mice at 48h post-
infection (p=0.04) (Fig. 5.4C). Moreover, goblet cell depletion was also significantly elevated at
48h post-infection in Pglyrp2/
mice, relative to WT mice (p= 0.01) (Fig. 5.4D). Despite the
absence of significant differences at early time points of infection, we observed at 72h post-
infection a marked increase in cecal inflammation in Pglyrp2/
mice (p= 0.02) (Fig. 5.4A-B).
This was reflected by significantly enhanced PMN recruitment, and goblet cell depletion in
infected Pglyrp2/
mice, compared to WT mice (p=0.03, and 0.003, respectively) (Fig. 5.4C-D).
It must be noted that this increase in pathology did not follow the pathology seen in
Nod1/Nod2
double knockout (DKO) mice, where inflammation is significantly reduced
following infection (Geddes et al., 2010). Finally, spleens and cecal tissue samples were
examined from the same infected mice as those used for histological analysis to determine
bacterial colonization and spread. Although Pglyrp2/
mice had levels of colonization similar to
those of WT mice in both spleen and cecum samples, a trend toward increased bacterial load
(p=0.07) was observed in Pglyrp2/
cecal tissues at 72h post-infection, compared to WT cecal
tissues (Fig. 5.4E-F). Thus, our findings indicate that PGLYRP2 plays a protective role during
the late stage of Salmonella colitis, and that this role is independent from Nod1- and Nod2-
induced control of inflammation.
123
124
Figure 6.4. Pglyrp2/
mice have increased inflammation following SL1344 infection.
Streptomycin-treated WT or Pglyrp2/
(KO) mice were either PBS-treated (uninfected) or
infected with 5 x 107 CFU of SL1344 for 24 to 72h, then their ceca were examined for
histological changes and bacterial loads. For histological changes, the average pathological
scores for each analyzed feature (edema, neutrophil recruitment, goblet cell depletion, and
epithelial erosion) for all mice from each group was calculated (A) as well as the average total
sum of the pathological scores (B). The line graphs depict the average numbers of PMNs (C) and
goblet cells (D) observed per microscopic field from infected samples over the period of
infection. For bacterial loads, CFU counts were determined on cecal tissue (E) and spleen (F)
samples from infected mice (n=3, six to eight mice per group per experiment). Error bars
represent 1 s.e.m. Significant: *, P < 0.05; **, P < 0.01.
125
Cecal inflammation is greatly exacerbated in Nod2/
Pglyrp2/
DKO mice following 24h
post-infection with Salmonella SL1344. Next, we sought to investigate whether PGLYRP2
differentially influence Nod1 or Nod2 response to bacterial peptidoglycan in vivo. In order to
carry out the investigation, we first crossed our Pglyrp2/
mice with either Nod1/
or Nod2/
mice to generate the double knock-outs (DKO) of Nod1/
Pglyrp2/
and Nod2/
Pglyrp2/
. We
then performed histological analysis on the cecum samples from uninfected and infected WT,
Pglyrp2/
, Nod1/
Pglyrp2/
DKO and Nod2/
Pglyrp2/
DKO mice at 24h. The individual
pathological features were scored (Fig. 5.5A) and were subsequently combined to calculate the
average pathological scores (Fig. 5.5B). Infected Nod1/
Pglyrp2/
DKO mice displayed no
significant change (p=0.12) in cecal inflammation compared to that of infected WT or Pglyrp2/
mice at 24h (Fig. 5.5B). Interestingly, however, we observed that the level of cecal inflammation
was greatly elevated (p=0.005) in Nod2/
Pglyrp2/
DKO mice at 24h p.i. with Salmonella (Fig.
5.5B). This increase was attributed to significantly higher level of infiltrating PMNs (p=0.003),
as well as increased percentage of submucosal edema (p=0.005) in the cecal tissue of
Nod2/
Pglyrp2/
DKO mice compared to that of the WT mice (Fig. 5.5C-D). In contrast, goblet
cell depletion did not seem to contribute to this enhanced phenotype as no difference was
observed in the levels from the cecum of either WT or Nod2/
Pglyrp2/
DKO mice (data not
shown). Finally, both Nod1/
Pglyrp2/
DKO and Nod2/
Pglyrp2/
DKO mice had similar
levels of colonization compared to those of WT mice in both spleen and cecum samples at 24h
post-infection (Fig. 5.5E-F). In conclusion, Nod2/
Pglyrp2/
DKO mice seem to have
exacerbated inflammatory response to Salmonella infection than Nod1/
Pglyrp2/
DKO mice,
suggesting that PGLYRP2 may differentially regulate the response by Nod1 and Nod2 to
bacterial peptidoglycan, and that Nod2 signaling is likely intact and confers early protection
against Salmonella infection in Pglyrp2/
mice.
126
127
Figure 6.5. Nod2/
Pglyrp2/
mice have significantly increased inflammation at 24h
following SL1344 infection.
Streptomycin-treated WT, Pglyrp2/
(KO), Nod1/
Pglyrp2/
(PG1), Nod2/
Pglyrp2/
(PG2)
mice were either PBS-treated (uninfected) or infected with 5 x 107 CFU of SL1344 for 24h, then
their ceca were examined for histological changes and bacterial loads. For histological changes,
the average pathological scores for each analyzed feature (edema, neutrophil recruitment, goblet
cell depletion, and epithelial erosion) for all mice from each group was calculated (A) as well as
the average total sum of the pathological scores (B). The line graphs depict the average numbers
of PMNs (C) and the percentage of submucosal edema (D) observed per microscopic field from
infected samples over the period of infection. For bacterial loads, CFU counts were determined
on cecal tissue (E) and spleen (F) samples from infected mice (n=3, six to eight mice per group
per experiment). Error bars represent 1 s.e.m. Significant: *, P < 0.05; **, P < 0.01; NS, non-
significant.
128
6.5 Discussion
In the present study, we investigated the role of PGLYRP2 in Salmonella enterica serovar
Typhimurium induced colitis. We found that Pglyrp2 expression was increased in the cecum of
Salmonella-infected mice and, by flow cytometry, we observed that expression of GFP was
increased in discrete populations, including cecal lymphocytes in response to infection. Our
results also demonstrated that PGLYRP2 did not contribute to the expression of Th17-associated
cytokines, IL-22-dependent antimicrobial proteins, or inflammatory cytokines. However,
Pglyrp2-deficient mice displayed significantly enhanced inflammation in the cecum at 72h post-
infection, reflected by increased PMN infiltration and goblet cell depletion, thus showing for the
first time a role for PGLYRP2 in host defense against an enteric bacterial pathogen in vivo.
Moreover, Nod2/
Pglyrp2/
DKO mice displayed highly elevated level of inflammation at an
earlier time point (24h p.i. infection) compared to its counterparts, WT, Pglyrp2/
, and
Nod1/
Pglyrp2/
DKO mice, suggesting intricate and complex relationships among these
PRMs.
The processing and degradation of peptidoglycan by host enzymes such as PGLYRP2 and
lysozyme can indirectly influence bacterial sensing by pattern-recognition receptors, such as
Nod1 and Nod2. While lysozyme cleaves the sugar chain between GlcNAc (N-
acetylglucosamine) and MurNAc (N-acetylmuramic acid), PGLYRP2 specifically hydrolyzes the
lactyl bond between MurNAc and L-Ala, generating free peptide fragments, nonetheless still
recognized by Nod1 (such as the tripeptide L-Ala-D-Glu-mesoDAP or the tetrapeptide L-Ala-D-
Glu-mesoDAP-D-Ala) (Girardin et al., 2003a; Magalhaes et al., 2005). Similarly, PGLYRP2 was
shown to hydrolyze the lysine-containing muramyl tripeptide MurNAc-L-Ala-D-Glu-Lys into L-
Ala-D-Glu-Lys (Wang et al., 2003), which can no longer be recognized by Nod2 (Girardin et al.,
2003b). Interestingly, the minimum peptidoglycan fragments hydrolyzed by PGLYRP2 are
muramyl tripeptides (containing either mesoDAP or Lys), and therefore, the typical Nod2 ligand
MDP is not cleaved by PGLYRP2 (Wang et al., 2003), suggesting that MDP could remain
biologically active to stimulate Nod2 regardless of the presence or absence of PGLYRP2. For
this reason, it is likely that the hydrolytic activity of PGLYRP2 is not sufficient to functionally
degrade Nod1/2-specific peptidoglycan fragments in vivo, although this has not been directly
tested. In particular, it remains possible that, although MurNAc-L-Ala-D-Glu-mesoDAP and L-
129
Ala-D-Glu-mesoDAP can activate Nod1 with similar capacity, the presence of the sugar moiety
could modify cellular uptake, as we recently suggested (Lee et al., 2009). It is also possible that
PGLYRP2 could differentially affect Nod2-dependent responses to bacteria, depending on the
relative proportions of dipeptide versus lys-containing tripeptides in their peptidoglycan, a ratio
that varies from one bacterial species to another. Nevertheless, these considerations strongly
suggest that the amidase activity of mammalian PGLYRP2 may not be responsible for promoting
a global scavenger function aiming to dampen immune responses dependent on peptidoglycan.
This contrasts with the role assigned to Drosophila amidase PGRPs, such as PGRP-LB. Indeed,
in Drosophila, detection of peptidoglycan and induction of innate immune responses to bacteria
by effector PGRPs (such as PGRP-LC or PGRP-SA) require that peptidoglycan fragments
contain both sugar and peptide moieties (Kaneko et al., 2004; Stenbak et al., 2004).
In our Salmonella infection model, it appears that PGLYRP2 may trigger host defense and innate
immune responses independently of its amidase activity, especially given that our histology data
on infected mice did not follow the pathology observed in Nod1/Nod2
double knockout mice
where inflammation is significantly reduced during infection (Geddes et al.). Supporting this
argument, an immune-modulatory role for PGLYRP2 irrespective of its amidase function has
been recently shown in the arthritis inflammation model (Saha et al., 2009). In this study, the
authors showed that both Nod2 and PGLYRP2 were required for the induction of peptidoglycan-
induced arthritis, and that Nod2 was acting upstream of PGLYRP2 to induce its expression.
Indeed, our data support the notion that Nod proteins and PGLYRP2 may be working together to
promote protection in our colitis model. In our study, we observed a significant increase in cecal
inflammation in Nod2/
Pglyrp2/
DKO mice, but not Nod1/
Pglyrp2/
DKO mice, at an an
early stage (24h) of Salmonella infection, compared to that of WT or Pglyrp2/
mice. Our data
thus suggest that both Nod2 and PGLYRP2 may be working in concert as part of a regulatory
pathway where contribution of Nod1 is minimal, to confer protection during Salmonella
infection. These results are also in agreement with the previous biochemical data mentioned
above, which demonstrated that PGLYPR2 was unable to degrade MDP, the muramyl peptide
agonist of Nod2 (Wang et al., 2003).
In summary, we have demonstrated a protective role for PGLYRP2 during Salmonella infection
in vivo, and this represents the first indication that this molecule contributes to host defense
130
against bacterial pathogens at mucosal surfaces. Although it is clear that PGLYRP2 plays a
protective role in down-regulating inflammation in Salmonella-induced colitis, whether this
effect is mediated by amidase-dependent processing of peptidoglycan fragments and affecting
Nod1/2-driven host responses is questionable, given that PGLYRP2 did not seem to modulate
Nod1/2-dependent, early Th17 responses to Salmonella infection. Further research is required to
delineate the mechanisms by which PGLRP2 confers protection in the intestine during bacterial
infection.
131
Chapter 7 Discussion
7
7.1 Thesis summary
The central theme of this thesis has been the study of the innate immune molecules that
recognize bacterial peptidoglycan (Figure 7.1). In particular, the first three data chapters
(Chapter 3-5) focused mainly on Nod1 and Nod2, the intracellular innate immune receptors
crucial for recognizing peptidoglycan, with respect to the downstream signaling molecule of the
receptors, and to the entry mechanism of their respective ligands. First, the contribution of Rip2,
the adaptor protein for Nod1- and Nod2-dependent signaling, in innate and adaptive immunity
was investigated in vivo using Rip2-deficient mice (Chapter 3). I demonstrated that Rip2 was
required and critical for triggering Nod1- and Nod2-driven induction of innate and adaptive
immunity in vivo. Next, I investigated how monomeric peptidoglycan fragments can enter into
epithelial cells to be detected by Nod1 and Nod2 (Chapter 4). Using biochemical approaches and
molecular biology techniques in vitro, I determined that the entry of these Nod1 and Nod2
ligands was mediated through clathrin-dependent endocytosis, and the internalization of the
ligands was dependent on pH. More importantly, I identified a role for SLC15A4, an
oligopeptide transporter expressed in early endosomes, in Nod1-dependent signaling. While
investigating the role of SLC15A4, a surprising observation (Fig 4.4D) was made which alluded
to a possible role for the host hydrolytic enzyme, PGLYRP2, in cleaving Nod1 ligands prior to
transport into cytosol. Thus, the last chapter of this thesis was dedicated to further investigating
the role of the peptidoglycan recognition molecule, PGLYRP2, in induction of innate immune
response to Salmonella enterica serovar Typhimurium infection (Chapter 6). Initially, I
hypothesized that PGLYRP2 can indirectly influence bacterial peptidoglycan sensing by Nod1
and Nod2, since PGLYRP2 is known to cleave Nod1 and Nod2 ligands. Surprisingly, I found
that PGLYRP2 did not modulate Nod1- and Nod2-dependent inflammatory responses during
Salmonella colitis in vivo. Rather, PGLYRP2 displayed a protective role in the host defense
against S. Typhimurium, and this role appeared to be independent of its amidase activity.
Together, this thesis has provided a better understanding to some important questions in Nod
biology, and formulated many new questions for future investigation.
132
Figure 7.1. Summary of my thesis.
The central theme of my thesis was to address some of the important questions surrounding the
muramyl peptides. Since the discovery of Nod1 and Nod2, it has been a critical issue to
understand how these muramyl peptides enter the cells to activate Nod1 and Nod2. Using an in
vitro assay, I showed a mechanism of entry in epithelial cells, and provided the first evidence
that SLC15A4 is important in trafficking Nod1 ligands. Further, my work on Rip2 nicely settled
the age-old debate, confirming that Rip2 is fully required for all Nod-dependent signaling in vivo
triggered by these ligands. Lastly, despite the fact that PGLYRP2 is one of the most abundantly
secreted enzymes in body fluids of mammals, and it has the ability to process Nod ligands, not
much had been known as to what the function of this enzyme might be. My work demonstrated a
protective role of PGLYRP2 in vivo, which had not been previously identified in bacterial colitis
model.
133
7.2 Revisiting the entry mechanism of Nod1 ligands
One of the central dogmas in Nod biology was how free-floating extracellular peptidoglycan
fragments get access to the cytosol of a cell where Nod1 or Nod2 receptors reside. My work
contributed to finding one of the entry mechanisms of muramyl peptides into epithelial cells,
introducing SLC15A4 as an emerging transporter involved in trafficking of the ligands inside the
epithelial cells. Since then, other publications came forth in support of SLC15A4 playing a role
in trafficking of ligands, especially in APCs such as dendritic cells. For instance, SLC15A4 is
required for endosomal TLR7 and TLR9 signaling in plasmacytoid dendritic cells (Blasius et al.,
2010). The authors hypothesize that SLC15A4 may play a role in transporting a critical
component in and out of the endosome, and/or maintaining the appropriate pH of the endosomal
compartment as endosomal acidification is necessary for optimal TLR7 and TLR9 activation.
Similarly, studies in Slc15a4/
dendritic cells suggest that SLC15A4 contributes to TLR9
signaling by regulating endosomal histidine levels (Sasawatari et al., 2011). With regards to
Nod1 ligands, SLC15A4 was also shown to function as a transporter of TriDAP in vivo as
Slc15a4/
mice demonstrated a severe defect in Nod1-dependent cytokine production
(Sasawatari et al., 2011).
Intriguingly, some of the SLC subfamilies that could be potentially implicated in the transport of
peptidoglycan-derived peptides have also been associated with the pathophysiology of IBD. It
has been reported that SLC22A5 gene is important susceptibility genes in IBD, and that genetic
polymorphisms within this region contribute to the inflammatory phenotype (Cucchiara et al.,
2007; Waller et al., 2006). Among SLC15 transporters, polymorphisms in genes encoding
SLC15A1 have been linked to IBD (Zucchelli et al., 2009). SLC15A1 was also reported to be
involved in the suppression of inflammation in mouse models of colitis because of uptake of the
therapeutic tripeptide KPV (Dalmasso et al., 2008). On the contrary, no genetic evidence linking
SLC15A4 to IBD exist yet, although SLC15A4 has been identified as one of susceptibility genes
associated with the autoimmune disease, systemic lupus erythematosus (SLE) (Han et al., 2009;
He et al., 2010). Interestingly, our collaborators demonstrated that SLC15A4 mRNA expression
level was increased in inflamed colon of IBD patients compared to control subjects. Further, it
was recently reported that SLC15A4 deficiency ameliorated susceptibility to DSS colitis in mice
(Sasawatari et al., 2011). Together, these findings suggest that SLC15A4 may have a role in the
pathophysiology of IBD. In a global view, these findings and the presence of genes such as
134
SLC22A5, and SLC15A1 in IBD-risk loci suggest that solute carriers may help to maintain
intestinal homeostasis by transducing signals from microbial ligands, which can in turn have
immune-modulatory effects on the host.
Future directions: Following my work that showed SLC15A4 is involved in transporting Nod1
ligands in epithelial cells, others have found the expression of SLC15A4 in immune cells such as
B cells and dendritic cells (Sasawatari et al., 2011). It would thus be interesting to determine if
SLC15A4 is functional in these cell types that can potentially be in contact with peptidoglycan,
and investigate whether this protein plays a role in transporting Nod1 ligands into these cells.
Further, in vivo processing/transporting capability of the ligands could be examined by injecting
various Nod1 ligands (M-Tri-DAP, iE-DAP, TCT, FK156) into SLC15A4-deficient mice, and
measuring the inflammatory cytokine responses, compared to WT mice. Lastly, it would be
interesting to investigate how the specific internalization of Nod1 ligands by SLC14A4 might
contribute to the detection of harmful pathogens at the epithelial lining of the mucosa nearby. To
study this, a conditional knockout of SLC15A4 in the intestinal epithelial cells should be
generated, using floxed mice crossed with transgenic animals expressing the Cre recombinase
under control of the villin promoter, a gene specifically expressed in the gut epithelium.
Together, these studies are of critical importance in further understanding the role of SLC15A4
in innate immunity.
7.3 PGLYRP2 : unpublished observations & future directions
Antimicrobial role of PGLYRP2
The study featured in Chapter 6 of this thesis characterized a new role of PGLYRP2, which has
not been identified previously in bacterial colitis models. Although I have not been able to
identify the exact mechanism by which PGLYRP2 confers protection in bacterial colitis,
evidence seems to indicate that the amidase activity of PGLYRP2 may not be responsible for this
protection. I then hypothesized that PGLYRP2 may be acting as a bactericidal molecule. Indeed,
zebrafish and rockfish orthologs of mammalian PGLYRP2 have been shown to function both as
amidase and bactericidal molecule against Gram-negative and Gram-positive bacteria (Kim et
al., 2010; Li et al., 2007). Although the antimicrobial property of mammalian PGLYRP2 has
135
never been shown, the notion that mammalian PGLYRP2 also posses antibacterial properties has
recently been suggested (Royet et al., 2011). Given that neutrophils are known to have a wide
range of antimicrobial arsenals and that the clearance of Salmonella was blunted in the absence
of PGLYRP2 although more neutrophils infiltrated in Pglyrp2/
mice following infection, I
investigated the possibility that PGLYRP2, secreted from neutrophils, may then act as an
antimicrobial molecule. It was previously reported that serum amidase, PGLYRP2, was
expressed in granules of neutrophils and eosinophils (Hoijer et al., 1997a). However, by flow
cytometry, I found the expression of PGLYRP2 in neutrophils in the cecal tissue to be minimal
(Fig 6.2 B& C). I also performed neutrophil killing assays by isolating neutrophils from wild-
type and Pglyrp2/
mice in order to test their killing activity against Salmonella in vitro, but
found that neutrophils from both wild-type and Pglyrp2/
mice were able to kill Salmonella with
similar efficiency (Figure 7.2). Another possibility might be that the antimicrobial effect of
PGLYRP2 could be masked by other PGRPs such as PGLYRP1, which is constitutively
expressed in the granules of neutrophils and eosinophils (Cho et al., 2005; Dziarski et al., 2003).
PGLYRP1 expression was not impaired in Pglyrp2/
mice, since I found the level of Pglyrp1 to
be similar in both wild-type and Pglyrp2/
cecum during SL1344 infection (Figure 7.3).
Future directions: In order to investigate the antimicrobial role of PGLYRP2, more direct
approach where purified PGLYRP2 is incubated with Salmonella Typhimurium should be used
to determine whether PGLYRP2 could inhibit the growth of the enteric pathogen. Moreover, the
wild-type and Pglyrp2/
cecal tissues following infection with Salmonella should be examined
for the expression of other antimicrobial peptides such as defensins, which are known to play an
important role in intestinal mucosal immunity against bacterial pathogens. Previously, the
porcine amidase PGLYRP2 was suggested to also function in regulating the expression of the
antimicrobial peptide -defensin-1 (Sang et al., 2005). Thus, it would be interesting to
investigate whether murine or human PGLYRP2 can regulate expression of these antimicrobial
molecules.
136
Figure 7.2. The neutrophil killing assay.
Neutrophils were isolated from WT and Pglyrp2/
mice and incubated with Salmonella enterica
serovar Typhimurium (MOI of 100:1) at different time points (0min, 60min, 90min). Following
incubation, neutrophils were lysed with 1% Triton X, and the supernantants were serially diluted
and plated onto LB agar to measure CFU counts (n=3).
137
Figure 7.3. Pglyrp1 expression in the cecum following Salmonella infection at 72h.
qRT-PCR was used to measure the expression of Pglyrp1 in the ceca from uninfected and
infected wild-type and Pglyrp2/
mice at 72h. The expression is normalized to the housekeeping
gene Rpl19 (6 to 8 mice per group per experiment) (n=3). NS: not significant.
138
Investigating the role of PGLYRP2 in a Citrobacter rodentium-induced colitis model
In vivo studies on PGLYRP2 thus far seem to suggest diverse roles of PGLYRP2 in tissue-, and
disease-specific manner. Indeed, PGLYRP2 in arthritis model was shown to play pro-
inflammatory role in localized inflammatory response at the ankle joints and the feet (Saha et al.,
2009). In contrast, PGRPL2 had an opposing effect in the skin, as PGLYRP2 was recently shown
to have a protective role in an experimentally induced psoriasis mouse model by promoting
Tregs and limiting Th17 responses (Park et al., 2011a). Interestingly, however, PGLYRP2 does
not seem to have a role in inflammatory skin disease such as experimentally-induced atopic
dermatitis and contact dermatitis (Park et al., 2011b). At the intestinal mucosa, PGLYRP2 seems
to serve different functions depending on the model of colitis used. In a chemically-induced
colitis model, PGLYRP2 has a protective role, but is not the only PGRPs with this function, as
all four PGRP knockout mice (Pglyrp1/
to Pglyrp4/
) were shown to be more sensitive than
wild-type mice to DSS-induced colitis (Saha et al., 2010). Contrary to my observations using the
S. Typhimurium colitis model, my preliminary data with C. rodentium, an attaching/effacing
mouse pathogen related to enteropathogenic Escherichia coli (EPEC) (Luperchio and Schauer,
2001; Schauer and Falkow, 1993), seems to offer an interesting, and yet different outcome.
Because a recent publication from our laboratory showed that Nod1/Nod2 are required to mount
a robust early Th17 response to bacterial colitis in both the C. rodentium and S. Typhimurium
models, I also examined the role of PGLYRP2 in the immune response against C. rodentium by
analyzing Pglyrp2-deficient mice for pathological changes as well as monitoring changes in
cytokine production (IFN- and IL-17a) by intracellular cytokine staining. Following 7-day
infection with C. rodentium (1 x 109 CFU) via oral gavage, Pglyrp2-deficient mice showed
significantly lower pathological scores and less visible colonic inflammation compared to the
wild-type mice (Figure 7.4), which followed the trend seen with the Nod1/Nod2 double KO mice
(Geddes et al., 2011). My preliminary findings on the expression of intracellular cytokines
suggest that baseline immune responses in Pglyrp2-deficient mice are more Th1-skewed, with
higher levels of IFN- than WT mice (Figure 7.5a & 7.5b). Furthermore, Pglyrp2-deficient mice
infected with C. rodentium at day 7 also showed enhanced IFN- (Figure 7.5b). In contrast,
Pglyrp2-deficient mice have reduced levels of IL-17a producing CD4+ T cells 7 days after
infection with C. rodentium (Figure 7.5a & 7.5c). All together, these preliminary data are
139
interesting, and seem to suggest that mammalian PGLYRP2 may trigger different immune
responses against different enteric pathogens.
Future directions: The role of PGLYRP2 in a C. rodentium-induced colitis model should
continue to be investigated. First and foremost, my preliminary work with C. rodentium should
be repeated thoroughly to see whether my observations are reproducible and expandable. This
will involve collecting uninfected and infected cecum/colon samples from wild-type and
Pglyrp2/
mice at different time points (4, 7 or 10-day) following infection with C. rodentium
and comparing these samples for pathological scoring, bacterial loads, and cytokine production.
140
Figure 7.4. Colonic pathology following 7-day infection with C. rodentium in WT and
Pglyrp2-deficient mice.
A) total pathological scores (top) and individual inflammation scores (bottom) are shown. Total
pathological scores are composed of individual inflammation scores including submucosal
edema, goblet cell depletion, epithelial hyperplasia & integrity, and inflammatory cell infiltrate.
B) hematoxylin- and eosin-stained colon samples from 7-day-infected wild-type (top panel) and
Pglyrp2-deficient (bottom panel) mice.
141
Figure 7.5. Intracellular cytokines, IL-17a and IFN- responses from cecal WT and
Pglyrp2-deficient mice during C. rodentium-induced colitis.
A) Flow cytometric analysis of intracellular cytokine release from CD4+ TCR+ LPLs of
uninfected and 7-day infected wild-type and Pglyrp2/
(KO) mice. Bar graphs depict the
average relative frequency of all B) IFN-+ cells or C) IL-17a+ cells.
142
The effect of PGLYRP2 in maintaining normal microbiota composition in the gut
Recent studies have uncovered the important role of the intestinal microbiota in shaping the
immune system of mammals. As previously mentioned, Nod2 was recently found to be an
important regulator of the commensal gut microbiota in mice (Petnicki-Ocwieja et al., 2009;
Rehman et al., 2011), as mutations/deficiency in Nod2 induces intestinal dysbiosis resulting in
increased sensitivity to IBD. Because of its close proximity to Nod1 and Nod2 as a
peptidoglycan sensing or modifying enzyme, the role of PGLYRP2 in maintaining normal
microbiota composition was analyzed between wild-type and Pglyrp2-deficient littermates by
qRT-PCR using group-specific 16S rRNA primers. My preliminary data reveals a difference in
microbiota composition between wild-type and Pglyrp2-deficient mice on a C57/BL6
background when I performed a littermate comparison of the gut microbiota across the different
genotypes. In particular, I observed statistically significant changes in microbiota species
including Bacillus, Eubacterium rectale, Bacteroides, and Enterobacteriaceae (Figure 7.6).
Interestingly, other studies showed that Pglyrp2-deficient mice on a Balb/c background and a
C57/BL6 have altered microbiota (Duerr et al., 2010; Saha et al., 2010) although the expression
of these individual bacterial species varies greatly between studies. It has been suggested that
even if the mice were raised in the same animal facility, wild-type and Pglyrp2/
mice could still
display distinct microbiota if PGLYRP2 directly impacted on the bacterial flora, an effect
observed in Nod2 KO mice recently (Petnicki-Ocwieja et al., 2009). For this reason, our mice
were F2 littermates generated from wild-type and Pglyrp2/
mice, and raised in specific
pathogen-free environment. Thus, these other studies must be interpreted with caution since they
did not use littermates and their mice were raised in a conventional facility, rather than a specific
pathogen-free environment.
Future directions: More work is needed to determine the impact of PGLYRP2 in shaping the
microbial communities of the gut. The next step with my preliminary data is to perform a more
in depth community analysis using different tools available to identify more precise differences
in microbiota composition. For example, the community fingerprinting techniques such as
terminal restriction fragment length polymorphism (T-RFLP) and denaturing gradient gel
electrophoresis (DGGE) are widely used to assess microbial community diversity and responses
to changing environmental conditions (Marzorati et al., 2008; Zoetendal et al., 2008). These tools
143
Figure 7.6. The microbiota composition of cecum content samples from WT and Pglyrp2-
deficient mice.
qRT-PCR of 16S rRNA for the indicated bacterial groups in cecal tissue homogenate. Tissue
from three mice was analyzed in each group. The numbers relative to the total bacteria
(eubacteria) present are indicated in percentages. The following bacterial groups are shown:
Eubacterium rectale group, Lactobacillus, Bacillus, Bacteroides, Segmented filamentous
bacteria, Enterobacteriaceae. *P< 0.05; **P<0.01
144
would be useful, and further validate findings by the conventional qRT-PCR of group-specific
16S rRNA primers. Using bone-marrow chimeric animals, it would also be interesting to
determine whether PGLYRP2 in the stromal vs hematopoietic compartment is more important in
regulating the microbiota composition.
Next, it will be interesting to investigate how acute colitis in Pglyrp2-deficient mice impacts on
the microbial composition of the gut. Indeed, this is extremely relevant for understanding the role
of the microbiota in human IBD, especially because one of the IBD susceptibility loci, for which
the susceptibility gene has not yet been identified, harbors human Pglyrp2 gene (Budarf et al.,
2009). Pglyrp2 thus could be one of the human IBD susceptibility genes in this locus. In order to
carry out this investigation, the microbiota changes should be examined in the wild-type and
Pglyrp2-deficient mice using our well established bacteria-induced colitis models.
7.4 Conclusions
The work presented in this thesis reveals novel insights into the immune responses elicited by the
peptidoglycan recognition molecules, Nod1, Nod2, and PGLYRP2, and defines these molecules
as key regulators of immune responses at the level of the intestinal mucosa. Further studies will
aid in delineating their implication in the pathogenesis of inflammatory diseases such as IBD,
and open up new avenues for the treatment of the disease through the modulation of their
functions.
145
Bibliography
Abbott, D.W., Wilkins, A., Asara, J.M., and Cantley, L.C. (2004). The Crohn's disease protein,
NOD2, requires RIP2 in order to induce ubiquitinylation of a novel site on NEMO. Curr Biol 14,
2217-2227.
Adam, A., Ciorbaru, R., Ellouz, F., Petit, J.F., and Lederer, E. (1974). Adjuvant activity of
monomeric bacterial cell wall peptidoglycans. Biochem Biophys Res Commun 56, 561-567.
Adam, A., Petit, J.F., Lefrancier, P., and Lederer, E. (1981). Muramyl peptides. Chemical
structure, biological activity and mechanism of action. Mol Cell Biochem 41, 27-47.
Akira, S., and Takeda, K. (2004). Toll-like receptor signalling. Nat Rev Immunol 4, 499-511.
Akira, S., Uematsu, S., and Takeuchi, O. (2006). Pathogen recognition and innate immunity. Cell
124, 783-801.
Allison, C.C., Kufer, T.A., Kremmer, E., Kaparakis, M., and Ferrero, R.L. (2009). Helicobacter
pylori induces MAPK phosphorylation and AP-1 activation via a NOD1-dependent mechanism.
J Immunol 183, 8099-8109.
Anderson, C.A., Boucher, G., Lees, C.W., Franke, A., D'Amato, M., Taylor, K.D., Lee, J.C.,
Goyette, P., Imielinski, M., Latiano, A., et al. (2011). Meta-analysis identifies 29 additional
ulcerative colitis risk loci, increasing the number of confirmed associations to 47. Nat Genet 43,
246-252.
Askari, N., Correa, R.G., Zhai, D., and Reed, J.C. (2012). Expression, purification, and
characterization of recombinant NOD1 (NLRC1): A NLR family member. J Biotechnol 157, 75-
81.
Babic, A., Patin, D., Boniface, A., Hervé, M., Mengin-Lecreulx, D., Pecar, S., Gobec, S., and
Blanot, D. (2007). Chemoenzymatic synthesis of the nucleotide substrates of the Mur ligases. 5th
Joint Meeting on Medicinal Chemistry, June 17-21, Portoroz, Slovenia (Kikelj, D., ed.), pp. 1-4.
Medimond Srl, Bologna, Italy.
Barnich, N., Aguirre, J.E., Reinecker, H.C., Xavier, R., and Podolsky, D.K. (2005). Membrane
recruitment of NOD2 in intestinal epithelial cells is essential for nuclear factor-{kappa}B
activation in muramyl dipeptide recognition. J Cell Biol 170, 21-26.
Barreau, F., Meinzer, U., Chareyre, F., Berrebi, D., Niwa-Kawakita, M., Dussaillant, M.,
Foligne, B., Ollendorff, V., Heyman, M., Bonacorsi, S., et al. (2007). CARD15/NOD2 is
required for Peyer's patches homeostasis in mice. PLoS One 2, e523.
Barthel, M., Hapfelmeier, S., Quintanilla-Martinez, L., Kremer, M., Rohde, M., Hogardt, M.,
Pfeffer, K., Russmann, H., and Hardt, W.D. (2003). Pretreatment of mice with streptomycin
146
provides a Salmonella enterica serovar Typhimurium colitis model that allows analysis of both
pathogen and host. Infect Immun 71, 2839-2858.
Baumgart, D.C., and Sandborn, W.J. (2007). Inflammatory bowel disease: clinical aspects and
established and evolving therapies. Lancet 369, 1641-1657.
Benko, S., Philpott, D.J., and Girardin, S.E. (2008). The microbial and danger signals that
activate Nod-like receptors. Cytokine 43, 368-373.
Bertrand, M.J., Doiron, K., Labbe, K., Korneluk, R.G., Barker, P.A., and Saleh, M. (2009).
Cellular inhibitors of apoptosis cIAP1 and cIAP2 are required for innate immunity signaling by
the pattern recognition receptors NOD1 and NOD2. Immunity 30, 789-801.
Bevins, C.L., Stange, E.F., and Wehkamp, J. (2009). Decreased Paneth cell defensin expression
in ileal Crohn's disease is independent of inflammation, but linked to the NOD2 1007fs
genotype. Gut 58, 882-883; discussion 883-884.
Bhardwaj, R.K., Herrera-Ruiz, D., Eltoukhy, N., Saad, M., and Knipp, G.T. (2006). The
functional evaluation of human peptide/histidine transporter 1 (hPHT1) in transiently transfected
COS-7 cells. Eur J Pharm Sci 27, 533-542.
Biegel, A., Knutter, I., Hartrodt, B., Gebauer, S., Theis, S., Luckner, P., Kottra, G., Rastetter, M.,
Zebisch, K., Thondorf, I., et al. (2006). The renal type H+/peptide symporter PEPT2: structure-
affinity relationships. Amino Acids 31, 137-156.
Bielig, H., Rompikuntal, P.K., Dongre, M., Zurek, B., Lindmark, B., Ramstedt, M., Wai, S.N.,
and Kufer, T.A. (2011). NOD-like receptor activation by outer membrane vesicles from Vibrio
cholerae non-O1 non-O139 strains is modulated by the quorum-sensing regulator HapR. Infect
Immun 79, 1418-1427.
Bischoff, V., Vignal, C., Duvic, B., Boneca, I.G., Hoffmann, J.A., and Royet, J. (2006).
Downregulation of the Drosophila immune response by peptidoglycan-recognition proteins SC1
and SC2. PLoS Pathog 2, e14.
Blander, J.M., and Medzhitov, R. (2004). Regulation of phagosome maturation by signals from
toll-like receptors. Science (New York, NY 304, 1014-1018.
Blasius, A.L., Arnold, C.N., Georgel, P., Rutschmann, S., Xia, Y., Lin, P., Ross, C., Li, X.,
Smart, N.G., and Beutler, B. (2010). Slc15a4, AP-3, and Hermansky-Pudlak syndrome proteins
are required for Toll-like receptor signaling in plasmacytoid dendritic cells. Proceedings of the
National Academy of Sciences of the United States of America 107, 19973-19978.
Bohnhoff, M., Miller, C.P., and Martin, W.R. (1964a). Resistance of the Mouse's Intestinal Tract
to Experimental Salmonella Infection. I. Factors Which Interfere with the Initiation of Infection
by Oral Inoculation. The Journal of experimental medicine 120, 805-816.
Bohnhoff, M., Miller, C.P., and Martin, W.R. (1964b). Resistance of the Mouse's Intestinal Tract
to Experimental Salmonella Infection. Ii. Factors Responsible for Its Loss Following
Streptomycin Treatment. The Journal of experimental medicine 120, 817-828.
147
Boll, M., Herget, M., Wagener, M., Weber, W.M., Markovich, D., Biber, J., Clauss, W., Murer,
H., and Daniel, H. (1996). Expression cloning and functional characterization of the kidney
cortex high-affinity proton-coupled peptide transporter. Proceedings of the National Academy of
Sciences of the United States of America 93, 284-289.
Boneca, I.G. (2005). The role of peptidoglycan in pathogenesis. Curr Opin Microbiol 8, 46-53.
Boneca, I.G., Dussurget, O., Cabanes, D., Nahori, M.A., Sousa, S., Lecuit, M., Psylinakis, E.,
Bouriotis, V., Hugot, J.P., Giovannini, M., et al. (2007). A critical role for peptidoglycan N-
deacetylation in Listeria evasion from the host innate immune system. Proceedings of the
National Academy of Sciences of the United States of America 104, 997-1002.
Boughan, P.K., Argent, R.H., Body-Malapel, M., Park, J.H., Ewings, K.E., Bowie, A.G., Ong,
S.J., Cook, S.J., Sorensen, O.E., Manzo, B.A., et al. (2006). Nucleotide-binding oligomerization
domain-1 and epidermal growth factor receptor: critical regulators of beta-defensins during
Helicobacter pylori infection. J Biol Chem 281, 11637-11648.
Buchholz, K.R., and Stephens, R.S. (2008). The cytosolic pattern recognition receptor NOD1
induces inflammatory interleukin-8 during Chlamydia trachomatis infection. Infect Immun 76,
3150-3155.
Budarf, M.L., Labbe, C., David, G., and Rioux, J.D. (2009). GWA studies: rewriting the story of
IBD. Trends Genet 25, 137-146.
Caetano, B.C., Biswas, A., Lima, D.S., Jr., Benevides, L., Mineo, T.W., Horta, C.V., Lee, K.H.,
Silva, J.S., Gazzinelli, R.T., Zamboni, D.S., et al. (2011). Intrinsic expression of Nod2 in CD4+
T lymphocytes is not necessary for the development of cell-mediated immunity and host
resistance to Toxoplasma gondii. European journal of immunology 41, 3627-3631.
Cepek, K.L., Shaw, S.K., Parker, C.M., Russell, G.J., Morrow, J.S., Rimm, D.L., and Brenner,
M.B. (1994). Adhesion between epithelial cells and T lymphocytes mediated by E-cadherin and
the alpha E beta 7 integrin. Nature 372, 190-193.
Chamaillard, M., Hashimoto, M., Horie, Y., Masumoto, J., Qiu, S., Saab, L., Ogura, Y.,
Kawasaki, A., Fukase, K., Kusumoto, S., et al. (2003). An essential role for NOD1 in host
recognition of bacterial peptidoglycan containing diaminopimelic acid. Nat Immunol 4, 702-707.
Chang, C.I., Chelliah, Y., Borek, D., Mengin-Lecreulx, D., and Deisenhofer, J. (2006). Structure
of tracheal cytotoxin in complex with a heterodimeric pattern-recognition receptor. Science
(New York, NY 311, 1761-1764.
Chang, C.I., Pili-Floury, S., Herve, M., Parquet, C., Chelliah, Y., Lemaitre, B., Mengin-Lecreulx,
D., and Deisenhofer, J. (2004). A Drosophila pattern recognition receptor contains a
peptidoglycan docking groove and unusual L,D-carboxypeptidase activity. PLoS Biol 2, E277.
Chen, Z.J. (2005). Ubiquitin signalling in the NF-kappaB pathway. Nat Cell Biol 7, 758-765.
Cheroutre, H., Lambolez, F., and Mucida, D. (2011). The light and dark sides of intestinal
intraepithelial lymphocytes. Nat Rev Immunol 11, 445-456.
148
Cheroutre, H., and Madakamutil, L. (2004). Acquired and natural memory T cells join forces at
the mucosal front line. Nat Rev Immunol 4, 290-300.
Chin, A.I., Dempsey, P.W., Bruhn, K., Miller, J.F., Xu, Y., and Cheng, G. (2002). Involvement
of receptor-interacting protein 2 in innate and adaptive immune responses. Nature 416, 190-194.
Chipman, D.M., and Sharon, N. (1969). Mechanism of lysozyme action. Science (New York,
NY 165, 454-465.
Cho, J.H., Fraser, I.P., Fukase, K., Kusumoto, S., Fujimoto, Y., Stahl, G.L., and Ezekowitz, R.A.
(2005). Human peptidoglycan recognition protein S is an effector of neutrophil-mediated innate
immunity. Blood 106, 2551-2558.
Choe, K.M., Werner, T., Stoven, S., Hultmark, D., and Anderson, K.V. (2002). Requirement for
a peptidoglycan recognition protein (PGRP) in Relish activation and antibacterial immune
responses in Drosophila. Science (New York, NY 296, 359-362.
Clarke, T.B., Davis, K.M., Lysenko, E.S., Zhou, A.Y., Yu, Y., and Weiser, J.N. (2011).
Recognition of peptidoglycan from the microbiota by Nod1 enhances systemic innate immunity.
Nat Med 16, 228-231.
Coombes, B.K., Coburn, B.A., Potter, A.A., Gomis, S., Mirakhur, K., Li, Y., and Finlay, B.B.
(2005). Analysis of the contribution of Salmonella pathogenicity islands 1 and 2 to enteric
disease progression using a novel bovine ileal loop model and a murine model of infectious
enterocolitis. Infect Immun 73, 7161-7169.
Cooney, R., Baker, J., Brain, O., Danis, B., Pichulik, T., Allan, P., Ferguson, D.J., Campbell,
B.J., Jewell, D., and Simmons, A. (2010). NOD2 stimulation induces autophagy in dendritic cells
influencing bacterial handling and antigen presentation. Nat Med 16, 90-97.
Cucchiara, S., Latiano, A., Palmieri, O., Staiano, A.M., D'Inca, R., Guariso, G., Vieni, G.,
Rutigliano, V., Borrelli, O., Valvano, M.R., et al. (2007). Role of CARD15, DLG5 and OCTN
genes polymorphisms in children with inflammatory bowel diseases. World J Gastroenterol 13,
1221-1229.
da Silva Correia, J., Miranda, Y., Leonard, N., Hsu, J., and Ulevitch, R.J. (2007). Regulation of
Nod1-mediated signaling pathways. Cell Death Differ 14, 830-839.
Dalmasso, G., Charrier-Hisamuddin, L., Nguyen, H.T., Yan, Y., Sitaraman, S., and Merlin, D.
(2008). PepT1-mediated tripeptide KPV uptake reduces intestinal inflammation.
Gastroenterology 134, 166-178.
Dalmasso, G., Nguyen, H.T., Charrier-Hisamuddin, L., Yan, Y., Laroui, H., Demoulin, B.,
Sitaraman, S.V., and Merlin, D. (2010). PepT1 mediates transport of the proinflammatory
bacterial tripeptide L-Ala-{gamma}-D-Glu-meso-DAP in intestinal epithelial cells. Am J Physiol
Gastrointest Liver Physiol 299, G687-696.
149
Damgaard, R.B., Nachbur, U., Yabal, M., Wong, W.W., Fiil, B.K., Kastirr, M., Rieser, E.,
Rickard, J.A., Bankovacki, A., Peschel, C., et al. (2012). The Ubiquitin Ligase XIAP Recruits
LUBAC for NOD2 Signaling in Inflammation and Innate Immunity. Mol Cell 46, 746-758.
Daniel, H., and Kottra, G. (2004). The proton oligopeptide cotransporter family SLC15 in
physiology and pharmacology. Pflugers Arch 447, 610-618.
Darcissac, E.C., Bahr, G.M., Parant, M.A., Chedid, L.A., and Riveau, G.J. (1996). Selective
induction of CD11a,b,c/CD18 and CD54 expression at the cell surface of human leukocytes by
muramyl peptides. Cell Immunol 169, 294-301.
De Pauw, P., Neyt, C., Vanderwinkel, E., Wattiez, R., and Falmagne, P. (1995). Characterization
of human serum N-acetylmuramyl-L-alanine amidase purified by affinity chromatography.
Protein Expr Purif 6, 371-378.
Deretic, V., and Levine, B. (2009). Autophagy, immunity, and microbial adaptations. Cell Host
Microbe 5, 527-549.
Derry, W.B., Putzke, A.P., and Rothman, J.H. (2001). Caenorhabditis elegans p53: role in
apoptosis, meiosis, and stress resistance. Science (New York, NY 294, 591-595.
Doherty, G.J., and McMahon, H.T. (2009). Mechanisms of endocytosis. Annu Rev Biochem 78,
857-902.
Drubin, D.G., Kaksonen, M., Toret, C., and Sun, Y. (2005). Cytoskeletal networks and pathways
involved in endocytosis. Novartis Found Symp 269, 35-42; discussion 43-36, 223-230.
Duan, W., Mehta, A.K., Magalhaes, J.G., Ziegler, S.F., Dong, C., Philpott, D.J., and Croft, M.
(2010). Innate signals from Nod2 block respiratory tolerance and program T(H)2-driven allergic
inflammation. J Allergy Clin Immunol 126, 1284-1293 e1210.
Duerr, C.U., Salzman, N.H., Dupont, A., Szabo, A., Normark, B.H., Normark, S., Locksley,
R.M., Mellroth, P., and Hornef, M.W. (2010). Control of intestinal Nod2-mediated
peptidoglycan recognition by epithelium-associated lymphocytes. Mucosal immunology.
Dziarski, R., and Gupta, D. (2006). The peptidoglycan recognition proteins (PGRPs). Genome
Biol 7, 232.
Dziarski, R., and Gupta, D. (2010). Review: Mammalian peptidoglycan recognition proteins
(PGRPs) in innate immunity. Innate immunity 16, 168-174.
Dziarski, R., Platt, K.A., Gelius, E., Steiner, H., and Gupta, D. (2003). Defect in neutrophil
killing and increased susceptibility to infection with nonpathogenic gram-positive bacteria in
peptidoglycan recognition protein-S (PGRP-S)-deficient mice. Blood 102, 689-697.
Eckburg, P.B., and Relman, D.A. (2007). The role of microbes in Crohn's disease. Clin Infect
Dis 44, 256-262.
150
Eckmann, L. (2006). Animal models of inflammatory bowel disease: lessons from enteric
infections. Annals of the New York Academy of Sciences 1072, 28-38.
Ellouz, F., Adam, A., Ciorbaru, R., and Lederer, E. (1974). Minimal structural requirements for
adjuvant activity of bacterial peptidoglycan derivatives. Biochem Biophys Res Commun 59,
1317-1325.
Endt, K., Stecher, B., Chaffron, S., Slack, E., Tchitchek, N., Benecke, A., Van Maele, L., Sirard,
J.C., Mueller, A.J., Heikenwalder, M., et al. (2010). The microbiota mediates pathogen clearance
from the gut lumen after non-typhoidal Salmonella diarrhea. PLoS Pathog 6, e1001097.
Fairhead, T., Lian, D., McCully, M.L., Garcia, B., Zhong, R., and Madrenas, J. (2008). RIP2 is
required for NOD signaling but not for Th1 cell differentiation and cellular allograft rejection.
Am J Transplant 8, 1143-1150.
Fei, Y.J., Kanai, Y., Nussberger, S., Ganapathy, V., Leibach, F.H., Romero, M.F., Singh, S.K.,
Boron, W.F., and Hediger, M.A. (1994). Expression cloning of a mammalian proton-coupled
oligopeptide transporter. Nature 368, 563-566.
Ferwerda, G., Girardin, S.E., Kullberg, B.J., Le Bourhis, L., de Jong, D.J., Langenberg, D.M.,
van Crevel, R., Adema, G.J., Ottenhoff, T.H., Van der Meer, J.W., et al. (2005). NOD2 and toll-
like receptors are nonredundant recognition systems of Mycobacterium tuberculosis. PLoS
Pathog 1, 279-285.
Fleming (1922). On a Remarkable Bacteriolytic Element Found in Tissues and Secretions. Proc
R Soc Lond B 93, pp. 306–317.
Fogler, W.E., and Fidler, I.J. (1987). Comparative interaction of free and liposome-encapsulated
nor-muramyl dipeptide or muramyl tripeptide phosphatidylethanolamine (3H-labelled) with
human blood monocytes. International journal of immunopharmacology 9, 141-150.
Frank, D.N., St Amand, A.L., Feldman, R.A., Boedeker, E.C., Harpaz, N., and Pace, N.R.
(2007). Molecular-phylogenetic characterization of microbial community imbalances in human
inflammatory bowel diseases. Proceedings of the National Academy of Sciences of the United
States of America 104, 13780-13785.
Franke, A., McGovern, D.P., Barrett, J.C., Wang, K., Radford-Smith, G.L., Ahmad, T., Lees,
C.W., Balschun, T., Lee, J., Roberts, R., et al. (2010). Genome-wide meta-analysis increases to
71 the number of confirmed Crohn's disease susceptibility loci. Nat Genet 42, 1118-1125.
Franke, A., Ruether, A., Wedemeyer, N., Karlsen, T.H., Nebel, A., and Schreiber, S. (2006). No
association between the functional CARD4 insertion/deletion polymorphism and inflammatory
bowel diseases in the German population. Gut 55, 1679-1680.
Fritz, J.H., Ferrero, R.L., Philpott, D.J., and Girardin, S.E. (2006). Nod-like proteins in
immunity, inflammation and disease. Nat Immunol 7, 1250-1257.
151
Fritz, J.H., Le Bourhis, L., Sellge, G., Magalhaes, J.G., Fsihi, H., Kufer, T.A., Collins, C., Viala,
J., Ferrero, R.L., Girardin, S.E., et al. (2007). Nod1-mediated innate immune recognition of
peptidoglycan contributes to the onset of adaptive immunity. Immunity 26, 445-459.
Ganz, T., Gabayan, V., Liao, H.I., Liu, L., Oren, A., Graf, T., and Cole, A.M. (2003). Increased
inflammation in lysozyme M-deficient mice in response to Micrococcus luteus and its
peptidoglycan. Blood 101, 2388-2392.
Garver, L.S., Wu, J., and Wu, L.P. (2006). The peptidoglycan recognition protein PGRP-SC1a is
essential for Toll signaling and phagocytosis of Staphylococcus aureus in Drosophila.
Proceedings of the National Academy of Sciences of the United States of America 103, 660-665.
Geddes, K., Magalhaes, J.G., and Girardin, S.E. (2009). Unleashing the therapeutic potential of
NOD-like receptors. Nat Rev Drug Discov 8, 465-479.
Geddes, K., Rubino, S., Streutker, C., Cho, J.H., Magalhaes, J.G., Le Bourhis, L., Selvanantham,
T., Girardin, S.E., and Philpott, D.J. (2010). Nod1 and Nod2 regulation of inflammation in the
Salmonella colitis model. Infect Immun 78, 5107-5115.
Geddes, K., Rubino, S.J., Magalhaes, J.G., Streutker, C., Le Bourhis, L., Cho, J.H., Robertson,
S.J., Kim, C.J., Kaul, R., Philpott, D.J., et al. (2011). Identification of an innate T helper type 17
response to intestinal bacterial pathogens. Nat Med 17, 837-844.
Gelius, E., Persson, C., Karlsson, J., and Steiner, H. (2003). A mammalian peptidoglycan
recognition protein with N-acetylmuramoyl-L-alanine amidase activity. Biochem Biophys Res
Commun 306, 988-994.
Girardin, S.E., Boneca, I.G., Carneiro, L.A., Antignac, A., Jehanno, M., Viala, J., Tedin, K.,
Taha, M.K., Labigne, A., Zahringer, U., et al. (2003a). Nod1 detects a unique muropeptide from
gram-negative bacterial peptidoglycan. Science (New York, NY 300, 1584-1587.
Girardin, S.E., Boneca, I.G., Viala, J., Chamaillard, M., Labigne, A., Thomas, G., Philpott, D.J.,
and Sansonetti, P.J. (2003b). Nod2 is a general sensor of peptidoglycan through muramyl
dipeptide (MDP) detection. J Biol Chem 278, 8869-8872.
Girardin, S.E., Jehanno, M., Mengin-Lecreulx, D., Sansonetti, P.J., Alzari, P.M., and Philpott,
D.J. (2005). Identification of the critical residues involved in peptidoglycan detection by Nod1. J
Biol Chem 280, 38648-38656.
Girardin, S.E., and Philpott, D.J. (2004). Mini-review: the role of peptidoglycan recognition in
innate immunity. European journal of immunology 34, 1777-1782.
Girardin, S.E., Tournebize, R., Mavris, M., Page, A.L., Li, X., Stark, G.R., Bertin, J., DiStefano,
P.S., Yaniv, M., Sansonetti, P.J., et al. (2001). CARD4/Nod1 mediates NF-kappaB and JNK
activation by invasive Shigella flexneri. EMBO reports 2, 736-742.
Girardin, S.E., Travassos, L.H., Herve, M., Blanot, D., Boneca, I.G., Philpott, D.J., Sansonetti,
P.J., and Mengin-Lecreulx, D. (2003c). Peptidoglycan molecular requirements allowing
detection by Nod1 and Nod2. J Biol Chem 278, 41702-41708.
152
Godinez, I., Haneda, T., Raffatellu, M., George, M.D., Paixao, T.A., Rolan, H.G., Santos, R.L.,
Dandekar, S., Tsolis, R.M., and Baumler, A.J. (2008). T cells help to amplify inflammatory
responses induced by Salmonella enterica serotype Typhimurium in the intestinal mucosa. Infect
Immun 76, 2008-2017.
Godinez, I., Raffatellu, M., Chu, H., Paixao, T.A., Haneda, T., Santos, R.L., Bevins, C.L., Tsolis,
R.M., and Baumler, A.J. (2009). Interleukin-23 orchestrates mucosal responses to Salmonella
enterica serotype Typhimurium in the intestine. Infect Immun 77, 387-398.
Goto, Y., and Kiyono, H. (2012). Epithelial barrier: an interface for the cross-communication
between gut flora and immune system. Immunol Rev 245, 147-163.
Gottar, M., Gobert, V., Michel, T., Belvin, M., Duyk, G., Hoffmann, J.A., Ferrandon, D., and
Royet, J. (2002). The Drosophila immune response against Gram-negative bacteria is mediated
by a peptidoglycan recognition protein. Nature 416, 640-644.
Grubman, A., Kaparakis, M., Viala, J., Allison, C., Badea, L., Karrar, A., Boneca, I.G., Le
Bourhis, L., Reeve, S., Smith, I.A., et al. (2009). The innate immune molecule, NOD1, regulates
direct killing of Helicobacter pylori by antimicrobial peptides. Cell Microbiol 12, 626-639.
Guan, R., Brown, P.H., Swaminathan, C.P., Roychowdhury, A., Boons, G.J., and Mariuzza, R.A.
(2006). Crystal structure of human peptidoglycan recognition protein I alpha bound to a muramyl
pentapeptide from Gram-positive bacteria. Protein Sci 15, 1199-1206.
Guan, R., Malchiodi, E.L., Wang, Q., Schuck, P., and Mariuzza, R.A. (2004). Crystal structure
of the C-terminal peptidoglycan-binding domain of human peptidoglycan recognition protein
Ialpha. J Biol Chem 279, 31873-31882.
Gutierrez, O., Pipaon, C., Inohara, N., Fontalba, A., Ogura, Y., Prosper, F., Nunez, G., and
Fernandez-Luna, J.L. (2002). Induction of Nod2 in myelomonocytic and intestinal epithelial
cells via nuclear factor-kappa B activation. J Biol Chem 277, 41701-41705.
Guy-Grand, D., Malassis-Seris, M., Briottet, C., and Vassalli, P. (1991). Cytotoxic
differentiation of mouse gut thymodependent and independent intraepithelial T lymphocytes is
induced locally. Correlation between functional assays, presence of perforin and granzyme
transcripts, and cytoplasmic granules. The Journal of experimental medicine 173, 1549-1552.
Hall, H.T., Wilhelm, M.T., Saibil, S.D., Mak, T.W., Flavell, R.A., and Ohashi, P.S. (2008). RIP2
contributes to Nod signaling but is not essential for T cell proliferation, T helper differentiation
or TLR responses. European journal of immunology 38, 64-72.
Han, J.W., Zheng, H.F., Cui, Y., Sun, L.D., Ye, D.Q., Hu, Z., Xu, J.H., Cai, Z.M., Huang, W.,
Zhao, G.P., et al. (2009). Genome-wide association study in a Chinese Han population identifies
nine new susceptibility loci for systemic lupus erythematosus. Nat Genet 41, 1234-1237.
Hapfelmeier, S., and Hardt, W.D. (2005). A mouse model for S. typhimurium-induced
enterocolitis. Trends Microbiol 13, 497-503.
153
Hapfelmeier, S., Stecher, B., Barthel, M., Kremer, M., Muller, A.J., Heikenwalder, M.,
Stallmach, T., Hensel, M., Pfeffer, K., Akira, S., et al. (2005). The Salmonella pathogenicity
island (SPI)-2 and SPI-1 type III secretion systems allow Salmonella serovar typhimurium to
trigger colitis via MyD88-dependent and MyD88-independent mechanisms. J Immunol 174,
1675-1685.
Hasegawa, M., Fujimoto, Y., Lucas, P.C., Nakano, H., Fukase, K., Nunez, G., and Inohara, N.
(2008). A critical role of RICK/RIP2 polyubiquitination in Nod-induced NF-kappaB activation.
Embo J 27, 373-383.
Hathaway, L.J., and Kraehenbuhl, J.P. (2000). The role of M cells in mucosal immunity. Cell
Mol Life Sci 57, 323-332.
Hayden, M.S., and Ghosh, S. (2004). Signaling to NF-kappaB. Genes Dev 18, 2195-2224.
He, C.F., Liu, Y.S., Cheng, Y.L., Gao, J.P., Pan, T.M., Han, J.W., Quan, C., Sun, L.D., Zheng,
H.F., Zuo, X.B., et al. (2010). TNIP1, SLC15A4, ETS1, RasGRP3 and IKZF1 are associated
with clinical features of systemic lupus erythematosus in a Chinese Han population. Lupus 19,
1181-1186.
Hediger, M.A., Romero, M.F., Peng, J.B., Rolfs, A., Takanaga, H., and Bruford, E.A. (2004).
The ABCs of solute carriers: physiological, pathological and therapeutic implications of human
membrane transport proteinsIntroduction. Pflugers Arch 447, 465-468.
Heinzelmann, M., Polk, H.C., Jr., Chernobelsky, A., Stites, T.P., and Gordon, L.E. (2000).
Endotoxin and muramyl dipeptide modulate surface receptor expression on human mononuclear
cells. Immunopharmacology 48, 117-128.
Herrera-Ruiz, D., Wang, Q., Gudmundsson, O.S., Cook, T.J., Smith, R.L., Faria, T.N., and
Knipp, G.T. (2001). Spatial expression patterns of peptide transporters in the human and rat
gastrointestinal tracts, Caco-2 in vitro cell culture model, and multiple human tissues. AAPS
PharmSci 3, E9.
Herskovits, A.A., Auerbuch, V., and Portnoy, D.A. (2007). Bacterial ligands generated in a
phagosome are targets of the cytosolic innate immune system. PLoS Pathog 3, e51.
Hisamatsu, T., Suzuki, M., Reinecker, H.C., Nadeau, W.J., McCormick, B.A., and Podolsky,
D.K. (2003). CARD15/NOD2 functions as an antibacterial factor in human intestinal epithelial
cells. Gastroenterology 124, 993-1000.
Hitotsumatsu, O., Ahmad, R.C., Tavares, R., Wang, M., Philpott, D., Turer, E.E., Lee, B.L.,
Shiffin, N., Advincula, R., Malynn, B.A., et al. (2008). The ubiquitin-editing enzyme A20
restricts nucleotide-binding oligomerization domain containing 2-triggered signals. Immunity 28,
381-390.
Hoijer, M.A., Melief, M.J., Calafat, J., Roos, D., van den Beemd, R.W., van Dongen, J.J., and
Hazenberg, M.P. (1997a). Expression and intracellular localization of the human N-
acetylmuramyl-L-alanine amidase, a bacterial cell wall-degrading enzyme. Blood 90, 1246-1254.
154
Hoijer, M.A., Melief, M.J., Debets, R., and Hazenberg, M.P. (1997b). Inflammatory properties
of peptidoglycan are decreased after degradation by human N-acetylmuramyl-L-alanine amidase.
Eur Cytokine Netw 8, 375-381.
Homer, C.R., Richmond, A.L., Rebert, N.A., Achkar, J.P., and McDonald, C. (2010). ATG16L1
and NOD2 interact in an autophagy-dependent antibacterial pathway implicated in Crohn's
disease pathogenesis. Gastroenterology 139, 1630-1641, 1641 e1631-1632.
Hruz, P., Zinkernagel, A.S., Jenikova, G., Botwin, G.J., Hugot, J.P., Karin, M., Nizet, V., and
Eckmann, L. (2009). NOD2 contributes to cutaneous defense against Staphylococcus aureus
through alpha-toxin-dependent innate immune activation. Proceedings of the National Academy
of Sciences of the United States of America 106, 12873-12878.
Hsu, L.C., Ali, S.R., McGillivray, S., Tseng, P.H., Mariathasan, S., Humke, E.W., Eckmann, L.,
Powell, J.J., Nizet, V., Dixit, V.M., et al. (2008). A NOD2-NALP1 complex mediates caspase-1-
dependent IL-1beta secretion in response to Bacillus anthracis infection and muramyl dipeptide.
Proceedings of the National Academy of Sciences of the United States of America 105, 7803-
7808.
Hsu, Y.M., Zhang, Y., You, Y., Wang, D., Li, H., Duramad, O., Qin, X.F., Dong, C., and Lin, X.
(2007). The adaptor protein CARD9 is required for innate immune responses to intracellular
pathogens. Nat Immunol 8, 198-205.
Hugot, J.P., Chamaillard, M., Zouali, H., Lesage, S., Cezard, J.P., Belaiche, J., Almer, S., Tysk,
C., O'Morain, C.A., Gassull, M., et al. (2001). Association of NOD2 leucine-rich repeat variants
with susceptibility to Crohn's disease. Nature 411, 599-603.
Hull, S.R., and Turco, S.J. (1985). Separation of dansyl hydrazine-derivatized oligosaccharides
by liquid chromatography. Anal Biochem 146, 143-149.
Husebye, H., Halaas, O., Stenmark, H., Tunheim, G., Sandanger, O., Bogen, B., Brech, A., Latz,
E., and Espevik, T. (2006). Endocytic pathways regulate Toll-like receptor 4 signaling and link
innate and adaptive immunity. Embo J 25, 683-692.
Huysamen, C., and Brown, G.D. (2009). The fungal pattern recognition receptor, Dectin-1, and
the associated cluster of C-type lectin-like receptors. FEMS Microbiol Lett 290, 121-128.
Inohara, Chamaillard, McDonald, C., and Nunez, G. (2005). NOD-LRR proteins: role in host-
microbial interactions and inflammatory disease. Annu Rev Biochem 74, 355-383.
Inohara, N., del Peso, L., Koseki, T., Chen, S., and Nunez, G. (1998). RICK, a novel protein
kinase containing a caspase recruitment domain, interacts with CLARP and regulates CD95-
mediated apoptosis. J Biol Chem 273, 12296-12300.
Inohara, N., Koseki, T., del Peso, L., Hu, Y., Yee, C., Chen, S., Carrio, R., Merino, J., Liu, D.,
Ni, J., et al. (1999). Nod1, an Apaf-1-like activator of caspase-9 and nuclear factor-kappaB. J
Biol Chem 274, 14560-14567.
155
Inohara, N., Koseki, T., Lin, J., del Peso, L., Lucas, P.C., Chen, F.F., Ogura, Y., and Nunez, G.
(2000). An induced proximity model for NF-kappa B activation in the Nod1/RICK and RIP
signaling pathways. J Biol Chem 275, 27823-27831.
Inohara, N., Ogura, Y., Chen, F.F., Muto, A., and Nunez, G. (2001). Human Nod1 confers
responsiveness to bacterial lipopolysaccharides. J Biol Chem 276, 2551-2554.
Inohara, N., Ogura, Y., Fontalba, A., Gutierrez, O., Pons, F., Crespo, J., Fukase, K., Inamura, S.,
Kusumoto, S., Hashimoto, M., et al. (2003). Host recognition of bacterial muramyl dipeptide
mediated through NOD2. Implications for Crohn's disease. J Biol Chem 278, 5509-5512.
Ismair, M.G., Vavricka, S.R., Kullak-Ublick, G.A., Fried, M., Mengin-Lecreulx, D., and
Girardin, S.E. (2006). hPepT1 selectively transports muramyl dipeptide but not Nod1-activating
muramyl peptides. Can J Physiol Pharmacol 84, 1313-1319.
Iyer, J.K., and Coggeshall, K.M. (2011). Cutting edge: primary innate immune cells respond
efficiently to polymeric peptidoglycan, but not to peptidoglycan monomers. J Immunol 186,
3841-3845.
Kagan, J.C., Su, T., Horng, T., Chow, A., Akira, S., and Medzhitov, R. (2008). TRAM couples
endocytosis of Toll-like receptor 4 to the induction of interferon-beta. Nat Immunol 9, 361-368.
Kaiser, P., Diard, M., Stecher, B., and Hardt, W.D. (2012). The streptomycin mouse model for
Salmonella diarrhea: functional analysis of the microbiota, the pathogen's virulence factors, and
the host's mucosal immune response. Immunol Rev 245, 56-83.
Kaksonen, M., Toret, C.P., and Drubin, D.G. (2006). Harnessing actin dynamics for clathrin-
mediated endocytosis. Nat Rev Mol Cell Biol 7, 404-414.
Kaneko, T., Goldman, W.E., Mellroth, P., Steiner, H., Fukase, K., Kusumoto, S., Harley, W.,
Fox, A., Golenbock, D., and Silverman, N. (2004). Monomeric and polymeric gram-negative
peptidoglycan but not purified LPS stimulate the Drosophila IMD pathway. Immunity 20, 637-
649.
Kang, D., Liu, G., Lundstrom, A., Gelius, E., and Steiner, H. (1998). A peptidoglycan
recognition protein in innate immunity conserved from insects to humans. Proceedings of the
National Academy of Sciences of the United States of America 95, 10078-10082.
Kaparakis, M., Turnbull, L., Carneiro, L., Firth, S., Coleman, H.A., Parkington, H.C., Le
Bourhis, L., Karrar, A., Viala, J., Mak, J., et al. (2010). Bacterial membrane vesicles deliver
peptidoglycan to NOD1 in epithelial cells. Cell Microbiol 12, 372-385.
Kaser, A., Zeissig, S., and Blumberg, R.S. (2010). Inflammatory bowel disease. Annu Rev
Immunol 28, 573-621.
Kashyap, D.R., Wang, M., Liu, L.H., Boons, G.J., Gupta, D., and Dziarski, R. (2011).
Peptidoglycan recognition proteins kill bacteria by activating protein-sensing two-component
systems. Nat Med 17, 676-683.
156
Kersse, K., Bertrand, M.J., Lamkanfi, M., and Vandenabeele, P. (2011). NOD-like receptors and
the innate immune system: coping with danger, damage and death. Cytokine Growth Factor Rev
22, 257-276.
Kilshaw, P.J., and Murant, S.J. (1990). A new surface antigen on intraepithelial lymphocytes in
the intestine. European journal of immunology 20, 2201-2207.
Kim, J.G., Lee, S.J., and Kagnoff, M.F. (2004). Nod1 is an essential signal transducer in
intestinal epithelial cells infected with bacteria that avoid recognition by toll-like receptors.
Infect Immun 72, 1487-1495.
Kim, J.Y., Omori, E., Matsumoto, K., Nunez, G., and Ninomiya-Tsuji, J. (2008a). TAK1 is a
central mediator of NOD2 signaling in epidermal cells. J Biol Chem 283, 137-144.
Kim, M.S., Byun, M., and Oh, B.H. (2003). Crystal structure of peptidoglycan recognition
protein LB from Drosophila melanogaster. Nat Immunol 4, 787-793.
Kim, M.Y., Jang, J.H., Lee, J.W., and Cho, J.H. (2010). Molecular cloning and characterization
of peptidoglycan recognition proteins from the rockfish, Sebastes schlegeli. Fish Shellfish
Immunol 28, 632-639.
Kim, S.K., Schluns, K.S., and Lefrancois, L. (1999). Induction and visualization of mucosal
memory CD8 T cells following systemic virus infection. J Immunol 163, 4125-4132.
Kim, Y.G., Park, J.H., Daignault, S., Fukase, K., and Nunez, G. (2008b). Cross-tolerization
between Nod1 and Nod2 signaling results in reduced refractoriness to bacterial infection in
Nod2-deficient macrophages. J Immunol 181, 4340-4346.
Kiselev, S.L., Kustikova, O.S., Korobko, E.V., Prokhortchouk, E.B., Kabishev, A.A., Lukanidin,
E.M., and Georgiev, G.P. (1998). Molecular cloning and characterization of the mouse tag7 gene
encoding a novel cytokine. J Biol Chem 273, 18633-18639.
Kobayashi, K., Inohara, N., Hernandez, L.D., Galan, J.E., Nunez, G., Janeway, C.A., Medzhitov,
R., and Flavell, R.A. (2002). RICK/Rip2/CARDIAK mediates signalling for receptors of the
innate and adaptive immune systems. Nature 416, 194-199.
Kobayashi, K.S., Chamaillard, M., Ogura, Y., Henegariu, O., Inohara, N., Nunez, G., and
Flavell, R.A. (2005). Nod2-dependent regulation of innate and adaptive immunity in the
intestinal tract. Science (New York, NY 307, 731-734.
Korn, T., Bettelli, E., Oukka, M., and Kuchroo, V.K. (2009). IL-17 and Th17 Cells. Annu Rev
Immunol 27, 485-517.
Kotani, S., Watanabe, Y., Shimono, T., Narita, T., and Kato, K. (1975). Immunoadjuvant
activities of cell walls, their water-soluble fractions and peptidoglycan subunits, prepared from
various gram-positive bacteria, and of synthetic n-acetylmuramyl peptides. Zeitschrift fur
Immunitatsforschung, experimentelle und klinische Immunologie 149, 302-319.
157
Krieg, A., Correa, R.G., Garrison, J.B., Le Negrate, G., Welsh, K., Huang, Z., Knoefel, W.T.,
and Reed, J.C. (2009). XIAP mediates NOD signaling via interaction with RIP2. Proceedings of
the National Academy of Sciences of the United States of America 106, 14524-14529.
Kuehn, M.J., and Kesty, N.C. (2005). Bacterial outer membrane vesicles and the host-pathogen
interaction. Genes Dev 19, 2645-2655.
Kufer, T.A., Kremmer, E., Adam, A.C., Philpott, D.J., and Sansonetti, P.J. (2008). The pattern-
recognition molecule Nod1 is localized at the plasma membrane at sites of bacterial interaction.
Cell Microbiol 10, 477-486.
Kufer, T.A., and Sansonetti, P.J. (2011). NLR functions beyond pathogen recognition. Nat
Immunol 12, 121-128.
Kumar, H., Kawai, T., and Akira, S. (2009). Pathogen recognition in the innate immune
response. Biochem J 420, 1-16.
Kumar, S., Roychowdhury, A., Ember, B., Wang, Q., Guan, R., Mariuzza, R.A., and Boons, G.J.
(2005). Selective recognition of synthetic lysine and meso-diaminopimelic acid-type
peptidoglycan fragments by human peptidoglycan recognition proteins I{alpha} and S. J Biol
Chem 280, 37005-37012.
Kusumoto, S., Tarumi, Y., Ikenaka, K., and Shiba, T. (1976). Chemical synthesis of N-
acetylmuramyl peptides with partial structures of bacterial cell wall and their analogs in relation
to immunoadjuvant activities. Bull Chem Soc Jpn 49, 533-539.
Laroui, H., Yan, Y., Narui, Y., Ingersoll, S.A., Ayyadurai, S., Charania, M.A., Zhou, F., Wang,
B., Salaita, K., Sitaraman, S.V., et al. (2011). L-Ala-gamma-D-Glu-meso-diaminopimelic acid
(DAP) interacts directly with leucine-rich region domain of nucleotide-binding oligomerization
domain 1, increasing phosphorylation activity of receptor-interacting serine/threonine-protein
kinase 2 and its interaction with nucleotide-binding oligomerization domain 1. J Biol Chem 286,
31003-31013.
Latz, E., Schoenemeyer, A., Visintin, A., Fitzgerald, K.A., Monks, B.G., Knetter, C.F., Lien, E.,
Nilsen, N.J., Espevik, T., and Golenbock, D.T. (2004). TLR9 signals after translocating from the
ER to CpG DNA in the lysosome. Nat Immunol 5, 190-198.
Le Bourhis, L., Benko, S., and Girardin, S.E. (2007). Nod1 and Nod2 in innate immunity and
human inflammatory disorders. Biochemical Society transactions 35, 1479-1484.
Le Bourhis, L., Magalhaes, J.G., Selvanantham, T., Travassos, L.H., Geddes, K., Fritz, J.H.,
Viala, J., Tedin, K., Girardin, S.E., and Philpott, D.J. (2009). Role of Nod1 in mucosal dendritic
cells during Salmonella pathogenicity island 1-independent Salmonella enterica serovar
Typhimurium infection. Infect Immun 77, 4480-4486.
Lecine, P., Esmiol, S., Metais, J.Y., Nicoletti, C., Nourry, C., McDonald, C., Nunez, G., Hugot,
J.P., Borg, J.P., and Ollendorff, V. (2007). The NOD2-RICK complex signals from the plasma
membrane. J Biol Chem 282, 15197-15207.
158
Lederer, E. (1980). Synthetic immunostimulants derived from the bacterial cell wall. J Med
Chem 23, 819-825.
Lederer, E. (1986). New developments in the field of synthetic muramyl peptides, especially as
adjuvants for synthetic vaccines. Drugs Exp Clin Res 12, 429-440.
Lee, J., Tattoli, I., Wojtal, K.A., Vavricka, S.R., Philpott, D.J., and Girardin, S.E. (2009). pH-
dependent internalization of muramyl peptides from early endosomes enables Nod1 and Nod2
signaling. J Biol Chem 284, 23818-23829.
Lefrancier, P., Choay, J., Derrien, M., and Lederman, I. (1977). Synthesis of N-acetyl-muramyl-
L-alanine-D-isoglutamine, an adjuvant of the immune response, and of some N-acetyl-muramyl-
peptide analogs. Int J Peptide Protein Res 9, 249-257.
Legrand-Poels, S., Kustermans, G., Bex, F., Kremmer, E., Kufer, T.A., and Piette, J. (2007).
Modulation of Nod2-dependent NF-kappaB signaling by the actin cytoskeleton. J Cell Sci 120,
1299-1310.
Leishman, A.J., Naidenko, O.V., Attinger, A., Koning, F., Lena, C.J., Xiong, Y., Chang, H.C.,
Reinherz, E., Kronenberg, M., and Cheroutre, H. (2001). T cell responses modulated through
interaction between CD8alphaalpha and the nonclassical MHC class I molecule, TL. Science
(New York, NY 294, 1936-1939.
Leteux, C., Childs, R.A., Chai, W., Stoll, M.S., Kogelberg, H., and Feizi, T. (1998). Biotinyl-L-
3-(2-naphthyl)-alanine hydrazide derivatives of N-glycans: versatile solid-phase probes for
carbohydrate-recognition studies. Glycobiology 8, 227-236.
Leulier, F., Parquet, C., Pili-Floury, S., Ryu, J.H., Caroff, M., Lee, W.J., Mengin-Lecreulx, D.,
and Lemaitre, B. (2003). The Drosophila immune system detects bacteria through specific
peptidoglycan recognition. Nat Immunol 4, 478-484.
Ley, R.E., Peterson, D.A., and Gordon, J.I. (2006). Ecological and evolutionary forces shaping
microbial diversity in the human intestine. Cell 124, 837-848.
Li, X., Wang, S., Qi, J., Echtenkamp, S.F., Chatterjee, R., Wang, M., Boons, G.J., Dziarski, R.,
and Gupta, D. (2007). Zebrafish peptidoglycan recognition proteins are bactericidal amidases
essential for defense against bacterial infections. Immunity 27, 518-529.
Li, X., Wang, S., Wang, H., and Gupta, D. (2006). Differential expression of peptidoglycan
recognition protein 2 in the skin and liver requires different transcription factors. J Biol Chem
281, 20738-20748.
Lim, J.H., Kim, M.S., Kim, H.E., Yano, T., Oshima, Y., Aggarwal, K., Goldman, W.E.,
Silverman, N., Kurata, S., and Oh, B.H. (2006). Structural basis for preferential recognition of
diaminopimelic acid-type peptidoglycan by a subset of peptidoglycan recognition proteins. J Biol
Chem 281, 8286-8295.
159
Liu, C., Xu, Z., Gupta, D., and Dziarski, R. (2001). Peptidoglycan recognition proteins: a novel
family of four human innate immunity pattern recognition molecules. J Biol Chem 276, 34686-
34694.
Lo, D., Tynan, W., Dickerson, J., Mendy, J., Chang, H.W., Scharf, M., Byrne, D., Brayden, D.,
Higgins, L., Evans, C., et al. (2003). Peptidoglycan recognition protein expression in mouse
Peyer's Patch follicle associated epithelium suggests functional specialization. Cell Immunol
224, 8-16.
Lu, C., Wang, A., Dorsch, M., Tian, J., Nagashima, K., Coyle, A.J., Jaffee, B., Ocain, T.D., and
Xu, Y. (2005). Participation of Rip2 in lipopolysaccharide signaling is independent of its kinase
activity. J Biol Chem 280, 16278-16283.
Lu, W.G., Zou, Y.F., Feng, X.L., Yuan, F.L., Gu, Y.L., Li, X., Li, C.W., Jin, C., and Li, J.P.
(2010). Association of NOD1 (CARD4) insertion/deletion polymorphism with susceptibility to
IBD: a meta-analysis. World J Gastroenterol 16, 4348-4356.
Lu, X., Wang, M., Qi, J., Wang, H., Li, X., Gupta, D., and Dziarski, R. (2006). Peptidoglycan
recognition proteins are a new class of human bactericidal proteins. J Biol Chem 281, 5895-
5907.
Luperchio, S.A., and Schauer, D.B. (2001). Molecular pathogenesis of Citrobacter rodentium
and transmissible murine colonic hyperplasia. Microbes and infection / Institut Pasteur 3, 333-
340.
Ma, P., Wang, Z., Pflugfelder, S.C., and Li, D.Q. (2010). Toll-like receptors mediate induction of
peptidoglycan recognition proteins in human corneal epithelial cells. Exp Eye Res 90, 130-136.
Macia, E., Ehrlich, M., Massol, R., Boucrot, E., Brunner, C., and Kirchhausen, T. (2006).
Dynasore, a cell-permeable inhibitor of dynamin. Dev Cell 10, 839-850.
Magalhaes, J.G., Fritz, J.H., Le Bourhis, L., Sellge, G., Travassos, L.H., Selvanantham, T.,
Girardin, S.E., Gommerman, J.L., and Philpott, D.J. (2008). Nod2-dependent Th2 polarization of
antigen-specific immunity. J Immunol 181, 7925-7935.
Magalhaes, J.G., Philpott, D.J., Nahori, M.A., Jehanno, M., Fritz, J., Le Bourhis, L., Viala, J.,
Hugot, J.P., Giovannini, M., Bertin, J., et al. (2005). Murine Nod1 but not its human orthologue
mediates innate immune detection of tracheal cytotoxin. EMBO reports 6, 1201-1207.
Magalhaes, J.G., Tattoli, I., and Girardin, S.E. (2007). The intestinal epithelial barrier: how to
distinguish between the microbial flora and pathogens. Seminars in immunology 19, 106-115.
Marina-Garcia, N., Franchi, L., Kim, Y.G., Hu, Y., Smith, D.E., Boons, G.J., and Nunez, G.
(2009). Clathrin- and dynamin-dependent endocytic pathway regulates muramyl dipeptide
internalization and NOD2 activation. J Immunol 182, 4321-4327.
Marsh, R.A., Madden, L., Kitchen, B.J., Mody, R., McClimon, B., Jordan, M.B., Bleesing, J.J.,
Zhang, K., and Filipovich, A.H. (2010). XIAP deficiency: a unique primary immunodeficiency
160
best classified as X-linked familial hemophagocytic lymphohistiocytosis and not as X-linked
lymphoproliferative disease. Blood 116, 1079-1082.
Martinon, F., Agostini, L., Meylan, E., and Tschopp, J. (2004). Identification of bacterial
muramyl dipeptide as activator of the NALP3/cryopyrin inflammasome. Curr Biol 14, 1929-
1934.
Marzorati, M., Wittebolle, L., Boon, N., Daffonchio, D., and Verstraete, W. (2008). How to get
more out of molecular fingerprints: practical tools for microbial ecology. Environ Microbiol 10,
1571-1581.
Masopust, D., Vezys, V., Marzo, A.L., and Lefrancois, L. (2001). Preferential localization of
effector memory cells in nonlymphoid tissue. Science (New York, NY 291, 2413-2417.
Masumoto, J., Yang, K., Varambally, S., Hasegawa, M., Tomlins, S.A., Qiu, S., Fujimoto, Y.,
Kawasaki, A., Foster, S.J., Horie, Y., et al. (2006). Nod1 acts as an intracellular receptor to
stimulate chemokine production and neutrophil recruitment in vivo. The Journal of experimental
medicine 203, 203-213.
Mathur, P., Murray, B., Crowell, T., Gardner, H., Allaire, N., Hsu, Y.M., Thill, G., and Carulli,
J.P. (2004). Murine peptidoglycan recognition proteins PglyrpIalpha and PglyrpIbeta are
encoded in the epidermal differentiation complex and are expressed in epidermal and
hematopoietic tissues. Genomics 83, 1151-1163.
McCarthy, J.V., Ni, J., and Dixit, V.M. (1998). RIP2 is a novel NF-kappaB-activating and cell
death-inducing kinase. J Biol Chem 273, 16968-16975.
McGovern, D.P., Hysi, P., Ahmad, T., van Heel, D.A., Moffatt, M.F., Carey, A., Cookson, W.O.,
and Jewell, D.P. (2005). Association between a complex insertion/deletion polymorphism in
NOD1 (CARD4) and susceptibility to inflammatory bowel disease. Hum Mol Genet 14, 1245-
1250.
McGuckin, M.A., Linden, S.K., Sutton, P., and Florin, T.H. (2011). Mucin dynamics and enteric
pathogens. Nat Rev Microbiol 9, 265-278.
Mehta, K., Lopez-Berestein, G., Hersh, E.M., and Juliano, R.L. (1982). Uptake of liposomes and
liposome-encapsulated muramyl dipeptide by human peripheral blood monocytes. J
Reticuloendothel Soc 32, 155-164.
Meinzer, U., Esmiol-Welterlin, S., Barreau, F., Berrebi, D., Dussaillant, M., Bonacorsi, S.,
Chareyre, F., Niwa-Kawakita, M., Alberti, C., Sterkers, G., et al. (2008). Nod2 mediates
susceptibility to Yersinia pseudotuberculosis in mice. PLoS One 3, e2769.
Mellroth, P., Karlsson, J., and Steiner, H. (2003). A scavenger function for a Drosophila
peptidoglycan recognition protein. J Biol Chem 278, 7059-7064.
Mengin-Lecreulx, D., and Lemaitre, B. (2005). Structure and metabolism of peptidoglycan and
molecular requirements allowing its detection by the Drosophila innate immune system. J
Endotoxin Res 11, 105-111.
161
Meredith, D., and Price, R.A. (2006). Molecular modeling of PepT1--towards a structure. J
Membr Biol 213, 79-88.
Merlin, D., Si-Tahar, M., Sitaraman, S.V., Eastburn, K., Williams, I., Liu, X., Hediger, M.A.,
and Madara, J.L. (2001). Colonic epithelial hPepT1 expression occurs in inflammatory bowel
disease: transport of bacterial peptides influences expression of MHC class 1 molecules.
Gastroenterology 120, 1666-1679.
Michel, T., Reichhart, J.M., Hoffmann, J.A., and Royet, J. (2001). Drosophila Toll is activated
by Gram-positive bacteria through a circulating peptidoglycan recognition protein. Nature 414,
756-759.
Mo, J., Boyle, J.P., Howard, C.B., Monie, T.P., Davis, B.K., and Duncan, J.A. (2012). Pathogen
Sensing by Nucleotide-binding Oligomerization Domain-containing Protein 2 (NOD2) Is
Mediated by Direct Binding to Muramyl Dipeptide and ATP. J Biol Chem 287, 23057-23067.
Mopper, K., and Johnson, L. (1983). Reverse-phase liquid chromatographic analysis of Dns-
sugars. Optimization of derivatization and chromatographic procedures and applications to
natural samples. J Chromatogr 256, 27-38.
Mukherjee, S., Vaishnava, S., and Hooper, L.V. (2008). Multi-layered regulation of intestinal
antimicrobial defense. Cell Mol Life Sci 65, 3019-3027.
Nayar, R., Schroit, A.J., and Fidler, I.J. (1986). Liposome encapsulation of muramyl peptides for
activation of macrophage cytotoxic properties. Methods Enzymol 132, 594-603.
Nembrini, C., Reissmann, R., Kopf, M., and Marsland, B.J. (2008). Effective T-cell immune
responses in the absence of the serine/threonine kinase RIP2. Microbes and infection / Institut
Pasteur 10, 522-530.
O'Reilly, T., and Zak, O. (1992). Enhancement of the effectiveness of antimicrobial therapy by
muramyl peptide immunomodulators. Clin Infect Dis 14, 1100-1109.
Odenbreit, S., Puls, J., Sedlmaier, B., Gerland, E., Fischer, W., and Haas, R. (2000).
Translocation of Helicobacter pylori CagA into gastric epithelial cells by type IV secretion.
Science (New York, NY 287, 1497-1500.
Ogura, Y., Bonen, D.K., Inohara, N., Nicolae, D.L., Chen, F.F., Ramos, R., Britton, H., Moran,
T., Karaliuskas, R., Duerr, R.H., et al. (2001). A frameshift mutation in NOD2 associated with
susceptibility to Crohn's disease. Nature 411, 603-606.
Ogura, Y., Lala, S., Xin, W., Smith, E., Dowds, T.A., Chen, F.F., Zimmermann, E., Tretiakova,
M., Cho, J.H., Hart, J., et al. (2003). Expression of NOD2 in Paneth cells: a possible link to
Crohn's ileitis. Gut 52, 1591-1597.
Opitz, B., Forster, S., Hocke, A.C., Maass, M., Schmeck, B., Hippenstiel, S., Suttorp, N., and
Krull, M. (2005). Nod1-mediated endothelial cell activation by Chlamydophila pneumoniae.
Circulation research 96, 319-326.
162
Opitz, B., Puschel, A., Beermann, W., Hocke, A.C., Forster, S., Schmeck, B., van Laak, V.,
Chakraborty, T., Suttorp, N., and Hippenstiel, S. (2006). Listeria monocytogenes activated p38
MAPK and induced IL-8 secretion in a nucleotide-binding oligomerization domain 1-dependent
manner in endothelial cells. J Immunol 176, 484-490.
Opitz, B., Puschel, A., Schmeck, B., Hocke, A.C., Rosseau, S., Hammerschmidt, S., Schumann,
R.R., Suttorp, N., and Hippenstiel, S. (2004). Nucleotide-binding oligomerization domain
proteins are innate immune receptors for internalized Streptococcus pneumoniae. J Biol Chem
279, 36426-36432.
Osanai, A., Sashinami, H., Asano, K., Li, S.J., Hu, D.L., and Nakane, A. (2011). Mouse
peptidoglycan recognition protein PGLYRP-1 plays a role in the host innate immune response
against Listeria monocytogenes infection. Infect Immun 79, 858-866.
Ott, S.J., Musfeldt, M., Wenderoth, D.F., Hampe, J., Brant, O., Folsch, U.R., Timmis, K.N., and
Schreiber, S. (2004). Reduction in diversity of the colonic mucosa associated bacterial
microflora in patients with active inflammatory bowel disease. Gut 53, 685-693.
Pardigon, N., Darche, S., Kelsall, B., Bennink, J.R., and Yewdell, J.W. (2004). The TL MHC
class Ib molecule has only marginal effects on the activation, survival and trafficking of mouse
small intestinal intraepithelial lymphocytes. Int Immunol 16, 1305-1313.
Paredes, J.C., Welchman, D.P., Poidevin, M., and Lemaitre, B. (2011). Negative regulation by
amidase PGRPs shapes the Drosophila antibacterial response and protects the fly from innocuous
infection. Immunity 35, 770-779.
Park, J.H., Kim, Y.G., McDonald, C., Kanneganti, T.D., Hasegawa, M., Body-Malapel, M.,
Inohara, N., and Nunez, G. (2007a). RICK/RIP2 mediates innate immune responses induced
through Nod1 and Nod2 but not TLRs. J Immunol 178, 2380-2386.
Park, J.H., Kim, Y.G., Shaw, M., Kanneganti, T.D., Fujimoto, Y., Fukase, K., Inohara, N., and
Nunez, G. (2007b). Nod1/RICK and TLR signaling regulate chemokine and antimicrobial innate
immune responses in mesothelial cells. J Immunol 179, 514-521.
Park, S.Y., Gupta, D., Hurwich, R., Kim, C.H., and Dziarski, R. (2011a). Peptidoglycan
recognition protein Pglyrp2 protects mice from psoriasis-like skin inflammation by promoting
regulatory T cells and limiting Th17 responses. J Immunol 187, 5813-5823.
Park, S.Y., Gupta, D., Kim, C.H., and Dziarski, R. (2011b). Differential effects of peptidoglycan
recognition proteins on experimental atopic and contact dermatitis mediated by Treg and Th17
cells. PLoS One 6, e24961.
Petnicki-Ocwieja, T., Hrncir, T., Liu, Y.J., Biswas, A., Hudcovic, T., Tlaskalova-Hogenova, H.,
and Kobayashi, K.S. (2009). Nod2 is required for the regulation of commensal microbiota in the
intestine. Proceedings of the National Academy of Sciences of the United States of America 106,
15813-15818.
163
Phillips, N.C., Stewart-Phillips, J., and Wang, P. (1994). Tumor cell binding and induction of
endothelial cell tumoricidal activity in vitro by muramyl dipeptide is enhanced by liposomal
encapsulation. J Immunother Emphasis Tumor Immunol 15, 185-193.
Philpott, D.J., and Girardin, S.E. (2004). The role of Toll-like receptors and Nod proteins in
bacterial infection. Molecular immunology 41, 1099-1108.
Philpott, D.J., and Girardin, S.E. (2010). Nod-like receptors: sentinels at host membranes. Curr
Opin Immunol 22, 428-434.
Raffatellu, M., George, M.D., Akiyama, Y., Hornsby, M.J., Nuccio, S.P., Paixao, T.A., Butler,
B.P., Chu, H., Santos, R.L., Berger, T., et al. (2009). Lipocalin-2 resistance confers an advantage
to Salmonella enterica serotype Typhimurium for growth and survival in the inflamed intestine.
Cell Host Microbe 5, 476-486.
Raffatellu, M., Santos, R.L., Verhoeven, D.E., George, M.D., Wilson, R.P., Winter, S.E.,
Godinez, I., Sankaran, S., Paixao, T.A., Gordon, M.A., et al. (2008). Simian immunodeficiency
virus-induced mucosal interleukin-17 deficiency promotes Salmonella dissemination from the
gut. Nat Med 14, 421-428.
Rahman, M.K., Midtling, E.H., Svingen, P.A., Xiong, Y., Bell, M.P., Tung, J., Smyrk, T., Egan,
L.J., and Faubion, W.A., Jr. (2010). The pathogen recognition receptor NOD2 regulates human
FOXP3+ T cell survival. J Immunol 184, 7247-7256.
Rakoff-Nahoum, S., Paglino, J., Eslami-Varzaneh, F., Edberg, S., and Medzhitov, R. (2004).
Recognition of commensal microflora by toll-like receptors is required for intestinal
homeostasis. Cell 118, 229-241.
Ramet, M., Manfruelli, P., Pearson, A., Mathey-Prevot, B., and Ezekowitz, R.A. (2002).
Functional genomic analysis of phagocytosis and identification of a Drosophila receptor for E.
coli. Nature 416, 644-648.
Regueiro, V., Moranta, D., Frank, C.G., Larrarte, E., Margareto, J., March, C., Garmendia, J.,
and Bengoechea, J.A. (2011). Klebsiella pneumoniae subverts the activation of inflammatory
responses in a NOD1-dependent manner. Cell Microbiol 13, 135-153.
Rehman, A., Sina, C., Gavrilova, O., Hasler, R., Ott, S., Baines, J.F., Schreiber, S., and
Rosenstiel, P. (2011). Nod2 is essential for temporal development of intestinal microbial
communities. Gut 60, 1354-1362.
Rigaud, S., Fondaneche, M.C., Lambert, N., Pasquier, B., Mateo, V., Soulas, P., Galicier, L., Le
Deist, F., Rieux-Laucat, F., Revy, P., et al. (2006). XIAP deficiency in humans causes an X-
linked lymphoproliferative syndrome. Nature 444, 110-114.
Rivas, M.A., Beaudoin, M., Gardet, A., Stevens, C., Sharma, Y., Zhang, C.K., Boucher, G.,
Ripke, S., Ellinghaus, D., Burtt, N., et al. (2011). Deep resequencing of GWAS loci identifies
independent rare variants associated with inflammatory bowel disease. Nat Genet 43, 1066-1073.
164
Rosenstiel, P., Fantini, M., Brautigam, K., Kuhbacher, T., Waetzig, G.H., Seegert, D., and
Schreiber, S. (2003). TNF-alpha and IFN-gamma regulate the expression of the NOD2
(CARD15) gene in human intestinal epithelial cells. Gastroenterology 124, 1001-1009.
Royet, J., and Dziarski, R. (2007). Peptidoglycan recognition proteins: pleiotropic sensors and
effectors of antimicrobial defences. Nat Rev Microbiol 5, 264-277.
Royet, J., Gupta, D., and Dziarski, R. (2011). Peptidoglycan recognition proteins: modulators of
the microbiome and inflammation. Nat Rev Immunol 11, 837-851.
Ruefli-Brasse, A.A., Lee, W.P., Hurst, S., and Dixit, V.M. (2004). Rip2 participates in Bcl10
signaling and T-cell receptor-mediated NF-kappaB activation. J Biol Chem 279, 1570-1574.
Rydstrom, A., and Wick, M.J. (2007). Monocyte recruitment, activation, and function in the gut-
associated lymphoid tissue during oral Salmonella infection. J Immunol 178, 5789-5801.
Sabbah, A., Chang, T.H., Harnack, R., Frohlich, V., Tominaga, K., Dube, P.H., Xiang, Y., and
Bose, S. (2009). Activation of innate immune antiviral responses by Nod2. Nat Immunol 10,
1073-1080.
Saha, S., Jing, X., Park, S.Y., Wang, S., Li, X., Gupta, D., and Dziarski, R. (2010).
Peptidoglycan recognition proteins protect mice from experimental colitis by promoting normal
gut flora and preventing induction of interferon-gamma. Cell Host Microbe 8, 147-162.
Saha, S., Qi, J., Wang, S., Wang, M., Li, X., Kim, Y.G., Nunez, G., Gupta, D., and Dziarski, R.
(2009). PGLYRP-2 and Nod2 are both required for peptidoglycan-induced arthritis and local
inflammation. Cell Host Microbe 5, 137-150.
Saiki, I., and Fidler, I.J. (1985). Synergistic activation by recombinant mouse interferon-gamma
and muramyl dipeptide of tumoricidal properties in mouse macrophages. J Immunol 135, 684-
688.
Sang, Y., Ramanathan, B., Ross, C.R., and Blecha, F. (2005). Gene silencing and overexpression
of porcine peptidoglycan recognition protein long isoforms: involvement in beta-defensin-1
expression. Infect Immun 73, 7133-7141.
Santos, R.L., Zhang, S., Tsolis, R.M., Kingsley, R.A., Adams, L.G., and Baumler, A.J. (2001).
Animal models of Salmonella infections: enteritis versus typhoid fever. Microbes and infection /
Institut Pasteur 3, 1335-1344.
Sasawatari, S., Okamura, T., Kasumi, E., Tanaka-Furuyama, K., Yanobu-Takanashi, R.,
Shirasawa, S., Kato, N., and Toyama-Sorimachi, N. (2011). The solute carrier family 15A4
regulates TLR9 and NOD1 functions in the innate immune system and promotes colitis in mice.
Gastroenterology 140, 1513-1525.
Sato, T., van Es, J.H., Snippert, H.J., Stange, D.E., Vries, R.G., van den Born, M., Barker, N.,
Shroyer, N.F., van de Wetering, M., and Clevers, H. (2011). Paneth cells constitute the niche for
Lgr5 stem cells in intestinal crypts. Nature 469, 415-418.
165
Schauer, D.B., and Falkow, S. (1993). Attaching and effacing locus of a Citrobacter freundii
biotype that causes transmissible murine colonic hyperplasia. Infect Immun 61, 2486-2492.
Schleifer, K.H., and Kandler, O. (1972). Peptidoglycan types of bacterial cell walls and their
taxonomic implications. Bacteriol Rev 36, 407-477.
Schroder, K., Muruve, D.A., and Tschopp, J. (2009). Innate immunity: cytoplasmic DNA
sensing by the AIM2 inflammasome. Curr Biol 19, R262-265.
Schroder, K., and Tschopp, J. (2010). The inflammasomes. Cell 140, 821-832.
Schroit, A.J., and Fidler, I.J. (1982). Effects of liposome structure and lipid composition on the
activation of the tumoricidal properties of macrophages by liposomes containing muramyl
dipeptide. Cancer Res 42, 161-167.
Sekirov, I., Tam, N.M., Jogova, M., Robertson, M.L., Li, Y., Lupp, C., and Finlay, B.B. (2008).
Antibiotic-induced perturbations of the intestinal microbiota alter host susceptibility to enteric
infection. Infect Immun 76, 4726-4736.
Serbina, N.V., Salazar-Mather, T.P., Biron, C.A., Kuziel, W.A., and Pamer, E.G. (2003).
TNF/iNOS-producing dendritic cells mediate innate immune defense against bacterial infection.
Immunity 19, 59-70.
Shaw, M.H., Reimer, T., Sanchez-Valdepenas, C., Warner, N., Kim, Y.G., Fresno, M., and
Nunez, G. (2009). T cell-intrinsic role of Nod2 in promoting type 1 immunity to Toxoplasma
gondii. Nat Immunol 10, 1267-1274.
Shinohara, Y., Sota, H., Kim, F., Shimizu, M., Gotoh, M., Tosu, M., and Hasegawa, Y. (1995).
Use of a biosensor based on surface plasmon resonance and biotinyl glycans for analysis of sugar
binding specificities of lectins. J Biochem 117, 1076-1082.
Silva, G.K., Gutierrez, F.R., Guedes, P.M., Horta, C.V., Cunha, L.D., Mineo, T.W., Santiago-
Silva, J., Kobayashi, K.S., Flavell, R.A., Silva, J.S., et al. (2010). Cutting edge: nucleotide-
binding oligomerization domain 1-dependent responses account for murine resistance against
Trypanosoma cruzi infection. J Immunol 184, 1148-1152.
Simms, L.A., Doecke, J.D., Walsh, M.D., Huang, N., Fowler, E.V., and Radford-Smith, G.L.
(2008). Reduced alpha-defensin expression is associated with inflammation and not NOD2
mutation status in ileal Crohn's disease. Gut 57, 903-910.
Sorbara, M.T., and Philpott, D.J. (2011). Peptidoglycan: a critical activator of the mammalian
immune system during infection and homeostasis. Immunol Rev 243, 40-60.
Souvannavong, V., Brown, S., and Adam, A. (1990). Muramyl dipeptide (MDP) synergizes with
interleukin 2 and interleukin 4 to stimulate, respectively, the differentiation and proliferation of
B cells. Cell Immunol 126, 106-116.
166
Stecher, B., Macpherson, A.J., Hapfelmeier, S., Kremer, M., Stallmach, T., and Hardt, W.D.
(2005). Comparison of Salmonella enterica serovar Typhimurium colitis in germfree mice and
mice pretreated with streptomycin. Infect Immun 73, 3228-3241.
Stecher, B., Robbiani, R., Walker, A.W., Westendorf, A.M., Barthel, M., Kremer, M., Chaffron,
S., Macpherson, A.J., Buer, J., Parkhill, J., et al. (2007). Salmonella enterica serovar
typhimurium exploits inflammation to compete with the intestinal microbiota. PLoS Biol 5,
2177-2189.
Steinberg, B.E., Huynh, K.K., and Grinstein, S. (2007). Phagosomal acidification: measurement,
manipulation and functional consequences. Biochemical Society transactions 35, 1083-1087.
Stenbak, C.R., Ryu, J.H., Leulier, F., Pili-Floury, S., Parquet, C., Herve, M., Chaput, C., Boneca,
I.G., Lee, W.J., Lemaitre, B., et al. (2004). Peptidoglycan molecular requirements allowing
detection by the Drosophila immune deficiency pathway. J Immunol 173, 7339-7348.
Sugawara, Y., Uehara, A., Fujimoto, Y., Kusumoto, S., Fukase, K., Shibata, K., Sugawara, S.,
Sasano, T., and Takada, H. (2006). Toll-like receptors, NOD1, and NOD2 in oral epithelial cells.
Journal of dental research 85, 524-529.
Sundquist, M., and Wick, M.J. (2005). TNF-alpha-dependent and -independent maturation of
dendritic cells and recruited CD11c(int)CD11b+ Cells during oral Salmonella infection. J
Immunol 175, 3287-3298.
Sundquist, M., and Wick, M.J. (2009). Salmonella induces death of CD8alpha(+) dendritic cells
but not CD11c(int)CD11b(+) inflammatory cells in vivo via MyD88 and TNFR1. J Leukoc Biol
85, 225-234.
Swaan, P.W., Bensman, T., Bahadduri, P.M., Hall, M.W., Sarkar, A., Bao, S., Khantwal, C.M.,
Ekins, S., and Knoell, D.L. (2008). Bacterial peptide recognition and immune activation
facilitated by human peptide transporter PEPT2. Am J Respir Cell Mol Biol 39, 536-542.
Swaminathan, C.P., Brown, P.H., Roychowdhury, A., Wang, Q., Guan, R., Silverman, N.,
Goldman, W.E., Boons, G.J., and Mariuzza, R.A. (2006). Dual strategies for peptidoglycan
discrimination by peptidoglycan recognition proteins (PGRPs). Proceedings of the National
Academy of Sciences of the United States of America 103, 684-689.
Takada, H., Tsujimoto, M., Kato, K., Kotani, S., Kusumoto, S., Inage, M., Shiba, T., Yano, I.,
Kawata, S., and Yokogawa, K. (1979). Macrophage activation by bacterial cell walls and related
synthetic compounds. Infect Immun 25, 48-53.
Tanabe, T., Chamaillard, M., Ogura, Y., Zhu, L., Qiu, S., Masumoto, J., Ghosh, P., Moran, A.,
Predergast, M.M., Tromp, G., et al. (2004). Regulatory regions and critical residues of NOD2
involved in muramyl dipeptide recognition. Embo J 23, 1587-1597.
Tanji, T., and Ip, Y.T. (2005). Regulators of the Toll and Imd pathways in the Drosophila innate
immune response. Trends Immunol 26, 193-198.
167
Tao, M., Scacheri, P.C., Marinis, J.M., Harhaj, E.W., Matesic, L.E., and Abbott, D.W. (2009).
ITCH K63-ubiquitinates the NOD2 binding protein, RIP2, to influence inflammatory signaling
pathways. Curr Biol 19, 1255-1263.
Thome, M., Hofmann, K., Burns, K., Martinon, F., Bodmer, J.L., Mattmann, C., and Tschopp, J.
(1998). Identification of CARDIAK, a RIP-like kinase that associates with caspase-1. Curr Biol
8, 885-888.
Totemeyer, S., Sheppard, M., Lloyd, A., Roper, D., Dowson, C., Underhill, D., Murray, P.,
Maskell, D., and Bryant, C. (2006). IFN-gamma enhances production of nitric oxide from
macrophages via a mechanism that depends on nucleotide oligomerization domain-2. J Immunol
176, 4804-4810.
Traub, S., Kubasch, N., Morath, S., Kresse, M., Hartung, T., Schmidt, R.R., and Hermann, C.
(2004). Structural requirements of synthetic muropeptides to synergize with lipopolysaccharide
in cytokine induction. J Biol Chem 279, 8694-8700.
Traub, S., von Aulock, S., Hartung, T., and Hermann, C. (2006). MDP and other muropeptides--
direct and synergistic effects on the immune system. J Endotoxin Res 12, 69-85.
Travassos, L.H., Carneiro, L.A., Girardin, S.E., Boneca, I.G., Lemos, R., Bozza, M.T.,
Domingues, R.C., Coyle, A.J., Bertin, J., Philpott, D.J., et al. (2005). Nod1 participates in the
innate immune response to Pseudomonas aeruginosa. J Biol Chem 280, 36714-36718.
Travassos, L.H., Carneiro, L.A., Ramjeet, M., Hussey, S., Kim, Y.G., Magalhaes, J.G., Yuan, L.,
Soares, F., Chea, E., Le Bourhis, L., et al. (2010). Nod1 and Nod2 direct autophagy by recruiting
ATG16L1 to the plasma membrane at the site of bacterial entry. Nat Immunol 11, 55-62.
Trompouki, E., Hatzivassiliou, E., Tsichritzis, T., Farmer, H., Ashworth, A., and Mosialos, G.
(2003). CYLD is a deubiquitinating enzyme that negatively regulates NF-kappaB activation by
TNFR family members. Nature 424, 793-796.
Tydell, C.C., Yount, N., Tran, D., Yuan, J., and Selsted, M.E. (2002). Isolation, characterization,
and antimicrobial properties of bovine oligosaccharide-binding protein. A microbicidal granule
protein of eosinophils and neutrophils. J Biol Chem 277, 19658-19664.
Tydell, C.C., Yuan, J., Tran, P., and Selsted, M.E. (2006). Bovine peptidoglycan recognition
protein-S: antimicrobial activity, localization, secretion, and binding properties. J Immunol 176,
1154-1162.
Uehara, A., Fujimoto, Y., Fukase, K., and Takada, H. (2007). Various human epithelial cells
express functional Toll-like receptors, NOD1 and NOD2 to produce anti-microbial peptides, but
not proinflammatory cytokines. Molecular immunology 44, 3100-3111.
Uehara, A., Sugawara, Y., Kurata, S., Fujimoto, Y., Fukase, K., Kusumoto, S., Satta, Y., Sasano,
T., Sugawara, S., and Takada, H. (2005). Chemically synthesized pathogen-associated molecular
patterns increase the expression of peptidoglycan recognition proteins via toll-like receptors,
NOD1 and NOD2 in human oral epithelial cells. Cell Microbiol 7, 675-686.
168
Uematsu, S., and Fujimoto, K. (2010). The innate immune system in the intestine. Microbiol
Immunol 54, 645-657.
Vaishnava, S., Behrendt, C.L., Ismail, A.S., Eckmann, L., and Hooper, L.V. (2008). Paneth cells
directly sense gut commensals and maintain homeostasis at the intestinal host-microbial
interface. Proceedings of the National Academy of Sciences of the United States of America 105,
20858-20863.
Van Limbergen, J., Philpott, D., and Griffiths, A.M. (2011). Genetic profiling in inflammatory
bowel disease: from association to bedside. Gastroenterology 141, 1566-1571 e1561.
Van Limbergen, J., Russell, R.K., Nimmo, E.R., Torkvist, L., Lees, C.W., Drummond, H.E.,
Smith, L., Anderson, N.H., Gillett, P.M., McGrogan, P., et al. (2007). Contribution of the
NOD1/CARD4 insertion/deletion polymorphism +32656 to inflammatory bowel disease in
Northern Europe. Inflamm Bowel Dis 13, 882-889.
Vanderwinkel, E., de Pauw, P., Philipp, D., Ten Have, J.P., and Bainter, K. (1995). The human
and mammalian N-acetylmuramyl-L-alanine amidase: distribution, action on different bacterial
peptidoglycans, and comparison with the human lysozyme activities. Biochem Mol Med 54, 26-
32.
Vavricka, S.R., Musch, M.W., Chang, J.E., Nakagawa, Y., Phanvijhitsiri, K., Waypa, T.S.,
Merlin, D., Schneewind, O., and Chang, E.B. (2004). hPepT1 transports muramyl dipeptide,
activating NF-kappaB and stimulating IL-8 secretion in human colonic Caco2/bbe cells.
Gastroenterology 127, 1401-1409.
Velin, D., Favre, L., Bernasconi, E., Bachmann, D., Pythoud, C., Saiji, E., Bouzourene, H., and
Michetti, P. (2009). Interleukin-17 is a critical mediator of vaccine-induced reduction of
Helicobacter infection in the mouse model. Gastroenterology 136, 2237-2246 e2231.
Vermeulen, M.W., David, J.R., and Remold, H.G. (1987). Differential mRNA responses in
human macrophages activated by interferon-gamma and muramyl dipeptide. J Immunol 139, 7-9.
Viala, J., Chaput, C., Boneca, I.G., Cardona, A., Girardin, S.E., Moran, A.P., Athman, R.,
Memet, S., Huerre, M.R., Coyle, A.J., et al. (2004). Nod1 responds to peptidoglycan delivered
by the Helicobacter pylori cag pathogenicity island. Nat Immunol 5, 1166-1174.
Vollmer, W., Blanot, D., and de Pedro, M.A. (2008). Peptidoglycan structure and architecture.
FEMS Microbiol Rev 32, 149-167.
Waller, S., Tremelling, M., Bredin, F., Godfrey, L., Howson, J., and Parkes, M. (2006). Evidence
for association of OCTN genes and IBD5 with ulcerative colitis. Gut 55, 809-814.
Wang, H., Gupta, D., Li, X., and Dziarski, R. (2005). Peptidoglycan recognition protein 2 (N-
acetylmuramoyl-L-Ala amidase) is induced in keratinocytes by bacteria through the p38 kinase
pathway. Infect Immun 73, 7216-7225.
169
Wang, J.E., Jorgensen, P.F., Ellingsen, E.A., Almiof, M., Thiemermann, C., Foster, S.J., Aasen,
A.O., and Solberg, R. (2001). Peptidoglycan primes for LPS-induced release of proinflammatory
cytokines in whole human blood. Shock 16, 178-182.
Wang, M., Liu, L.H., Wang, S., Li, X., Lu, X., Gupta, D., and Dziarski, R. (2007). Human
peptidoglycan recognition proteins require zinc to kill both gram-positive and gram-negative
bacteria and are synergistic with antibacterial peptides. J Immunol 178, 3116-3125.
Wang, Z.M., Li, X., Cocklin, R.R., Wang, M., Wang, M., Fukase, K., Inamura, S., Kusumoto, S.,
Gupta, D., and Dziarski, R. (2003). Human peptidoglycan recognition protein-L is an N-
acetylmuramoyl-L-alanine amidase. J Biol Chem 278, 49044-49052.
Watanabe, T., Asano, N., Fichtner-Feigl, S., Gorelick, P.L., Tsuji, Y., Matsumoto, Y., Chiba, T.,
Fuss, I.J., Kitani, A., and Strober, W. (2010a). NOD1 contributes to mouse host defense against
Helicobacter pylori via induction of type I IFN and activation of the ISGF3 signaling pathway. J
Clin Invest 120, 1645-1662.
Watanabe, T., Asano, N., Kitani, A., Fuss, I.J., Chiba, T., and Strober, W. (2010b). NOD1-
Mediated Mucosal Host Defense against Helicobacter pylori. Int J Inflam 2010, 476482.
Wehkamp, J., Harder, J., Weichenthal, M., Schwab, M., Schaffeler, E., Schlee, M., Herrlinger,
K.R., Stallmach, A., Noack, F., Fritz, P., et al. (2004). NOD2 (CARD15) mutations in Crohn's
disease are associated with diminished mucosal alpha-defensin expression. Gut 53, 1658-1664.
Wehkamp, J., Salzman, N.H., Porter, E., Nuding, S., Weichenthal, M., Petras, R.E., Shen, B.,
Schaeffeler, E., Schwab, M., Linzmeier, R., et al. (2005). Reduced Paneth cell alpha-defensins in
ileal Crohn's disease. Proceedings of the National Academy of Sciences of the United States of
America 102, 18129-18134.
Welter-Stahl, L., Ojcius, D.M., Viala, J., Girardin, S., Liu, W., Delarbre, C., Philpott, D., Kelly,
K.A., and Darville, T. (2006). Stimulation of the cytosolic receptor for peptidoglycan, Nod1, by
infection with Chlamydia trachomatis or Chlamydia muridarum. Cell Microbiol 8, 1047-1057.
Werner, T., Liu, G., Kang, D., Ekengren, S., Steiner, H., and Hultmark, D. (2000). A family of
peptidoglycan recognition proteins in the fruit fly Drosophila melanogaster. Proceedings of the
National Academy of Sciences of the United States of America 97, 13772-13777.
Werts, C., Rubino, S., Ling, A., Girardin, S.E., and Philpott, D.J. (2011). Nod-like receptors in
intestinal homeostasis, inflammation, and cancer. J Leukoc Biol 90, 471-482.
Weston, B.J., Henderson, D.C., Seal, S., Spackman, V., Robertson, F., and Dewdney, J.M.
(1991). Stimulatory effects of FK156 in a panel of tests designed to detect changes in immune
function. International journal of immunopharmacology 13, 117-124.
Wilkins, C., and Gale, M., Jr. (2010). Recognition of viruses by cytoplasmic sensors. Curr Opin
Immunol 22, 41-47.
170
Windheim, M., Lang, C., Peggie, M., Plater, L.A., and Cohen, P. (2007). Molecular mechanisms
involved in the regulation of cytokine production by muramyl dipeptide. Biochem J 404, 179-
190.
Wojtal, K.A., Eloranta, J.J., Hruz, P., Gutmann, H., Drewe, J., Staumann, A., Beglinger, C.,
Fried, M., Kullak-Ublick, G.A., and Vavricka, S.R. (2009). Changes in mRNA expression levels
of solute carrier transporters in inflammatory bowel disease patients. Drug Metab Dispos 37,
1871-1877.
Xu, M., Wang, Z., and Locksley, R.M. (2004). Innate immune responses in peptidoglycan
recognition protein L-deficient mice. Molecular and cellular biology 24, 7949-7957.
Yang, S., Tamai, R., Akashi, S., Takeuchi, O., Akira, S., Sugawara, S., and Takada, H. (2001).
Synergistic effect of muramyldipeptide with lipopolysaccharide or lipoteichoic acid to induce
inflammatory cytokines in human monocytic cells in culture. Infect Immun 69, 2045-2053.
Yang, Y., Yin, C., Pandey, A., Abbott, D., Sassetti, C., and Kelliher, M.A. (2007). NOD2
pathway activation by MDP or Mycobacterium tuberculosis infection involves the stable
polyubiquitination of Rip2. J Biol Chem 282, 36223-36229.
Yates, R.M., and Russell, D.G. (2005). Phagosome maturation proceeds independently of
stimulation of toll-like receptors 2 and 4. Immunity 23, 409-417.
Yoshida, H., Kinoshita, K., and Ashida, M. (1996). Purification of a peptidoglycan recognition
protein from hemolymph of the silkworm, Bombyx mori. J Biol Chem 271, 13854-13860.
Zaidman-Remy, A., Herve, M., Poidevin, M., Pili-Floury, S., Kim, M.S., Blanot, D., Oh, B.H.,
Ueda, R., Mengin-Lecreulx, D., and Lemaitre, B. (2006). The Drosophila amidase PGRP-LB
modulates the immune response to bacterial infection. Immunity 24, 463-473.
Zaidman-Remy, A., Poidevin, M., Herve, M., Welchman, D.P., Paredes, J.C., Fahlander, C.,
Steiner, H., Mengin-Lecreulx, D., and Lemaitre, B. (2011). Drosophila immunity: analysis of
PGRP-SB1 expression, enzymatic activity and function. PLoS One 6, e17231.
Zasloff, M. (2002). Antimicrobial peptides of multicellular organisms. Nature 415, 389-395.
Zeitz, M., Schieferdecker, H.L., Ullrich, R., Jahn, H.U., James, S.P., and Riecken, E.O. (1991).
Phenotype and function of lamina propria T lymphocytes. Immunol Res 10, 199-206.
Zeitz, M., Ullrich, R., Schneider, T., Schieferdecker, H.L., and Riecken, E.O. (1994). Cell
differentiation and proliferation in the gastrointestinal tract with respect to the local immune
system. Annals of the New York Academy of Sciences 733, 75-86.
Zhang, Y., van der Fits, L., Voerman, J.S., Melief, M.J., Laman, J.D., Wang, M., Wang, H.,
Wang, M., Li, X., Walls, C.D., et al. (2005). Identification of serum N-acetylmuramoyl-l-alanine
amidase as liver peptidoglycan recognition protein 2. Biochim Biophys Acta 1752, 34-46.
Zhou, L., Srisatjaluk, R., Justus, D.E., and Doyle, R.J. (1998). On the origin of membrane
vesicles in gram-negative bacteria. FEMS Microbiol Lett 163, 223-228.
171
Zilbauer, M., Dorrell, N., Elmi, A., Lindley, K.J., Schuller, S., Jones, H.E., Klein, N.J., Nunez,
G., Wren, B.W., and Bajaj-Elliott, M. (2007). A major role for intestinal epithelial nucleotide
oligomerization domain 1 (NOD1) in eliciting host bactericidal immune responses to
Campylobacter jejuni. Cell Microbiol 9, 2404-2416.
Zoetendal, E.G., Rajilic-Stojanovic, M., and de Vos, W.M. (2008). High-throughput diversity
and functionality analysis of the gastrointestinal tract microbiota. Gut 57, 1605-1615.
Zucchelli, M., Torkvist, L., Bresso, F., Halfvarson, J., Hellquist, A., Anedda, F., Assadi, G.,
Lindgren, G.B., Svanfeldt, M., Janson, M., et al. (2009). PepT1 oligopeptide transporter
(SLC15A1) gene polymorphism in inflammatory bowel disease. Inflamm Bowel Dis 15, 1562-
1569.
Zunic, M., Kricek, F., Dukor, P., and Bahr, G.M. (1996). Oral administration of muramyl
dipeptide into mice modulates cell proliferation, immunoglobulin synthesis and cytokine mRNA
levels in gut associated lymphoid tissues. International journal of immunopharmacology 18, 155-
162.
Recommended