Reliability of ITS in Species Identification by Surachit Waengsothorn

Reliability of ITS in Species Identification

by

Surachit Waengsothorn

What’s ITS

ITS stands for Internal Transcribed Spacer regions

Where are they?

These regions are located in ribosome.

Ribosomal RNA

5S rRNS 5.8s rRNA 18s rRNS

120bp 160bp ~1900bp

ITS1 ITS2

What’s ITS

ITS stands for Internal Transcribed Spacer regions

Where are they?

These regions are located in ribosome.

Why do I pick ITS?

rRNA is highly conserved across texa while the ITS may be species-specific.

rRNA evolution rate use

Small-subunit very slow distantly related organisms

Mitocondrial more rapidly family level

ITS fastest variation among species

Species

In the past 30 years, over six concepts have been proposed.

Species is a very simple word BUT its definition is not that easy.

Three majors concepts:

-The biological species concept

- The phylogenetic species concept

- The morphospeceis concept

The biological species concept• proposed in 1942 by Ernst Mayr

• used by many zoologists

• defined “species” in Endangered Species Act

Criterion: reproductive isolation (lack of gene flow)

• populations do not hybridize

• populations fail to produce fertile offspring

Cons:

• can be applied to only living organisms

• difficult to keep tract on all populations

The phylogenetic species concept

Criterion: monophyly

Populations contain all the know descendants of a single common ancestor.

Species are the smallest diagnosable monophyletic groups.

The morphospeceis concept: used by paleontologists

They define species on the basis of morphological differences among fossils.

All concepts share three things in common:

1) Species consist of interbreeding populations.

2) Species are a fundamental unit of evolution.

3) Species share a distinguishing characteristic.

Why is species identification so important?

Species plays a major role in all conservation aspects.

Species identification is a starting point of life science disciplines i.e. biology, ecology, forestry, biotechnology, etc.

Species identification is daily used in many careers such as farmers, foresters, lawyers, gardeners, researchers, scientists, curators, ete.

MethodData collections:

Lab work:- extract DNA from a sugar maple sample.

- amplify ITS region using PCR technique.

- perform fragment sequencing.

5s RNA 5.8s RNA 18s RNA

ITS1 primer:TCCGTAGGTGAACCTGCGG

ITS4 primer: TCCTCCGCTTATTGATATGC

Method (cont.)

Office work:

- search around the cool web (NCBI home page) and collect ITS data of maples.

- use GCG to perform pileup, pretty - consensus, tofasta.

- put fasta file in clastalW, and get the tree from Treeview

Data collections:

Results

• 15 species of maples (genus Acer)

• 3 sample per species except sugar maple has only 2 samples + 1 sample of mine.

Pretty -consensus

Results

•15 species of maples (genus Acer)

•3 sample per species except sugar maple has only 2 samples + 1 sample of mine.

Pretty -consensus

Clustal W

Treeview

Data Interpretation

Recommendations

Unknown sample(s) is(are) recommended to compare with at least three sequences of a known species, and several species in the same genus or different genus in the same family.

ITS is a powerful tool to discriminate species. 42 of 45 sequences (>93%) support the hypothesis.