View
4
Download
0
Category
Preview:
Citation preview
Regulation of telomere length and
telomerase during human multistep
hepatocarcinogenesis
Young-Joo Kim
Department of Medical Science
The Graduate School, Yonsei University
Regulation of telomere length and
telomerase during human multistep
hepatocarcinogenesis
Directed by Professor Young Nyun Park
The Master’s Thesis submitted to the Department of Medical Science, the Graduate School of Yonsei
University in partial fulfillment of the requirements for the degree of Master of Medical Science
Young-Joo Kim
December 2004
This certifies that theMaster’s Thesis of
Young-Joo Kim is approved.
The Graduate School
Yonsei University
December 2004
Thesis Supervisor : Young Nyun Park
Bong-Kyeong Oh
Kwang-Hyub Han
Acknowledgements
본 논문이 완성되기까지 부족한 저를 세심한 배려와
깊은 관심으로 이끌어 주신 박영년 교수님과 오봉경
교수님께 진심으로 감사를 드립니다. 좋은 조언으로
논문을 심사해 주신 한광협 교수님께도 감사 드립니다.
그리고 어려운 일이 있을 때마다 물심 양면으로 도와주신
병리학 교실 선생님들께도 감사를 드립니다. 특히 처음
실험실에 들어왔을 때 잘 적응 할 수 있도록 옆에서
지켜봐 주신 광조 형님께도 감사 드립니다. 저희가
필요로 하는 실험 기자재를 흔쾌히 사용하도록 도와주신
안용호 교수님과, 실험에 대한 조언과 격려를 해 주신
김건홍 교수님께도 감사를 드립니다.
언제나 저를 위해 기도해 주시는 할머니와 지금은 하늘
나라에 계신 할아버지께 고개 숙여 감사 드리고, 저의
뒷바라지 때문에 늙어가시는 부모님께도 감사 드립니다.
힘든 학교 생활을 웃을 수 있게 해준 고마운
친구들에게도 감사하고, 이 모든 분들의 은혜에
보답하고자 앞으로도 열심히 노력하겠습니다.
저자 씀
Table of contents
ABSTRACT ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥1
Ⅰ. INTRODUCTION ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥3
Ⅱ. MATERIALS AND METHODS ‥‥‥‥‥‥‥‥‥‥‥ 6
1. Tissue samples ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥ 6
2. Total RNA isolation ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥ 7
3. cDNA synthesis ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥ 8
4. Genomic DNA isolation ‥‥‥‥‥‥‥‥‥‥‥‥‥‥ 9
5. Real-time quantitative PCR ‥‥‥‥‥‥‥‥‥‥‥‥ 9
A. cDNA amplification ‥‥‥‥‥‥‥‥‥‥‥‥‥‥12
B. Gene amplification ‥‥‥‥‥‥‥‥‥‥‥‥‥‥ 15
6. Southern hybridization analysis ‥‥‥‥‥‥‥‥‥‥ 17
A. Analysis of telomere length ‥‥‥‥‥‥‥‥‥‥‥17
B. Analysis of hTERT gene copy number ‥‥‥‥‥‥ 18
Ⅲ. RESULTS ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥20
1. Upregulation of TRF1, TRF2 and TIN2 mRNA in human
multistep hepatocarcinogenesis ‥‥‥‥‥‥‥‥‥‥20
2. Telomere shortening during human multistep
hepatocarcinogenesis ‥‥‥‥‥‥‥‥‥‥‥‥‥‥ 24
3. TRF1, TRF2 and TIN2 in relation to telomere length
regulation ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥26
4. Upregulation of hTERT mRNA in human multistep
hepatocarcinogenesis ‥‥‥‥‥‥‥‥‥‥‥‥‥‥28
5. The number of hTERT gene copies in human multistep
hepatocarcinogenesis‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥28
Ⅳ. DISCUSSION ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥33
Ⅴ. CONCLUSION ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥ 36
REFERENCES ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥37
ABSTRACT (in Korean) ‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥ 42
List of Figures
Figure 1. Microscopic feature of human multistep
hepatocarcinogenesis ‥‥‥‥‥‥‥‥‥‥‥‥‥ 7
Figure 2. Principle of the TaqMan methodology ‥‥‥‥‥‥ 11
Figure 3. Amplification profiles and standard curves by real-time
quantitative PCR ‥‥‥‥‥‥‥‥‥‥‥‥‥‥ 14
Figure 4. Expression of the telomeric repeat binding factor 1
(TRF1), TRF2 and TRF1-interacting nuclear protein 2
(TIN2) mRNA in human multistep
hepatocarcinogenesis ‥‥‥‥‥‥‥‥‥‥‥‥23
Figure 5. Comparison of each telomere length in human multistep
hepatocarcinogenesis ‥‥‥‥‥‥‥‥‥‥‥‥ 25
Figure 6. Comparison of the telomeric repeat binding factor 1
(TRF1), TRF2 and TRF1-interacting nuclear protein 2
(TIN2) mRNA levels with telomere length
in human multistep hepatocarcinogenesis ‥‥‥‥ 27
Figure 7. Expression of the human telomerase reverse
transcriptase (hTERT) mRNA in human multistep
hepatocarcinogenesis ‥‥‥‥‥‥‥‥‥‥‥‥ 30
Figure 8. Status of the human telomerase reverse transcriptase
(hTERT) gene in human multistep hepatocarcinogenesis
‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥ 31
Figure 9. Southern blot analysis for the status of the human
telomerase reverse transcriptase (hTERT) gene
‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥‥ 32
List of Tables
Table 1. Oligonucleotide primer and probe sequences used for
real-time quantitative PCR analysis‥‥‥‥‥‥‥‥16
Table 2. Summary of the telomeric repeat binding factor 1 (TRF1),
TRF2, TRF1-interacting nuclear protein 2 (TIN2) mRNA
levels and telomere length in human multistep
hepatocarcinogenesis ‥‥‥‥‥‥‥‥‥‥‥‥‥22
Table 3. Comparison between the human telomerase reverse
transcriptase (hTERT) mRNA level and its gene copy
number in hepatocarcinogenesis ‥‥‥‥‥‥‥‥‥29
1
ABSTRACT
Regulation of telomere length and telomerase during human multistep
hepatocarcinogenesis
Young-Joo Kim
Department of Medical Science
The Graduate School, Yonsei University
(Directed by Professor Young Nyun Park)
Aims : There is increasing evidence of human multistep hepatocarcinogenesis and
dysplastic nodules (DNs) are considered to be preneoplastic lesion. Telomere
shortening and telomerase reactivation is an important early event of
hepatocarcinogenesis, however their regulation mechanism is still unknown. The
telomeric repeat binding factor 1 (TRF1), TRF2 and TRF1-interacting nuclear
protein 2 (TIN2) are involved in telomere maintenance. Here we describe the
regulation of these genes expression along with their relationship to the telomere
length in multistep hepatocarcinogenesis. We also determined mRNA level of
human telomerase reverse transcriptase (hTERT), a catalytic component of
telomerase, and the hTERT gene dosages in multistep hepatocarcinogenesis, and
subsequently analyzed their relationship.
Meterials and Methods : There were 9 normal livers, 14 chronic hepatitis (CH), 24
liver cirrhosis (LC), 5 large regenerative nodules (LRN), 14 low grade dysplastic
nodules (DNs), 7 high grade DNs, 10 DNs with hepatocellular carcinoma (HCC)
foci and 31 HCCs. The transcriptional expressions of TRF1, TRF2, TIN2 and
hTERT were examined by real-time quantitative PCR and the telomere lengths were
2
measured by southern hybridization. The gene copy number of hTERT was
evaluated by real-time quantitative PCR and confirmed by southern hybridization.
Results : A marked increase in TRF1, TRF2 and TIN2 mRNA levels was found in
the high grade DNs and DNs with HCC foci and a further increase was observed in
HCCs. Most lesions (52/67) had shorter telomeres than their adjacent CHs or LCs,
and their telomeres were inversely correlated with the mRNA level of these genes
(p≤0.001). This negative correlation was more evident in the early stages of
hepatocarcinogenesis of low grade DNs, high grade DNs and DNs with HCC foci.
The hTERT mRNA was progressively increased during hepatocarcinogenesis, and a
great induction was found in DNs. In contrast, the hTERT gene, located at 5p15.33,
was not numerically varied. There was no significant correlation between the hTERT
mRNA level and its gene copy number.
Conclusion : Our results suggest that the upregulation of TRF1, TRF2 and TIN2
have a negative regulatory influence over the telomere length during the
hepatocarcinogenesis and increase of the hTERT mRNA occurred in the early stages
of hepatocarcinogenesis, but its induction was unlikely regulated by the genetic
alteration.
Key words : Telomere, telomeric repeat binding factor 1, telomeric repeat binding
factor 2, TRF1-interacting nuclear protein 2, human telomerase reverse
transcriptase, hepatocellular carcinoma, dysplastic nodule
3
Regulation of telomere length and telomerase during human multistep
hepatocarcinogenesis
Young-Joo Kim
Department of Medical Science
The Graduate School, Yonsei University
(Directed by Professor Young Nyun Park)
I. Introduction
Telomeres, the specialized nucleoprotein complexes at the ends of linear
chromosomes, consist of multi-kilobase tandem arrays of double-stranded TTAGGG
repeats, a single-stranded overhang of the G rich 3’ strand and associated proteins. 1-4
This complexes distinguish natural chromosome ends from broken DNA, protecting
chromosome ends from end-to-end fusion and preventing the activation of a DNA
damage response. 5-7 In somatic human cells, telomeres shorten during cell division
until they reach a critical length at which they are no longer able to be protective and
enter replicative senescence. In contrast, most transformed cells including tumor
cells maintain short but stable telomeres by activating telomerase. Therefore, the
telomere maintenance along with telomerase activation has been suggested as a
general mechanism of tumorigenesis.8
The 3’ telomeric DNA single stranded overhang is apparently buried in the t-
loop form with telomeric proteins bound to stabilize the t-loop junction.9 The
telomeric repeat binding factor 1 (TRF1) and -2 (TRF2) directly bind to the double-
stranded region of the telomere and play important roles in the t-loop structure.4, 10
Growing evidence has shown that these proteins are involved in telomere
4
maintenance by acting as negative regulators. The expression of TRF1 is considered
to link to telomere length, acts as negative regulator by limiting the access of
telomerase to the telomere and mediates the interaction of the telomere with a
mitotic spindle.11-12 TRF2 is related to karyotypic stability13 and leads to the
progressive shortening of the telomere length.14 TRF1-interacting protein 2 (TIN2)
plays a negative regulator of telomere length in accordance with a previous study of
TIN2 truncation mutant.15
Several reports have described the upregulation of TRF1, TRF2 and TIN2 in
lung cancer,16 gastric cancer,17 and that of TRF2 in lymphomas.18 In contrast,
downregulation of these genes has been reported in breast cancers,19 gastric
cancers20 and malignant hematopoietic cells.21
Telomerase is a ribonucleoprotein enzyme which synthesizes telomeres after
cell division and maintains chromosomal stability.22, 23 The enzyme is active in 70-
90% of malignant tissue and many immortal cell lines. The fundamental components
of telomerase have been identified as the reverse transcriptase (hTERT), the RNA
template (hTR) and the telomerase associated proteins.24 Of these hTR and
telomerase associated proteins are expressed ubiquitously in both normal and
cancerous tissue,25 whereas hTERT is detectable in tumor cells but not in normal
somatic cells. 24 And hTERT is the rate-limiting component of telomerase, because
the level of hTERT expression is correlated to telomerase activity. The hTERT gene
is localized at 5p15.33.26
Hepatocellular carcinoma (HCC) is the seventh most common cancer and
accounts for the highest number of adult malignancies in those areas endemic for the
hepatitis B virus. There is increasing evidence of a multistep process in human
hepatocarcinogenesis, emphasizing the preneoplastic nature of large nodules, which
are referred as dysplastic nodules (DNs) or adenomatous hyperplasia, usually found
in a cirrhotic liver.27 DNs, especially high grade DNs, are believed to be
preneoplastic lesions, although the nature of low grade DNs appears less resolved
than that of high grade DNs.
5
Telomere shortening and telomerase activation, which is important for
carcinogenesis, has been observed in HCCs.28-33 A previous study demonstrated that
telomere shortening and telomerase activation occur in DNs during the early stages
of hepatocarcinogenesis with a significant change in the transition of low grade DNs
to high grade DNs.34 However, the expression levels of telomeric repeat binding
proteins as well as their relationship with the telomere length during multistep
hepatocarcinogenesis have not been examined. In order to address these issues, the
mRNA levels of TRF1, TRF2 and TIN2 were examined using real-time quantitative
PCR in normal livers, livers with chronic hepatitis, cirrhosis, large regenerative
nodules (LRNs), low grade DNs, high grade DNs, DNs with HCC foci and HCCs.
These mRNAs were subsequently compared with the telomere length, which was
measured by southern hybridization, in multistep hepatocarcinogenesis, and then
with the pathological parameters, such as the differentiation, mitotic activity and
tumor size of HCCs. We also determined both hTERT mRNA level correlated to
telomerase activity and hTERT gene copy numbers in above lesions, and then
subsequently analyzed their relationship.
6
Ⅱ. Materials and Methods
1. Tissue samples
Nine normal liver tissues (Nr), 14 chronic hepatitis (CH), 24 liver cirrhosis
(LC), 5 large regenerative nodules (LRN), 14 low grade dysplastic nodules (DNs), 7
high grade DNs, 10 DNs with hepatocellular carcinoma (HCC) foci and 31 HCCs
were obtained from 47 patients undergoing surgery and analyzed for TRF1, TRF2
and TIN2. Among them, 6 Nr, 6 CH, 15 LC, 4 LRN, 11 low grade DN, 7 high grade
DN, 10 DN with HCC foci and 16 HCC samples were analyzed for hTERT. The
tissues were immediately frozen in liquid nitrogen and stored at -80°C until use. The
diagnostic classification of the nodular lesions was subdivided into the following 5
groups: 1) LRN, 2) low grade DN, 3) high grade DN, 4) DN with HCC foci, and 5)
HCC according to the standard criteria of an international working party27 (Figure 1).
In this study, the term ‘others’ denotes the patients who have only two lesions, HCC
and their adjacent CH/ LC.
7
Figure 1. Microscopic features of human multistep hepatocarcinogenesis. Low grade dysplastic nodule (A), high grade dysplastic nodule with small liver cell dysplasia (B), dysplastic nodule with hepatocellular carcinoma foci in right lower part (C), and hepatocellular carcinoma with trabecular pattern (D) (H-E, original magnification ×200).
2.Total RNA isolation
The frozen tissues were stored in RNAlater™ (Ambion, Austin, TX, USA) at -
80°C in order to prevent RNA degradation. The tissues, weighing 30 mg, were
powdered by grinding thoroughly with a pestle and mortar in liquid nitrogen. The
tissue powder was transfered into 2 ml microcentrifuge tube filled with 600 µl buffer
RLT (Qiagen, Gmbh, Germany) containing 10 µl β-mercaptoethanol per 1 ml buffer
RLT, then pipetted the lysate directly onto a Qiashredder spin column (Qiagen)
A
C D
B
8
placed in 2 ml collection tube, and homogenized by centrifugation at 13,000 rpm for
2 min. The total RNA was extracted using the RNeasy mini kit (Qiagen) according
to the manufacturer’s protocol. The quantity of total RNA was determined by UV
spectrophotometry using UV-1601(Simadzu, Kyoto, Japan).
3. cDNA synthesis
The total RNA was pretreated with RNase-free DNase I (Takara, Shiga, Japan)
to remove genomic DNA prior to the cDNA synthesis. The reaction was carried out
at 37°C for 20 min using 2 µg of the total RNA, 1× DNase I buffer (Takara), 10
units of DNase I (Takara) in a 20 µl volume. This was followed by incubation at
80°C for 10 min to inactivate the enzyme. The complete removal of the genomic
DNA was confirmed by a PCR of the total RNA using β-actin primers (forward
primer; 5’-ATCTGGCACCACACCTTCTACAATGAGCTGCG-3’, reverse primer;
5’- CGTCATACTCCTGCTTGCTGATCCACATCTGC-3’), which generated no
product. The reaction mixture contained 100 ng of the total RNA pretreated with
DNase I (Takara), 1× PCR buffer (Promega, Madison, WI, USA), 0.2 mM of dNTP,
1.5 mM of MgCl2, 200 nM of forward and reverse primers, 1.25 units of Taq DNA
polymerase (Promega) in a 50 µl volume. The thermal cycle profile was heated to
94°C for 5 min, followed by 31 cycles of denaturation at 94°C for 45 sec, annealing
at 60°C for 45 sec, elongation at 72°C for 2 min each, and a final extension at 72°C
for 7 min. The cDNA synthesis was performed in a total volume of 20 µl, at 42°C
for 50 min, containing 1 µg of the total RNA, 160 pmol of the random hexamers
(Takara), 200 units of superscript™ RNase H- reverse transcriptase (Invitrogen,
Carlsbad, CA, USA), 20 units of the RNase inhibitor (Ambion), 0.5 mM dNTP, 10
mM DTT and 1× the first strand buffer (Invitrogen). This was followed by
incubation at 70°C for 15 min to stop the reverse transcription reaction. Aliquots of
the first-strand cDNA were stored at -20°C until use. To confirm whether cDNAs
9
were synthesized or not, the PCR for β-actin amplification was performed with the
same as mentioned above. The PCR products including the open-reading frame of
838bp were electrophoresed in 1.8% agarose gel and stained with ethidium bromide
(EtBr), followed by scanning the gel.
.
4. Genomic DNA isolation
The genomic DNA was extracted from the tissue samples stored at -80°C. The
tissues (30mg) were powdered by grinding thoroughly with a pestle and mortar in
liquid nitrogen. The tissue powder was scraped into 2 ml microcentrifuge tube filled
with 600 µl of extraction buffer TNES (20 mM Tris-HCl [pH 8], 400 mM NaCl, 5
mM EDTA [pH 8], 1% (v/v) SDS) containing 1 mg/ ml of proteinase K, and 20 µg/
ml of RNase A. The samples were incubated at 55°C overnight with shaking gently
to avoid aggregation. Equal volume (600 µl) of phenol/ chloroform (1:1) was added
to the extract, followed by shaking softly at room temperature for 30 min and
centrifugation at 13,000 rpm for 5 min, and then the upper aqueous phase was
transferred to a clean tube. The process was repeated twice to clear aqueous phase.
One volume (600 µl) of isopropanol was added to the aqueous phase, and mixed
carefully by inversion. The mixture was then centrifuged at 13,000 rpm at 4°C for 5
min. The pellet was rinsed with 70% ethanol and allowed to dry briefly in air. The
DNA was finally resuspended in 300 µl of ddH2O, followed by rocking gently
overnight. The quantity of genomic DNA was determined by UV spectrophotometry
using UV-1601(Simadzu).
5. Real-time quantitative PCR
In this study, the real-time quantitative PCR technique based on the TaqMan
methodology was used. Using 5’ nuclease activity of Taq polymerase, a specific
10
fluorescent signal, generated by cleavage of an oligonucleotide hybridization probe
with a 5’ fluorescent reporter dye and a 3’ quencher dye, is measured at each cycle
during a run (Figure 2). Reactions are characterized by the point during cycling
when amplification of the PCR product is first detected, rather than by the amount of
PCR products accumulated after a fixed number of cycles. The larger starting
quantity of the target molecules, the earlier a significant increase in fluorescence is
observed. The parameter Ct (threshold cycle) is defined as the fractional cycle
number at which the fluorescence generated by cleavage of the probe passes a fixed
threshold above baseline. The fluorescence signal is monitored using the laser
detector of the ABI PRISM 7700 sequence detection system (Perkin-Elmer Applied
Biosystems, Foster City, CA, USA).
11
Figure 2. Principle of the TaqMan methodology. The Taq polymerase extends the primer and hydrolyzes the probe. Release of the 5’-attached reporter dye abolishes the quenching effect of the 3’-attached quencher dye, and then a fluorescence signal is detected. (Abbreviations: F. primer, Forward primer; R. primer, Reverse primer)
5’
5’
3’
3’
Fluorescent
5’
5’
3’
3’
3’
5’
5’
3’
F. primer
R. primer
Reporter Quencher
12
A. cDNA amplification
The TRF1, TRF2, TIN2 and hTERT mRNA expression levels were measured
using the gene-specific fluorescent hybridization probes. Either FAM or VIC was
used as the 5’-fluorescent reporters while TAMRA was added to the 3’ end as a
quencher. The gene-specific primers and fluorescent hybridization probes used in
this study are shown Table 1. The 18S rRNA was used to normalize the sample-to-
sample variation in the amount of the input cDNA, and also to evaluate the quality
of the isolated RNA and RT efficiency. Amplification of the 18S rRNA was
performed using the primers and the internal probe provided by Perkin-Elmer
(Perkin-Elmer Applied Biosystems). The standard curve was constructed with five-
fold serial dilutions of the cDNA from the HT1080 cell line, which corresponded to
the total RNA ranging from 0.32 to 200 ng for TRF1, from 0.16 to 100 ng for TRF2,
from 0.08 to 50 ng for TIN2 and hTERT, and from 0.008 to 5 ng for 18S rRNA. The
PCR for TRF1 amplification was carried out using 0.5 µl of each RT reaction, which
corresponded to 25 ng of the total RNA, 1× TaqMan universal master mix (Perkin-
Elmer Applied Biosystems), 300 nM of primers, and 200 nM of the probe in a 25 µl
volume. The reaction for TRF2 and TIN2 amplification was performed with 0.5 µl
of each RT reaction, which corresponded to 25 ng of the total RNA, 1× TaqMan
universal master mix (Perkin-Elmer Applied Biosystems), 1× each Gene Expression
ProductsTM in a 25 µl volume. The amplification of hTERT was done using 1 µl of
each RT reaction, which corresponded to 50 ng of the total RNA, 1× TaqMan
universal master mix (Perkin-Elmer Applied Biosystems), 300 nM of primers, and
200 nM of the probe in a 25 µl volume. The 18S rRNA reaction was performed with
50 nM of the primers, 200 nM of the probe and 1 µl of the RT reaction, which
corresponded to 0.5 ng of the total RNA. Thermal cycling was initiated with a 2-
minute incubation at 50°C, for the uracil N-glycosylase reaction, which was
followed by a 10-minute reaction at 95°C to activate the AmpliTaq gold, and 40
PCR cycles at 95°C for 15 sec and at 60°C for 1 min. Fluorescence measurements
13
were taken at the end of the annealing/ extension phase at 60°C. The quantity of
target mRNA in unknown samples was determined from the Ct value using the
standard curve (Figure 3). Each experiment included a determination of the
standards and “no-template” as a negative control, where water was substituted for
the cDNA. Non-template controls, standard dilutions and samples were assayed in
duplicate.
14
Figure 3. Amplification profiles and standard curves by real-time quantitative PCR. A. Amplification plots for TRF1. B. Amplification plots for 18S rRNA. C. Standard curve for TRF1. D. Standard curve for 18S rRNA. The ΔRn value reflects the quantity of fluorescent probe degraded for each well. Threshold cycle (Ct) represents the fractional cycle at which the fluorescence passes a fixed threshold above baseline. The quantity of target molecules is obtained by the Ct value and by using a standard curve performed during the same experiment. 18S rRNA was used as an internal control.
D.B.
A.
0 10 20 30 400
0.5
1.0
1.5
2.0
2.5
∆Rn
Number of cycles
TRF1
0 10 20 30 40
7
0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
∆Rn
Number of cycles
18S rRNA
-1 0 1 2 30
10
20
30
40
Thr
esho
ld C
ycle
s
Log[cDNA] (ng)
TRF1
R2=0.994
0 1 2 3 40
5
10
15
20
25
Thr
esho
ld C
ycle
s
Log[cDNA] (ng)
18S rRNA
R2=0.998
C.
HT1080 sample
HT1080 sample
15
B. Gene amplification
The number of hTERT gene copies was determined by real-time PCR analysis.
The quantity of hTERT gene was normalized as a ratio to the amount of insulin-like
growth factor-1 (IGF-1) gene. Each reaction for the hTERT and IGF-1 gene was
carried out in a total volume of 25 µl. The reaction mixture contained 25 ng of the
genomic DNA, 1× TaqMan universal master mix (Perkin-Elmer Applied
Biosystems), 300 nM of primers, and 200 nM of the probe. The standard curve was
made up of five-fold serial dilutions of the genomic DNA from the HEK293 cell line,
which corresponded to the genomic DNA ranging from 0.16 to 100 ng for hTERT
and IGF-1 each. The sequences of the primers and probes used in this experiment
are shown in Table 1.
16
Table 1. Oligonucleotide primer and probe sequences used for real-time quantitative
PCR analysis
Target Sequence (5’→3’) TRF1 Forward primer TCTCTCTTTGCCGAGCTTTCC cDNA
amplification Reverse primer ACTGGCAAGCTGTTAGACTGGAT Probe (FAM)-
CCCGCAACAGCGCAGAGGCTA-(TAMRA)
hTERT Forward primer CACGCGAAAACCTTCCTCA Reverse primer CAAGTTCACCACGCAGCC Probe (FAM)-
TCAGGGACACCTCGGACCAGGGT-(TAMRA)
hTERT Forward primer CCACGAGCACCGTCTGATTAG Gene amplification Reverse primer GGAGGCCGTGTCAGAGATGA
Probe (FAM)-CCTTTCCTCTGACGCTGTCCGCC-(TAMRA)
IGF-1 Forward primer TTGCCTCATCGCAGGAGAA Reverse primer TGTGATCTCATTTCCTAGAACCTATGG Probe (FAM)-
AGGGACCAATCCAATGCTGCCTG-(TAMRA)
For the amplification of TRF2 and TIN2, Gene Expression Products™ (Perkin-Elmer Applied Biosystems) was used. The sequence of the TRF2 and TIN2 primers and probes are under the copyright of Perkin-Elmer Applied Biosystems.
17
6. Southern hybridization analysis
A. Analysis of telomere length
Genomic DNA (6 µg) was digested with 60 units of HinfⅠ(New England
BioLabs, Beverly, MA, USA) at 37°C in 100 µl of restriction buffer (New England
BioLabs), which generate terminal restriction fragments consisting of telomeric and
subtelomeric regions. The digested DNA was extracted with equal volume (100 µl)
of phenol/ chloroform (1:1), repeatedly, followed by precipitation using 3 volume
(300 µl) of absolute ethanol, 0.1 volume (10 µl) of 3M sodium acetate and 20 µg of
glycogen (Roche Molecular Biochemicals, Mannheim, Germany), and
centrifugation at 13,000 rpm at 4°C for 30 min. After rinsed with 70% ethanol, the
pellet was allowed to dry briefly in air and dissolved in 25 µl of ddH2O. The HinfⅠ-
digested DNA along with 500 ng of λ DNA/ HindⅢ marker (Promega) was
fractionated on 0.7% agarose gel in 0.5× Tris-borate-EDTA(TBE) at 24 V for 16 hr.
The gel was stained with EtBr, and depurinated in 0.125 M HCl for 15 min,
denatured twice in 1.5 M NaCl, 0.5 M NaOH for 30 min and neutralized in 1.5 M
NaCl, 0.5 M Tris [pH 7.5] for 30 min. The digested DNA was immediately
transferred overnight to a Hybond-N+ membrane (Amersham Pharmacia Biotech,
Piscataway, NJ, USA) in 10× SSC (1.5 M NaCl, 0.15 M sodium citrate, [pH 8])
using an upward capillary transfer, and immobilized by UV cross-linking. The
hybridization was carried out with a 3’-end digoxigenin-labeled d(TTAGGG)4
(Roche Molecular Biochemicals) created by terminal transferase, overnight at 37°C.
The hybrids were detected according to the manufacturer’s recommendation (Roche
Molecular Biochemicals). The mean telomere length was calculated by a previously
described method.35 The hybridization signals, telomeres, were scanned with LAS-
1000 (Fujifilm, Tokyo, Japan) and quantified using the Image Gauge Version 3.12
(Fujifilm). In the software, a grid object was defined as a single column with 25
rows. This 1×25 grid was placed over the size marker lane, and the row, 1-25, in
which each ladder of the marker fell was recorded. And then the 1×25 grid was
18
reproduced and placed over the telomere signals. The measurements corresponding
to the average optical density for each row were transferred to EXCEL for Microsoft
Windows XP software. The mean telomere length was calculated as Σ(MWi × ODi)/
Σ(ODi)35, where ODi is the densitometer output and MWi, determined by the
calibration curve obtained by plotting log (molecular size) for the size marker vs
row number and given in the form y = ax + b, is the length of the DNA at row
number i. A mean length of the sample was obtained from 2-3 replicate experiments.
B. Analysis of hTERT gene copy number The isolated genomic DNA (20-25 µg) was digested by incubation overnight
at 37°C in 100 µl of restriction buffer (Promega) and 100 units of BamHⅠ
(Promega). The BamHⅠ-digested DNA was requantified by UV spectrophotometry
using UV-1601(Simadzu) for an exact quantity. Eighteen micrograms of the
digested and quantified DNA were extracted, precipitated and electrophoresed by
the same methods as described above. After denatured by soaking in a alkaline
solution (0.4 N NaOH, 1 M NaCl), the digested DNAs were blotted overnight to a
Hybond-N+ membrane (Amersham Pharmacia Biotech) in alkaline transfer buffer
(0.4 N NaOH, 1 M NaCl) using an upward capillary transfer. For the hTERT
hybridization, the probe was amplified using the pcDNA3 (Invitrogen) cloned
hTERT cDNA as a template and primers (forward; 5’-
CACGCGAAAACCTTCCTCA-3’, reverse; 5’-CTGTGACACTTCAGCCGCA-3’)
in exon 10 and exon 12, denaturated and labeled with α-32P-dCTP (3000 Ci/ mmol)
using random prime labeling system (Amersham Pharmacia Biotech) following the
manufacturer’s protocol. Southern blots were hybridized overnight at 60°C, using
ExpressHybTM Hybridization Solution (BD Biosciences, Palo Alto, CA, USA) and
washed twice for 30 min at low stringency (2× SSC, 0.05% SDS, at RT) and twice
for 30 min at high stringency (0.1× SSC, 0.1% SDS, at 55°C) in order. The blot was
exposed on a phosphorimager screen for 1 hr and to X-ray film for 18 hr. The image
19
quantification was performed using Image Gauge Version 3.12 (Fujifilm).
20
Ⅲ. Results
1. Upregulation of TRF1, TRF2 and TIN2 in human multistep
hepatocarcinogenesis
The expression levels of TRF1, TRF2 and TIN2 mRNA were gradually
increased according to the progression of multistep hepatocarcinogenesis and it was
also evident in the patients with multiple synchronous nodules of DNs and/ or HCCs.
The results are summarized in Table 2 and Figure 4.
The TRF1 mRNA levels remained low in chronic hepatitis, cirrhosis and
LRNs, which was comparable to those of the normal liver (Table 2 and Figure 4A).
The low- and high grade DNs expressed a higher TRF1 mRNA level than chronic
hepatitis, cirrhosis and LRNs (p=0.002) and the mean TRF1 mRNA level of the DNs
was 1.3 times higher than that of the normal livers. The TRF1 mRNA level was
further increased in the DNs with HCC foci compared to the DNs, where the mean
value was 1.7 times higher than that of the normal livers. A marked increase was
observed in the HCCs (p= 0.005), where the mean value was 3.2 times higher than
that of the normal livers. The HCCs showed a wide range of the TRF1 mRNA levels
from 20 to 261, and 29 HCCs (94%) had higher TRF1 mRNA levels than the
adjacent non-HCCs. According to the differentiation of HCC, those with poorer
differentiation showed significantly higher levels of the TRF1 mRNA (p=0.004).
However, the mitotic activity and tumor size of HCCs had no correlation with it.
Increase of the TRF2 mRNA level also appeared according to the progression
of multistep hepatocarcinogenesis, particularly from DNs to HCCs (Table 2 and
Figure 4B). The TRF2 mRNA levels of chronic hepatitis and cirrhosis were higher
than that of the normal liver (p=0.019), however, they were still low. Low grade
DNs showed a TRF2 mRNA level similar to chronic hepatitis, cirrhosis and LRNs. A
significant increase was observed in the transition of the low grade DNs to high
grade DNs (p=0.016) and the mean TRF2 mRNA level of the high grade DNs was
2.5 times higher than that of the normal livers. The DNs with HCC foci had the
21
TRF2 mRNA level similar to high grade DNs. A further marked increase was
observed in the HCCs (p=0.036), where the mean value was 3.4 times higher than
that of the normal livers. The range of the TRF2 mRNA level in HCCs was a rather
wide from 9 to 92 and 29 HCCs (94%) had a higher TRF2 mRNA level than the
adjacent non-HCCs. The TRF2 mRNA levels were significantly higher in HCCs
with poorer differentiation (p=0.028) and it was positively correlated with the
mitotic activity of HCCs (p<0.001, R2=0.347), but had no correlation with the size
of HCCs.
The TIN2 mRNA level showed a similar pattern of upregulation during
multistep hepatocarcinogenesis to the TRF2 mRNA level (Table 2 and Figure 4C).
Chronic hepatitis and cirrhosis expressed TIN2 mRNAs at a similarly low level,
although their expression level was higher than that of the normal liver (p=0.043).
Low grade DNs showed a similar TIN2 mRNA level to that observed in the livers
with chronic hepatitis and cirrhosis. A significant increase was noted in the transition
from the low grade DNs to high grade DNs (p=0.007) and the mean value of the
high grade DNs was about 2.7 times higher than the normal livers. A further increase
was observed in the DNs with HCC foci, where the mean value was 3.2 times higher
than that of the normal livers. The HCCs showed a marked increase in the TIN2
mRNA level (p=0.026), where the mean value was 4.3 times higher than that of the
normal livers. All the HCCs expressed a higher amount of TIN2 than the adjacent
non-HCC, and their TIN2 mRNA level ranged from 11 to 155. TIN2 mRNA level
showed a positive correlation with mitotic activity of HCCs (p<0.001, R2=0.424),
however it showed no significant difference according to the differentiation and size
of HCCs.
The TRF1, TRF2 and TIN2 mRNA levels appeared to positively correlate with
each other. The TRF1 mRNA levels were higher in the lesions with higher TRF2
(p<0.001, R2=0.377) and TIN2 levels (p<0.001, R2=0.323), and a similar feature was
found between TRF2 and TIN2 (p<0.001, R2=0.547).
22
Table 2. Summary of the telomeric repeat binding factor 1 (TRF1), TRF2, TRF1-
interacting nuclear protein 2 (TIN2) mRNA levels and telomere length in human
multistep hepatocarcinogenesis
TRF1 TRF2 TIN2 Telomere Length (kb)
Range Mean±SD Range Mean±SD Range Mean±SD Range Mean±SD Normal (n=9) 13-42 26±8.5 4-24 10±7.3 3-25 12±8.2 8.1-9.8 8.7±0.57
CH (n=14) 14-48 27±8.8 7-29 17±6.7 7-36 20±9.5 6.8-9.6 8.3±0.94 LC (n=24) 15-39 28±6.4 4-56 17±10.8 5-49 22±10.4 5.6-11.0 7.8±1.19 LRN (n=5) 23-37 30±6.0 7-22 13±5.5 7-15 10±3.0 5.2-9.1 7.8±1.63
LGDN (n=14) 28-47 34±5.9 6-29 14±6.4 7-48 15±11.5 3.9-9.8 7.4±1.77 HGDN (n=7) 25-38 34±4.9 14-41 25±9.4 19-61 32±15.6 4.5-8.1 5.3±1.25
DN with HCC (n=10) 16-74 44±17.2 9-58 22±14.7 12-65 38±20.2 4.4-8.5 6.4±1.31 HCC (n=31) 20-261 82±47.4 9-92 34±20.2 11-155 51±29.6 4.7-14.3 7.3±2.26
Abbreviations: CH, chronic hepatitis; LC, liver cirrhosis; LRN, large regenerative nodule; LGDN, low grade dysplastic nodule; HGDN, high grade dysplastic nodule; DN, dysplastic nodule; HCC, hepatocellular carcinoma. The TRF1, TRF2 and TIN2 mRNA levels = [target gene mRNA copies of sample/18S rRNA copies of sample] х 105. Telomere length of each tissue was obtained from 2-3 replicate experiments.
23
20
40 60
80 100
120 140 160 260 280
Normal (n=9)
CH (n=14)
LC (n=24)
LRN (n=5)
LG DN
(n=14)
HG DN
(n=7)
DN with HCC
(n=10)
HCC (n=31)
TR
F1 m
RN
A le
vel
0
20
40
60
80
100
Normal (n=9)
CH (n=14)
LC (n=24)
LRN (n=5)
LG DN
(n=14)
HG DN
(n=7)
DN with HCC
(n=10)
HCC (n=31)
TR
F2 m
RN
A le
vel
0
30
60
90 130
150
Normal (n=9)
CH (n=14)
LC (n=24)
LRN (n=5)
LG DN
(n=14)
HG DN
(n=7)
DN with HCC
(n=10)
HCC (n=31)
TIN
2 m
RN
A le
vel
0
patient 1 patient 7 patient 2 patient 8 patient 3 patient 9 patient 4 patient 10 patient 5 patient 11 patient 6 others
A.
B.
C.
Figure 4. Expression of the telomeric repeat binding factor 1 (TRF1), TRF2 and TRF1-interacting nuclear protein 2 (TIN2) mRNA levels in human multistep hepatocarcinogenesis. The TRF1 (A), TRF2 (B) and TIN2 (C) mRNA levels are increased according to the progression of multistep hepatocarcinogenesis. (Abbreviations: CH, chronic hepatitis; LC, liver cirrhosis; LRN, large regenerative nodule; LGDN, low grade dysplastic nodule; HGDN, high grade dysplastic nodule; DN, dysplastic nodule; HCC, hepatocellular carcinoma)
24
2. Telomere shortening during human multistep hepatocarcinogenesis
The normal liver tissues showed telomere lengths ranging from 8.1 to 9.8 kb,
which did not significantly correlate with the patient ages. A gradual reduction in the
telomere length was observed from the livers with chronic hepatitis, to cirrhosis and
to LRNs (Table 2 and Figure 5). The low grade DNs had a wide range of telomere
lengths, most of which showed similar telomere length to those with chronic
hepatitis, cirrhosis and LRNs, and 2 (14%) of the low grade DNs had short
telomeres, which overlapped with those of the high grade DNs. Significant telomere
shortening occurred in the transition of the low grade DNs to high grade DNs
(p=0.020). The high grade DNs showed telomere lengths ranging from 4.5 to 8.1 kb,
and 6 (86%) of those had a telomere length < 5.4 kb. DNs with HCC foci had
telomere length in the similar range to those of high grade DNs. The HCCs had a
telomere length with a wide range from 4.7 to 14.3 kb and showed no significant
reduction of the telomere length compared to those of DNs with HCC foci, but most
HCCs (24/31, 77%) had shorter telomeres than their adjacent non-HCCs.
Most nodular lesions (52/67, 78%) including 4 LRNs, 11 low grade DNs, 7
high grade DNs, 6 DNs with HCC foci and 24 HCCs had shorter telomeres than
their adjacent chronic hepatitis/cirrhosis, while some lesions (15/67, 22%) including
a LRN, 3 low grade DNs, 4 DNs with HCC foci and 7 HCCs had longer telomeres.
Three of the HCCs had telomeres > 10 kb. A case of HCC with a telomere length of
14.3 kb is believed to be an alternative lengthening of the telomere because it
possessed neither telomerase activity nor hTERT mRNA (data not shown).
25
23kb
9.4kb
6.5kb
4.3kb
2.3kb 2.0kb
DN
w
ith H
CC
LR
N
LC
HC
C
HC
C
CH
CH
Nor
mal
patient 11 others B
2
4
6
8
10
12
14
16 Te
lom
ere
leng
th (k
b)
Normal (n=9)
CH (n=14)
LC (n=24)
LRN (n=5)
LG DN
(n=14)
HG DN
(n=7)
DN with HCC
(n=10)
HCC (n=31)
A
0
patient 1 patient 7 patient 2 patient 8 patient 3 patient 9 patient 4 patient 10 patient 5 patient 11 patient 6 others
Figure 5. Comparison of each telomere length in human multistep hepatocarcinogenesis. A. The telomere length is shown in normal livers, chronic hepatitis (CH), liver cirrhosis (LC), large regenerative nodules (LRNs), low grade dysplastic nodules (LGDNs), high grade dysplastic nodules (HGDNs), DNs with hepatocellular carcinoma (HCC) foci and HCCs. The lesions are denoted by different symbols according to the patient numbers. B. A representative result of southern blot analysis in various lesions. The genomic DNA, digested with Hinf I, was hybridized with a digoxigenin-labeled d(TTAGGG)4. The mean telomere restriction fragment length was calculated as previously described method,35 using the IMAGE GAUGE software (Fujifilm, Tokyo, Japan). The λ-DNA digested with HindⅢ was used as the size marker and indicated on the right.
26
3. TRF1, TRF2 and TIN2 in relation to telomere length regulation
In order to evaluate whether TRF1, TRF2 and TIN2 are involved in the
telomere length regulation, the mRNA levels of these genes were compared with the
telomere length in each lesion. All of these genes showed significant negative
correlations with the telomere length, when the analysis was done with the lesions
with shortened telomeres compared to their respective adjacent chronic hepatitis and
cirrhosis, (Note: This analysis included 4 LRNs, 11 low grade DNs, 7 high grade
DNs, 6 DNs with HCC foci, 24 HCCs and their respective adjacent chronic hepatitis
and cirrhosis) (Figure 6). The inverse correlation was more evident in the early
stages of hepatocarcinogenesis including low grade DNs, high grade DNs and DNs
with HCC foci (p=0.036, R2 =0.184; p=0.002, R2 =0.352; p=0.005, R2 =0.308,
respectively). Meanwhile, there was no statistically significant relationship between
those genes and the telomere length in the HCCs, which showed a rather wide range
of mRNA levels of these genes.
The analysis was also performed on the nodular lesions with the lengthened
telomeres compared to the respective adjacent chronic hepatitis and cirrhosis, which
were one LRN, 3 low grade DNs, 4 DNs with HCC foci and 7 HCCs. Most of these
lesions also expressed higher levels of TRF1, TRF2 and TIN2 mRNA compared to
the respective adjacent chronic hepatitis and cirrhosis. However, the mRNA levels of
these genes did not show a significant correlation with the telomere length in the
lesions with elongated telomeres.
27
chronic hepatitis cirrhosis LRN
low grade DN high grade DN DN with HCC foci
HCC
Figure 6. Comparison of the telomeric repeat binding factor 1 (TRF1), TRF2 and TRF1-interacting nuclear protein 2 (TIN2) mRNA levels with telomere length in human multistep hepatocarcinogenesis, shown in A, B and C, respectively. The analysis was performed with the nodular lesions with shortened telomeres compared to the adjacent chronic hepatitis and cirrhosis. This analysis included 4 large regenerative nodules (LRNs), 11 low grade dysplastic nodules (DNs), 7 high grade DNs, 6 DNs with hepatocellular carcinoma (HCC) foci, 24 HCCs and their respective adjacent chronic hepatitis (n=11) and cirrhosis (n=19).
2
4
6
8
10
12
0 50 100 150 200 0
TRF1 mRNA level
Telo
mer
e le
ngth
(kb)
y = -0.022x + 8.074 R2 = 0.133
p=0.001
A.
2
4
6
8
10
12
0 100 20 40 60 80 0
TRF2 mRNA level
Telo
mer
e le
ngth
(kb)
y = -0.050x + 8.145 R2 = 0.146 p<0.001
B.
2
4
6
8
10
12
0 100 80 60 40 20 0
TIN2 mRNA level
Telo
mer
e le
ngth
(kb)
y = -0.038x + 8.161 R2 = 0.206 p<0.001
C.
28
4. Upregulation of hTERT mRNA level in human multistep
hepatocarcinogenesis
The expression of hTERT mRNAs was dramatically increased in
conformity with the progression of multistep hepatocarcinogenesis, especially from
low grade DNs to HCC (Table 3 and Figure 7). A significant increase was detected
in low grade DNs, where the mean hTERT mRNA level was approximately 2,000
times higher than that of the normal livers. A further increase was observed in high
grade DNs and the mean hTERT mRNA level of the high grade DNs was about
25,000 times higher than the normal livers. All HCCs expressed higher hTERT
mRNAs than the adjacent non-HCCs, and their hTERT mRNA level ranged from
123 to 14.1×105 similar to high grade DNs and DNs with HCC foci. Although there
was a slightly increase in chronic hepatitis, cirrhosis and large regenerative nodules,
the hTERT mRNA expression was a little level.
5. The number of hTERT gene copies in human multistep hepatocarcinogenesis
The hTERT gene copy numbers were not varied in multistep
hepatocarcinogenesis (Table 3 and Figure 8). Only one HCC from a patient showed
a significant amplification, where the hTERT gene copies were about 4 times higher
than those of the adjacent non-HCC. But in almost all samples, little amplification
was detected with the mean values varying between 0.8 and 1.2. In this study, we
tested 3 reference genes, IGF-1, γ-actin and glyceraldehyde-3-phosphate
dehydrogenase (GAPDH), for their suitability as internal controls. Among these,
IGF-1 was best suited, so we used that. The hTERT amplification was also assessed
by southern blot analysis to confirm above result. We collected the samples
containing one hTERT-amplified HCC, two non-amplified HCC and their adjacent
non-HCCs, and performed the experiments. Based on the results of real-time PCR
experiments, the anticipated results of southern blot assays were obtained. The
results are shown in Figure 9. The level of the hTERT gene signal was normalized
29
with the intensity of EtBr-stained DNA.
We found that the hTERT mRNA level was not correlated with the hTERT
gene amplification in hepatocarcinogenesis. Even if the mRNA level is high in a
lesion, there is no amplification of the gene copies in the lesion.
Table 3. Comparison between the human telomerase reverse transcriptase (hTERT)
mRNA level and its gene copy number in hepatocarcinogenesis
hTERT mRNA hTERT gene Range Mean Range Mean±SD
Normal (n=6) 0.0-10.0 3.5 0.8-0.9 0.8±0.08 CH/LC (n=21) 0.0-57.9 14.4 0.6-1.3 1.0±0.17
LRN (n=4) 0.0-92.1 32.4 0.7-1.4 0.9±0.31 LGDN (n= 11) 0.0-71.1×103 6504.9 0.5-1.0 0.8±0.14 HGDN (n=7) 53.8×10-44.5×104 86037.9 0.9-1.2 1.0±0.12
DN with HCC (n=10) 25.8-12.9×104 23143.1 0.9-1.5 1.1±0.14 HCC (n=16) 12.3×10-14.1×105 96207.2 0.5-4.1 1.2±0.80
Abbreviations: CH, chronic hepatitis; LC, liver cirrhosis; LRN, large regenerative nodule; LGDN, low grade dysplastic nodule; HGDN, high grade dysplastic nodule; DN, dysplastic nodule; HCC, hepatocellular carcinoma. The hTERT mRNA and the hTERT gene was normalized with 18S rRNA and IGF-1, respectively.
30
Figure 7. Expression of the human telomerase reverse transcriptase (hTERT) mRNA in human multistep hepatocarcinogenesis. The hTERT mRNA was progressively increased during hepatocarcinogenesis, and a great induction was found in dysplastic nodules. Eleven patients with multiple synchronous nodules are denoted by different symbols in accordance with the patient numbers.
HCC (n=16)
0
50
100
150
200
250
5000
10000
15000
20000
250003000050000
1500000hT
ER
T m
RN
A le
vel
Normal(n=6)
CH/ LC
(n=21)
LRN(n=4)
LG DN
(n=11)
HG DN
(n=7)
DN withHCC
(n=11)
patient 1 patient 7 patient 2 patient 8 patient 3 patient 9 patient 4 patient 10 patient 5 patient 11 patient 6 others
CH : chronic hepatitis LC : liver cirrhosis LRN : large regenerative nodule LGDN : low grade dysplastic nodule HGDN : high grade dysplastic nodule DN : dysplastic nodule HCC : hepatocellular carcinoma
31
Normal (n=6)
CH/ LC
(n=21)
LRN (n=4)
LG DN
(n=11)
HG DN
(n=7)
DN with HCC
(n=11)
HCC (n=16)
0
1
2
3
4
5
hTE
RT
gene
stat
us *
patient 1 patient 7 patient 2 patient 8 patient 3 patient 9 patient 4 patient 10 patient 5 patient 11 patient 6 others
Figure 8. Status of the human telomerase reverse transcriptase (hTERT) gene in human multistep hepatocarcinogenesis. The copy number of the hTERT gene and the reference gene, insulin-like growth factor-1 (IGF1), was measured in each tissue sample. The ratio of hTERT/IGF-1 indicates the hTERT gene status. There is little variation of the hTERT gene copies during multistep hepatocarcinogenesis. (* : The HCC amplified hTERT gene. This case was confirmed by southern blot analysis shown in Figure 9. Abbreviations: CH, chronic hepatitis; LC, liver cirrhosis; LRN, large regenerative nodule; LGDN, low grade dysplastic nodule; HGDN, high grade dysplastic nodule; DN, dysplastic nodule; HCC, hepatocellular carcinoma)
32
Figure 9. Southern blot analysis for the status of the human telomerase reverse transcriptase (hTERT) gene. Each patient contains both hepatocellular carcinoma (HCC) and adjacent non-HCC (CH, chronic hepatitis; LC, liver cirrhosis). A. The genomic DNA, digested with BamHⅠ, was hybridized with α-32P-dCTP-labeled probe. BamHⅠ-digested DNA from each lesion was detected approximately 2.3kb and 7.0 kb. The second lane, only one case of hTERT-amplified HCC (*) as result of real time PCR, was visualized with more intensity than the others. The λ-DNA digested with HindⅢ was used as the size marker and indicated on the right. B. The signal intensity of each lesion was measured by summing up the measurements of two bands using the IMAGE GAUGE software (Fujifilm), and then normalized with value of EtBr-stained DNA shown in C.
Sign
al in
tens
ity
A.
B.
23kb
9.4kb
6.5kb
4.3kb
2.3kb 2.0kb
CH LC CH HCC HCC HCC
patients
1
2
3
4
5
*
0
C. Loadingcontrol
33
Ⅳ. Discussion
In this study, upregulation of the TRF1, TRF2 and TIN2 mRNA levels was
observed according to the progression of human multistep hepatocarcinogenesis,
particularly from DNs to HCCs, and progressive telomere shortening was
demonstrated according to the progression of hepatocarcinogenesis. Most (78%,
52/67) of the nodular lesions including LRNs, DNs and HCCs had shorter telomeres
than their adjacent chronic hepatitis/ cirrhosis, and the lesions with shorter telomeres
had a higher mRNA expression level of the TRF1, TRF2 and TIN2. This inverse
correlation suggested that these telomere-binding proteins play important roles in
telomere shortening during multistep hepatocarcinogenesis. Moreover, the positive
correlations among the expression levels of these genes suggest their collaboration
in telomere shortening. It was proposed that these telomere-binding proteins act as
negative length regulators at the telomeres.12, 15, 36-39 During hepatocarcinogenesis,
telomere shortening occurred despite telomerase activation.34 This might be, in part,
explained as follows: the upregulation of the TRF1, TRF2 and TIN2 might be
involved in the stabilization of the telomeres by promoting t-loop folding. The
stabilization of the t-loop structures, which limits the access of telomerase to the
telomeres,38, 39 would eventually result in telomere shortening in
hepatocarcinogenesis. In other words, the telomeric length might be not increased
but maintained with short length as above results, even though telomerase is
excessively active in hepatocarcinogenesis.
There is growing evidences that DNs are precancerous lesions.40 Previous
studies as well as this study have demonstrated that many of high grade DNs has a
short telomere length and a high telomerase activity, which is similar to those of
HCCs. Moreover, some low grade DNs also have similar features.34 Considering that
telomere shortening and telomerase activation play a key role in tumorigenesis,
these results suggest that low and high grade DNs are important early lesions in
34
multistep hepatocarcinogenesis.
In this study, a significant increase of the TRF1, TRF2 and TIN2 expression
and an inverse correlation between mRNA levels of these genes and the telomere
length were first noted in DNs during multistep hepatocarcinogenesis. These results
suggest that these telomere-binding proteins involve in telomere shortening in the
early stages of hepatocarcinogenesis. Upregulation of these genes, therefore, is
likely to be crucial for hepatocarcinogenesis by inducing “telomere crisis”, a driving
force in tumor development.41
HCCs showed no further significant telomere shortening, compared to the
high grade DNs and DNs with HCC foci. One of the possible explanations for this
would be the expression of strong telomerase in the HCCs. 28, 29, 34 HCCs expressed a
high TRF1, TRF2 and TIN2 mRNA level, and their mean value was more than 3-4
times that of the normal livers. The mRNA levels of these genes showed no
significant correlation with telomeres in HCCs, indicating that the induction of these
genes is unlikely to directly influence telomere shortening in the HCCs. Their roles
on telomere shortening might be screened by the strong telomerase activity, which
involves in telomere elongation. Therefore, the balance between the telomere
binding protein expression and telomerase activation might be crucial for the
telomere maintenance in HCCs. Interestingly, the HCCs with poorer differentiation
or higher mitotic activity expressed higher mRNA levels of these telomere-binding
protein genes. This suggests that an excess of these genes is likely to be involved in
HCC progression.
Telomere lengthening was also found during hepatocarcinogenesis. Seven
HCCs and 8 other nodular lesions showed an elongated telomere length. It suggests
that the mechanism of telomere lengthening is also involved in hepatocarcinogenesis,
even though it is minor pathway. Our data on higher levels of the TRF1, TRF2 and
TIN2 mRNA in those lesions but no correlation with telomere length suggest that an
excess of these genes might be required for the association with the lengthen
telomeres rather directly involve in telomere length regulation.
35
hTERT is a key component of telomerase and important in tumorigenesis. The
expression of the hTERT mRNA was increased according to the progression of
multistep hepatocarcinogenesis, and significant increase was found in the transition
from DNs to HCCs. But amplification of the hTERT gene was not found during
multistep hepatocarcinogenesis except a case of HCC. This result indicates that there
is no correlation between the hTERT mRNA level and its gene dosage in
hepatocarcinogenesis. In other words, the hTERT overexpression is not influenced
by the hTERT gene copy numbers. Gene amplification frequently occurs during
tumorigenesis and is one of the most common mechanisms for oncogene activation.
The amplification of the hTERT gene was reported in several tumors including
cervical cancer42 and embryonal brain tumors.43 However, there was little alteration
of the hTERT gene in hepatocarcinogenesis according to our results.
36
Ⅴ. Conclusion
In conclusion, an upregulation of TRF1, TRF2, and TIN2 was observed during
multistep hepatocarcinogenesis and the mRNA levels of these genes inversely
correlated with the telomere length. The negative correlation was more evident in
the DNs and DNs with HCC foci of early stages of hepatocarcinogenesis in which
the telomere was significantly shortened. These findings suggest that TRF1, TRF2,
and TIN2 are involved in hepatocarcinogenesis, particularly in the early stages of
hepatocarcinogenesis by playing crucial roles in the telomere shortening. And the
expression of the hTERT mRNA was significantly increased according to the
progression of multistep hepatocarcinogenesis, but an amplification of the hTERT
gene was not found. This result indicates that there is no correlation between the
hTERT mRNA level and its gene copy numbers in multistep hepatocarcinogenesis.
37
References
1. Wright JH, Gottschling DE, Zakian VA. Saccharomyces telomeres assume
a non-nucleosomal chromatin structure. Genes Dev 1992;6:197-210.
2. Tommerup H, Dousmanis A, de Lange T. Unusual chromatin in human
telomeres. Mol Cell Biol 1994;14:5777-5785.
3. Nugent CI, Hughes TR, Lue NF, Lundblad V. Cdc13p: a single-strand
telomeric DNA-binding protein with a dual role in yeast telomere
maintenance. Science 1996;274:249-252.
4. Karlseder J. Telomere repeat binding factors: keeping the ends in check.
Cancer Lett 2003;194:189-197.
5. Collins K. Mammalian telomeres and telomerase. Curr Opin Cell Biol
2000;12:378-383.
6. Kim SH, Kaminker P, Campisi J. Telomeres, aging and cancer: in search of
a happy ending. Oncogene 2002;21:503-511.
7. de Lange T. Protection of mammalian telomeres. Oncogene 2002;21:532-
540.
8. Hackett JA, Greider CW. Balancing instability: dual roles for telomerase
and telomere dysfunction in tumorigenesis. Oncogene 2002;21:619-626.
9. Griffith JD, Comeau L, Rosenfield S, Stansel RM, Bianchi A, Moss H, et al.
Mammalian telomeres end in a large duplex loop. Cell 1999;97:503-514.
10. Stansel RM, de Lange T, Griffith JD. T-loop assembly in vitro involves
binding of TRF2 near the 3' telomeric overhang. EMBO J 2001;20:5532-
5540.
11. van Steensel B, de Lange T. Control of telomere length by the human
telomeric protein TRF1. Nature 1997;385:740-743.
12. Smogorzewska A, van Steensel B, Bianchi A, Oelmann S, Schaefer MR,
Schnapp G, et al. Control of human telomere length by TRF1 and TRF2.
Mol Cell Biol 2000;20:1659-1668.
38
13. de Lange T, Shiue L, Myers RM, Cox DR, Nayor SL, Killery AM, et al.
Structure and variability of human chromosome ends. Mol Cell Biol
1990;10:518-527.
14. van Steensel B, Smogorzewska A, de Lange T. TRF2 protects human
telomeres from end-to-end fusions. Cell 1998;92:401-413.
15. Kim SH, Kaminker P, Campisi J. TIN2, a new regulator of telomere length
in human cells. Nat Genet 1999;23:405-412.
16. Nakanishi K, Kawai T, Kumaki F, Hiroi S, Mukai M, Ikeda E, et al.
Expression of mRNAs for Telomeric Repeat Binding Factor (TRF)-1 and
TRF2 in Atypical Adenomatous Hyperplasia and Adenocarcinoma of the
Lung. Clin Cancer Res 2003;9:1105-1111.
17. Miyachi K, Fujita M, Tanaka N, Sasaki K, Sunagawa M. Correlation
between telomerase activity and telomeric-repeat binding factors in gastric
cancer. J Exp Clin Cancer Res 2002;21:269-275.
18. Klapper W, Krams M, Qian W, Janssen D, Parwaresch R. Telomerase
activity in B-cell non-Hodgkin lymphomas is regulated by hTERT
transcription and correlated with telomere-binding protein expression but
uncoupled from proliferation. Br J Cancer 2003;89:713-719.
19. Saito K, Yagihashi A, Nasu S, Izawa Y, Nakamura M, Kobayashi D, et al.
Gene expression for suppressors of telomerase activity (telomeric-repeat
binding factors) in breast cancer. Jpn J Cancer Res 2002;93:253-258.
20. Yamada M, Tsuji N, Nakamura M, Moriai R, Kobayashi D, Yagihashi A, et
al. Down-regulation of TRF1, TRF2 and TIN2 genes is important to
maintain telomeric DNA for gastric cancers. Anticancer Res 2002;22:3303-
3307.
21. Yamada K, Yagihashi A, Yamada M, Asanuma K, Moriai R, Kobayashi D,
et al. Decreased gene expression for telomeric-repeat binding factors and
TIN2 in malignant hematopoietic cells. Anticancer Res 2002;22:1315-1320.
39
22. Stewart SA, Weinberg RA. Telomerase and human tumorigenesis. Semin
Cancer Biol 2000;10:399-406.
23. Mokbel K. The role of telomerase in breast cancer. Eur J Surg Oncol
2000;26:509-514.
24. Meyerson M, Counter CM, Eaton EN, Ellisen LW, Steiner P, Caddle SD, et
al. hEST2, the putative human telomerase catalytic subunit gene, is up-
regulated in tumor cells and during immortalization. Cell 1997;90:785-795.
25. Wu A, Ichihashi M, Ueda M. Correlation of the expression of human
telomerase subunits with telomerase activity in normal skin and skin
tumors. Cancer 1999;86:2038-2044.
26. Zhang A, Zheng C, Lindvall C, Hou M, Ekedahl J, Lewensohn R, et al.
Frequent amplification of the telomerase reverse transcriptase gene in
human tumors. Cancer Res 2000;60:6230-6235.
27. University of Toronto. Terminology of nodular hepatocellular lesions.
International Working Party. Hepatology 1995;22:983-993.
28. Miura N, Horikawa I, Nishimoto A, Ohmura H, Ito H, Hirohashi S, et al.
Progressive telomere shortening and telomerase reactivation during
hepatocellular carcinogenesis. Cancer Genet Cytogenet 1997;93:56-62.
29. Huang GT, Lee HS, Chen CH, Chiou LL, Lin YW, Lee CZ, et al.
Telomerase activity and telomere length in human hepatocellular carcinoma.
Eur J Cancer 1998;34:1946-1949.
30. Hytiroglou P, Kotoula V, Thung SN, Tsokos M, Fiel MI, Papadimitriou CS.
Telomerase activity in precancerous hepatic nodules. Cancer 1998;82:1831-
1838.
31. Kitamoto M, Ide T. Telomerase activity in precancerous hepatic nodules.
Cancer 1999;85:245-248.
40
32. Isokawa O, Suda T, Aoyagi Y, Kawai H, Yokota T, Takahashi T, et al.
Reduction of telomeric repeats as a possible predictor for development of
hepatocellular carcinoma: convenient evaluation by slot-blot analysis.
Hepatology 1999;30:408-412.
33. Youssef N, Paradis V, Ferlicot S, Bedossa P. In situ detection of telomerase
enzymatic activity in human hepatocellular carcinogenesis. J Pathol
2001;194:459-465.
34. Oh BK, Chae KJ, Park C, Kim K, Lee WJ, Han KH, et al. Telomere
shortening and telomerase reactivation in dysplastic nodules of human
hepatocarcinogenesis. J Hepatol 2003;39:786-792.
35. Kruk PA, Rampino NJ, Bohr VA. DNA damage and repair in telomeres:
relation to aging. Proc Natl Acad Sci USA 1995;92:258-262.
36. Ancelin K, Brunori M, Bauwens S, Koering CE, Brun C, Ricoul M, et al.
Targeting assay to study the cis functions of human telomeric proteins:
evidence for inhibition of telomerase by TRF1 and for activation of
telomere degradation by TRF2. Mol Cell Biol 2002;22:3474-3487.
37. Kim SH, Han S, You YH, Chen DJ, Campisi J. The human telomere-
associated protein TIN2 stimulates interactions between telomeric DNA
tracts in vitro. EMBO Rep 2003;4:685-691.
38. Ancelin K, Brun C, Gilson E. Role of the telomeric DNA-binding protein
TRF2 in the stability of human chromosome ends. Bioessays 1998;20:879-
883.
39. Karlseder J, Smogorzewska A, de Lange T. Senescence induced by altered
telomere state, not telomere loss. Science 2002;295:2446-2449.
40. Theise ND, Park YN, Kojiro M: Dysplastic nodules and
hepatocarcinogenesis. Clin Liver Dis 2002;6:497-512.
41. Ishikawa F. Breakthrough and views. Telomere crisis, the driving force in
cancer cell evolution. Biochem Biophys Res Commun 1997;230:1-6.
41
42. Zhang A, Zheng C, Hou M, Lindvall C, Wallin KL, Angstrom T, et al.
Amplification of the telomerase reverse transcriptase (hTERT) gene in
cervical carcinomas. Genes Chromosomes Cancer 2002;34:269-275.
43. Fan X, Wang Y, Kratz J, Brat DJ, Robitaille Y, Moghrabi A, et al. hTERT
gene amplification and increased mRNA expression in central nervous
system embryonal tumors. Am J Pathol 2003;162:1763-1769.
42
ABSTRACT (in Korean)
인간의 다단계 간암발생과정에서 텔로미어 길이와 텔로머레이즈
조절 기전
<지도교수 박영년>
연세대학교 대학원 의과학과
김 영 주
연구 목적 : 인간의 다단계 간암발생과정에 대한 연구가 최근 활발히 진
행되면서, 형성이상 결절이 전암병변이라는 증거가 축적되고 있다. 그리
고 텔로미어 길이 감소와 텔로머레이즈 재활성화는 초기 간암발생과정에
서 나타나는 현상으로, 아직 그 기작은 정확히 알려지지 않았다. 따라서
본 연구에서는 텔로미어 결합 단백질들 가운데 telomeric repeat binding
factor 1 (TRF1), TRF2 및 TRF1-interacting nuclear protein 2 (TIN2)가 텔로미
어 길이 유지에 관련되어 있다는 사실을 토대로, 인간의 다단계 간암발생
과정에서 각 유전자의 발현양상과 텔로미어 길이와의 관계에 대하여 조사
하였다. 또 텔로머레이즈 활성화에 중요한 역할을 하는 human telomerase
reverse transcriptase (hTERT) 유전자에 대해, mRNA 발현 정도와 유전자 수
를 측정한 후, 그 둘의 관계에 대해서도 조사하였다.
연구재료 및 방법 : 본 실험에서는 간암발생과정의 각 단계별 조직에서
real-time PCR을 이용하여 TRF1, TRF2, TIN2, hTERT mRNA 발현량 및
hTERT 유전자 수를 측정하였으며, 텔로미어의 길이와 앞서 측정된
43
hTERT 유전자 수의 확인을 위해 southern blot을 시행하였다.
결과 : TRF1, TRF2 및 TIN2의 mRNA 발현양상은 형성이상 결절 고등도
조직과 형성이상 결절 유래 간세포암종 조직에서 증가함을 보였으며, 특
히 간세포암종에서 매우 증가함을 확인할 수 있었다. 텔로미어의 길이는
이들 유전자의 발현 양상과는 반대로 간세포암종으로 진행될수록 주위 비
종양 간조직에 비해 감소함을 보였다. hTERT의 mRNA 발현량은 간세포
암종으로 진행될수록 매우 증가함을 보인 반면, 5p15.33에 위치한 hTERT
유전자 수는 변화가 없었다.
결론 : 간암발생과정에서 증가된 TRF1, TRF2 및 TIN2에 의하여 텔로미어
의 길이 감소가 유발되며, hTERT mRNA 발현량의 증가는 간암발생 초기
단계의 중요한 소견이나, 그 유전자 수의 변화에 의한 것이 아닌 것으로
생각한다.
핵심 되는 말 : 텔로미어, telomeric repeat binding factor 1, telomeric repeat
binding factor 2, TRF1-interacting nuclear protein 2,
텔로머레이즈, human telomerase reverse transcriptase,
간세포암종, 형성이상 결절
Recommended