View
19
Download
1
Category
Preview:
Citation preview
١۴٣٠/١٢/٠۴
١
Recombinant DNA Technology
(DNA cloning)( N g)
Majid Mojarrad
History of recombinant DNA technology
Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by
i i d d h itwo scientists named Boyer and Cohen in 1973.
Recombinant DNA
Formed when two genes from two different sources -often different species are combined in vitro into the same moleculeThis process is called genetic engineeringp g g gLead to a new field called biotechnology, the manipulation of organisms or their components to make useful products
Fig. Fig. 11..2 2 Many scientific disciplines contribute to molecular Many scientific disciplines contribute to molecular biotechnology, which generates a wide range of commercial biotechnology, which generates a wide range of commercial
productsproducts
DNA cloninggene cloning - prepare multiple identical copies of gene-sized pieces of DNA. Generation of DNA fragment
Joining into a vector or carrier molecule
Introduction into host cell to amplification
Selection of required sequences
١۴٣٠/١٢/٠۴
٢
Genes can be cloned into recombinant DNA vectorsFive steps:
Isolation of vector and geneIsolation of vector and geneInsert gene into vectorTransform bacteria with vectorPlate bacteria under selectionIdentify clones carrying vector
Generation of DNA fragment
Direct chemical synthesis
Restriction enzymatic digestion
Mechanical shearing
Joining into a vector
Homopolymertailing
Sticky end ligation
Blunt end ligation
Introduction into host cell
Transfection with recombinant phage
Transformation with recombinant plasmid
synthesis
PCR
RT-PCR
Use of linker
Ligase independent cloning
Packaging DNA in vitro
Generation of DNA fragment
Enzymatic digestion of purified DNAPCRRT-PCR
Restriction enzymes are used to make recombinant DNA
Cut DNA at specific DNA sequences
symmetrical series of four to eight basesSticky or blunt endsSticky or blunt endsRestriction fragments-specific for each DNA
Origin – bacteriaHow do they protect their own DNA?
Combined by DNA ligase
Methods of Introducing Foreign DNA
TransformationElectroporationConjugation
How can you identify which clones carry the vector?
1) Nucleic acid hybridization2) Isolation of plasmid DNA from individual clones
and restriction mappingPCRPCR
١۴٣٠/١٢/٠۴
٣
PCR: HistoryPCR: History
PCR Invention: PCR Invention: 1987 1987 KaryKary MullisMullis
PCR is essentially DNA replication in a tube.PCR is essentially DNA replication in a tube.
Series of repetitive steps enabling amplificationSeries of repetitive steps enabling amplificationof target DNA from a complex mixture of DNAof target DNA from a complex mixture of DNA
The major advantages of PCRThe major advantages of PCR
Speed and ease of useSpeed and ease of use30 30 cycles each taking cycles each taking 33--5 5 minsmins
SensitivitySensitivityCan amplify from a single cell great care must beCan amplify from a single cell great care must beCan amplify from a single cell, great care must be Can amplify from a single cell, great care must be taken to avoid contaminationtaken to avoid contamination
RobustnessRobustnessWill even work on degraded DNA or fixed DNAWill even work on degraded DNA or fixed DNA
Disadvantages of PCRDisadvantages of PCR
Need for Target DNA sequence informationNeed for Target DNA sequence informationTo construct primers you need to know your targetTo construct primers you need to know your target
Short size limit for productShort size limit for productThere is an upper limit to the size of DNA synthesized by There is an upper limit to the size of DNA synthesized by pp y ypp y yPCRPCR
Infidelity of replicationInfidelity of replicationBecause the PCR polymerases are heat stable they ten not to Because the PCR polymerases are heat stable they ten not to have the have the 33’’-->>55’ exonuclease activity’ exonuclease activity
BasicsBasicsTargetTarget
dNTP’sdNTP’s
BufferBuffer
DenatureDenature-- 929200CC--959500C C ((949400C)C)
AnnealAnneal-- 505000CC--727200CCAim for Aim for 5500C below C below calculated Tmcalculated Tm
PrimersPrimers
DNA DNA TaqTaq polymerasepolymerase
calculated Tmcalculated Tm((525200CC--585800C generally best)C generally best)
Extension Extension -- 686800CC--808000CC((727200C)C)highest efficiency highest efficiency 707000CC--808000CC
TemplateTemplate
PlasmidPlasmidcDNAcDNA (RT(RT--PCR)PCR)Genomic DNAGenomic DNA
Purified (P)Purified (P)Crude Crude LysateLysate (C)(C)
P C P CPlasmid Genomic
40ng 10ng 1ng
١۴٣٠/١٢/٠۴
۴
dNTPsdNTPs
Mixture of Mixture of dATPdATP, , dCTPdCTP, , dGTPdGTP, , dTTPdTTP or or dUTPdUTPPurityPurity-- chemical or enzymatic synthesischemical or enzymatic synthesisStabilityStability-- concentration concentration –– Li or Na salt formLi or Na salt form
BufferBufferAll All 1010x Buffers are not the samex Buffers are not the same
SaltSalt 1010--50 50 mMmM TrisTris pH pH 88..33
MonovalentMonovalent cationcation 100100--150 150 mMmM KClKCl or or NaClNaCl
Divalent Divalent cationcation 11..55uM or > MgCluM or > MgCl22++
MgMg22+, Mn+, Mn22++
Additives Additives Detergent, Glycerol, GelatinDetergent, Glycerol, Gelatin
Buffer SystemsBuffer SystemsModifications:MgpHIonic strength AdditivesAdditives
Ionic strength
Mg2+
Buffer AdditivesBuffer Additives
QQ--solutionsolution--BetaineBetaineDMSODMSOBSA BSA GlycerolGlycerolGlycerolGlycerolGelatinGelatinPEG PEG GCGC--meltmeltFormamideFormamideDetergents Detergents Q D B G P Q/D F D
PrimersPrimers
Pair complementary to opposite strandsPair complementary to opposite strands55’’ 33’ sense primer’ sense primer33’’ 55’ anti’ anti--sense primer sense primer
FeaturesFeatures1818--26 26 nucleotidesnucleotides Equal mix GC to AT basesEqual mix GC to AT bases
Match Tm of primersMatch Tm of primers Tm Tm ooCC= = 22(A/T) + (A/T) + 44(G/C)(G/C)
33’ Stability ’ Stability GG or GC clampsGG or GC clamps
Additional ConsiderationsAdditional Considerations
Secondary structureSecondary structure-- avoid hairpins, selfavoid hairpins, self--dimersdimers, cross, cross--homologyhomology
AvoidAvoid didi--nucleotide repeats that occur consecutivelynucleotide repeats that occur consecutively--Avoid Avoid didi nucleotide repeats that occur consecutivelynucleotide repeats that occur consecutivelyATATATATATATATAT
Avoid long runs of single basesAvoid long runs of single bases-- ACGGGGGGATACGGGGGGAT
Avoid crossAvoid cross--homologyhomology-- BLAST TestBLAST Test
١۴٣٠/١٢/٠۴
۵
Primer Variation ExamplePrimer Variation ExamplePCR 1st Round vary primer pairs Sets A-F
A= Primer 1F Primer 1RB= Primer 2F Primer 1RC= Primer 3F Primer 1RD= Primer 1F Primer 2R
Forward primersPrimer 1: GAGGGCAGATTCGGGAATG Tm=600cPrimer 2: TCGGGAGAGGCCCTTCCC Tm=620cPrimer 3: CAGTTTCCCGGGTTCGGC Tm=600c
Reverse primersPrimer 1: AGCCTAATCAAGTCACTATCAAG Tm=620CPrimer 2: GCAAGTGAGAAAATGGGGAG Tm=600C
D Primer 1F Primer 2RE= Primer 2F Primer 2RF= Primer 3F Primer 2R
DNA Taq PolymerasesDNA Taq PolymerasesConsiderations: Considerations: Aim of experimentAim of experiment
Thermal stabilityThermal stabilityProcessivityProcessivityFidelity Fidelity
DNA Taq PolymerasesDNA Taq PolymerasesStandard polymeraseStandard polymerase works for most applicationsworks for most applicationsStandard polymerase with loading dyeStandard polymerase with loading dye aids in higher throughaids in higher through--putputHot Start polymerase Hot Start polymerase inhibits noninhibits non--specific primer specific primer
extensionextensionPolymerase blends or cocktailsPolymerase blends or cocktails combine polymerases for combine polymerases for
fidelity with speedfidelity with speedfidelity with speedfidelity with speed
Taq blend Standard Taq Hot Start Taq
FidelityPCR product sequence
PCR product T/A clonedIndividual isolates sequenced
PCR CyclingPCR Cycling Modified PCR MethodsModified PCR MethodsHot Start PCRHot Start PCRManual Hot StartManual Hot StartPhysical BarrierPhysical BarrierM difi dM difi d TT DNA lDNA lModified Modified TaqTaq DNA polymeraseDNA polymeraseOligoOligo InhibitorsInhibitorsModified Modified dNTP’sdNTP’s
SemiSemi--Nested or Nested PCRNested or Nested PCRTouch down PCRTouch down PCR
١۴٣٠/١٢/٠۴
۶
SemiSemi--Nested or NestedNested or Nested--PCRPCR
Specificity
-------------------------------------------
Sensitivity
Additional PCR MethodsAdditional PCR MethodsAlleleAllele--specific PCRspecific PCRAssembly PCR (PCA)Assembly PCR (PCA)Breakpoint PCRBreakpoint PCRIntersequenceIntersequence--specific PCR (ISSR)specific PCR (ISSR)InverseInverse--PCR (IPCR or REPCR (IPCR or RE--PCR)PCR)Ligation Mediated PCR (LMLigation Mediated PCR (LM--PCR)PCR)Long distance PCRLong distance PCRMultiplexMultiplex--PCRPCRMethylation Specific PCR Methylation Specific PCR MiniMini--primer PCRprimer PCRQuantitative PCR or RealQuantitative PCR or Real--time PCRtime PCRReverse Transcriptase PCR (RTReverse Transcriptase PCR (RT--PCRPCR))
RTRT--PCRPCR
Quality of RNA
Reverse Transcriptase-QColigo dTrandom hexamersgene specific primers
MultiplexMultiplex--PCRPCR
2 3 4 5 6 7 81 9
Increase throughputIncrease data with limited material
Exon 7 and 8Exon 9Exon 3
Exon 5Exon 1Exon 2Exon 6
Exon 4
LongLong--PCRPCRAnalyze large area in single reaction
Tool to analyze inserts and breakpoints
14kb
3kb
1.6kb20kb
BreakpointBreakpoint--PCRPCR
Isolate low frequency event Isolate low frequency event
١۴٣٠/١٢/٠۴
٧
InverseInverse--PCR and REPCR and RE--Inverse PCRInverse PCRIsolate unknown flanking regionIsolate unknown flanking regionDigest with restriction enzymeDigest with restriction enzymeLigate with TLigate with T4 4 DNA ligaseDNA ligase
Restriction fragment length polymorphismRestriction fragment length polymorphism
Allele specificAllele specificPCRPCR
Genomic WalkingGenomic Walking
TaqManTaqMan™ ™ assayassay
Allele specific PCR using the 5’ to 3’ exoactivity and a third primer with a Fluor
d Q hand Quencher.
RealReal--Time PCR or QTime PCR or Q--PCRPCR
Increased SensitivityIncreased SensitivityIncreased SpecificityIncreased SpecificityIncreased ThroughputIncreased Throughput
١۴٣٠/١٢/٠۴
٨
Designing of primers
Identification of restriction map:http://www.firstmarket.com/cutter/cut2.html
Primer Design http://frodo wi mit edu/primer3/http://frodo.wi.mit.edu/primer3/
Evaluation of primers specifityhttp://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome
Introducing of restriction sites
PCR reaction
PCR cycle Cloning of PCR products
Plasmid digestionPCR product digestionMeasurement of molar concentration of DNA
htt // b i th t d /bi t l / lihttp://www.basic.northwestern.edu/biotools/oligocalc.htmlLigationtransformation
transformation
Heat shockelectroporation
١۴٣٠/١٢/٠۴
٩
Preparing mediumAntibiotic selectionLiquid culturePl id t tiPlasmid extractionPlasmid identity confirmationSequencing subcloning
Extraction of plasmid
Recommended