View
4
Download
0
Category
Preview:
Citation preview
Quantitative Biology Lecture 2
(probability distributions + diffusion)
Gurinder Singh “Mickey” Atwal Center for Quantitative Biology
22nd Sep 2015
Summary
• Probability distribu0ons in biology • Delbruck-‐Luria Experiment
• Central Limit Theorem • Molecular Diffusion
Probability and Sta0s0cs in Biology
MODELS • Molecular biology is fundamentally noisy and processes are best described probabilis)cally.
DATA ANALYSIS • Interpreta0on of finite noisy measurements
Sequence Analysis • CAGCCAGACTGCCTTCCGGGTCACTGCCATGGAGGAGCCGCAGTCAGATCCTAGCGTCGAGCCCCCTCTGA
GTCAGGAAACATTTTCAGACCTATGGAAACTGTGAGTGGATCCATTGGAAGGGCAGGCCACCACCCCGACCCCAACCCCAGCCCCCTAGCAGAGACCTGTGGGAAGCGAAAATTCATGGGACTGACTTTCTGCTCTTGTCTTTCAGACTTCCTGAAAACAACGTTCTGGTAAGGACAAGGGTTGGGCTGGGACCTGGAGGGCTGGGGGGGCTGGGGGGCTGGGACCTGGTCCTCTGACTGCTCTTTTCACCCATCTACAGTCCCCCTTGCCGTCCCAAGCAATGGATGATTTGATGCTGTCCCCGGACGATATTGAACAATGGTTCACTGAAGACCCAGGTCCAGATGAAGCTCCCAGAATGCCAGAGGCTGCTCCCCGCGTGGCCCCTGCACCAGCAGCTCCTACACCGGCGGCCCCTGCACCAGCCCCCTCCTGGCCCCTGTCATCTTCTGTCCCTTCCCAGAAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCTTGCATTCTGGGACAGCCAAGTCTGTGACTTGCACG
Biological Problem Given this sequence : • how do we quan0fy this sequence? • can we determine what organism this sequence comes from? • is the sequence different from the rest of the genome?
Sequence taken from TP53 gene
Solu0on Probabilis0c model (sta0s0cs)
Binomial Distribu0on
• Example: what is the probability of observing n guanine bases in a genomic segment of size L bases?
P (n) =L!
(L− n)!n!pn(1− p)L−n
�Ln
�≡ L!
(L− n)!n!shorthand nota0on
p = probability of G base
q ≡ 1− p
How many different orderings of N different objects?
!
N " (N #1) " (N # 2).....3 " 2 "1 $ N!
Example: amino acids in a polypep0de chain
Number of permuta0ons:
How many different orderings of N different objects?
!
N!3!
* * *
3 objects are iden0cal
Number of permuta0ons:
How many different orderings of N objects?
!
N!R!(N " R)!
#NR$
% & '
( )
R red objects B=(N-‐R) blue objects
Commonly used Probability Distribu0ons
• Discrete Distribu0ons – Binomial – Poisson – Hypergeometric
• Con0nuous Distribu0ons – Gaussian (normal distribu0on; Bell curve) – Exponen0al – Flat – Beta
Proper0es of binomial distribu0on
!
P(n;N, p) =Nn"
# $ %
& ' pn (1( p)N (n
!
n = nP(n;N, p) = Npn=0
N
"
!
"2 = n # n( )2
= Np(1# p)
MEAN
VARIANCE
Probability of k events occurring out of n chances, with each event occurring with probability p
Binomial Sampling Example Cell containing N copies of a par0cular molecule
Number of molecules in a daughter cell
= Np± Np(1! p)
=N2±
N2
Molecules par00on randomly into two
equally sized daughter cells
(p=1/2)
DIVISION
Phenotypic varia0on in daughter cells due to finite number of molecules
Rare events: Poisson Distribu0on
• Example: what is the probability of observing the sequence GATTACA in large stretch of the genome
• Small probabili0es implies few events
• Binomial distribu0on -‐> Poisson distribu0on in the rare probability limit
Poisson Distribu0on
!
P(n;N, p) =(Np)n
n!e"Np N >> 1
p << 1 Np fixed
!
n = Np"2 = Np mean=variance
coefficient of varia0on: c =standard deviation
mean
=σ
�n�
=1√N
=1√Np
Poisson Distribu0on
• Note that the Poisson distribu0on only depends on the mean <n>
• Example: the probability that a DNA nucleo0de is not sequenced given that the sequencing coverage is 5x
P(n | n ) =n n
n!e! n
= P(0 | 5) = 50e!5
0!= e!5 = 0.007
Poisson Process • Describes the distribu0on of random events • Assump0ons:
– The number of events in each interval is independent of other events
– The probability of an event in a small interval is propor0onal to the interval dura0on
– The probability of seeing more than one event in a vanishing small interval is zero
!
P(k) =(rt)k
k!e"rt
Probability of observing k events in 0me t:
r = rate of events For a homogeneous process the rate is constant.
Poisson Process Example: Restric0on sites
Restric0on endonuclease EcoRI recognizes the sequence 5’-‐GAATTC-‐3’. The probability of observing a par0cular 6-‐mer ≈ (0.25)6 ≈ 2*10-‐4
genome
restric0on sites
Model: Homogeneous Poisson Process with rate μ per base pair
Probability of n restric0on sites in segment of length d p(n) =
(µd)ne−µd
n!
Mean number of restric0on sites
Variance of restric0on sites
�n� = µd�(∆n)2
�≡
�(n− �n�)2
�= µd
Poisson Process Example: Neural Spike Trains
0 0 1 0 1 0 1 1 0 0 1 0 1 1 0
Neural spike train
Binary representa0on. Discre0za0on into small bins Δt
In small interval Δt, the probability of a single spike =
0me
Δt Tint
Model: Homogeneous Poisson Process with rate r spikes per unit 0me
In 0me interval Tint, the probability of n spikes =
volta
ge
(rTint)ne−rTint
n!
r∆t
The average number of spikes = rTint
Variance of spike counts = rTint
The Luria-Delbrück Model of evolution of Bacterial
Resistance
(Application of Poisson distribution and Fluctuation Test)
Curious experimental observation bacteria colony grows add virus (bacteriophage)
bacteria die new colony emerges
The Question
Did the mutation to resistance happen i) BECAUSE of the presence of a virus, or
ii) BEFORE adding the virus to the culture?
Two evolution models of bacterial resistance
The mutation happens…
BECAUSE of the virus (acquired immunity)
BEFORE adding the virus (mutation to immunity)
VIRUS VIRUS
Binomial ≈ Poisson distribution
Luria-Delbrück distribution
Fluctuation Test
In 1943, S.E. Luria and M. Delbrück compared the mean and variance (fluctuations) of both distributions to show that the number of mutations follows the Luria-Delbrück distribution, and not the Poisson distribution.
Mutations happen independent of the presence of viruses.
The data can then be used to estimate the mutation rate µ.
Results: variance ≠ mean
In every experiment the fluctuation of the numbers of resistant bacteria is much higher than the expectations from the hypothesis of acquired immunity.
Hypergeometric Distribu0on • The hypergeometric distribu0on is another important discrete
distribu0on. • Example: the genome contains N total genes, of which there are
T total tumor suppressor genes. A recent study publishes F fer0lity-‐related genes. What is the probability that there are t tumor suppressor genes in the fer0lity list?
• The hypergeometric distribu0on is useful in tests of independence in categorical data (Fisher’s exact test).
!
p(t) =
Tt"
# $ %
& ' N (TF ( t"
# $
%
& '
NF"
# $ %
& '
Continuous Distributions Example • Gaussian
• Exponential
• Beta distribution
Note that these continuous probability distributions are described by probability densities p(x). The probability that a value lies between x and x+dx is p(x)dx The area under each curve must equal one.
Gaussian Distribu0on
P(x; x ,! 2 ) = 12"! 2
e!(x! x )2
2! 2
Large N limit of the Binomial distribu0on. Gaussian distribu0on depends only on mean <x> and variance σ2 Note that P(x;<x>, σ2) is a probability density. P(x;<x>, σ2) = the probability that a measurement lies between x and x+dx
x is a con0nuous variable
Central Limit Theorem
• The theorem tells us how the mean/sum of a set of independent measurements should behave
• Let us take an arbitrary distribu0on, f(x), with mean μ and standard devia0on σ. We now take n samples from this distribu0on and calculate the sampling mean, <x>=(x1+x2+…xn)/n
• Remarkably, the theorem states that the sampling mean <x> will always follow a Gaussian distribu0on with mean μ and standard devia0on
!
"n
Central Limit Theorem • The average <x> of the n observa0ons has a Gaussian
(Normal) Distribu0on with mean μ and standard devia0on
!
x ~ Normal(µ,"2
n)!
"n
!
Z =x " µ#
n~ Normal(0,1)
Note that if the popula0on standard devia0on σ is unknown and we use the sample standard devia0on s instead then we get the t-‐sta0s0c
!
t =x " µsn
~ Student's t " distributionn-‐1 degrees freedom
!
P(n;N, p) =Nn"
# $ %
& ' pn (1( p)N (n
!
P(n;N, p) =12"#2
e$(n$Np )2
2# 2
!
P(n;N, p) =(Np)n
n!e"Np
BINOMIAL
POISSON GAUSSIAN
(Probability density)
N large n con0nuous
N large p small
!
"2 = Np
! 2 = Np(1! p)n = Np
Python code for distribu0ons
Check out the IPython notebook for sta0s0cal distribu0ons and simula0ons of the central limit theorem:
hsp://nbviewer.ipython.org/url/atwallab.cshl.edu/teaching/distribu0ons.ipynb
Diffusion Model
0 1 2 3 4 5 6 7 -‐1 -‐2 -‐3 -‐4 -‐5 -‐6 -‐7 X
Par0cle moves either lev (L) or right (R) at each 0me step Δt. Example sequence of N steps: LLLRLRRLRRRLLRRLRRL
A=Total number of R steps B=Total number of L steps N=Total number of steps=A+B T=Total 0me=NΔt
Displacement at 0me T is
Distribu0on of A and B given by simple Binomial Distribu0on
XT = A−B = A− (N −A)
= 2A−N
Diffusion Model Ques0on: How far has the par0cle been typically displaced aver 0me T?
i.e., what are <XT> and <XT2> ?
The mo0on of a single par0cle is completely stochas0c and thus we need a probabilis0c model. This is equivalent to observing the mo0on of a large collec0on of par0cles with the same star0ng condi0ons.
�XT � = 2 �A� −N�X2
T
�= 4
�A2
�− 4 �A�N +N2
To calculate these quan00es we need <A> and <A2>.
Diffusion Model
P (A) =N !
(N −A)!A!
�1
2
�A �1− 1
2
�N−A
=N !
(N −A)!A!
�1
2
�N
�A� = N1
2
σ2A =
�(A− �A�)2
�=
�A2
�− �A�2
= N1
2
�1− 1
2
�=
N
4
mean
variance
Let’s take the simple case of equal probability of moving either to the lev or to the right. The probability distribu0on of A (the number of R steps out of N total steps) is
Therefore,
Binomial Distribu0on
�A2� = σ2A + �A�2
=N
4+
N2
4
Diffusion Model Plugging the equa0ons for <A> and<A2>, we get
�XT � = 2 �A� −N
= 0�X2
T
�= 4
�A2
�− 4 �A�N +N2
= N
In terms of the total 0me T and the the diffusion constant, D=1/(2Δt), we get �X2
T
�= 2DT
�X2
T
�1/2= (2DT )1/2
The spread of a collec0on of par0cles grows as the square root of 0me. Therefore a par0cle will take a 0me 100 0mes longer to diffuse a distance 10 0mes longer. We derived this result in one dimension, but it holds in all dimensions
Limi0ng distribu0on of a Random Walk
• For a large number of steps, the binomial distribu0on becomes Gaussian
• 1-‐dimensional random walk
!
P(x, t;x0,t0) =14"#t
e$(#x )2
4D#t
!
x 2 = 2D"tThis Gaussian distribu0on is the solu0on to the diffusion equa0on which describes the probability dynamics of a diffusing par0cle
!P!t
= D!2P!x2
Δt=t-‐t0
DIFFUSION EQUATION
Diffusion Model (large 0me) In the limit of large 0me T, or steps N, the Binomial probability distribu0on of the posi0on of the diffusing par0cle becomes Gaussian with a 0me-‐dependent width.
p(X,T) P (X,T ) =
1√4πDT
e−X2
4DT
σ =√2DT
early T
late T
width
Gene Regula0on
Transcrip0on factors searching for their specific binding site using both three-‐dimensional diffusion and one-‐dimensional diffusion along the DNA molecule.
Recommended