View
8
Download
0
Category
Preview:
Citation preview
PREVALENCE OF TICKS AND TICK-BORNE PATHOGENS
FROM PUNJAB, PAKISTAN
By
Marriam Batool
2011-GCUF-05235
Thesis submitted in partial fulfilment of
the requirements for the degree of
DOCTOR OF PHILOSOPHY
IN
ZOOLOGY
DEPARTMENT OF ZOOLOGY
GOVERNMENT COLLEGE UNIVERSITY, FAISALABAD.
March 2018
i
DEDICATION
I dedicate this thesis to my beloved
Father and Mother
ii
DECLARATION The work reported in this thesis was carried out by me under the supervision of Dr.
Shabab Nasir, Assistant Professor, Department of Zoology, Government College University
Faisalabad, Pakistan.
I hereby declare that the title of thesis “Prevalence of ticks and tick-borne pathogens
from Punjab, Pakistan” and the contents of thesis are the product of my own research and no
part has been copied from any published source (except the references, standard mathematical or
genetic models / equations / formulas / protocols etc.). I further declare that this work has not
been submitted for award of any other degree/ diploma. The university may take action if the
information provided is found inaccurate at any stage.
Signature of the Student/Scholar
Name of Student: Marriam Batool
Registration No: 2011-GCUF-05235
iii
CERTIFICATE BY SUPERVISORY COMMITTEE
We certify that the contents and form of thesis submitted by Marriam Batool, Registration No.
2011-GCUF-05235 has been found satisfactory and in accordance with the prescribed format.
We recommend it to be processed for the evaluation by the External Examiner for the award of
degree.
Signature of Supervisor ………………….
Name: Dr. Shabab Nasir
Designation with Stamp……………………….
Member of Supervisory Committee
Signature ………………………………….
Name: Prof. Dr. Farhat Jabeen
Designation with Stamp……………………….
Member of Supervisory Committee
Signature ………………………………….
Name: Prof. Dr Tayyaba Sultana
Designation with Stamp……………………….
Chairperson
Signature with Stamp……………………………
Dean / Academic Coordinator
Signature with Stamp……………………………
iv
CERTIFICATE BY ETHICAL COMMITTEE,
DEPARTMENT OF ZOOLOGY
We certify that the contents and form of thesis submitted by by Marriam Batool, Registration
No. 2011-GCUF-05235 has been found satisfactory and in accordance with the prescribed
format. We recommend it to be processed for the evaluation by the External Examiner for the
award of degree.
Signature ………………….
Name: Prof. Dr. Salma Sultana
Designation with Stamp……………………….
Signature ………………….
Name: Dr. Azhar Rasul
Designation with Stamp……………………….
v
Plagiarism Undertaking
I solemnly declared that research work presented in the thesis titled “Prevalence of ticks and
tick-borne pathogens from Punjab, Pakistan” is solely my research work with no significant
contribution from any other person. Small contribution/help wherever taken has been duly
acknowledged and that complete thesis has been written by me.
I understand the zero tolerance policy of the HEC and Govt. College University Faisalabad
toward plagiarism. Therefore, I as an Author of above titled thesis declare that no portion of my
thesis has been plagiarized and any material used as reference is properly referred/cited.
I undertake that if I am found guilty of any formal plagiarism in the above titled thesis even after
the award of PhD degree, the University reserves the rights to withdraw/revoke my PhD degree
and HEC and the University has the right to publish my name on the HEC/University website on
which names of students are placed who submitted plagiarized thesis.
Student/Author Signature ----------------------
Name Marriam Batool
vi
LIST OF CONTENTS
Declaration ii
Certificate by supervisory committee iii
Certificate by ethical committee, Department of Zoology iv
Plagiarism undertaking v
List of contents vi-viii
List of tables ix-xi
List of figures xii-xiii
List of abbreviations xiv-xvii
Acknowledgements xviii
Abstract xix
Chapter 1 Introduction 1-6
Chapter 2 Review of Literature 7-32
2.1 Prevalence and identification of ticks 7-14
2.2 Tick-borne pathogens and diseases 14-23
2.3 Use of acaricides and medicinal plants to control ticks 23-32
Chapter 3 Materials and Methods 33-45
3.1 Study area 32-35
3.2. Collection and preservation of ticks 36
vii
3.3. Identification of ticks 36
3.4. Collection and identification of plant materials 36
3.5. Preparation of plants extract 37
3.6. Phytochemical analysis 39
3.6.1 Test for the confirmation of Flavonoids 39
3.6.2 Test for the confirmation of Terpenoids 39
3.6.3 Test for the confirmation of Alkaloids 39
3.6.4 Test for the confirmation of Tannins 39
3.6.5 Test for the confirmation of Saponins 39
3.6.6 Test for the confirmation of Steroids 39
3.6.6.1 Liebermann Burchard test 39
3.6.6.2 Salkowskis test 40
3.6.7 Test for the confirmation of Phenols 40
3.7 Bioassay 40
3.7.1 Preparation of stock solution of selected plants 40
3.7.2 Percent mortality 40
viii
3.7.3 Stock solution of selected acaricides 42
3.7.4 Percent mortality 42
3.8 DNA extraction 42
3.9 Using PCR for amplification of DNA of tick borne
pathogens 43
3.9 Statistical analysis 45
Chapter 4
Results & Discussion
46-107
4.1 Analytical characteristics of the population
46
4.2 Tick prevalence 46
4.3 Identification of tick species 61
4.4 Screening of ticks for tick-borne pathogens
74
4.5 Control of tick species 88
4.6 Phytochemical analysis 95
4.7 Prevalence of ticks in agro-ecological zones 96
4.8 Tick-borne pathogens 101
4.9 Tick control 106
ix
Summary 108-109
Conclusion 110
Recommendations 111
References 112-138
x
LIST OF TABLES
Table # Title Page #
3.1. Classification of selected plants of study 37
3.2. Specific primers sequence, PCR conditions and targeted
size of tick borne pathogens 44
4.1. Zone-wise tick prevalence (%) for overall data 47
4.2. . Animal-wise tick prevalence (%) for overall data 47
4.3. Season-wise tick prevalence (%) for overall data. 48
4.4. Animal-wise prevalence with respect to different seasons
for Southern zone 48
4.5. Animal-wise prevalence with respect to different seasons
for Western zone 50
4.6. Animal-wise prevalence with respect to different seasons
for Central zone 51
4.7.
Animal-wise prevalence with respect to different seasons
for Northern zone
52
4.8. Area-wise prevalence with respect to different Animals for
spring season 53
4.9. Zone-wise prevalence with respect to different animals for
summer season 54
4.10. Zone-wise prevalence with respect to different animals for
autumn season 55
4.11. Zone-wise prevalence with respect to different Animals for
winter season 56
xi
4.12. Season-wise prevalence with respect to different zones for
buffalo 57
4.13. Season-wise prevalence with respect to different zones for
cow 58
4.14. Season-wise prevalence with respect to different zones for
goat 59
4.15. Season-wise prevalence with respect to different zones for
sheep 60
4.16.
Prevalence of identified tick species in different farm
animals in Southern zone Punjab, Pakistan 68
4.17. Prevalence of identified tick species in different farm
animals in Western zone Punjab, Pakistan 69
4.18. Prevalence of identified tick species in different farm
animals in Central zone Punjab, Pakistan 70
4.19. Prevalence of identified tick species in different farm
animals in Northern zone Punjab, Pakistan 71
4.20. Analysis of variance for comparison of means 71
4.21. Means between animals, zones and tick species 72
4.22. Overall prevalence of tick-borne pathogens in agro-
ecological zones of Punjab, Pakistan 73
4.23. The overall prevalence of tick-borne pathogens in Southern,
Western, Central and Northern zones 74
xii
4.24.
Species of Babesia, Theleria, Anaplasmoisis and Ehrlichia
isolated from different tick species in Southern Zone
Punjab; Pakistan
77
4.25.
Species of Babesia, Theleria, Anaplasmoisis and Ehrlichia
isolated from different tick species in Western Zone Punjab;
Pakistan
79
4.26.
Species of Babesia, Theleria, Anaplasmoisis and Ehrlichia
isolated from different tick species in Central zone Punjab;
Pakistan
80
4.27.
Species of Babesia, Theleria, Anaplasmoisis and Ehrlichia
isolated from different tick species in Northern zone
Punjab; Pakistan
82
4.28. Lethal concentration of selected plant extracts against tick
species 87
4.29. Lethal time of selected plant extracts against tick species 89
4.30. Lethal concentration of selected acaricides against tick
species 91
4.31. Lethal time of selected Acaricides against tick species 92
4.32. Qualitatively phytochemical analysis of selected plants 94
xiii
LIST OF FIGURES
Figure # Title Page #
1
Map of province Punjab in Pakistan and the districts from
where samples of tick were collected 35
2
(a) Calotropis procera, (b) Solanum nigrum, (c) Brassica
rapa (d) Trigonella foenum graecum (e) and Citrullus
colocynthis
37
3 Dorsal and ventral view of Hy. dromedarii 62
4 Dorsal and ventral view of Hy. truncatum (female) 63
5 Dorsal and ventral view of Hy. rufipes 63
6 Dorsal and ventral view of Hy. marginatum 64
7 Dorsal and ventral view Hylomma annatolicum 64
8 Dorsal and ventral view of Rhipicephalus appendiculatus 65
9 Dorsal and ventral view of Rhipicephalus sanguineus 65
10 Dorsal and ventral view of Boophilus microplus 66
11 Dorsal and ventral view Boophilus decoloratus 66
12 Dorsal and ventral view of Argas percicus 67
xiv
13 Agarose gel electropherosis for the presence of Anaplasma
and Ehrlichia spp. 84
14 Agarose gel electropherosis for the presence of Babesia and
Theileria spp 85
15 Agarose gel electropherosis for the presence of Babesia and
Theileria spp 86
16
Mortality (%) of tick species after 96 hrs in the different
concentration of plants extract
90
17 Mortality (%) of tick species after 72 hrs in the different
concentration of acaricides 93
xv
LIST OF ABBREVIATIONS
Acronyms Unsynchronized form
A. sativum Allium sativum
A. ovis Anaplasma ovis
A. centrale Anaplasma central
A. conyzoides Ageratum conyzoides
A Anus
A. marginale Anaplasma marginale
A. percicus Argus percicus
A.indica Azadirachta indica
AA Anus Aperture
A.absinthium Artemisia absinthium
AEZ Agro Ecological Zone
AG Anal Groove
AIT Adult Immersion Test
AO Anal Orifice
AP Adnal Plates
APSE Adnal Plates Square Ends
B. bigemina Babesia bigemina
B. bovis Babesia bovis
B. caballi Babesia caballi
B. decolratus Boophilus decolratus
B. microplus Boophilus microplus
B. rapa Brassica rapa
BLPRI Barani Livestock Production Research Institute
BPA Broad Prose Areas
C. adenocucaulis Cissus adenocucaulis
xvi
C. aurea Calpurnia aurea
C. colocynthis Citrullus colocynthis
C. didymobotrya Cassia didymobotrya
C. procera Calotropis procera
CA Caudal Appendages
CCHF Congo Hemorrhagic Fever Virus
Celisa competitive Enzyme-linked Immuno Sorbent Assay
CG Cervical Grooves
CG Caudal Grooves
CI Confidence Interval
CP Caudal Process
CS Curved Scutum
D. marginatus Dermacentor marginatus
D. metel Datura metel
DC Dark Conscutum
DF Dark Festoons
DMSO Dimethyl Sulfoxide
DS Dark sScutum
DSS Dark Setae on Spiracle
E Eyes Present
E. hirta Euphorbia hirta
EVPs Ethno-Veterinary Practices
GAS Genital Aperture Semicircular
GC–MS Gas Chromatography–Mass Spectrometry
GG Genital Groove
GO Genital Orifice
xvii
H. suaveolens Hyptis suaveolens
Hy. anatolicum Hyalomma anatolicum
Hy. dromedarii Hylomma dromedarii
Hy. marginatum Hyalomma marginatum
Hy. Rufipes Hylomma . rufipes
Hy. truncatum Hylomma truncatum
I. cicinus Ixodes ricinus
ISG Irregular Scapular Grooves
K. africana Kigelia Africana
LC Lethal Concentration
LG Pale Parma
LMP Long Mouth Part
LPT Larval Packet Test
LT Lethal Time
MG Marginal grooves
MG Maiden Groove
NAE Number of Animals Examined
NAI Number of Animals Infested
NARC National Agricultural Research Centre
NPP No of Poles Positive
NPT No of Poles Tested
NTC Number of Ticks Collected
O. sanctum Ocimum sanctum
OR Odd‟s Ratio
P. harmala Peganum harmala
PA Porose Area
PBL Pale Banded Legs
xviii
PCV Packed Cell Volume
Qpcr quantitative PCR
RAP Rounded Adnal Plates
Rh. appendiculatus Rhipicephalus appendiculatus
Rh. sanguineus Rhipicephalus sanguineus
S. nigrum Solanum nigrum
SC Sclerotized Conscutum
SC Sharp Capituli
SE Standard Error
SL Spurs on Legs
SMP Short Mouth Parts
SP Spiracular Plate
SSAP Small Sub Anal Plates
SSP Sparse Spot Distribution
T. annulata Theleria annulata
T. foenum-graecum Trigonella foenum- graecum
T. orientalis Theleria orientalis
T. ovis Theleria ovis
(TBDs) Tick-borne Diseases
TBPs Tick-borne Pathogens
TEC Total Erythrocyte Count
TLC Total Leukocytes Count
VSGA V Shape Genital Aperture
xix
ACKNOWLEDGEMENTS
First of all I would like to bow my head before “Almighty Allah” the Omnipotent, the Merciful,
the Beneficial who presented me in a Muslim community and also bestowed and blessed me with
such an intelligence to complete the research work successfully. Firstly, I would like to express
my sincere gratitude to my supervisor Dr. Shabab Nasir Department of Zoology, Govt. College
University Faisalabad, for the continuous support of my Ph.D study and related research, for his
patience, motivation, and immense knowledge. His guidance helped me in all the time of
research and writing of this thesis.
Respectful thanks to my supervisory committee Prof. Dr. Farhat Jabeen; Chairperson
Department of Zoology and Prof. Dr. Tayyaba Sultana Govt. College University Faisalabad for
their insightful comments and encouragement, but also for the hard question which incented me
to widen my research from various perspectives. I offer my heartfull thanks and gratitude to my
teachers Prof. Dr Salma sultana and Dr. Azhar Rasul whose kind and remarkable suggestion
help out to complete my thesis
I am extremely grateful to my parents for their love, prayers, caring and sacrifices for educating
and preparing me for my future. Also I express my thanks to my sisters, brothers and couzins
for their support and valuable prayers. My Special thanks go to my friend Aasma Noureen who
supported me in writing and incented me to complete this thesis successfully. I am also thankful
to the Mr. Zahid and Muhammad Sufian for their cooperative behavior during my research
work. Finally, my thanks go to all the people who have supported me to complete the research
work directly or indirectly. May Allah bless all these people with happy and pleasant lives
(Ameen).
Marriam Batool
xx
ABSTRACT
Ticks are the second to mosquitoes as vectors of a number of human and animals pathogens like
viruses, spirochetes, bacteria, rickettsia, protozoa and filarial nematodes etc. Important tick borne
diseases are Crimean Congo hemorrhagic fever, anaplasmosis, theileriosis and babesiosis that
cause mortality in humans and animals. So, this study was carried out to check the prevalence of
ticks and tick borne diseases in the Punjab, Pakistan. Three districts were selected from each of
four zones of Punjab. The total 120 livestock farms were randomly selected from 12 districts, 10
farms (05 urban and 05 rural) from each district. Tick species were collected in morning and
evening during 2016 to 2017 systematically from head to tail directions with the help of small
steel forceps. The tick samples were taken to research laboratory in clean and dry appropriately
labeled plastic bottles with muslin at the top for proper aeration. In the laboratory, the process of
preservation was carried out by keeping ticks into 70% methanol. On the basis of morphology
the collected ticks were distinguished microscopically with the help of dichotomous key. For
molecular studies, ticks from each species were individually used for the extraction of DNA.
Extracted DNA of ticks was stored at ‒20⁰C. The tick pathogens were confirmed by PCR using
specific primers. Different acaricides and plant extracts were used to control ticks. Prevalence of
tick and tick-borne pathogens were tested by χ2
tests and multiple logistic regressions model
which was performed in SPSS 21. To calculate the percent mortality the data were analyzed by
probit analysis using Minitab-15 statistical software. The total prevalence of tick-infected
animals was 36.52% (4382/12,000). The prevalence of tick was significantly least in the
Northern zone (33.47%) as compared to the Southern (36.33%), Western (35.83%) and Central
zones (40.43%). The total ten tick species i.e. Hylomma (Hy.) anatolicum (25.92%), Hy.
marginatum (14.05%), Hy. dromedarii (5.62%), Hy. truncatum (2.44%), Hy. rufipes (1.79%),
Rhipicephalus (Rh.) sanguineus (16.33%), Rh. appendiculatus (12.39%), Boophilus (B.)
microplus (14.2%), B. decolratus (5.15%) and Argus percicus (2.02%) were identified. Hy.
anatolicum and Hy. marginatum were the most abundant ticks spcies in all selected zones. Argas
percicus was found only in Central zone. The overall prevalence of ticks infestation in all
animals were 36.52% and it was significantly different in all animal species, like buffaloes
(37.53%), cows (42.41%), goats (36.14%) and sheep (29.00%). The prevalence of overall
evaluations of tick-borne pathogens in all agro-ecological zones was significantly different.
Highest prevalence was found in Ehrlichia spp. (16%) followed by Anaplasma spp. (9.1%),
Theileria spp. (9.03%) and Babesia spp. (4.14%). It was concluded that there is wider variety of
ticks and tick-borne pathogens in Pakistan. In case of control experiments, extracts of selected
plant (Calotropis procera, Citrullus colocynths, Brasica rapa, Solanum nigrum and Trigonella
foenum-graceum) also showed promising results along with acaricides.
1
Chapter 1
INTRODUCTION
Pakistan is basically an agricultural country with 21.2% contribution from agriculture
sector as Gross Domestic Production. The agricultural sector is believed to be the strength of the
rural economy as it provides employment to 45% of the workforce of the country. In Pakistan,
more than 70% of the population lives in rural areas and the majority depends up on livestock for
their subsistence (Mather & Abdullah, 2015). A variety of domesticated farm animal genetic
resources are present, generally referred as livestock, e.g., animals, like poultry, camel, goat,
sheep, buffaloes, cattle, horses and donkeys (Khan, 2004). In Pakistan‟s rural economy, the
livestock plays major role. Rural population (about 30-35 million) is involved in livestock raising
which helps them to obtain their earnings from it (Zulfiqar et al., 2012; Ashraf et al., 2013). In
Pakistan the dairy sector includes three kinds of producers, based on location and herd size,
small farmers producing more than 50% of the total milk, medium-sized producers recognized as
gowalas producing 29% of the whole milk and an efficient agricultural scheme producing ~ 20%
of the whole milk is known as large-scale producers (Jabbar et al., 2015; LDDDP, 2015).
The diseases which are related to parasites of different types are the prime disorder which
badly affects the production of animals. Parasites that live inside the animals called as endo-
parasites (hookworm and tapeworm) or ecto-parasites which attack on the body surface (ticks,
fleas, midges, mites, flies) (Admassu et al., 2015). Reptiles, amphibians, birds and mammals are
infected by ticks which are mandatory blood-sucking ectoparasites (Rajput et al., 2006; Aslam et
al., 2015; Ali et al., 2016). The economic and medical significance of ticks had long been
revealed due to their ability to transfer diseases to animals and humans. In order acarina ticks
make up the largest collection of creatures and belong to phylum arthropoda (Rajput et al.,
2006). Ticks are categorized into three families i.e. (Ixodidae, Argasidae and Nuttalliellidae) but
Argasidae (soft ticks) and Ixodidae (hard ticks) are of veterinary importance (Latif et al., 2012).
Hard ticks are the 80% of the world tick creatures, with the exemption of one tick specie in
family Nuttalliellidae while the residual are soft ticks (Guglielmone et al, 2010; Latif et al., 2012;
Ali et al., 2013). In domestic animals and humans, 10% of the total Ixodid and Argasid tick
species are known to spread disease (Jongejan & Uilenberg, 2004; Ali et al., 2013). Ixodid and
2
Argasid ticks vary in range of their morphological and biological characters. Hard ticks possess
sclerotized scutum, an apical hypostome, feed for prolonged periods in all life periods. Soft ticks
have a leathery skin; feed for short periods, their hypostome is situated anterior ventrally and
does not possess scutum (Mans & Neitz, 2004; Latif et al., 2012). Nuttalliella namaqua has been
designated as the „„missing link‟‟ among the tick families because it shared characteristics of
both Ixodid and Argasid tick families (Latif et al., 2012). According to a study from different
regions of Pakistan, the most commonly reported species of ticks were Rhipicephalus
(Boophilus) microplus (Rh.), Hyalomma (Hy.) anatolicum, Hy. marginatum, Rh. annulatus and
Rh. sanguineus (Durrani et al., 2008; Ramzan et al., 2008; Sajid et al., 2008).
The host is damage by ticks in two ways; directly by tick bites and indirectly by disease
spreading (Diyes & Rajakaruna, 2015). According to their life cycle, ticks are divided into three
groups, one host ticks, two host ticks and three host ticks. One-host ticks are the tick species that
persist on the host in two molting periods. In the two host species, the ecdysis of larvae to the
nymph stage take place on the host but after blood sucking nymphs deattach from the host,
sheds on the ground and then search a new host. Larvae and nymph leave the host for molting
and again find the host for feeding in case of three host tick life cycle (Mtshali et al., 2004; Ali et
al., 2013). The spreading of ticks is cosmopolitan, but occurs mostly in tropical and subtropical
areas (Durrani et al., 2008). Ticks of Pakistan are rich in number of genera and species. Because
Pakistan is a humid country which offers favourable environmental situations for multiplication
and growth of ticks (Durrani et al., 2008). The total rate of tick infestation (about 50%) has been
detected in Pakistan. Therefore, few studies showed the prevalence of tick taxonomy, infestation
and acaricidal activity (Durrani, 2008; Sajid et al., 2008, 2009a, b; Ali et al., 2016). For impact
the resistance and receptiveness of livestock to tick infestation numerous features like age, sex,
species, breed, season, photoperiod and management are responsible (Asmaa et al., 2014).
Grazing, muddy floor and tying of ruminants were found related with high infestation of tick in
animals (Sajid et al., 2009a; Iqbal et al., 2013). Likewise, factors of the risk related with tick
borne diseases (TBDs) have also been studied hardly (Ashraf et al., 2013; Iqbal et al., 2014;
Jabbar et al., 2015). Generally, hidden parts of the animals are damaged by ticks and cause
mortality and lower productivity. The incidence of TBD has increased and produced problems
related to health, over past two decades (Kaur et al., 2015). Harmful impacts of ticks to livestock
are irritation, stress, blood loss and depression of immune function. Because of the direct
3
diseases spread into the host, ticks are highly responsible for economic losses in term of reducing
quality of cow skin from twenty to thirty percent (Sultana et al., 2015).
Now a days, the most emerging infectious diseases are caused by zoonotic pathogens and
transmitted by tick vectors. As vectors of a number of human and cattle pathogens, ticks are
second to mosquitoes (Satta et al., 2011; Gosh & Nagar 2014; Kaur et al., 2015). Tick borne
infestation is a universal problem and an important hurdle in the health and production of
livestock which cause significant financial losses (Taswar et al., 2014; Kemal et al., 2016). Ticks
are important ectoparasites that are involved in transmition of different diseases e.g.
trypanosomiasis, babesiosis, theileriosis, anaplasmosis and toxicosis (Kaur et al., 2015). They are
the significant contributors of infectious diseases and cause mortality in livestock and humans
(Kamboj & Pathak, 2013). Tick-borne disease, anaplasmosis formerly known as gall sickness is
caused by a rickettsial microorganism (Kumar et al., 2015). The Symptoms of anaplasmosis
include abortion in pregnant animals, pyrexia, jaundice, anorexia, depression, progressive
anaemia, reduced milk production and death particularly in exotic breeds (Jabbar et al., 2015).
The theileriosis is transmitted by certain Ixodid ticks such as Hy. anatolicum anatolicum, Hy.
marginatum marginatum and Hy. anatolicum excavatum (Durrani et al., 2008; Kaur et al., 2015;
Akbar et al., 2014). Clinical indices of oriental theileriosis frequently comprise, jaundice,
lethargy, pyrexia, anaemia, weakness, mortality and miscarriage in female cattle (Aparna et al.,
2011; Islam et al., 2011). Babesiosis is also called the red-water disease and is caused by
different species of genus Babesia (Akbar et al., 2014; Jabbar et al., 2015). Major symptoms of
babesiosis include haemoglobinuria, anorexia, high fever, depression, icterus, abortion in
pregnant cows, and death may occur in serious cases (Durrani et al., 2008; Atif et al., 2012; Ali
et al., 2013; Jabbar et al., 2015). Due to ticks and tickborne diseases (TTBDs) the global loss was
expected to be between US$ 13.9 and 18.7 billion yearly (Gosh & Nagar, 2014). Economic
losses to animals production caused by ticks which affects the hosts in numerous methods such
as deterioration of the quality of skin, loss of blood and by transferring various viral and
protozoan diseases to other livestock (Ashfaq et al., 2015). Very few studies related to tick-borne
pathogens were done (Khan et al., 2013). So, there is a need to use modern tools like PCR for the
recognition of TBDs (Karim et al., 2017).
4
In Pakistan especially in Punjab; being the largest province with respect to the population
there is need to manage and control the ticks and TBPs (Nawaz et al., 2015; Adenubi et al.,
2016). In the world different chemical acaricides i.e. chlorinated hydrocarbons, synthetic
pyrethroids, organophosphates, formamidines and macrocyclic lactones have been used in order
to control ticks. But there are many disadvantages of using acaricides such as long residual effect
on milk and meat are risk for human health. These acaricides also contaminate environment and
water, so effects the non-targeting organisms (Brito et al., 2011; Gosh et al., 2015; Nawaz et al.,
2015). These issues urge the usage and promotion of substitute tick control resources. To control
ticks, many plants have been traditionally used worldwidely. Medicinal plants represent the most
prevalent and ancient form of medication (Nawaz et al., 2015). Because the plants are
environment friendly and have no residual influence. Plants material are the cheap source of
control and easily available to the poor owner of livestock.
Almost 80% of the world populations depend on old-style medicines for their health
which was assessed by the World Health Organization (Kharb et al., 2004; Sindhu et al., 2012).
Herbal drugs have commonly been used in the form of fruits and vegetables, and their extracts
can cure the diseases and care for health (Ullah et al., 2016). Therefore, the following plant
species were used in study to control ticks. Calotropis (C) procera L. is a perennial shrub, soft
wooded and is present in Pakistan, India and in other countries such as tropical Africa, Egypt and
Afghanistan (Najar & Khare, 2017; Shyma et al., 2014). It is usually recognized as “auk” in
Pakistan. The leaves and flower of this plant contain phytochemical compounds such as
alkaloids, flavonoids, terpenoids and saponins (Najar & Khare, 2017). The plants have been
described to keep anti-culex and anti-anopheles activity of mosquito (Elimam et al., 2009), anti-
mite, anti-acaricidal activity (Gosh et al., 2011; Iqbal et al., 2012; Shyma et al., 2014) and
repellant effects (Iqbal et al., 2012). C. procera is recognized to comprise cardiac glycosides that
are toxic to ticks (Al- Rajhy et al., 2003). Citrullus (C) colocynthis (L) is known as “bitter apple”
(Gurudeeban et al., 2010). In Pakistan and India, it is identified as “tumba” (Mahajan &
Kumawat, 2013; Hussain et al., 2014; da Silva & Hussain, 2017). The seeds of C. colocynthis
have nutritive qualities while the fruit pulp has therapeutic properties. Its fruit has been
commonly applied for the remedies of several infections comprising ulcer, diabetes, rheumatism,
paronychia and cancer. Because it is a high source of functionally significant therapeutics and
5
bioactive composites like triterpenes, cucurbitacins, glycosides and polyphenols (Hussain et al.,
2014) and anti-parasital (Farooq et al., 2008).
Trigonella (T) foenum-graecum L. belongs to the family Fabacecae. It is commonly
known as “maithe” in Pakistan and India. It is a legume widely cultivated in most areas of the
world due to its medicinal importance (Kor et al., 2013). This plant contains active components
such as alkaloids, flavonoids, steroids, saponins (Ullah et al., 2016). It is recognized to have
hypocholesterolaemic and hypoglycemic effects (Joshi & Rajni, 2007). It was also reported for
anti-inflammatory, anti-cancer (Hibasami et al., 2003), anti-diabetic and antioxidant effects (Kor
et al., 2013). Brassica (B) rapa commonly is known as “shaljam” in Pakistan. It belongs to
cruciferae family. It contains phytochemical compounds such as alkaloids, carbohydrates,
proteins and vitamins (Dinesh & Gopal, 2014). The stem and leaves are used in the treatment of
cancer (Coventry, 1923) its root barks have a natural insecticide that is effective against red
spider mites, aphids and flies (Allardice, 1993). Solanum (S) nigrum commonly is known as
“makoi” in Pakistan. It is native to Eurasia but widely distributed in American continent, Asia,
Australia, Europe and Africa. It has anti-inflammatory, anti-hyperlipidemic, antiseptic diuretic,
diaphoretic and antioxidant effects (Sindhu et al., 2012; Gosh et al., 2011).
There is still a deficiency of effective effort to examine distribution and incidence of
species of ticks causing livestock in Pakistan (Durrani et al., 2008). A number of the earlier
revealed research were limited to a lesser zone and did not study agro-ecological areas, sampling
strategies and manufacture organizations that are all aspects which can influence the ticks
prevalence and tick borne diseases (Jabbar et al., 2015). Furthermore, till now, there is no
research from Pakistan that discovered the recognized species of ticks from all over the Punjab,
Pakistan. It is hard to acquire precise and specific facts to plot the current prevalence and
spreading of ticks and TBPs. There is the lack of facts related to the prevalence of TBPs,
population dynamics and control of ticks.
Hypothesis
“The prevalence of ticks and tick-borne diseases varies regionally and plant extracts have
potential to control ticks and tick-borne diseases.”
6
Therefore, the present study was planned to investigate the prevalence of ticks, tick borne
pathogens and their control through acaricides and medicinal plants to attain the following
objectives
(i) Distribution of ticks across various topographical zones of the Province, Punjab.
(ii) Determination of potential of ticks in carrying pathogens of veterinary and public health
significance using advanced molecular tools.
(iii) Testing the efficacy of different commercial acaricides and plant extracts.
7
Chapter 2
REVIEW OF LITERATURE
Ticks are ectoparasites that are vectors of many animalas and human diseases. So, this
project was prepared to know their prevalence after identification of different tick species on
different animals, their control with acaricides and plant extracts and identification of pathogens
they carry in various agro-ecological zones of Punjab, Pakistan. This chapter comprising of the
following sections;
2.1 Prevalence and identification of ticks
2.2 Tick-borne pathogens and diseases
2.3 Use of acaricides and medicinal plants to control ticks
2.1 . Prevalence and identification of ticks
Rehman et al. (2017) conducted a research to find out the risk causes related with
abundant prevalence of tick in farms of animals and the distribution of ticks infesting ruminants
in the dry and semi-dry agro-ecological zones of Pakistan. Ticks were collected from nine
districts, 108 livestock farms and counted from 471 animals, comprising 194 buffaloes, 179
cattle, 18 sheep and 80 goats, including both arid and semi-arid agro-ecological regions. About
3,807 tick indicating four species were collected: Rh. microplus, Rh. turanicus, Hy. dromedarii
and Hy. anatolicum. For the first time, these species were reported from the study area. In the
arid regions Hy. anatolicum was the most plentiful species, while in the semi-dry regions Rh.
microplus was the predominant species. The rate of tick infestation in ruminants was 78.3%.
Examination of questionnaire statistics revealed that the higher tick prevalence in animals farms
related with the lack of rural poultry, not use of any acaricides, grazing and rural housing
systems were possible risk factors. They concluded that present study can be beneficial in the
arrangement of incorporated control methods for ticks and TBDs in Pakistan.
Riaz et al. (2017) carried out a study to check the variety and seasonal spreading of hard
ticks in goats and sheep by epidemiological survey in Multan (Pakistan). The collection of ixodid
ticks was done from randomly selected animals and on the basis of their morphological
characters identification of ticks was done. The results revealed that the rate of infestation of tick
observed in small ruminants was 48.0%. Sheep were mainly affected by ticks (50.0%) than goats
8
(43.6%). The prevailing tick species were Hy. anatolicum (52.2%) and Rh. sanguineus (17.4%).
The mixed infection in small ruminants observed was (30.4%). The tick prevalence in sheep and
goats varies according to age, sex and breed. The result revealed that tick prevalence was noted
maximum in Summer with respect to Winter season. They concluded from the study that more
infested sites were internal ear and external ear in sheep similarly internal ear was the most
infested site in goats.
Ali et al. (2016) carried out a study in river Ravi (Lahore) to illustrate epidemiological
characteristics of bovine infestation of tick. To check the tick infestation in bovines, they
examined about 532 buffaloes and 726 cattle. In cattle and buffaloes, the most prevalent tick
genera are Hyalomma and Boophilus. In bovines, the observed more affected gender were
females than males. According to age group the adults and youngs were more affected than old
in cattle and buffaloes. They concluded from the result that in bovines, the most appropriate
climatic conditions for ticks were Summer as compared to Winter, Spring and Autumn.
Kemal et al. (2016) carried out a study to find out the tick infestation rate and the related
risk factors in district Arbegona (Southern Ethiopia). About 2024 adult ticks were collected and
eight ticks species from three genera were recognized. A feedback form was also employed. The
results revealed that the incidence of infestation of tick was found to be statistically significant in
good, medium and poor body situation animal. They conclude from the result that the higher rate
of tick infestation was responsible for decreasing output, economic losses and causes harsh
effects on health of cattle.
Admassu et al. (2015) conducted a study in Dangila district (North West Ethiopia) to
estimate the infestation and identification of major Ixodid tick genra of cows. The tick infestation
rate was (56.2%) from randomly selected cattle. From the animal body parts, about 864 adult
ticks were collected, preserved with 70% alcohol and stereo-microscope was used to identify
upto genus level. Four genus namely; Hyalomma, Boophilus, Amblyomma, and Rhipicephalus
were identified from the total collected ticks and account for 37.5, 25.0, 23.1 and 14.4%,
respectively. Highest incidence of tick infestation was recorded in deprived body situation
livestock (62.9%) as compared to medium (59.4%) and good body situation (41.2%). They
9
concluded from this study that the prevalence of ticks can also be responsible for spreading of
TBDs and also cause physical damage to the skin.
Gharekhani et al. (2015) worked in Hamedan province, Iran on the identification of
Ixodid tick species on cattle and sheep. In 3 rural regions during the year of 2010 to 2011
sampling of tick was done on the complete body of sheep and cow. A total of 1534 hard tick
were collected in animals through which 62.1% were male and 37.9% female. The observed tick
infestation rate was in cattle ascompared to sheep. The results revealed that the dominant hard
tick species is Hy. marginatum.
Kaur et al. (2015) conducted a study on incidence of Ixodid ticks attacking cows and their
control through extracts of plant. Out of 2150 cattle, 1262 cows were found infected with ticks.
On the basis of seasonal trends, in rainy season rate of infestation of tick was higher as compared
to Summer and Winter. The prevalence of infestation of tick was found greater in female cows
than males. Ticks identification was carried out on the basis of their morphological characters,
identified ticks are Rh. microplus and Hemaphysalis bispinosa out of which the Rh. microplus
was rich. Due to acaricidal disadvantages like high cost, toxic to environment, non-
biodegradable, left residuals in animal body and above all development of resistance in ticks.
They concluded the importance of plant-based, effective anti-tick agent and less toxic, twenty
plants were selected in the present study that was used as anti-tick agent.
Ganjali et al. (2014) worked on the diversity of tick family Ixodidae and their distribution
in Iran. For this purpose, they randomly selected ticks from camels, cattle, sheep and goats. The
collected ticks were stored in 70% ethanol and examined under stereomicroscope for
identification. The results revealed that the presence of, Hy. Marginatum, Hy. dromedarii, Hy.
Schulzei Hy. anatolicum excavatum, Hy. asiaticum asiaticum, Hy. anatolicum anatolicum, Rh.
turacunis, Rh. bursa and Rh. sanguineus. They concluded that more investigations are important
to reveal the contribution of above tick species as vectors of different diseases.
Musa et al. (2014) conducted a research in Maiduguri (Nigeria) to check the incidence of
infestation of tick in different breeds of cows. The identified tick species from 205 cattle were
Boophilus microplus, Hyalomma spp, Rh. sanguineous, Amblyomma variegatum and
Ornithodorus spp. The tick infestation rate was significantly higher in males than females. In
10
Wadara and Kuri breed tick infestation was significantly higher. Under the tail/perineum, inner
thigh, external genitalia and the udder were the most tick-infested predilection sites. The
prevalence of tick infestation was lower in ears, eyes, neck, and all over the body. They
concluded through this study that prevalence of tick infestation among indigenous cattle was
high. It could hinder the rate of productivity and cattle production in Nigeria.
Soomro et al. (2014) carried out a study in the upper Sindh, Pakistan to estimate
incidence of ticks in buffaloes. The research was conducted related to host (age and species) and
study area to recognize and to calculate difference in the incidence of bovine infestation of tick.
Random selection method was adopted to collect samples from Kundi buffaloes. Main tick genus
was Hyalomma followed by Rhipicephalus. The rate of tick infestation in calves less than one
year was significantly higher than the adult livestock one to two years and greater than two years
livestock. Though, the location of the district was not related with the prevalence of tick
infestation. They concluded from results that the prevalence of ticks helps to understand for
development of the tactical and planned ticks control in local types of dairy animals.
Chhillar et al. (2014) conducted a research to check the prevalence of Ixodid ticks on
domestic cows and buffaloes in Haryana, India. A number of 867 ticks were gathered and
examined from 662 animals and the out of which 309 were affected with ticks of Ixodidae family
which belonged to three different genera. Identification of tick species of the three genera were
Rh. sanguineus (Latreille, 1806), Rh. (Boophilus) microplus, Rh. decoloratus, Hy. anatolicum
anatolicum, Hy. anatolicum excavatum and Dermacentor spp. They concluded from the study
that the most prevalent species of vector which affected cattle and buffaloes in this region were
Hy. anatolicum anatolicum and Rh. microplus. The periodic ticks prevalence and the related
management applications provided the basis for level of infestation.
Sharifinia et al. (2014) conducted a research in South West of Iran to show the existence
of hard tick and CCHF. In both fields of veterinary and medicine, many important arthropod-
borne diseases are caused by ticks, such as CCHF, Rocky Mountain spotted fever, lyme,
tularemia and as well as some types of encephalitis. Ticks were collected to identify the viral
infection and fauna of the hard ticks in livestock by random sampling. PCR method was
subjected to a sample of ticks for detection of viral infection. Ixodidae ticks (592) were collected
11
during the study period and seven known species i.e. Rh. sanguineus, Rh. bursa, Hy. dromedarii,
Hy. marginatum, , Hy. asiaticum, Hy. detritum and Hy. anatolicum were used for the detection of
the genome of CCHF virus, more than 20% of these ticks were examined. Through which 6.6%
species were found positive such as Hylomma. CCHF disease caused by hard ticks mainly infects
the large number of livestock. It is concluded from the result that all five species of Hyalomma
should act for the utmost CCHF vector. Precautionary measures could be used to overcome the
animal infestation and to diminish the transmission of CCHF on the basis of seasonal activity of
Ixodidae.
Patel et al. (2013) carried out a work on the economic effect of many tick species on
livestock. The research was conducted from July 2010 to June 2011 for observing the common
ticks.The overall prevalence of tick infestation rate was reported 60.07 % in cattle. The lowest
prevalence was observed 46.07% in January while the highest was recorded 75 % in September.
In Summer higher rate infestation of tick was observrd than in Winter season. According to age
the incidence of tick infestation was examined more in the animals of one year as compared to
the animals having age between one and three years. Similarly it was observed lowest in the
animals of animals of more than 3 years. Two tick species were recognized on the source of
morphological chracters i.e. Hy. anatolicum anatolicum and Boophilus microplus.
Katuri et al. (2013) worked on the investigation of site preference for the Ixodid ticks.
They gathered ticks out of 927 buffaloes and 1473 Cattle of four distinct villages, growing up
under unorganized farming and open grazing system. In both cattle and buffaloes, occurrence of
Rh. microplus was more than 50% of the ticks which is mostly found in abdomen followed by
neck in both cattle and buffalo. The dual infestation rate occurs 16% in cattle and 3 % in
buffaloes.The results were useful to determine the tick infestation rate in bovines based on their
site of predilection.
Singh and Rath (2013) planned a study in Punjab state (India) on epidemiology of hard
ticks in (N=4459) cows population belonging to eighteen districts of five foremost agro-climatic
areas from both sex and all age groups. The general prevalence of hard ticks and mix infestation
were Rh. microplus 58.06% and Hy. anatolicum anatolicum 50.16%. Highest rate of prevalence
Hy. anatolicum anatolicum and Rh. microplus were observed in sub mountain undulating region
12
(79.36%) and Western region (20.40%) correspondingly, between the several agro-climatic
regions. The results showed that Rh. microplus mainly existed in hot and humid environment
whereas, Hy. anatolicum anatolicum prefered arid and semi-arid environment. Through the age
wise distribution of groups, in calves having less than six months of age tick infestation rate was
maximum than six months to one year age group and minimum in greater as compared to one
year age group (55.02%). The observed infestation rate of ixodidae ticks was significantly higher
in males. They concluded that this study provides effective approach to control the ticks
management in bovines of the area.
Khan et al. (2013) studied different areas of Khyber Pakhtunkhwa, Pakistan to check the
prevalence of infestation of tick in buffalo and cattle. The present study was done on the basis of
two groups of climate; cold mountainous zone at an elevation of 1110m and hot dry zone at an
average of 500m beyond the sea level. In the same season at the different altitude, about 1223
(48.35%) cattle and 1306 (51.65%) buffaloes were observed and infestation of tick was
examined. Through the observation, consequences revealed that in the hot dry zone, the
infestation of ticks was higher at the lower elevations as compared to the cold hilly zones at
higher altitudes.
Perveen (2011) carried a study in the Northern, Pakistan to detect the dissemination and
identification of Ixodidae species on cattle. The most abundant species of tick was Amblyomma,
Boophilus microplus, Hyalomma dromedarii and Hyalomma anatolicum. However, cows were
subjected more at risk than buffaloes and ticks infestation rate was ranked third. Moreover,
buffalos, cows, sheep and goats harbored had more than one type of ticks, similarly, camels and
donkey harbored had only one type of tick. It is concluded from the result that this research will
help the farmers to increase farm productivity and will be aided in taking effective methods to
diminish infestation of tick and to improve controlling practices.
Durrani and Shakoori (2009) carried out a study to determine the optimum rearing
temperature and relative humidity for cows ticks Hyalomma in Punjab, Pakistan. From each
district they collected one hundred ticks of different genera. After identification the ticks of
Hyalomma genera were raised in research lab under the impact of moisture and variable
temperature. The incidence of Rhipicephalus (3.1%) and Hyalomma (12%) ticks in cattle were
13
observed. The bionomical study illustrated that during Spring pre oviposition period was longer
but in Autumn it was lowest. The egg production rate was higher at 34 0C and lowest at 15
0C.
The process of eggs hatching was maximum at 32 0C and 85% humidity. They concluded from
this study that the maximum numbers of eggs were produced with the rise in temperature while
the rate of development of ticks was not affected by variation in relative humidity.
Durrani et al. (2008) worked on bionomics of Hyalomma ticks in three different districts
of Punjab, Pakistan. In cattle, the observed lowest prevalence of Rhipicephalus was 3.1% and
highest prevalence of Hyalomma ticks was 12%. The study illustrated that preoviposition period
was maximum in Summer and minimum in Autumn. Variation in the development period of the
egg of Hyalomma occurred from season to season. At the temperature 1000C and 85% humidity
no oviposition was recorded. The rate of egg production was higher at 34 and lower at 150C. At
320C and 85% humidity, the process of eggs hatching was maximum .PCR test was used to
confirm Theileria infestation in the gut of ticks which demonstrated the lowest prevalence
(20.8%) for Hyalomma marginatum while it was highest (86.6%) for Hyalomma anatolicum.
Sajid et al. (2008) worked on the rate of hard ticks infestation in local ruminants of lower
Punjab, Pakistan. The purpose of this study in lower Punjab (Pakistan) was to find out the variety
and concentration of tick population infecting domestic animals. Randomly selected 700
buffaloes, 1050 cattle, 250 camels and 1400 goats and sheep were observed for the infestation of
tick. The recorded tick rate of infestation was greater in cows than in goat and buffaloes.
Hyalomma anatolicum was found in large number than Rhipicephalus sanguineus. They
concluded that effective measures were needed to control tick infestation rate to overcome the
economic losses.
Manan et al. (2007) carried out a research in boundary part of Peshawar to find out the
occurrence of Ixodid tick genra. In Parasitology Laboratory of Veterinary Research Institute,
Peshawar ticks were recognized for their types. They recorded that the infestation of tick was
influenced by status of body situation, month, age, effect of acaricides after treatment, housing
and feeding systems. The most prevalence of ticks were from genus Boophilus as compared to
Hyalomma, Rhipicephalus and Amblyomma. They concluded from the result that the infestation
of tick was more in late Summer and less in Winter. But they found that there was non-
14
significant impact of age, status of body situation and effect of acaricides after treatment on the
prevalence of ticks. Most of the ticks were found in tropical and subtropical areas during spring
and summer season. Most abundant tick species were found Boophilus microplus, Hyalomma
anatolicum and Hyalomma dromedarii. Highest prevalence was showed in cows followed by
buffaloes and prevalence was associated with sanitation of animals.
2.2 Tick borne pathogens and diseases
Karim et al. (2017) carried out a work on ticks and TBPs in livestock Pakistan. Samples
were morphologically recognized. Nineteen various species from three significant Ixodid tick
genera (Hyalomma, Haemaphysalis and Rhipicephalus) and couple of soft tick genera (Argas
and Ornithodorus) were detected. Out of these species of ticks, using a 454-sequencing stage the
bacterial diversity was determined by bacterial 16S rRNA gene sequencing. The remarkable
genera of bacteria were detected including, Corynebacterium, Rickettsia, Lactobacillus,
Lactococcus, Ralstonia, Clostridium, Enterobacter, Enterococcus and Staphylococcus. They
found 10% of total ticks were affected with rickettsial-specific amplicons. Evidence of infection
was observed in only Hy. dromedarii, Hy. anatolicum and Rh. microplus by using a quantitative
PCR (qPCR) assay. They concluded from the study that variety of pathogenic bacteria and ticks
in different tick species were present in Pakistan. Their results revealed confirmation for
T.annulata and Candidatus R. amblyommii infection in Hy. anatolicum, Hy. dromedarii and Rh.
microplus.
Hossain et al. (2016) worked on the prevalence of ecto-parasitic infestation in cows from
milk hut parts of Bangladesh. For this purpose they examined 400 cattle for ectoparasite from the
study zone. The result showed that the rate of prevalence was maximum in Rhipicephalus
sanguinus with respect to Boophilus microplus, Haematopinus eurysternus and Linognathus
vituli. They studied that in female the rate of infestation was significantly higher than male. The
ecto-parasitic infestation in weak animals was more common as compared to ordinary healthy
cattle. They also found that the prevalence was significantly higher in rainy season than Summer
and Winter.
Khan et al. (2016) carried out a research to find out the occurrence of Babesia (B.)
bigemina and B. boves in house hold dairies of district Bannu and Lakki Marwat, Southern part
15
of Khyber Pakhtunkhwa, Pakistan. They collected blood samples for a period of one year. They
examined thick and thin smear of blood in light microscope. The results revealed that total
prevalence of babesiosis were positive for B. bigemina and B. boves. They concluded that this
disease was more prone in Summer season than other season of the year.
Memon et al. (2016) conducted a research to check the epidemology of Theleria annulata
and its influence on buffaloes by clinical findings and microscopic examination in semi-urban
and city parts of Hyderabad, Pakistan. A number of 2400 buffaloes, 1845 were found infected
with ticks, 970 in semi-urban and 875 in urban areas of Hyderabad. By Giemsa-stained method,
out of 1845 tick infested bovine samples, 1680 were found positive for Theileria species. They
observed that infected buffaloes have clinical signs such as temperature, anorexia, lymph node
enlargement, loss of hair, open mouth with difficulty in breathing, projection of eyes, redness of
skin and feebleness. But, during the survey suspected buffaloes showed normal feed intake,
urination and defecation. In the peri-urban areas the incidence of the parasitic infection was
significantly higher as compared to urban areas. The result revealed from the study that peri
urban buffaloes were more vulnerable to theileriosis than the urban buffaloes. They concluded
from the hematological studies that Theileria annulata in buffaloes produced significantly effect
on erythrocyte and leukocyte indices, while, platelet indices remained unaffected from Theileria
annulata in buffaloes.
Demessie and Derso (2015) reviewed different microorganisms and ticks that caused tick
borne diseases. Babesiosis, anaplasmosis and theileriosis were most significant tick borne
diseases in ruminants in tropics zones. The pathogens Anaplasma marginale causes anaplasmosis
that is a rickettsial disease of blood. Babesiosis and theilerioses are tick- borne protzoal diseases
produced by the genus Babesia and Theileria. These diseases have world-wide distribution
affecting numerous species of mammals with a highest effect on cows. They observed that
ruminants with tick borne diseases had problems like reduce meat and milk production, cattle
type with greater genetics, mortality and vulnerable rise in miscarriage in addition to expenses
for cure and control efforts are demolishing the profits of cattle owner and population. They
concluded from the review that effective measures of tick borne diseases of animals were useful
to apply suitable precautionary and control measures.
16
Kumar et al. (2015) conducted a research in Jalandhar District of Punjab (India to check
the prevalence and seasonal occurrence of theleriosis in cows). For this study, 620 samples of
blood were gathered and identified.The overall incidence of theileriosis (9.35%) was noted by
Microscopic study of blood smears. They concluded from the study that the maximum
prevalence was recorded in Summer season.
Jabbar et al. (2015) conducted a study on bovines tick-borne diseases in Pakistan. This
present study briefly described a key on bovine TBDs and identified the breaks in knowledge of
bovine TBDs in Pakistan and understanding of these diseases and provided information to
improve instruments for the analysis and to regulate TBDs in this state.
Wamuyu et al. (2015) conducted a study for the molecular finding and characterization of
theileria that infects Connochaetes taurinus in the Maasai Mara National reserve (Kenya). The
main hosts of many species of Theleria are wild animal. In a few species including buffaloes, the
molecular description and identification of theileria has been studied. To distinguish the
relationship of the 18 small subunit of rRNA with known species of theleria, molecular-genetic
and phylogenetic analysis are used. It is revealed through the results that Connochaetes taurinus
were infected by three new theileria haplotypes. This research was conducted to check the
probability of theleria transmission between small domestic ungulates (sheep and goats) and
wildebeest.
Saad et al. (2015) worked on the zoonotic significance and prophylactic measure against
babesiosis. Large number of mammals was being affected by babesiosis worldwide that is a
vector borne infection produced by the different species of genus Babesia. All over the world,
babesiosis has zoonotic significance causing health hazards in human population and huge loss
to livestock industry. Ixodid ticks are the primary zoonotic vector of babesia. Prophylactic
measure against babesiosis in early times was delayed but due to development in research,
vaccines and the anti babesial drugs have been developed. This review highlights on rural
communities, the awareness of public sector, owners of animal husbandry and health department
about the risk of disease in KPK and control measure should be applied. Vaccines of low cost
should be designed for the prevention of babesiosis in cattles and human population.
17
Iqbal et al. (2014) conducted a study to check the incidence and effects of ectoparasitic
fauna on infesting goats in the district Toba Tek Singh, Punjab, Pakistan. They found the variety
of ectoparasites like ticks, lice, fleas, mites and flies. The prevalent species of ectoparasites were
Hy. anatolicum, Rh. microplus, Ctenocepahlides felis, Ctenocepahlides canis, Haematopinus
spp. , Damalinia spp. , Linognathus spp. , Psoroptes ovis, Sarcoptes scabei and Hypoderma ovis.
The prevalence of ectoparasites was not directly related with type of host, sex and age. During
Spring and Summer season the maximum frequency distribution of ticks and flies was examined,
while during the season of Winter the maximum prevalence of mites, fleas, and lice was
observed. Evaluation of biochemical parameters exhibited higher values in positive animals,
while a decrease was observed in hematological parameters due to infestation. They concluded
that the current study has important role for organizing effective measures to control
ectoparasites.
Javed et al. (2014) carried out a study in and around Lahore, Pakistan from March 2012
to February 2013 to check the prevalence and hematology of tick borne haemoparasitic diseases
in equines. Theileriosis was the most prevalent TBHD followed by anaplasmosis, babesiosis and
mixed infection in horses. Babesiosis was the most prevalent TBHD followed by mixed
infection, anaplasmosis and theileriosis in mules. It was revealed through statistical analysis that
species of TBHDs show significant difference among each other. All the equines showed that
due to tick infestation there was a remarkable increase in total leukocytes count (TLC) values
and slightly increase in total erythrocyte count (TEC) values from the healthy equines while
packed cell volume (PCV) remained in the normal range in horses and mules with a significant
association between them but PCV values slightly increased in donkeys with significant
difference in the values. In mules and donkeys, there was an increase in haemoglobin values but
decrease in horses than the healthy equines. The result revealed that there was a remarkable
difference in TLC and Hb values of all equines than the normal values of equines according to
the statistical analysis.
Sajid et al. (2014) carried out a research to find the occurrence in 700 buffaloes and 836
cows and risk issues for anaplasmosis in the populations of cows and buffaloes in the district
Khanewal, Punjab, Pakistan. To check the epizootiology of anaplasmosis, conventional optical
microscopy of Giemsa‟s stained blood films was used. The allocation of anaplasmosis, with an
18
overall prevalence was more in calves, females and buffaloes related to adults, cattle and males,
correspondingly. In studied animal population, anaplasmosis was observed and related with the
housing system, animal custody, breed, season and hygienic administration. Through this work
evidence of first report of anaplasmosis was collected about this region. They concluded from
the results that the data will not provide information to the dairy growers to adapt agricultural
practices however also will not provide effective measures to control the problem in the cattle
population of the district. To examine the anaplasma from haemoprotozoa such as Babesia and
Theileria, modern molecular tools are recommended.
Chen et al. (2014) worked on TBPs and related co-infections in Central China from ticks
of domestic animals. From April to December 2012, collection of ticks was done from domestic
animals including sheep, cattle and dogs from 10 villages of Xinyang. PCR and sequence
analysis were applied to check the TBPs and identifcation of ticks. About 308 ticks were
collected for the identification of tick and tick-borne pathogens. They concluded from the results
that ticks were abundant with both animals and humans pathogens. In these regions animals and
humans were at a high risk of piroplasmosis.
Bursali et al. (2013) carried a research to study the infestation of tick rate in humans in
the provinces of Kelkit Valley (Turkey). In this region, there was no taxanomic information
available about the tick species that infests humans. During the survey, 1,460 ticks were gathered
from humans who were infested by tick. In this region, a number of 19 species of ticks have been
identified on humans comprising 7 Hyalomma, 3 Rhipicephalus, 2 Haemaphysalis, 2 Argas, 2
Ixodes and Dermacentor species. For the first time, the prevalence of Dermacentor reticulatus
on humans was examined in Turkey.
Liyanaarachchi et al. (2013) worked on the particular zones of Sri Lanka to check the
epidemiology of ticks in farm animals. The main purpose of this work was to screen out the
variety of tick in farm livestock from particular parts of Sri Lanka. Moreover, the probability of
the overview of species of ticks into livestock from wild animals was also studied. During the
years 2009 and 2010, ticks were gathered in 30 places in the damp area and 30 places in the arid
area. In this study 18 tick species were recorded, representing a reasonable increase in tick
19
species described in animals in Sri Lanka. They concluded that unusual species of ticks were
found in livestock, which has been earlier stated only on wild livestock.
Ali et al. (2013) carried a research on cows and buffalo in Punjab, Pakistan to check the
epidemology of Theileria Annulata (Ixodid ticks). The ticks were collected from 30 animal farms
containing more than 25 animals (cow and buffaloes) in each. From 710 cattle and 320 buffaloes,
about 6263 ticks were collected. The epidemology of Hyalomma species was considerably
higher as compared to other genera of Ixodid ticks (p>0.05). The rate of infestation of ticks in
buffaloes (34%) was considerably lower as compared to cattles (70%). PCR outcomes revealed
that Theilleria annulata was identified in 40% Hy. dromedarii and 50% Hy. anatolicum ticks.
They concluded that species of Hyalomma are chiefly responsible for spread of Theilleria in
dairy animals.
Atif et al. (2013) conducted a research in three diverse districts of the Northern Punjab,
Pakistan to investigate seroprevalence of Anaplasma marginale infection between cows.
Multistage cluster random selection method was used to gather 1050 samples from selected
small frames and private animals farms. The competitive enzyme-linked immuno sorbent assay
(cELISA) was used to determine the prevalence of Anapalsma marginale infection. Between
dissimilar age groups and breed a significant relationship was found. In all studied districts, the
seroprevalence was significantly higher in small frames than private animals farms. They
concluded that Anaplasma marginale infection was more vulnerable to small holder‟s hybridized
cattle of more than four years of age in Summer season.
Shams et al. (2013) conducted a study in domesticated cattle of Khyber Pakhtunkhwa,
Pakistan to illustrate the specificity and sensitivity of PCR & microscopy in recognition of
babesiosis. From animal hospitals of district Karak and Kohat in Khyber Pakhtunkhwa Pakistan,
six hundred blood specimens of clinically supposed cattle were collected. Examination of thick
and thin smear slides was carried out through microscope. Through PCR using species specific
primers, extracted DNA from serum was amplified. Analysis of augmented product was done
after electrophoresis in ultra violet transilluminator. General incidence of Babesia was maximum
in cows (34.4%) as compared to cattles (27.5%) and calves (20.6%). Similarly through
microscopy overall prevalence was observed higher in cows as compare to cattle and calves.
20
They concluded from the study that PCR was more effective technique to detect babesiosis than
microscopy and suggested it for practical usage in Khyber Pakhtunkhwa Pakistan. To increase
the productivity of domesticated cattle definite measures shoud be taken out.
Atif et al. (2012) worked in Sargodha District, Pakistan to check the prevalence of
Anaplasma marginale, Babesia bigemina and Theileria annulata infections between cows. In
each month, samples were randomly gathered from particular small holders having 30 cows and
private animal farms having more than 50 cattle. The samples were gathered of indigenous and
hybridized cows of both sexes. A complete prevalence of haemoparasites 26.86% was revealed
by microscopic observation of the Giemsa stained blood smears. The infestation of Anaplasma
marginale was more than Theileria annulata and Babesia bigemina, respectively. Crossbred
cattle (29.1%) were more at risk of tick-borne diseases than the indigenous cows (17.7%).
Gender wise prevalence showed that female cows were more susceptible to TBDs as compared
to males. The transmission of tick borne diseases was higher in small holders as compared to
large animal farms. Through the Chi square analysis, association among selected tick borne
diseases and different breeds, season and farm size was observed. This research showed that
TBDs are predominant in the Sargodha district, Pakistan.
Moges et al. (2012) carried out a research in Chilga district, Northwest Ethiopia to show
species composition of hard ticks, change in climatic conditions and their distribution on cattle.
About 922 adult ticks were gathered and identified eight species from four genera. The most
abundant species of tick was Amblyomm variegatum while Amblyomm lepidum being the least
abundant. The quantity of ticks per cows was recorded smaller throughout the arid month while
the highest number was observed in the rainy season. Ticks distribution was more in dissimilar
body parts of the host like udder, groin, ear, mammary gland, neck, tail and anal part of which
udder; dewlap and tail areas were the main infected areas of the body as compared to face and
neck. Effective measures should take into account to diminish problems of tick infestation of
cattle.
Naz et al. (2012) carried out a work in Lahore-Pakistan to find out the epidemology of
theileriosis in small animals. To determine the incidence of theileriosis, a number of 529 animals
were chosen. Samples 59/529 were positive for theileria on microscopic investigation. The
21
incidence of Theileria spp. was recorded higher in sheep as compared to goats. Theileria
infection in goat was not affected by age sex and season. Age, season and sex had major effects
on theileria infection in sheep. Pyrexia was detected in about 85.71% sheep and 78.95% goat.
Singh et al. (2012) conducted a research in and around Ludhiana district (Punjab) to
check the prevalence of canine hepatozoonosis. From canines a number of 532 samples of blood
were gathered and observed during current study with the historical continual of high fever
existing at small veterniary clinics, Ludhiana, (Punjab). Gimsa stained technique was used to
examine the blood samples, peripheral blood smears exposed that 1.13% (6/532) of canines was
infested with hepatozoon canis that prevalence varies with dissimilar age groups. It was
concluded that the infestation of the parasite was comparatively maximum in females as
compared to male dogs.
Zulfiqar et al. (2012) worked in Southern Punjab for the identification of Babesia (B.)
bovis in blood specimens and its influence on the large ruminants. From Southern Punjab, six
districts including, Layyah, Multan, Bahawalnagar, Bhakar, Muzaffar Garh, and Vehari, from
large animals (144), containing cows (105) and buffaloes (39) blood samples were collected.
Through questionnaires, statistics on the qualities of animals and herds was gathered. Various
samples of blood and serum of calves and cows were calculated and compared with positive and
negative specimens for determination of the influence of B. bovis on the blood and serum profile
of infested ruminants. For B. bovis, 541-bp specific fragment were produced from 5 out of 6
sampling districts. They concluded from this study that it reveals the incidence of B. bovis first
time in large ruminant and this study will help to increase the livestock output by preventing the
disease babesiosis in the region.
Alim et al. (2011) carried out a study in Chittagong division, Bangladesh to check the
occurrence of hemoprotozoan diseases in cow population. In three consecutive seasons, samples
of blood were randomly chosen from 216 hybridized and 432 native cattle of four typical areas.
Giemsa's stained blood smear technique was used to examine the samples. In this study the
observation of the effect of geography, season, age and sex was carried out in cattle during this
study. In crossbred and indigenous cattle the overall prevalence of hemoprotozoan diseases was
observed 16.18 and 12.02% correspondingly, where babesiosis and anaplasmosis were prevalent.
22
The highest prevalence of babesiosis (9.25%) was noted in hilly area but found to be reliable in
all the four different areas. In Summer season the hemoprotozoan diseases were predominant
than Winter and rainy seasons. Adult cows were considerably (P<0.05) at risk to babesiosis as
compared to younger. Babesiosis in crossbred cow was statistically important so that female
ruminants were more vulnerable to hemoprotozoan infestation as compared to male. They
concluded that breed and season play important role to examine the hemoprotozoan diseases.
Satta et al. (2011) carried out a research to check the symbionts and pathogens in ticks.
They conducted a research in Sardinia, (Italy) on the distribution of tick species and existence of
tick transferred micro-organisms. From mammalian hosts, a number of 1485 adult ticks were
gathered. Ticks identification was carried out to determine the existence of Rickettsia species of
the spotted fever group, Leishmania species, Anaplasma phagocytophilum, Bartonella species,
Coxiella burnetii and Ehrlichia canis by PCR analysis. Only Hyalomma marginatum
marginatum produced negative results among all tick species examined. They revealed from the
results that recorded data provided information on tick-borne diseases and could be helpful to
understand the prevalence of ticks in Sardinia.
Irshad et al. (2010) studied on sheep and goats at National Agricultural Research Centre
(NARC) Islamabad and Barani Livestock Production Research Institute (BLPRI) Kherimurat
district Attock, Pakistan to check the epidemology of infestation of tick and theileriosis. For the
presence of ticks, about 662 animals (443 goats and 219 sheep) were monitored. Of these, goats
and sheep were observed infested with several tick species. Within two homesteads combined in
sheep and goats, the difference in incidence of ticks was significant (P≤0.01). In different months
of research, difference in the incidence at BLPRI was significant, while at NARC was non
significant. On the basis of their morphological characters ticks were recognized. Both in sheep
and goats the most plentiful tick infecting was found Rhipicephalus spp. They concluded from
the results that the infestation of theileriosis in goats was 3.8%, while in sheep it was 7.36%.
Qamar et al. (2009) carried out a research in buffaloes at Rahim Yar Khan, Pakistan to
illustrate the epidemology of blood protozoans. Five hundred blood samples were gathered to
examine the incidence of different blood protozoans such as trypnosoma, theileria and babesia in
23
buffalo's blood. The study showed that the most abundant blood protozoans was babesia, while
prevalence of theileria was second and trypnosoma was found to be least prevalent.
Prevalence of diseases and tick-borne pathogens were associated with season and
geographical areas. Most prevalence diseases were theleriosis, babesiosis, anaplasmoisis and
ehrlichiosis caused by Theleria, Babesia, Ehrlichia and Babesia species of pathogens. These
were mostly identified through PCR.
2.3 Use of acaricide and medicinal plants to control ticks
Avinash et al. (2017) carried out a study to demonstrate the acaricidal activity of extracts
of Azadirachta indica. On fresh larvae the acaricidal action of chloroform and hexane extracts of
leaf of neem and deltamethrin were observed through the use of larval packet test (LPT).
Azadirachta indica was very critical therapeutic plant. The most important ectoparasites of farm
animals are Rhipicephalus (Boophilus) microplus. Conservative tick manipulate is specially
based totally on the application of artificial chemical substances, but ticks are growing resistance
against the acaricides and also have several negative outcomes. The LC50 and LC90 have been
maximum for hexane leaf extract at 2139.34 and 8687.70 ppm, correspondingly. By means of
contemporary sensitive gas chromatography–massspectrometry (GC–MS) the composition of
chemical extracts was also evaluated. They concluded from the study that phytogenic mixtures
contain the acaricidal action and also ecological.
Zaman et al. (2017) reviewed literature about the plants reported for having acaricidal
and anthelmintic properties. Socio-economic and geo-climatic conditions provide a favorable
climate for parasitic population of cows in Pakistan. Livestock industry is mainly affected by
hard ticks and gastrointestinal nematodes. Hard ticks play vital role in destruction of livestock
industry. To control these parasites, stockholders depend on synthetic drugs. This study was
conducted to determine the effectiveness of the medicinal plants against ticks and gastrointestinal
nematodes. Disposition of researchers to evaluate medicinal plants as anthelmintic was higher as
compare to acaridicals. However, absorption of cutting verge skills in evaluation method of
medicinal plants was suggested.
24
Adenubi et al. (2016) carried out a study on the extracts of plant to control ticks of
medical and veterinary importance in developing countries. The present study carried out in
laboratory to check the tick-repellent or acaricidal activities of medicinal plants. The extracts of
plant were used to control the different stages of ticks. About 200 species of plants from different
countries act as control strategy and have acaricidal or tick-repellent properties by vitro assays.
The extracts of several plant parts were most effective such as control strategies. Species
containing Azadirachta indica, Pelargonium roseum, Lavendula augustifolia, Gynandropsis
gynandra and Cymbopogon spp. had virtuous larvicidal and acaricidal activity with 90–100%
effectiveness as compared to those of presently use acricides. Various energetic composites like
geraniol, citronellal, carvacrol, azadirachtin, and linalool have been separated. The rural
livestock farmers mainly used large amount of plant extract to control tick infestation rate. The
effective acricides are prepared by plant-based mixtures or it might be a good source of new
acaricide compounds to perform active control strategy of ticks.
Nyahangare et al. (2016) studied the severe oral toxicity of mammal and impact of
diluents on efficiency of Maerua edulis De Wolf against larvae of Rhipicephalus decoloratus
species. Serial dilution of 5, 10, 20, and 25 % were made to form standard solution. To make
standard solution 25%w/v cold water plus surface active agent, hot water plus surface active
agent, methanol or hexane was used. These stock solutions were used to extract ground leaves
separately. Twenty larvae of Rhipicephalus decoloratus tick were sited in filter papers saturated
with excerpts for each concentration and the process of incubation was done after 24 h and 48 h
to observe the mortality rate at 27∘C and 85–90% RH. It is observed that the rate of larval
mortality was not dissimilar from the amitraz-based control which was maximum in methanol-
extracted M. edulis treatments. The rate of mortality was also lower in cold water as compared to
hot water plus surfactants treatments .They concluded from the results that methanol or hot water
extract of M. edulis were effective medication to control tick.
Nyigo et al. (2016) carried out a study to evaluate the consequences of medicinal plant as
acaricide against Boophilus species. To check the acaricidal impact of plant extract, adult and
larval immersion tests had been used. The end result found out that methanol and ethanol
extracts from leaves confirmed low adulticidal and larvicidal mortality, respectively. A non-
extensive activity of mortality showed from different extracts of this plant. They concluded that
25
for subject trials it is not suggested, as a substitute to determine its opportunities mainly using
sparkling plant material additional research is needed.
Mirania et al. (2016) carried out a research in Tharparker, Sindh; Pakistan on the records
of ethno veterinary plants for the cure of several buffalo and cow diseases. In Sindh province,
people living in Tharparkar depend on customary methods to solve health complications of their
animals and have rich heritage of indigenous knowledge. Hence this research was carried out to
demonstrate the application of therapeutic plants, their method of preparation and usage of these
ways for the cure of several diseases in this part. Ethno veterinary data was generated by
observation, semi-structural interviews and emphasis on group negotiations. To illustrate the
kinds of herb used against specific disease and dose, way of drug management and drug
preparation, observations were prepared. A number of 35 species of plants were recorded more
effective against 15 common diseases. The widely used plants in the study part were Plantago
lanceolata, Brassica campestris, Trachyspermum ammi, Capparis deciduas, Phoenix dactylifera,
Nicotiana tabacum, Azadirachta indica and Capsicum annuum. The most frequently used
botanical family of plants was Apiaceae followed by Fabaceae. Fruits, rhizomes, latex, seeds,
leaves, bulbs and husk were the most commonly used plants parts. Most repeatedly methods used
for drug preparation were pulverization. In the preparation of traditional drugs plants are the
most widely used components. In the study area, farmer used the reported medicinal plant for the
treatment of cattle and buffaloes in different health problems. This study suggested that the
described species of plants can be exposed to scientific authentication in demand to commend
more active treatments and preparations.
Chawech et al. (2015) studied on Citrullus colocynthis (L.) Schrad to check the
antibacterial activity and chemical composition of extracts and compounds separated from it.
The main purpose of this work was the phytochemical analysis of several extracts of stems and
leaves. It was made with three increasing quantity of polar solvents such as (methanol, ethyl
acetate and n-hexane) of Citrullus colocynthis. The key objective of this study was application of
the agar disc well-diffusion process to examine the antibacterial action of several extracts and
ethyl acetate extract of leaves. It is revealed through the results that latent antibacterial was
observed in ethyl acetate extracts of leaves and stems related to other excerpts in counter to
verified Gram-positive and negative microbial strains. Leaf extract of C. colocynthis (Ethyl
26
acetate) recommended the recognition of eight other cucurbitacins through LC-MS analysis. The
importance of sugar moiety was characterized by antibacterial activities of the isolated
compounds. The highest significant minimum inhibitory concentrations (MIC) standards were
found for Gluco cucurbitacin E 1.25 mg/mL against both Bacillus cereus and Enterococcus
faecalis and the ethyl acetate excerpt 0.625 mg/mL against Bacillus cereus.
Gosh et al. (2015) conducted a study to manipulate the acaricided resistant in animals
ticks, Rhipicephalus microplus from medicinal plant extracts. For trying out distinctive extracts,
the adult immersion test turned into adopted. Screening criterion primarily based on 72 h, 95 %
ethanolic extracts of Argemone mexicana complete plant and of Datura metel fruits had been
discovered powerful displaying extra as compared to fifty percent mortality of handled ticks. The
ninty five % ethanolic excerpts of both plants showed reproductive inhibitory and acaricidal
consequences on handled ticks. The LC90 values of Datura metel have been 7.13 and Argemone
mexicana 11.3 % had been determined, respectively. Phytochemical research confirmed the
existence of phenolics, flavonoids and terpenoids and alkaloids in Argemone mexicana complete
plant extracts and alkaloids and glucosides in Datura metel fruits. The effects discovered that
those botanicals may also play a big function to control ticks by decreasing the use of chemicals
and may be to achieve resistant tick population in surroundings responsive way.
Ohimain et al. (2015) research on the acaricidal activities of simple extracts of Ocimum
(O.) sanctum and Hyptis (H.) suaveolens towards Rhipicephalus sanguinneus. Solvent extract of
H. suaveolens precipitated LC50 at 175.00, 81.25 and 225.00 ppm, correspondingly from
chloroform, methanol and n-hexane extracts however O. sanctum showed mortalities for
chloroform, methanol and n-hexane extracts at 200.00, 137.50 and 287.50 ppm, respectively. In
the meantime, at 1 ppm the positive control became poisonous, while within the negative control
the tick turned into survived. The findigs discovered that solvent excerpts of H. suaveolens and
O. sanctum may be applied as acaricides for the management of canine tick Rhipicephalus
sanguinneus.
Nithya et al. (2015) carried a study on the activity of acaricide of shoot extracts of
Annona (A) squamosa, Azadirachta (A.) indica and Calotropis (C.) procera in vivo situation.
With methanol and water plants had been extracted and under in vivo circumstance the extracts
27
had been tested towards the cattle ticks. As tested individually the alcoholic and aqueous extracts
of A. indica showed highest mortality rate of ticks observed with the aid of A. squamosa and C.
procera. In combination of plant excerpts, on 5th day hot water excerpts of dried leaf powder
exhibited a hundred percent mortality of ticks even as ethanol and methanol excerpts confirmed
eighty three and eighty percent mortality, correspondingly. They concluded from the above
experimental results that the selected plant constituents have greater acaricidal pastime towards
farm animals ticks. They also conclude that the plant extracts in combinations are extra powerful
than single drug used.
Ullah et al. (2015) carried a research to assess the acaricidal efficacy of the aqueous
methanolic excerpts of fruit of C. colocynthis, rhizome of Curcuma longa and seed of Peganum
(P.) harmala. The activity of acaricidal plant excerpts was tested by larval immersion test in lab
against Rhipicephalus microplus. Acaricidal activity of every plant differs with specific exposure
times i.e., 24 hours and 6 days after exposure. Acricidal activities of plants were time and dose
dependent. The herbal components were appropriate for the poor farmers as a reasonably-priced
and wide spectrum antiparasitic. The mixture of flowers might be endorsed for use at farm stage
based on empirical suggestion of its anti-parasitic activity.
Nawaz et al. (2015) carried out a study to assess anti-tick activity of aquous extract of
Azadirachta indica, Morus alba and Dalbergia sisso against the larvae of Rhipicephalus
microplus. Acaricidal properties of vegetation and ivermectin were tested after 24h and six days
of remedy by using syringe test. LC50, LC90 and LC99 values had been observed for extract and
ivermectin. This considerable difference among LC50 values after 24 h and 6 days implied these
plants extract were greater poisonous after 6 days of treatment. Likewise, substantial difference
was found between LC90 and LC99 of plants extract and ivermectin. Time structured reaction of
water extract of plant was detected. They concluded from the results that extract of these plants
could be used to control ticks and for development as herbal acaricide.
Krishna et al. (2014) studied the activity of acaricide of the petroleum ether excerpt of
leaves of Tetrastigma leucosta through adult immersion test (AIT) against Rhipicephalus
(Boophilus) annulatus. At distinctive concentrations the percent mortality of adult, blocking off
of hatching of eggs and inhibition of fecundity were studied. The 10% concentration of the
28
extract confirmed 32% of adult tick mortality, 88.96% inhibition of fecundity and 50% inhibition
of hatching. After five days of remedy peak mortality rate was found. The rates of ticks mortality
were concentration dependent. Against Rhipicephalus annulatus, the LC50 of the extract were
10.46%. At least seven polyvalent compounds had been present in the HPTLC profiling of the
petroleum ether excerpt. They concluded from the result that the mortality of ticks and inhibition
of the fecundity were indication of synergistic effect of the bioactive additives.
Shyma et al. (2014) conducted a study on the methanolic extract of Azadirachta (A.)
indica, Datura (D.) stramonium, leaves of Calotropis (C.) procera, cloves of Allium (A.)
sativum, and Carica (C.) papaya for acaricidal activities against Rh. microplus. The rate of
mortality in adults was 12.5% within 15 days. The mortality of adult tick was maximum at the
highest concentration 66.67% for C. procera, 73.33% for D. stramonium, 80.00 % for A.
sativum, and 93.33 % C. papaya extracts. The Rate of inhibition of fertility of treated groups was
concentration dependent and differed mainly from the control group. However, calotropis, neem,
and datura were able to decreasing hatchability by 20, 50, and 70 %, correspondingly. They
concluded from the results that the excerpts of cloves of A. sativum and seed of C. papaya have
very significant acaricidal activities and could be alternative of Rh. microplus a potential
component of tick control strategy.
Mkangara et al. (2014) assessed the outcomes of medicinal plant Commiphora
swynnertonii stem bark extracts as acaricide against adult Amblyomma variegatum and
Rhipicephalus appendiculatus. Petroleum ether, ethyl acetate and methanol have been used as
solvent for plant extraction. The concentrations of extracts had been examined at 60, 70, 80, 90
and 100 mg/mL. All extracts showed acaricidal activity that was concentration and time
dependent. After 156 hours of exposure, the result confirmed that the petroleum ether extract
showed distinctly excessive acaricidal activity with LC50 of 72.31 and 71.67 mg/mL causing
mortality of Amblyomma variegatum was 100% and against Rhipicephalus appendiculatus was
87%. They concluded from the outcomes that Commiphora swynnertonii could be used for the
control of tick.
Parveen et al. (2014) studied the effectiveness of ethanolic excerpts acquired from the
aerial components of Ageratum (A.) conyzoides and Artemisia (A.) absinthium against Rh.
29
microplus through AIT in vitro. Five different treatments of the excerpt (1.25%, 2%, 5%, 10%,
and 20%) were used for bioassay. For every treatment, three replications had been used. In AIT,
the most mortality was observed for A. conyzoides (40%) and A. absinthium (66.7%) at 20%
concentration. The highest acricidal activity was observed in the excerpt of A. absinthium with
LC50 and LC95, respectively. Special concentrations of the excerpts were used to handle the egg
of the live ticks that became appreciably lower as compared to control ticks; subsequently, the
oviposition values and generative index of the handled ticks had been reduced extensively. They
concluded that A. absinthium has efficent activity of acaricide as compared to A. conyzoides and
can be beneficial in monitoring Rh. microplus.
Opiro et al. (2013) investigated the repellencey of four plant species extracts Cissus (C.)
adenocucaulis, Cassia (C.) didymobotrya, Kigelia (K.) africana and Euphorbia (E.) hirta on the
larvae of Rhipicephalus appendiculatus. The outcomes had been evaluated that three different
organic solvents of different polarities i.e hexane, methanol and dichloromethane have been used
to obtained extracts by way of the fingertip repellence bioassay. The research verified that each
one excerpts assessed showed a repellence impact that fluctuated from fourty three to eighty
eight percent. The application of dissimilar extraction solvents did not significantly vary
repellence impact, for all four plant species. The satisfying repellence percentages exhibited by
C. didymobotrya and K. africana. These shows the strong capacity of these flora for tick
manipulate in an incorporated tick management system for farm animals owned with the aid of
resource-terrible farmers in Northern Uganda.
Leschnik et al. (2013) carried out a research in Eastern Austria to illustrate the effect of
acaricidal action on tick prevalence and immunal response in tickborne pathogens in naturally
infected dogs. In this study, about thirty dogs were cured with fipronil plus S-methoprene,
permethrin, or supported as untreated control. Dogs were medically inspected and tested for
antibody reactions against Anaplasma phagocytophilum, Babesia canis and Borrelia burgdorferi,
over a period of 11 months. About 2/3 of all dogs had showed an optimistic immune reaction for
one or more pathogens. For canine babesiosis, only three dogs showed positive response whereas
the other dogs remained healthy. Application rate does not correlate with individual number of
ticks per dog. If owner did not use acaricides frequently, no effect on the number of contagions
could be observed while total of ticks was noticeably decreased through applying drugs. Clinical
30
disease caused by tick borne pathogens are rare in dogs exposed to tick-borne pathogens is rare
to make application of acaricide more effective, Extra educational teaching for dog owners about
the avoidance of TBDs was recommended.
Petro et al. (2012) conducted a study to illustrate the effectiveness of cypermethrin
against cow ticks in Tanzania. The laboratory evaluation was accompanied recommended by
FAO using laboratory reared tick species through larval packet test .The results showed that the
three weeks old larvae of Rhipicephalus appendiculatus were vulnerable to the technical grade of
cypermethrin. Two herds which were 3 kms apart from each other were treated with
recommended dose rate (0.01%) of vapco cypermethrin 10 EC once fortnightly while the other
herd was untreated. They concluded from the results that number of ticks reduced enormously in
the treatment group the vapco cypermethrin while the number of ticks remained less in the
control group throughout the study period. The maximum effectiveness was observed after
fourteen day dipping.
Sindhu et al. (2012) documented study to find out the ethno-veterinary applications to
cure parasitic infections in livestock. Visits of area, interviews and group negotiations were
planned to accumulate the records over a period of six months. A complete of 96 ethno-
veterinary practices (EVPs) has been recognized through which 66 had been primarily dependent
on medicinal plants and thirty on other natural and inorganic substances. About thirty five plants
from twenty three families had been recognized for the remedy of diverse sponging infections.
The pinnacle ten maximum often applied plants were: Ocimum basilicum, Aloe vera,
Azadirachta indica, Citrullus colocynthis, Brassica rapa, Nicotiana tabacum, Withania
coagulans, Ferula asafetida, Eruca vesicaria and Allium cepa. There was variety in the usage of
plants in their dose, way of instruction, portion used and signs. The maximum often revealed
remedies had been for the treatment observed by means of fly infestation, helminthiasis and tick
infestation. On a general foundation, farmers articulated their approval for the documented
EVPs. The present study provides information about these plants and its powerful use for
controlling parasitic infections regularly occurring inside the region by means of the local animal
husbandry. It was revealed through the result that regular usage of doses of plants and the use of
medical tactics would be helpful to the farmers, medical community and pharmaceutical
enterprise.
31
Brito et al. (2011) worked on the evaluation of the performance of acaricides utilized in
dairy herds elevated in the Brazilian SouthWestern Amazon to control the Rhipicephalus
microplus. A complete of 106 populations had been gathered from five cities, to evaluate the
efficacy of acaricide molecules. The adult immersion test (AIT) was used for control of
Rhipicephalus microplus. They concluded that the acaricide preparations had various impacts at
the tick populations observrd.
Zorloni et al. (2010) studied the efficacy of Calpurnia (C.) aurea extracts against the tick
infestation. In Southern Ethiopia; water, hexane and acetone leaf extracts of C. aurea had been
established for acaricidal and repellent properties against unfed adult ticks Rhipicephalus
pulchellus. In comparision to several other plants, the C. aurea excerpts did not have repulsive
possessions but alternatively it had moderate attractant ability. By twenty and ten percent acetone
excerpts, all ticks were either destroyed or their movement was harshly assigned after one μl of
excerpt changed into typically carried out on the stomach. At five% concentration, 85% of ticks
had been nevertheless influenced. A 10% aqueous solution additionally had an obvious
influence. The outcomes showed the efficiency of the conventional usage of this excerpt and
might lead to a product that could be applied commercial to prevent tick prevalence.
Durrani et al. (2009) carried out a research to check the behavior of therapeutic trials of
natural plant Calotropis procera and buparvaquone in hybrid cows after trial contagion with
Theileria annulata during the months of May to August, 2007. Extreme clinical reactions had
been recorded after experimental contamination. An association between medical responses and
piroplasm parasitemia and schizont parasitosis was also noted. The livestock were beared from
excessive fever, sub scapular lymph nodes and swelling of sub mandibular, weak spot, improved
respiratory and rhythm, anorexia, corneal opaqueness, condition loss and difficult hair covering.
By applying T. annulata particular primers N516/N517, 721-bp fragment of SSU rRNA was
changed into augmented from DNA of salivary glands and the inner organs of Hyalomma ticks.
The effects of therapeutic findings showed that the macrocytic hypochromic anaemia in
experimentally infested animals was improved by C. procera therapy. The end result revealed
that through the treatment of liver and kidney features with C. procera did not confirm
poisonousness at the dosage of 0.3 mg/Kg orally. They concluded from the study that the
effectiveness of C. procera was greater with respect to buparvaquone.
32
Kone et al. (2008) carried out a study to illustrate the use of medicinal plants for
veterinary purposes by rural communities of Northern West Africa. Ethno veterinary medicine is
the foremost alternative for the treatment of several diseases and disorders of their livestock.
Medicinal plants (55) were reported by breeders that belong to 40 genera and 30 families. Herbal
medication was mostly used as decoctions, crushed fresh plants or powdered plant material to
treat disorders of the eyes, gastrointestinal and respiratory tracts.
No doubt chemical control method is quick but it is harmful for animals and human
beings too. It is also a main cause of tick resistance, so now days most researchers are trying to
control with botanicals that are environment friendly and do not cause any harm to animals.
33
Chapter 3
MATERIALS AND METHODS
The study entitled “prevalence of ticks and tick borne pathogens from Punjab, Pakistan”
was conducted in Research Laboratory of the Department of Zoology, Government College
University Faisalabad.
3.1. Study Area
The research was focused to find the ticks prevalence, their management with plant
extract and acaricides and tick borne pathogens in livestock farms. The research work was
conducted from 2016 to 2017 in four different seasons (Autumn, Winter, Spring and Summer).
This study was carried out from four agro-ecological zones of Punjab, Pakistan, i. e.
Southern zone
a. Muzaffargarh
b. Bahawalpur
c. Rajan pur
Western zone
a. Khushab
b. Bhakar
c. Layyah
Central zone
a. Jhang
b. Gujranwala
c. Faisalabad
Northern zone
a. Rawalpindi
b. Attock
c. Chakwal
34
The study coveres four periods that are Autumn (August to October), Winter (November
to January), Spring (February to April) and Summer (May to July). The hottest month is June
having maximum temperature of 50°C. The coldest month of these areas is December having
minimum temperature of 0°C. From 12 districts as listed above the total 120 cattle farms were
chosen. Three districts were selected from each zone of Punjab. All the randomly selected
districts from all four zones of Punjab are important livestock farming zones. In province Punjab
the larger populations of livestock are found as compared to the other provinces of the country.
The total population of livestock in Punjab was estimated to be 175 million i.e. (cows, goats,
sheep and buffaloes) (Livestock Census, 2006). Mostly economy of the Southern zone of Punjab
is based on agriculture, the Cholistan desert falls in this zone. The districts of Western zone of
Punjab lying nearby to the Indus River. The geography is defined by the sand obtained from the
shifting flood bare deposits of the Indus. This zone consists of Layyah, Khushab and Bhakkar
districts which mostly covers the Thal desert. This area has a sizeable cement, sugar and textiles
industry and also rich in salt and coal. Though, poverty levels are much greater in this zone as
compared to Northern or Central Punjab. Central Punjab states to the flat surface that are
inhibited by the Southern verge of the Jhelum river down till the Sutlej river. Northern Punjab is
generally categorized as the mountainous, highland and hilly areas in the north of the province.
Bahawalpur is the biggest district of Punjab with a whole part of 24,830 Km, almost two-thirds
of the district is concealed by the Cholistan desert, which prolongs into the Thar Desert of India.
Bahawalpur and Rajun pur have the highest small animal population. Attock is the significant
cattle trade zone that links the Northern areas of country with the Southern areas.
35
Figure 1. Chart of Punjab region in Pakistan and the districts from where samples of tick were
gathered.
36
3.2. Collection and preservation of ticks
During four seasons of the year in morning and evening ticks were collected. From goats,
sheep, buffaloes and cows species of ticks were collected. Total ten (five urban and five rural)
livestock farms were haphazardly chosen from each designated district of the regions of Punjab.
In urban areas, every farm was at least ten kilometer apart from the other farm. Whereas in rural
parts, every farm was chosen from various villages which were at least 5km away from each
other. The designated 5-10 animals (if any animal was not available at the farms, then it was
observed from nearly farm) were systematically checked from farms through nearby analysis,
parting the furs in contrast to their usual way for the ticks identification. Species of tick were
gathered analytically from head to tail orders with the aid of tiny steel pincers with blunt tops
devoid of injuring their orifice. Ticks were placed in clean and dry appropriately labeled plastic
bottles covered with muslin cloth for proper aeration. Tick specimens were brought to research
laboratory for identification and PCR analysis. Complete record of the area, animal species, time
and season was maintained. In the laboratory, preservation process was done by keeping ticks
into 70% methanol for further investigation
3.3. Identification of ticks
Under low power and then high power amplification of microscope, collected ticks were
observed. According to the keys given by Mc Carthy (1967), Madder et al. (2004), Walker et al.
(2003) and Estrada-Pena et al. (2006) identification of various adult ticks were accomplished by
the aid of the structural and morphology features in the lab by dichotomizing and light
microscopes. Moreover, original explanations and representations of associated tick were also
checked (Apanaskevich & Horak, 2005). At the species level species of ticks were recognized
below a stereoscopic (OPTICA SZM-1 Italy) using 40-fold amplification. For the recognized
tick types, abbreviations were used as earlier recommended by Dantas-Torres (2012).
3.4. Collection and identification of plant materials
Five different plants i.e Trigonella foenum-graecum, Solanum nigrum, Calotropis
procera, Citrullus colocynthis and Brassica rapa were designated for the research (Table 3.1).
These plants were designated because these are easily available to the the owner of livestock
37
farms. From Department of Botany, Government College University, Faisalabad, the whole parts
of these plants were collected from the different areas of Jhang and identified. Fresh plant
materials were brought into the laboratory washed all plants with distilled water and dehydrated
under shade at room temperature for one month. After complete drying, the dried plants material
were crushed in mortar pestle, and then ground into fine powder by electric blender. The powder
was sifted by a mesh.
Table 3.1. Classification of selected plants of study
Sr No Scientific name Common
name
Family Genus Species English
name
1 Calotropis procera Auk Apocynaceae Calotropis Procera Milk weed
2 Brassica rapa Sarson Brassicaceae Brassica Rapa Mustard
3 Trigonella foenum-
graecum
Methi Fabaceae Trigonella foenum-
graecum
Fenugreek
4 Solanum nigrum Makoi Solanaceae Solanum Nigrum Black
nightshade
5 Citrullus colocynthis Khurtumma Cucurbitacea Citrullus colocynthis Bitter apple
3.5. Preparation of plants extract
To check the efficacy of the above mentioned plants, the plant extracts were prepared by
following process described by Gosh et al. (2015) with slight modifications. Five hundred (500)
grams of powdered material of all selected plants were individually added to methanol (1000ml)
in the beaker, covered it with aluminum foil and kept for seven days at room temperature. After
seven days was sifted through Whatman No.1 filter paper and dehydrated by rotatory evaporator.
The crude extract was measured separately and stored in glass jar at room temperature for the
application of acaricidal activity to control ticks.
38
(a) (b) (c)
(d) (e)
Figure 2. Medicinal plants used for plant extracts i.e (a) Calotropis procera, (b) Solanum nigrum,
(c) Brassica rapa (d) Trigonella foenum-graecum (e) and Citrullus colocynthis.
39
3.6. Phytochemical analysis
Plant extracts were further subjected to qualitative phytochemical analysis. This analysis
was carried out with the following standard methods;
3.6.1 Test for the confirmation of Flavonoids
One ml of ten percent solution of lead acetate was mixed in 1ml of methanolic plant
extract. The establishment of yellow precipitate showed the presence of flavonoids (Jabin &
Nasreen, 2016).
3.6.2 Test for the confirmation of Terpenoids
Methanolic extract (2 ml) of given plant was added in 2 ml of chloroform and vaporized
to desiccation. Then two ml of concentrated sulphuric acid was mixed and heated the solution for
two minutes. Establishment of grayish color showed the existence of terpenods (Bargah, 2015).
3.6.3 Test for the confirmation of Alkaloids
Two ml of methanolic extract was mixed with 2 ml of concentrated hydrochloric acid on
steam wash. Then few drops of Dragendroffs reagent were added. The formation of orange red
precipitate indicated the presence of alkaloids (Bargah, 2015).
3.6.4 Test for the confirmation of Tannins
Two ml of excerpt was stimulated in 2 ml of dH2O and then few drops of FeCl3 solution
were mixed. Occurrence of green swift was taken as positive test for tannins (Bargah, 2015).
3.6.5 Test for confirmation of Saponins
In a test tube 5 ml of distilled water and 5 ml of extract was shaken vigorously and
heated. The formation of smooth foam was considered as a positive for saponins (Bargah, 2015).
3.6.6 Test for confirmation of Steroids
3.6.6.1 Liebermann Burchard test
Two ml of methanolic extract was dissolved in 2 ml of chloroform CHCl3 and treated
with concentrated H2SO4 and CH3COOH. The formation of green color shows the existence of
steroids (Bargah, 2015).
40
3.6.6.2 Salkowskis test
Methanolic extract (2ml) of given plant was mixed in 2 ml of CHCl3 and added 2 ml of
concentrated H2SO4. A red color was formed in the lower CHCl3 layer that shows the existence
of steroids (Bargah, 2015).
3.6.7 Test for confirmation of Phenols
In 5 ml of distilled water 500 mg of extract was dissolved. Then few drops of 5 % ferric
chloride were added. The formation of green color shows the existence of phenols (Bargah,
2015).
3.7. Bioassay
3.7.1 Preparation of stock solution of selected plants
Stock solution was prepared by dissolving the plants extracts in dimethyl sulfoxide
(DMSO). Five different concentrations i.e. 0.75% (0.75 mg extract was mixed in 2.25 ml dist.
Water, then 0.075 ml of this solution is added in 9.925 DMSO), 1.5% (1.5 mg extract was mixed
in 2.25 ml dist. Water, then 0.15 ml of this solution is added in 9.85 DMSO), 3.00% (3 mg of
extract was mixed in 2.25 ml dist. Water, then 0.3 ml of this solution is added in 9.7 ml DMSO),
6.00% (6 mg of extract was mixed in 2.25 ml dist. Water, then 0.6 ml of this solution is added in
9.4ml DMSO)and 12.00% (12 mg of extract was mixed in 2.25 ml dist. Water, then 1.2 ml of
this solution is added in 8.8ml DMSO)of each extract were prepared in distilled water.
3.7.2 Percent mortality
The livestock farms were examined for the infestation of ticks and from the infested
buffaloes the adult ticks were separated for bioassays. All the plants extract were used against
adult ticks in the laboratory using standardized adult immersion test (AIT) with slight
modifications made by Gosh et al. (2015). Twenty tick species were immersed in 10 ml of
respective concentration in beaker with the help of small forceps and each group was tested in
replicate. Stirring the ticks with rod vigorously and after five minutes of immersion, the ticks
were removed from the beaker and put into the test tube and cover all these treated ticks with the
muslin cloth. Alive and dead ticks were counted after 24 hour (hr), 48 hr, 72 hr and 96 hrs. In
control group, ticks were dipped in distilled water and checked for mortality after each time
41
interval of 24 hrs. The percentage mortality was observed after each time interval of 24 hrs and
consecutively for four days.
42
3.7.3 Stock solution of selected acaricides
Acaricides cypermethrin (40% EC), emamectin (1.9% EC) and fiprnoil (5% SC) were
purchased from local market (Faisalabad). Five different concentrations 0.25%, 0.50%, 1.00%,
2.00% and 4.00% were prepared in distilled water to determine the mortality of ticks. The
solutions were homogenized by shaking.
3.7.4 Percent mortality
The number of twenty ticks was used in each group, and each group was tested in
triplicate (giving a total of 20 individuals per group). Before the application of each test, the tick
species were washed in a mesh with tap water and dehydrated on indulgent spongy paper. To
check the mortality of selected acaricides i.e. cypermethrin, emamectin and fipronoil adult
immersion test was used. The ticks were then randomly allotted to a treatment group and then
immersed in beaker for 5 min that contained a preset concentration of each acaricide. In the
control group ticks were dipped in distilled water only. After five minutes the ticks were
removed from the respective concentration, then dry in absorbent paper and placed into
recognized test tubes covered with muslin cloth. After four days the percent mortality of ticks
was calculated, only those ticks were considered alive that were still capable of movement
(Avinash et al., 2017).
3.8 DNA extraction
After identification of tick species on the bases of their morphological characters, the
ticks were stored and divided on the basis of locality of collection and host. The ticks of same
species and same host were placed together. Ticks from every species were individually used for
the DNA extraction. Filter paper were used to dry the tick species and homogenized in 1.5 ml
nontoxic ependorf then add 25µl proteinase K by using pasteurized pestle. The tubes incubated
in T mix shaking incubator (EHRET) at 60C0
temperature for one hour. For proper mixing used
adjustable speed RS-VA 10 vortexer (Bench Mixer). By using a commercial pure link mini kit
(Invitrogen), the DNA was extracted by following kit protocol. Extracted DNA of ticks was kept
at -20Co (Chen et al., 2014). The quality of extracted DNA was analyzed on agarose gel by
electropherosis. Ethidium bromide has been used to see DNA in gel. Extracted DNA samples
were loaded on 1% agarose gel and run for 60 minutes at 100 voltages. After one hour, gel was
43
examined under ultra violet light transilluminator and photographed using Syngene
documentation system.
3.9 Using PCR for magnification of DNA of tick borne pathogens
To amplify the DNA of Theleria and Babesia and other for Ehrlichia and Anaplasma spp.
two sets of PCR were performed. The total reaction volume for PCR was 25µl, which was
formed by adding 9.2 µl d3H2O, 2.5 µl dNTPs, 2.5 ul Taq buffer, 2 ul MgCl2, 3 ul F primers, 3 ul
R primers (working primer solutions were formed by adding 10ul from primers stock solution
and 190 ul d3H2O) and at the end Taq DNA 0.3 ul was added. Then added 2.5 ul templates in
22.5 µl master mix. A PCR was performed for Theleria and Babesia; two cycles of denaturation
(95 oC for 5 minutes and 2
nd for 1 minute), annealing (57
oC for 40 s) and extention at (72
oC for
fifteen second), followed by continuous two cycles with same situations of earlier cycle. The
annealing temperature abridged until approached 58oC. An additional 35 cycles were completed
during amplification process. All the conditions were the same, for Anaplasma and Ehrlichia,
only the temperature of initial annealing was changed (95°C-98°C) by following the PCR.
Negative and positive controls were used to check the results. A Thermal Cycler a C1000™ was
used for amplification of DNA (Ependroff). To determine and analyze the PCR results, agarose
gel electropherosis was performed. Agarose gels (1.5%) (WEALTEC Corp: mini GES) with
ethidium bromide dye were used for visualization of amplicon, below Ultra Violet light by
GeneSnap from SynGene version 7.12. For comparison of amplicon sizes, Gene Ruler (100-1000
bp) DNA molecule (Thermo Scientific™ Karlsruhe) was applied.
DNA amplification using specific primers
For each group (genus), individual PCR amplification reaction was carried out in 25 µl
with 100 ng of DNA, 10 pmol of onward and reverse primer for every species, 1U Taq DNA
polymerase, 2.5 mM MgCl2 & 200 µM of dNTPs. All amplification reactions were performed in
a thermal cycler. Specific primers and PCR situations were given in the table 3.2. PCR products
(10 µl) were loaded on agarose gel (1.5%), with DNA ladder electrophoresis was done at 120 V
for one hour. Gel was stained with ethidium bromide and photographed (Barghash et al., 2016).
44
Table 3.2. Specific primer sequences, PCR situations and targeted size of tick borne pathogens.
Pathogens Primer order (5’-3’) PCR situation Product
size (bp)
Theileria
annulata
F: ACTTTGGCCGTAATGTTAAAC
and
R: CTCTGGACCAACTGTTTGG
(Bilgic et al., 2010)
95°C for 5 min., 33 cycle at 94°C
for 30 sec., touchdown from
62°C-50°C for 30 sec., 72°C for 30
sec. and f. ext. at 72°C for 5 min.
312
T. ovis F: TCGAGACCTTCGGGT
and
R: TCCGGACATTGTAAAACAAA
(Altay et al., 2008)
95°C for 5 min., 33 cycle at 94°C
for 30 sec., touchdown from
62°C-50°C for 30 sec., 72°C for 30
sec. and f. ext. at 72°C for 5 min.
520
T. orientalis F: CTTTTGCCTAGGATACTTCCT
and
R: ACGGCAAGTGGTGAGAACT
(Ota et al., 2009)
95°C for 5 min., 33 cycle at 94°C
for 30 sec., touchdown from
62°C-50°C for 30 sec., 72°C for 30
sec. and f. ext. at 72°C for 5 min.
776
Babesia
bigemina
F: TAGTTGTATTTCAGCCTCGCG
and
R: AACATCCAAGCAGCTAHTTAG
(Ellis et al., 1992)
95°C for 3 min., 35 cycle at 94°C
for 30 sec., 57°C for 30 sec.,
72°C for 30 sec. and f. ext. at 72°C
for 6 min.
639
B. bovis F: TTTGGTATTTGTCTTGGTCAT
and
R: ACCACTGTAGTCAAACTCACC
(Chansiri & Bagnara, 1995)
95°C for 3 min., 35 cycle at 94°C
for 30 sec., 57°C for 30 sec.,
72°C for 30 sec. and f. ext. at 72°C
for 6 min.
448
B. caballi F:CGACACCAAGGATTTATTCGAGAA
and
R: ATTCCAAAGATTCACCCACAGC
(Guclu & Karaer, 2007)
95°C for 3 min., 35 cycle at 94°C
for 30 sec., 57°C for 30 sec.,
72°C for 30 sec. and f. ext. at 72°C
for 6 min.
539
A. marginale F: GCTCTAGCAGGTTATGCGTC
and
R: CTGCTTGGGAGAATGCACCT
(Bilgic et al., 2013)
95°C for 3 min., 35 cycle at 94°C
for 30 sec., 57°C for 30 sec.,
72°C for 30 sec. and f. ext. at 72°C
for 7 min.
265
A. ovis F: TGAAGGGAGCGGGGTCATGGG
and
R: GGTAATTGCAGCCAGGGACTCT
(Yousefi et al., 2017)
95°C for 3 min., 35 cycle at 94°C
for 30 sec., 57°C for 30 sec.,
72°C for 30 sec. and f. ext. at 72°C
for 7 min.
347
A.Centrale F: CATAACTTTGTTGTTGTAAAGCCT
and
R: TTCCAGACCTTCCCTAACTA
(Shkap et al., 2002)
95°C for 3 min., 35 cycle at 94°C
for 30 sec., 57°C for 30 sec.,
72°C for 30 sec. and f. ext. at 72°C
for 7 min
403
Ehrlichia spp. F: GGTTTATGGTGCTTTTCCTAGTGTTGA
R:
TTACAGATTTCTCAGGAGTATATGCCTCC
(Qiu et al., 2016)
95°C for 3 min., 33 cycle at 94°C
for 30 sec., touchdown from
64°C-50°C for 30 sec., 72°C for 30
sec. and f. ext. at 72°C for 5 min.
480
460
E. spp.
Omatjenne
F: GGAATTCAGAGTTGGATCMTGGYTCAGR
biotin- R:
CGGGATCCCGAGTTTGCCGGGACTTYTTCT
(Bilgic et al., 2017)
95°C for 3 min., 33 cycle at 94°C
for 30 sec., touchdown from
64°C-50°C for 30 sec., 72°C for 30
sec. and f. ext. at 72°C for 5 min.
Rickettsia
16S rRNA
F: GGGGGCCTGCTCACGGCGG and
R: ATTGCAAAAAGTACAGTGAACA
(Regnery et al., 1991)
95°C for 3 min., 33 cycle at 94°C
for 30 sec., touchdown from
64°C-50°C for 30 sec., 72°C for 30
sec. and f. ext. at 72°C for 5 min.
380
45
3.9 Statistical analysis
The prevalence of ticks and tick-borne pathogens was determined in all planned agro-
ecological regions of Punjab, Pakistan by using logistic regressions and odd‟s ratio (OR) at 95%
confidence intereval (CI). All statistical analysis was determined using SPSS software package
(SPSS, 21). Analysis of variance technique was applied to find out the significant differences
between zone animals and tick species. Comparison of means was done using Least Significant
Difference (LSD) test at 5% level of significance. The percent mortality was analyzed by probit
analysis (Abbott, 1925; Finney, 1971), using Minitab-17 statistical software for determining
LC50, LT50 and related parameters.
46
Chapter 4
RESULTS & DISCUSSION
4.1. Analytical Characteristics of the Population
A number of 12,000 animals (2800 goats, 2800 sheep, 3200 buffaloes and 3200 cows)
were observed from 120 livestock farms in four different agro-ecological zones (Southern,
Western, Central and Northern) of Punjab, Pakistan differentiated by urban and rural locality.
Ticks were collected, identified and analyzed for the presence of pathogens.
The research work was divided in to four steps
1. Prevalence of species of tick from the selected zones of Punjab, Pakistan
2. Identification of collected tick species on the basis of their physiological
characters
3. Detection and identification of tick-borne pathogens by PCR analysis
4. Management of tick species with acaricides and medicinal plants extract
4.2 Tick Prevalence
From buffaloes, cows, goats and sheep ticks were collected during four seasons of the
year. From each selected district of the regions of Punjab total 10 cattle farms (five urban and
five rural) were randomly designated. During the present study the selected livestock farms were
randomly examined for collection of ticks. All the cattle farms, regardless of their topographic
site, were observed infested with one or multiple ticks species. The overall prevalence of tick-
infested livestock was observed 36.52% (4382/12,000) as shown in table 4.1.
47
Table 4.1. Zone-wise ticks prevalence (%) from Punjab.
Zones
Total Infected Prevalence
(%)
Odds Ratio Confidence Interval 95% P-value
Lower limit Upper limit
Southern 3000 1090 36.33 1.135 1.020 1.262 0.020
Western 3000 1075 35.83 1.110 0.998 1.235 0.054
Central 3000 1213 40.43 1.349 1.215 1.499 0.000
Northern 3000 1004 33.47
(P<0.05) significant
The utmost prevalence (40.43%) was noticed from Central zone whereas lowest
(33.47%) from Northern zone and data of prevalence for two other zones was displayed in 4.1
table. The highly significant (p<0.00) differences were noticed in Central zone whereas
significant (p<0.05) differences in Southern zone and the non-significant (p>0.05) differences in
Western zone.
Table 4.2. Animal-wise ticks prevalence (%) from Punjab.
Animal
Total Infected Prevalence
(%)
Odds Ratio Confidence Interval 95% P-value
Lower limit Upper limit
Buffalo 3200 1201 37.53 1.471 1.320 1.640 0.000
Cow 3200 1357 42.41 1.803 1.619 2.007 0.000
Goat 2800 1012 36.14 1.386 1.239 1.550 0.000
Sheep 2800 812 29.00
(P<0.05) significant
In the current research a number of 12,000 cattles i.e. 2800 goats, 2800 sheep 3200
buffaloes and 3200 cows were haphazardly observed for tick collection. From 12,000 cattles
4382/12,000 (36.52%) livestock were identified infestation with ticks. The ticks prevalence in
buffaloes, cows, goats and sheep were observed (37.53, 42.41, 36.14 and 29.00%),
48
correspondingly as described in table 4.2. The highly significant (p<0.00) differences were
showed in the prevalence of all animals.
Table 4.3. Season-wise ticks prevalence (%) from Punjab.
Season
Total Infected Prevalence
(%)
Odds
Ratio
Confidence Interval 95% P-value
Lower limit Upper limit
Spring 3000 1239 41.30 2.936 2.614 3.297 0.000
Summer 3000 1676 55.87 5.282 4.704 5.930 0.000
Autumn 3000 887 29.57 1.752 1.554 1.974 0.000
Winter 3000 580 19.33
(P<0.05) significant
Table 4.3 revealed (prevalence %) season-wise for complete data. In this research the
highest prevalence was noticed in Summer, (55.87%) followed by Spring (41.30%), Autumn
(29.57) and lowest in Winter seasons (19.33%). The highly significant (p<0.00) differences were
detected in the ticks prevalence in all several seasons.
Table 4.4. Animal-wise prevalence with respect to different seasons for Southern zone.
Season
Animal
Total Infected Prevalence
(%)
Odds Ratio Confidence Interval 95% P-value
Lower limit Upper limit
Spring Buffalo 200 87 43.50 1.514 0.995 2.304 0.053
Cow
200 92 46.00 1.675 1.102 2.546 0.016
Goat
175 67 38.29 1.220 0.788 1.889 0.373
Sheep
175 59 33.71
Summer Buffalo 200 102 51.00 0.918 0.611 1.378 0.679
Cow
200 121 60.50 1.350 0.896 2.036 0.151
Goat
175 99 56.57 1.149 0.754 1.750 0.519
Sheep
175 93 53.14
49
Autumn Buffalo 200 57 28.50 1.224 0.772 1.941 0.391
Cow
200 73 36.50 1.765 1.127 2.764 0.013
Goat
175 47 26.86 1.127 0.698 1.821 0.625
Sheep
175 43 24.57
Winter Buffalo 200 37 18.50 0.977 0.580 1.644 0.929
Cow
200 41 20.50 1.110 0.666 1.850 0.690
Goat
175 39 22.29 1.234 0.734 2.075 0.428
Sheep
175 33 18.86
(P<0.05) significant
Table 4.4 showed the ticks prevalence in several seasons in Southern zone. The overall
prevalence was highest during Summer season in all animals. The prevalence of tick species in
buffaloes in this zone was highest in Summer season (51.00%) followed by Spring (43.50%),
Autumn (28.50%) and Winter (18.50%). In this zone the prevalence of ticks in cows was highest
in Summer season (60.50%) followed by Spring (46.00%), Autumn (36.50%) and was least in
Winter (20.50%). In case of goats and sheep, the tick prevalence in this zone was maximum in
Summer season (56.57 and 53.14%) followed by Spring (38.29 and 33.71%), Autumn season
(26.86 and 24.57%) and Winter (22.29 and 18.86%) respectively. The prevalence of ticks
showed highly significant (p<0.01) differences in Spring season in cows while non-significant
(p>0.05) differences were showed in case of buffaloes and goats. In Winter season non-
significant (p>0.05) differences in case of both buffaloes and goats whereas the highly
significant (p<0.01) differences were showed in cows. Therefore, in Summer and Autumn
seasons non-significant (p>0.05) differences were showed in all ruminants.
50
Table 4.5. Animal-wise prevalence with respect to different seasons for Western zone.
Season
Animal
Total Infected Prevalence
(%)
Odds Ratio Confidence Interval 95% P-value
Lower limit Upper limit
Spring Buffalo 200 91 45.50 1.922 1.255 2.942 0.003
Cow
200 97 48.50 2.168 1.417 3.317 0.000
Goat
175 77 44.00 1.809 1.166 2.807 0.008
Sheep
175 53 30.29
Summer Buffalo 200 111 55.50 1.003 0.667 1.508 0.989
Cow
200 127 63.50 1.399 0.924 2.117 0.112
Goat
175 88 50.29 0.813 0.534 1.238 0.335
Sheep
175 97 55.43
Autumn Buffalo 200 65 32.50 2.072 1.281 3.350 0.003
Cow
200 69 34.50 2.266 1.405 3.655 0.001
Goat
175 43 24.57 1.402 0.840 2.338 0.196
Sheep
175 33 18.86
Winter Buffalo 200 37 18.50 1.362 0.783 2.370 0.274
Cow
200 33 16.50 1.186 0.674 2.085 0.554
Goat
175 29 16.57 1.192 0.666 2.132 0.554
Sheep
175 25 14.29
(P<0.05) significant
Overall highest tick prevalence was detected during Summer on all animals. The highest
prevalence in buffaloes was observed during Summer (55.50%) while lowest in Winter (18.50%)
seasons. In case of goats and sheep, the prevalence of ticks species in this zone was detected
least in Winter season (16.57 and 14.29%) and highest in Summer season (50.29 and 55.43%),
followed by Spring (44.00 and 30.29%) and Autumn season (24.57 and 18.86%), respectively.
The prevalence of ticks showed in Summer and Winter seasons non-significant (p>0.05)
differences were detected in all animals while highly significant (p<0.00) differences in Spring
season in case of all observed animals. The ticks prevalence in Autumn season showed highly
significant (p<0.00) differences in case of observed buffaloes and cows but non-significant
(p>0.05) differences were showed in goats (table 4.5).
51
Table 4.6. Animal-wise prevalence with respect to different seasons for Central zone.
Season
Animal
Total Infected Prevalence
(%)
Odds Ratio Confidence Interval 95% P-value
Lower limit Upper limit
Spring Buffalo 200 101 50.50 2.480 1.617 3.805 0.000
Cow
200 109 54.50 2.912 1.897 4.471 0.000
Goat
175 81 46.29 2.095 1.348 3.257 0.001
Sheep
175 51 29.14
Summer Buffalo 200 127 63.50 1.606 1.062 2.428 0.025
Cow
200 131 65.50 1.753 1.156 2.656 0.008
Goat
175 101 57.71 1.260 0.826 1.921 0.283
Sheep
175 91 52.00
Autumn Buffalo 200 73 36.50 2.004 1.268 3.168 0.003
Cow
200 81 40.50 2.374 1.507 3.739 0.000
Goat
175 66 37.71 2.112 1.321 3.376 0.002
Sheep
175 39 22.29
Winter Buffalo 200 45 22.50 1.349 0.809 2.247 0.251
Cow
200 49 24.50 1.507 0.910 2.496 0.111
Goat
175 37 21.14 1.245 0.732 2.119 0.418
Sheep
175 31 17.71
(P<0.05) significant
The overall tick prevalence in buffaloes and cows in this zone was detected maximum in
Summer season (63.50% and 65.50%) followed by Spring (50.50% and 54.50%), Autumn
(36.50% and 40.50%) and was least in Winter (22.50% and 24.50%). In this zone the prevalence
of ticks in goats was noted highest in Summer season (57.71%) followed by Spring (46.29%),
Autumn (37.71%) and was least in Winter (24.50%). In case of sheep the tick species prevalence
in this zone was observed maximum in Summer season (52.00%) and was least in Winter season
(17.71%), respectively. The prevalence of ticks in Central zone non-significant (p>0.05)
differences were noticed in Winter seasons in all observed animals while in Spring and Autumn
season highly significant (p<0.00) differences were noticed in all examined animals as shown in
table 4.6.
52
Table 4.7. Animal-wise prevalence with respect to different seasons for Northern zone.
Season
Animal
Total Infected Prevalence
(%)
Odds Ratio Confidence Interval 95% P-value
Lower limit Upper limit
Spring Buffalo 200 75 37.50 1.543 0.997 2.388 0.052
Cow
200 87 43.50 1.980 1.285 3.051 0.002
Goat
175 63 36.00 1.446 0.921 2.273 0.109
Sheep
175 49 28.00
Summer Buffalo 200 109 54.50 1.674 1.111 2.521 0.014
Cow
200 117 58.50 1.970 1.305 2.973 0.001
Goat
175 89 50.86 1.446 0.948 2.205 0.087
Sheep
175 73 41.71
Autumn Buffalo 200 53 26.50 2.383 1.389 4.086 0.002
Cow
200 73 36.50 3.799 2.248 6.419 0.000
Goat
175 49 28.00 2.570 1.485 4.449 0.001
Sheep
175 23 13.14
Winter Buffalo 200 31 15.50 1.506 0.817 2.775 0.189
Cow
200 57 28.50 3.273 1.857 5.768 0.000
Goat
175 37 21.14 2.201 1.210 4.006 0.010
Sheep
175 19 10.86
(P<0.05) significant
For the ticks prevalence in Spring season, highly significant (p<0.00) differences in cows
and significant (p>0.05) differences were observed in buffaloes. In case of goats in Spring season
non-significant (p>0.05) differences were found. In Summer and Autumn the highly significant
(p<0.00) differences were noticed in all animals except goats the non-significant (p>0.05)
differences were noticed in Summer season. In winter season the non-significant (p>0.05)
differences were observed in buffaloes while the highly significant (p<0.00) differences were
recorded in case of cows and goats table 4.7. The overall prevalence of tick species in buffaloes
in this zone was observed maximum in Summer season (54.50%) followed by Spring (37.50%),
in Autumn (26.50%) and was least in Winter (15.50%). In this zone the prevalence of ticks in
cows was highest in Summer season (58.50%) as shown in table 4.7.
53
Table 4.8. Area-wise prevalence with respect to different Animals for Spring season.
Animal
Zone Total Infected Prevalence
(%)
Odds Ratio Confidence Interval 95% P-value
Lower limit Upper limit
Buffalo Southern 200 87 43.50 1.283 0.860 1.915 0.222
Western
200 91 45.50 1.391 0.933 2.074 0.105
Central
200 101 50.50 1.700 1.142 2.533 0.009
Northern
200 75 37.50
Cow Southern 200 92 46.00 1.106 0.746 1.641 0.615
Western
200 97 48.50 1.223 0.825 1.813 0.316
Central
200 109 54.50 1.556 1.049 2.308 0.028
Northern
200 87 43.50
Goat Southern 175 67 38.29 1.103 0.715 1.702 0.658
Western
175 77 44.00 1.397 0.909 2.146 0.127
Central
175 81 46.29 1.532 0.998 2.351 0.051
Northern
175 63 36.00
Sheep Southern 175 59 33.71 1.308 0.830 2.062 0.248
Western
175 53 30.29 1.117 0.704 1.772 0.638
Central
175 51 29.14 1.058 0.665 1.682 0.813
Northern
175 49 28.00
(P<0.05) significant
Table 4.8 shows the prevalence of tick in buffaloes from Southern, Western, Central and
Northern zones were 43.50%, 45.50%, 50.50% and 37.50%, respectively. In case of buffaloes
non-significant (p>0.05) differences were noted in Southern, Western and Northern zones while
the highly significant (p<0.00) differences in Central zone. In case of cows the ticks prevalence
in Southern, Western, Central and Northern zones were observed (46.00, 48.50, 54.50 and
43.50%), respectively. In cows the non-significant (p>0.05) differences were observed in
Southern, Western and Northern zones whereas the significant (p<0.05) differences were
recorded in Central zone. The tick prevalence in case of goats and sheep were observed (38.29
and 33.71%), (44.00% and 30.29%), (46.29% and 29.14%), (36.00% and 28.00%), respectively
in Southern, Western, Central and Northern zones.
54
Table 4.9. Zone-wise prevalence with respect to different animals for Summer season.
Animal
Zone Total Infected Prevalence
(%)
Odds Ratio Confidence Interval 95% P-value
Lower limit Upper limit
Buffalo Southern 200 102 51.00 0.869 0.587 1.287 0.483
Western
200 111 55.50 1.041 0.702 1.544 0.841
Central
200 127 63.50 1.452 0.973 2.168 0.068
Northern
200 109 54.50
Cow Southern 200 121 60.50 1.087 0.729 1.620 0.684
Western
200 127 63.50 1.234 0.825 1.846 0.306
Central
200 131 65.50 1.347 0.898 2.020 0.150
Northern
200 117 58.50
Goat Southern 175 99 56.57 1.259 0.826 1.918 0.284
Western
175 88 50.29 0.977 0.643 1.486 0.915
Central
175 101 57.71 1.319 0.865 2.011 0.198
Northern
175 89 50.86
Sheep Southern 175 93 53.14 1.585 1.039 2.418 0.033
Western
175 97 55.43 1.738 1.138 2.653 0.011
Central
175 91 52.00 1.514 0.992 2.309 0.054
Northern
175 73 41.71
(P<0.05) significant
In case of sheep significant (p<0.05) differences were recorded in Southern, Central,
Western and Northern zones whereas in buffaloes, cows and goats the non-significant (p>0.05)
differences were detected in Southern, Central, Western and Northern zones. Moreover, the
prevalence of ticks in buffaloes and cows in Southern (51.00 and 60.50%), Western (55.50 and
63.50%), Central (63.50% and 65.50%) and Northern zones (54.50 and 58.50%) were observed,
respectively. Therefore, in goats the ticks prevalence in Southern, Western, Central and Northern
zones were observed (56.57, 50.29, 57.71 and 50.86%), respectively. Ticks prevalence of in case
of sheep in Southern, Western, Central and Northern zones was observed (53.14, 55.43, 52.00
and 41.71%) respectively as showed in table 4.9.
55
Table 4.10. Zone-wise prevalence with respect to different animals for Autumn season.
Animal
Zone Total Infected Prevalence
(%)
Odds Ratio Confidence Interval 95% P-value
Lower limit Upper limit
Buffalo Southern 200 57 28.50 1.106 0.713 1.715 0.654
Western
200 65 32.50 1.335 0.867 2.056 0.189
Central
200 73 36.50 1.594 1.041 2.441 0.032
Northern
200 53 26.50
Cow Southern 200 73 36.50 1.000 0.666 1.502 1.000
Western
200 69 34.50 0.916 0.608 1.380 0.676
Central
200 81 40.50 1.184 0.791 1.772 0.411
Northern
200 73 36.50
Goat Southern 175 47 26.86 0.944 0.590 1.510 0.811
Western
175 43 24.57 0.838 0.520 1.349 0.466
Central
175 66 37.71 1.557 0.993 2.441 0.054
Northern
175 49 28.00
Sheep Southern 175 43 24.57 2.153 1.233 3.759 0.007
Western
175 33 18.86 1.536 0.860 2.742 0.147
Central
175 39 22.29 1.895 1.077 3.334 0.027
Northern
175 23 13.14
(P<0.05) significant (p>0.05) non-significant differences
For prevalence of ticks in buffaloes, the significant (p<0.05) differences in Central zone
while the non-significant (p>0.05) differences were observed in Southern and Western zones. In
Central zone significant (p<0.05) differences in goats however in Southern and Western zone
non-significant (p>0.05) differences were observed. Ticks prevalence in buffaloes and cow in
Southern (28.50 and 36.50%), Western (32.50 and 34.50%), Central (36.50 and 40.50%) and
Northern zones (26.50 and 36.50%) were observed respectively. Moreover, in goats the ticks
prevalence in Southern, Western, Central and Northern zones were found (26.86%, 24.57%,
37.71% and 28.00%), respectively as showed in table 4.10.
56
Table 4.11. Zone-wise prevalence with respect to different Animals for Winter season.
Animal
Zone Total Infected Prevalence
(%)
Odds Ratio Confidence Interval 95% P-value
Lower limit Upper limit
Buffalo Southern 200 37 18.50 1.237 0.733 2.089 0.425
Western
200 37 18.50 1.237 0.733 2.089 0.425
Central
200 45 22.50 1.583 0.954 2.627 0.076
Northern
200 31 15.50
Cow Southern 200 41 20.50 0.647 0.408 1.025 0.064
Western
200 33 16.50 0.496 0.306 0.804 0.004
Central
200 49 24.50 0.814 0.522 1.271 0.365
Northern
200 57 28.50
Goat Southern 175 39 22.29 1.070 0.643 1.778 0.795
Western
175 29 16.57 0.741 0.432 1.270 0.275
Central
175 37 21.14 1.000 0.599 1.671 1.000
Northern
175 37 21.14
Sheep Southern 175 33 18.86 1.908 1.038 3.506 0.037
Western
175 25 14.29 1.368 0.724 2.588 0.335
Central
175 31 17.71 1.768 0.956 3.267 0.069
Northern
175 19 10.86
(P<0.05) significant
Highly significant (p<0.00) differences were recorded in Western zone in cows while
non-significant (p>0.05) differences were detected in Southern, Central, Western and Northern
zones for tick prevalence in buffaloes and non-significant (p>0.05) differences were observed in
Southern and Central zones. In goats, non-significant (p>0.05) differences were recorded in all
Southern, Central, Western and Northern zones. Significant (p<0.05) differences in Southern
zone while non-significant (p>0.05) in Western and Central zones were observed in sheep. In
buffaloes, the prevalence of ticks in Southern and Western zones were recorded (18.50%), in
Central and Northern zones (22.50 and 15.50%), respectively. In case of cows, 20.50, 16.50,
24.50 and 28.50% ticks were observed in different zones as showed in table 4.11.
57
Table 4.12. Season-wise prevalence with respect to different zones for buffaloes.
Zone Season Total Infected Prevalence
(%)
Odds Ratio Confidence Interval 95% P-value
Lower limit Upper limit
Southern Spring 200 87 43.50 3.392 2.155 5.337 0.000
Summer
200 102 51.00 4.585 2.918 7.205 0.000
Autumn
200 57 28.50 1.756 1.097 2.812 0.019
Winter
200 37 18.50
Western Spring 200 91 45.50 3.678 2.339 5.783 0.000
Summer
200 111 55.50 5.494 3.493 8.642 0.000
Autumn
200 65 32.50 2.121 1.334 3.372 0.001
Winter
200 37 18.50
Central Spring 200 101 50.50 3.514 2.280 5.415 0.000
Summer
200 127 63.50 5.992 3.862 9.298 0.000
Autumn
200 73 36.50 1.980 1.276 3.072 0.002
Winter
200 45 22.50
Northern Spring 200 75 37.50 3.271 2.028 5.276 0.000
Summer
200 109 54.50 6.530 4.067 10.483 0.000
Autumn
200 53 26.50 1.966 1.198 3.225 0.007
Winter
200 31 15.50
(P<0.05) significant
The highest prevalence was detected in Central zone (63.5%) during Summer season and
lowest in Northern zone (15.50%) during Winter season as showed in table 4.12. The ticks
prevalence in buffaloes in all seasons and zones were observed highly significant (p<0.00).
58
Table 4.13. Season-wise prevalence with respect to different zones for cows.
Zones Season Total Infected Prevalence
(%)
Odds Ratio Confidence Interval 95% P-value
Lower limit Upper limit
Southern Spring 200 92 46.00 3.304 2.124 5.139 0.000
Summer
200 121 60.50 5.940 3.805 9.271 0.000
Autumn
200 73 36.50 2.229 1.424 3.489 0.000
Winter
200 41 20.50
Western Spring 200 97 48.50 4.766 2.993 7.588 0.000
Summer
200 127 63.50 8.804 5.494 14.107 0.000
Autumn
200 69 34.50 2.666 1.660 4.281 0.000
Winter
200 33 16.50
Central Spring 200 109 54.50 3.691 2.411 5.650 0.000
Summer
200 131 65.50 5.851 3.789 9.035 0.000
Autumn
200 81 40.50 2.098 1.367 3.219 0.001
Winter
200 49 24.50
Northern Spring 200 87 43.50 1.932 1.275 2.926 0.002
Summer
200 117 58.50 3.536 2.332 5.363 0.000
Autumn
200 73 36.50 1.442 0.947 2.197 0.088
Winter
200 57 28.50
(P<0.05) significant
Table 4.13 showed the highest prevalence was observed in Central zone (65.50%) during
Summer season and lowest in Western zone (16.50%) during Winter season. Moreover, the
prevalence of ticks in cows in all seasons Spring, Summer, Winter and Autumn and in zones
including Southern, Central and Western were observed highly significant (p<0.00) except
Northern zone in Autumn season non-significant (p>0.05) differences were detected.
59
Table 4.14. Season-wise prevalence with respect to different zones for goats.
Zone Season Total Infected Prevalence
(%)
Odds Ratio Confidence Interval 95% P-value
Lower limit Upper limit
Southern Spring 175 67 38.29 2.163 1.354 3.457 0.001
Summer
175 99 56.57 4.543 2.854 7.231 0.000
Autumn
175 47 26.86 1.280 0.786 2.087 0.321
Winter
175 39 22.29
Western Spring 175 77 44.00 3.956 2.404 6.508 0.000
Summer
175 88 50.29 5.092 3.099 8.367 0.000
Autumn
175 43 24.57 1.640 0.969 2.777 0.066
Winter
175 29 16.57
Central Spring 175 81 46.29 3.214 2.011 5.137 0.000
Summer
175 101 57.71 5.091 3.179 8.151 0.000
Autumn
175 66 37.71 2.258 1.405 3.630 0.001
Winter
175 37 21.14
Northern Spring 175 63 36.00 2.098 1.303 3.378 0.002
Summer
175 89 50.86 3.860 2.416 6.166 0.000
Autumn
175 49 28.00 1.450 0.888 2.369 0.137
Winter
175 37 21.14
(P<0.05) significant
The highest prevalence was detected in Central zone (57.71%) during Summer season
and lowest in Western zone (16.57%) during Winter season as showed in table 4.14. Moreover,
the ticks prevalence in goats highly significant (p<0.00) differences were detected in Southern,
Central, Western and Northern zones with respect to Spring and Summer seasons whereas in
Autumn season in Southern, Western and Northern zones non-significant (p>0.05) differences
were noted.
60
Table 4.15. Season-wise prevalence with respect to different zones for sheep.
Zone Season Total Infected Prevalence
(%)
Odds Ratio Confidence Interval 95% P-value
Lower limit Upper limit
Southern Spring 175 59 33.71 2.189 1.339 3.578 0.002
Summer
175 93 53.14 4.880 3.016 7.897 0.000
Autumn
175 43 24.57 1.402 0.840 2.338 0.196
Winter
175 33 18.86
Western Spring 175 53 30.29 2.607 1.531 4.438 0.000
Summer
175 97 55.43 7.462 4.446 12.523 0.000
Autumn
175 33 18.86 1.394 0.790 2.461 0.251
Winter
175 25 14.29
Central Spring 175 51 29.14 1.911 1.151 3.172 0.012
Summer
175 91 52.00 5.032 3.088 8.201 0.000
Autumn
175 39 22.29 1.332 0.787 2.255 0.286
Winter
175 31 17.71
Northern Spring 175 49 28.00 3.193 1.789 5.699 0.000
Summer
175 73 41.71 5.876 3.346 10.319 0.000
Autumn
175 23 13.14 1.242 0.650 2.374 0.511
Winter
175 19 10.86
(P<0.05) significant
The prevalence of ticks in goats highly significant (p<0.00) differences were noted during
Spring and Summer in all zones whereas during Autumn season from all zones non-significant
(p>0.05) differences were detected. The highest prevalence was observed in Western zone
(55.43%) during Summer season and lowest in Northern zone (10.86%) during Winter season as
shown in table 4.15.
61
4.3 Identification of tick species
Livestocks containing sheep, goats, buffaloes and cows were detected infected with
several ticks species, from four agro ecologic regions of Punjab. From four genera (Hylomma,
Rhiciphalus, Boophilus and Argas) ten species were identified. Identified species from the
selected regions from Punjab, Pakistan were Hy. anatolicum (Koch, 1844), Hy. dromedarii
(Koch, 1844), Hy. truncatum (Koch, 1844), Hy. marginatum (Koch, 1844) Hy. rufipes (Koch,
1844), Rh. (Boophilus) microplus (Canestrini, 1888), Boophilus decoloratus (Koch, 1844), Rh.
appendiculatus (Neuman, 1901), Rh. sanguineus (Latreille, 1806), and Argas percicus (Oken,
1818). In the all four zones Hy. anatolicum was the most common tick species, while the second
common tick species was Hy. marginatum in all the zone in ruminants except sheep. Hy.
dromedarii were present in the Southern, Central and Western except Northern zone. Hy.
truncatum and Hy. rufipes not present in Southern, Central and Northern zones but were existing
only in Western zone of Punjab, Pakistan. Rh. sanguineus and Rh. appendiculatus both were
existing in three zones but in Northern zone only Rh. sanguineus was found while Rh.
appendiculatus was not observed. Both species Boophilus decoloratus, Boophilus microplus
were observed in all three zones while Boophilus microplus was present in other zone but
Boophilus decoloratus was not observed in Northern zones. Argas percicus was not detected in
all three regions except Central region. The chracters on the basis of which identification was
made of ticks of different genera are followings.
Hylomma
Mouth parts elongated, 2nd
segments of palps elongate
Scutum light to dark brown
Eyes present and convex
Hooped legs
Coxae of first pair of legs with long, protruding posteriorly directed spurs
Boophilus
Mouth parts very short
Eyes present but not visible
62
Conscutum frequently so poorly sclerotized that the dark pattern of caeca can be seen
from above
Rhipicephalus
Mouth parts short to medium length
Scutum usually uniformally brown
Eyes present
Coxae of first pair of legs with long, protruding posteriorly directed spurs
Argas
Mouth parts are small, ventral and not evident from above . They comprise a Central
toothed hypostome and a pair of pulps.
Camerstomal fold is unclear.
On dorsal side of the body the various symmetrically organized discs are present.
The lateral side sharp by row of quadrangular cells on both dorsal and ventral sides.
Dorsal view Ventral view
Figure 3. Dorsal view of Hy. dromedarii (female) which representing ISG (Irregular Scapular
Grooves), DS (Dark Scutum), PBL (Pale Banded Legs), SSP (Sparse Spot Distribution),
CS (Curved Scutum). Ventral view representing SL (Spurs on first pair of legs), GO (Genital
Orifice), AG (Anal Groove), LMP (Long Mouth Part), GG (Genital Groove), S (Spiracle), AO
(Anal Orifice).
ISG
DS
PBL
SSD
CS GO
AG
LMP
GG
S
AO
63
Dorsal view Ventral view
Figure 4. Dorsal view of Hy. truncatum (female) representing the LM (Long Mouth Part), DS
(Dark Scutum), CS (Curved Scutum), BL (Banded Legs), and CD (Caudal Depression). Ventral
view representing the GAS (Genital Aperture Semicircular), A (anus) and AP (Adnal Plates).
Dorsal view Ventral view
Figure 5. dorsal view Hy. rufipes representing DS (Dark Scutum), BL (Banded Legs), LM (Long
Mouth),CS ( Curved Scutum), DSS (Dark Setae on Spiracle) and DF (Dark Festoons) and ventral
view representing the VSGA (V Shape Genital Aperture), A (anus), AG (Anal Groove).
1 2
DS
BL
S
DS
BL
LM CS
CD
GAS
A
A
AP
DS
BL
LM
CS
DSS DF
VSGA
A
AG
64
Dorsal view Ventral view
Figure 6. Dorsal view of Hy. marginatum representing the PA (Porose Area), E (Eyes Present),
BL (Banded Legs), LMP (Long Mouth Part), CS (Curved Scutumn), F (Festoons Present) and
ventral view representing the GA (Genital Aperture), SP (Spiracular Plate), AA (Anus Aperture)
and APSE ( Adnal Plates Square Ends).
Dorsal view Ventral view
Figure 7. Hylomma annatolicum dorsal view representing the E (Eyes Present), CG (Cervical
Grooves), LG (Lateral Grooves), PP (Pale Parma) and ventral view representing the
GA (Genital Aperture), A (Anus), RAP (Rounded Adnal Plates) and SSAP (Small Sub Anal
Plates).
PA
E
BL
LMP
CS
F
GA
SP
AA APSE
E
CG
LG
PP
GA
A
RAP
SSAP
65
Dorsal view Ventral view
Figure 8. Dorsal view of Rhipicephalus appendiculatus representing SMP (Short Mouth Parts),
SC (Sclerotized Conscutum) and ventral view representing CA (Caudal Appendages), GO
(Genital Orifice) and A(Anus).
Dorsal view Ventral view
Figure 9. Dorsal view of Rhipicephalus sanguineus representing SC (Sharp Capituli), CG
(Caudal Grooves), BPA (Broad Prose Areas), MG (Marginal Grooves) and ventral view
representing GA (Genital Aperture), AO (Anal Opening), GG (Genital Grooves), AP (Adnal
Plates) and CP (Caudal Process).
SMP
SC
CA
GO
A
SC
CG
BPA
MG
GA
AO
GG
AP
CP
66
Dorsal view Ventral view
Figure 10. Boophilus microplus dorsal view representing SM (Short Mouth), E (Eyes Present),
DC (Dark Conscutum), CA (Caudal Appendages) and ventral view representing the GG (Genital
Grooves), GA (Genital Aperture), AG (Anal Groove).
Dorsal view Ventral view
Figure 11. Boophilus decoloratus dorsal view representing SM (Short Mouth), CG (Cervical
Groove), MG (Maiden Groove) and ventral view representing LAP (Long Adnal Plates), SP
(Spiracle Plates), AO (Anal Orifice).
SM
E DC
CA
GA
GG
AG
SM
CG
MG
LAP
SP
AO
67
Dorsal view Ventral view
Figure 12. Dorsal view of Argas percicus representing Soft tick belonging to family Argasidae
Oval shape, Mouth are present on ventral side, Leathry integument, Eyes absent and on dorsal
side of the body various symmetrical arranged discs are prese and vental view representing
ventraly small mouth parts, Genital orifice, Anus
68
Table 4.16. Prevalence of identified tick species in different farm animals in Southern zone
Punjab, Pakistan.
Ticks species
Buffaloes
NAE/NAI/NTC
Cows
NAE/NAI/NTC
Goats
NAE/NAI/NTC
Sheep
NAE/NAI/NTC Tick
species
(%) 800/283/1265 800/327/1690 700/252/1375 700/228/790
Hy. anatolicum 265 534 376 215 27.14
Hy. marginatum 196 432 324 0 18.59
Hy. dromeddari 210 0 144 0 6.91
Hy. trunctaum 0 0 0 0 0
Hy. rufipes 0 0 0 0 0
Rh. sanguineus 234 256 154 153 15.56
Rh. appendiculatus 170 237 190 0 11.66
B. microplus 125 155 187 243 13.86
B. decolaratus 65 76 0 179 6.25 NAE= Number of animals examined, NAI= Number of animals infested, NTC= Number of ticks collected
In case of Southern zone, the most common tick species was Hy. anatolicum (27.14%)
followed by Hy. marginatum (18.59%) while the least was B. decolaratus (6.25%) as shown in
the table 4.16. Hy. trunctaum, and Hy. rufipes were not found in this zone. Hy. marginatum, Hy.
dromedarii were not found on sheep in this zone.
69
Table 4.17. Prevalence of identified tick species in different farm animals in Western zone
Punjab, Pakistan.
Ticks species Buffaloes
NAE/NAI/NTC
Cows
NAE/NAI/NTC
Goats
NAE/NAI/NTC
Sheep
NAE/NAI/NTC
Tick
species
(%) 800/304/1685 800/326/3005 700/237/2680 700/208/1312
Hy. anatolicum 356 678 687 381 24.21
Hy. marginatum 234 329 346 0 10.46
Hy. dromedarii 0 155 312 0 5.37
Hy. trunctaum 178 354 0 0 6.12
Hy. rufipes 193 198 0 0 4.5
Rh. Sanguineus 256 554 467 354 18.78
Rh.appendiculatus 237 473 394 189 14.89
B. microplus 155 155 336 265 10.49
B. decolaratus 76 109 138 123 5.13
NAE= Number of animals examined, NAI= Number of animals infested, NTC= Number of ticks collected
The highest prevalence of Hy. anatolicum (24.21%) followed by Rh. sanguineus
(18.78%), Rh. appendiculatus (14.89%) and the least was Hy. rufipes (4.5%) as shown in table
4.16. Hy. trunctaum, Hy. marginatum, Hy. dromedarii and Hy. rufipes were not found in sheep
in this zone. Hy. trunctaum and Hy. rufipes were not found in case of goats in this zone.
70
Table 4.18. Prevalence of recognized tick species in several farm animals in Central zone
Punjab, Pakistan.
Ticks species Buffaloes
NAE/NAI/NTC
Cows
NAE/NAI/NTC
Goats
NAE/NAI/NTC
Sheep
NAE/NAI/NTC
Tick
species
(%) 800/364/1265 800/370/1690 700/285/1475 700/212/790
Hy. anatolicum 356 478 158 149 21.85
Hy. marginatum 232 229 123 0 11.18
Hy. dromedarii 123 155 123 0 7.68
Hy. trunctaum 0 0 0 0 0
Hy. rufipes 0 0 0 0 0
Rh. Sanguineus 178 215 234 154 14.96
Rh. appendiculatus 219 172 254 159 15.4
B. microplus 155 155 236 165 13.62
B. decolaratus 0 54 138 163 6.8
Argas percicus 0 232 209 0 8.45
NAE= Number of animals examined, NAI= Number of animals infested, NTC= Number of ticks collected
The highest prevalence of Hy. anatolicum (21.85%) followed by Rh. appendiculatus
(15.4%) and Rh. sanguineus (14.96%) and the least was B. decolaratus (6.8%) as shown in table
4.18. Hy. trunctaum, Hy. marginatum, Hy. dromedarii, Hy. rufipes and Argus percicus were not
found in sheep in this zone.
71
Table 4.19. Prevalence of recognized tick species in several farm animals in Northern zone
Punjab, Pakistan.
Ticks species Buffaloes
NAE/NAI/NTC
Cows
NAE/NAI/NTC
Goats
NAE/NAI/NTC
Sheep
NAE/NAI/NTC
Tick
species
(%) 800/268/702 800/334/925 700/238/659 700/164/430
Hy. anatolicum 206 378 237 181 36.89
Hy. marginatum 210 229 171 0 22.46
Hy. dromedarii 0 0 0 0 0
Hy. trunctaum 0 0 0 0 0
Hy. rufipes 0 0 0 0 0
Rh. Sanguineus 131 126 0 84 12.55
Rh. appendiculatus 0 0 0 0 0
B. microplus 155 192 251 165 28.09 NAE= Number of animals examined, NAI= Number of animals infested, NTC= Number of ticks collected
Table 4.19 showed the prevalence of recognized species of ticks in several farm ruminants in
Northern zone Punjab, Pakistan. Even a single tick of Hy. dromedarii, Hy. trunctaum, Hy.
rufipes and Rh. appendiculatus were not recorded from the animals of Northern zone. The
highest prevalence of Hy. anatolicum (36.89%) and Hy. marginatum (22.46%) were detected
from Northern zone.
Table 4.20. Analysis of variance for comparison of means.
Source of variation Degrees of
freedom
Sum of squares Mean squares F-value
Animal
Zones
Species
Error
Total
3
3
9
128
143
244981
452267
1434041
1070741
3202030
81660
161828
159338
8365
9.76**
19.35**
19.05**
** = Highly significant (P<0.01)
Table 4.20 showed the highly significant diffrences in between all ticks species which
were collected from the studied agroecological zones on different animals.
72
Table 4.21. Means betwwen animals, zones and tick species
Animal Mean SD SE
Buffaloes 136.53 B 108.79 18.13
Cows 203.06 A 182.96 30.49
Goats 171.92 AB 163.31 27.22
Sheep 92.28 C 111.84 18.64
Zone
Southern 142.22 B 138.77 23.13
Western 241.17 A 186.47 31.08
Central 130.45 B 113.01 17.87
Northern 84.88 C 107.87 19.07
Species
Argas percicus 110.25 BC 127.65 63.83
B. decolaratus 93.42 C 58.53 16.90
B. microplus 193.44 B 56.71 14.18
Hy. anatolicum 352.19 A 171.00 42.75
Hy. dromeddari 76.38 C 99.05 24.76
Hy. marginatum 190.94 B 135.79 33.95
Hy. rufipes 24.44 C 66.78 16.70
Hy. trunctam 33.25 C 96.37 24.09
Rh. Appendiculatus 168.38 B 142.77 35.69
Rh. Sanguineus 221.88 B 139.54 34.89
Means sharing similar letter are statistically non-significant (P>0.05).
Table 4.21 showed the comparison of means of animals, zones and tick species. In case
of animals, the highest numbers of tick species were found from cows followed by buffaloes,
goats and sheep. While in case of zones the highest number of tick species were observed in
Western zone. The most commonly found tick species was Hy. anatolicum and least tick species
was Hy. rufipes.
73
4.4. Selection of ticks for tick-borne pathogens
Through PCR assay, 675 samples (Southern zone 271, Western zone 98, Central zone
186 and Northern 120) were screened for the existing of DNA TBPs i.e. Theileria, Babesia,
Anaplasma, and Ehrlichia species.
Table 4.22. Complete prevalence of tick-borne pathogens in agro-ecologic zones of Punjab,
Pakistan.
AEZ NPP/NPT Theileria
spp.
Babesia
spp.
Anaplasma
spp.
Ehrlichia
spp.
Prevalence
(%)
95%
Confidence
Interval
Southern 113/271 26 8 16 63 41.69% 35.76-47.82
Western 34/98 13 6 9 6 34.69% 25.36-44.98
Central 67/186 13 8 22 24 36.02% 29.13-43.37
Northern 45/120 9 6 15 15 37.5% 28.83-46.80
Total 259/675 61 (9.0%) 28 (4.1%) 62 (9.1%) 108 (16%) 38.37% 34.68-42.16
NPP= No of poles positive, NPT= No of poles tested. Fisher’s exact test shown significant difference
among four agro-ecologic zones.
The prevalence of overall evaluations of TBPs in all agro-ecologic zones was
significantly different. Highest prevalence was found of Ehrlichia spp (16%) followed by
Anaplasma spp. (9.1%), Theileria spp. (9.03%) and Babesia spp. (4.14%) as showed in table
4.22.
74
Table 4.23. The complete prevalence of TBPs in Southern, Western, Central and Northern
zones.
AEZ Name of species NPP/NPT Theileria
spp.
Babesia
spp.
Anaplasma
spp.
Ehrlichia
spp.
Prevalence (95% CI)
Southern 113/271 26 8 16 63 41.69%, 35.76-47.82
Hy.anatolicum 95/201 23 5 12 55
Hy .marginatum 0/5 0 0 0 0
Hy. dromedarii 5/18 1 0 1 3
Rh. Sanguineus 3/11 0 1 2 0
Rh. appendiculatus 0/3 0 0 0 0
B. microplus 9/29 2 1 1 5
B. decolaratus ¼ 0 1 0 0
Western 34/98 13 6 9 6 34.69%, 25.36-44.98
Hy. anatolicum 14/37 7 2 5 0
Hy. marginatum 2/10 1 1 0 0
Hy. dromedarii 4/12 0 0 1 3
Rh. Sanguineus 5/14 2 1 2 0
Rh. appendiculatus 1/3 1 0 0 0
B. microplus 7/15 2 1 1 3
B. decolaratus 1/7 0 1 0 0
Central 67/186 13 8 22 24 36.02%, 29.13-43.37
Hy.anatolicum 24/79 4 3 2 15
Hy.marginatum 0/3 0 0 0 0
Hy. dromedarii 1/6 1 0 0 0
Rh. Sanguineus 1/5 1 0 0 0
Rh. appendiculatus 0/4 0 0 0 0
B. microplus 41/87 7 5 20 9
B. decolaratus 0/6 0 0 0 0
Northern 45/120 9 6 15 15 37.5%, 28.83-46.80
Hy.anatolicum 14/29 2 2 1 9
75
Hy.marginatum 0/2 0 0 0 0
Hy. dromedarii 1/3 0 1 0 0
Rh. Sanguineus 1/5 0 0 1 0
Rh. appendiculatus 0/4 0 0 0 0
B. microplus 29/73 7 3 13 6
B. decolaratus 0/4 0 0 0 0
Total 259/675 61 28 62 108 38.37%, 34.68-42.16
AEZ= Agro ecological zone, NPP= Number of poles positive, NPT= Number of poles tested
The overall infection ratio of (i.e. the infected tick pools proportion) TBPs (Table 4.23)
was maximum in Hy. anatolicum (43.10%), followed by B. microplus (42.15%), Rh. Sanguineus
(28.57%), Hy. dromedarii (28.20%), Hy. marginatum (10%), B. decolaratus (9.5%) and Rh.
appendiculatus (7.15%). In the Southern zone, the percentage of infected ticks was maximum in
Hy. anatolicum (47.26%) followed by B. microplus (31.03%), Rh. sanguineus (27.27%) and B.
decolaratus (2.5%), however in the Western zone, B. microplus ticks were found more
frequently infected (46.67%) followed by Hy. anatolicum (37.83%), Rh. sanguineus (35.71%),
Hy. dromedarii (33.3%), Hy. marginatum (30%) and B. decolaratus (14.28%). In the Central
zone, the percentage of infected ticks was maximum in B. microplus (47.12%) followed by Hy.
anatolicum (30.37%), Rh. sanguineus (20%) and Hy. dromedarii (16.67%), however in the
Northern zone, Hy. anatolicum ticks were observed more frequently infected (48.27%) followed
by B. microplus (39.72%), Hy. dromedarii (33.34%) and Rh. sanguineus (20%).
Hy. dromedarii ticks were mostly infested with Ehrlichia spp. (15.38%), followed by
Theileria (5.12%), Anaplasma (5.12%) and Babesia spp. (2.51%). Ticks Hy. anatolicum were
mostly infested with Ehrlichia spp. (23.16%), followed by Theileria (10.55%), Anaplasma
(5.86%) and Babesia spp. (3.51%), however Hy. marginatum were similar infested with
Theileria and Anaplasma (5%). Rh. sanguineus was infested with Theileria (8.57%) followed by
Babesia spp. (5.71%) and Anaplasma (4.28%) whereas Rh. appendiculatus was only infested
with Theleria spp. (7.14%). Ticks B. microplus were mostly infested with Anaplasma spp.
(17.15%), followed by Ehrlichia (11.27%), Theileria (8.8%) and Babesia spp. (4.9%) whereas B.
decolaratus ticks were only infested with Babesia spp (9.52%). Hy. dromedarii ticks were
infected with Ehrlichia (33.3%) and Anaplasma spp. (11.1%). But Hy. marginatum, and Rh.
76
appendiculatus and B. decolaratus ticks were not found infested with Anaplasma and Ehrlichia
spp. Complete prevalence of TBPs in agro-ecologic zones of Punjab, Pakistan. In the Southern
zone, the percentage of infested ticks was maximum in Hy. anatolicum (47.26%) followed by
Boophilus (B.) microplus (31.03%), Rh. sanguineus (27.27%) and B. decolaratus (2.5%),
however in the Western zone, B. microplus ticks were found more frequently infested (46.67%)
followed by Hy. anatolicum (37.83%), Rh. sanguineus (35.71%), Hy. dromedarii (33.3%), Hy.
marginatum (30%) and B. decolaratus (14.28%). The ticks of Southern zone were mostly
infested with Ehrlichia spp. (23.24%) followed by Theileria spp. (9.59%), Anaplasma spp.
(5.90%) and Babesia spp. (2.95%). The complete prevalence of TBPs in the Southern zone at
95% confidence interval was recorded 41.69% (35.76-47.82). %). The ticks of Western zone
were mainly infested with followed by Theileria spp. (13.26%), Anaplasma spp. (9.18%),
Ehrlichia spp. (6.12%) and Babesia spp. (6.12%). The complete prevalence of TBPs in the
Western zone at 95% confidence interval was observed 34.69% (25.36-44.98). In Central and
Northern zone the prevalence of tick borne pathogens were recorded at 95% confidence interval
(36.02% and 37.50% at 29.13-43.37 and 28.83-46.80), respectively.
In the Central zone, the percentage of infested ticks (Table 4.23) was observed higher in
B. microplus (47.12%) followed by Hy. anatolicum (30.37%), Rh. sanguineus (20%) and Hy.
dromedarii (16.67%), however in the Northern zone, Hy. anatolicum ticks were detected further
frequently infested (48.27%) followed by B. microplus (39.72%), Hy. dromedarii (33.34%) and
Rh. sanguineus (20%). %). The ticks of Central zone were mainly infested with Ehrlichia spp.
(12.90%) followed by Anaplasma spp. (11.82%), Theileria spp. (6.98%), and Babesia spp.
(4.30%). The overall tick-borne pathogens prevalence in the Northern zone at 95% confidence
interval was observed 36.02% (29.13-43.37). The ticks of Western zone were mainly infested
with Ehrlichia spp. and Anaplasma spp. (12.5%), Theileria spp. (7.50%), and Babesia spp.
(5.0%). The complete tick-borne pathogens prevalence in the Northern zone at 95% confidence
interval was recorded 37.5% (28.83-46.80). The complete prevalence of TBPs in all the zones at
95% confidence interval was observed 38.37% (34.68-42.16).
77
Table 4.24. Species of Babesia, Theleria, Anaplasmoisis and Ehrlichia isolated from different tick species in Southern Zone Punjab; Pakistan.
Diseases TBP species Hy.
anatolicum
Hy.
marginatum
Hy.
dromeddari
Rh.
sanguineus
Rh.
appendiculatus
B.
microplus
B.
decolaratus
Prevalence
(%)
Theleriosis T. annulata 18 0 1 0 0 2 0 21 (7.74%)
T. ovis 0 0 0 0 0 0 0 0 (0.36)
T. orientalis 5 0 0 0 0 0 0 5 (1.84%)
Babesiosis B. bigemina 2 0 0 0 0 0 0 2 (0.73%)
B. bovis 0 0 0 1 0 0 0 1 (0.36)
B. caballi 5 0 0 0 0 0 0 5 (1.84%)
B. occultans 0 0 0 0 0 0 0 0
Anaplasmoisis A. Centrale 5 0 0 0 0 0 0 5 (1.84%)
A. marginale 5 0 0 2 0 1 0 8 (2.95%)
A. ovis 3 0 0 0 0 0 0 3 (1.10%)
Ehrlichiosis E. sp. 1 27 0 2 0 0 3 0 32 (11.80)
E. sp.
Omatjenne
25 0 1 0 0 5 0 31 (11.43)
The estimates of overall prevalence of several Theleria species were significant while estimates prevalence of Babesia species
were not significantly different in Southern zone, Punjab (Table 4.24). Among Theleria species, highest prevalence was found in T.
annulata (7.74%) as compared to T. orientalis (1.84%). T. annulata was found only in Hy. anatolicum, Hy. dromedarii and B.
microplus whereas T. orientalis was identified only in Hy. anatolicum. T. annulata was primarily found in (7.74%) Hy. anatolicum.
B. bigemina and B. caballi were observed only in Hy. anatolicum whereas B. bovis was detected only in Rh. sanguineus. The
estimates of overall prevalence of several Anaplasma species were significantly different in this zone. The prevalence of A. marginale
(2. 95%) was observed maximum followed by A. Centrale (1.84%) and A. ovis (1.10%) in this zone among Anaplasma spp.
Prevalence of A. Central and A. marginale was found highest in Hy. anatolicum and A. marginale was identified in Rh. sanguineus
and B. microplus too. A. ovis was detected only in Hy. anatolicum. Ehrlichia species prevalence estimate in this zone was found
significantly different.
78
Table 4.25. Species of Babesia, Theleria, Anaplasmoisis and Ehrlichia isolated from different tick species in Western Zone Punjab; Pakistan.
Diseases TBP species Hy.
anatolicum
Hy.
marginatum
Hy.
dromedarii
Rh.
sanguineus
Rh.
appendiculatus
B.
microplus
B.
decolaratus
Total
Theleriosis T. annulata 5 2 0 1 0 3 0 11(11.22%)
T. ovis 0 0 0 0 0 0 0 0
T. orientalis 2 0 0 1 0 0 0 3 (3.06%)
Babesiosis B. bigemina 0 0 0 0 0 0 1 1 (1.02%)
B. bovis 2 1 0 1 0 0 0 4 (4.08%)
B. caballi 0 0 0 0 0 0 0 0
Anaplasmoisis A. Centrale 0 0 0 0 0 0 0 0
A. marginale 5 0 0 2 0 1 0 8 (8.16%)
A. ovis 0 0 1 0 0 0 0 1 (1.02%)
Ehrlichiosis E. spp.
ERm58
0 0 2 0 0 3 0 5 (5.10%)
E. spp. Firat 0 0 0 0 0 0 0 0
E. spp.
Omatjenne
0 0 1 0 0 0 0 1 (1.02%)
Among Theleria species, highest prevalence was found in T. annulata (10.20%) as compared to T. orientalis (3.06%). T.
annulata was found in Hy. anatolicum, Hy. marginatum, Rh. sanguineus and B. microplus whereas T. orientalis was identified in Hy.
anatolicum and Rh. sanguineus. Theleria species was mainly present in Hy. anatolicum. The estimates of overall prevalence of several
Babesia species were significantly different in this zone B. bovis was found highest (4.08%) as compared to B. bigemina and B.
occultans (1.02%). B. bovis was mainly present in Hy. anatolicum. B. bigemina was found only in B. decolaratus. The estimates of
overall prevalence of several Anaplasma species were significantly different in this zone; Punjab. The prevalence of A. marginale
(8.16%) was maximum than A. ovis (1.02%). Prevalence of A. marginale was noted highest in Hy. anatolicum and A. ovis was only
identified in Hy. dromedarii. Ehrlichia species prevalence estimate in this zone was also found significantly different as shown in
table 4.25.
79
Table 4.26. Species of Babesia, Theleria, Anaplasmoisis and Ehrlichia isolated from different tick species in Central zone Punjab; Pakistan.
Diseases TBP
species
Hy.
anatolicum
Hy.
marginatum
Hy.
dromeddari
Rh.
sanguineus
Rh.
appendiculatus
B.
microplus
B.
decolaratus
Total
Theleriosis T.
annulata
2 0 1 0 0 0 0 3 (1.6%)
T. ovis 0 0 0 0 0 2 0 2
(1.075%)
T.
orientalis
2 0 0 1 0 5 0 8 (4.30%)
Babesiosis B.
bigemina
3 0 0 0 0 3 0 6 (3.22%)
B. bovis 0 0 0 0 0 2 0 2
(1.075%)
B. caballi 0 0 0 0 0 0 0 0
Anaplasmoisis A.
Centrale
0 0 0 0 0 3 0 3 (1.6%)
A.
marginale
2 0 0 0 0 15 0 17
(9.13%)
A. ovis 0 0 0 0 0 2 0 2
(1.075%)
Ehrlichiosis E. spp.1 7 0 0 0 0 5 0 12
(6.45%)
E. spp.
Omatjenne
8 0 0 0 0 4 0 12
(6.45%)
80
The estimates of overall prevalence of several Theleria species were significantly
different in Central zone, Punjab (Table 4.26). Among Theleria species highest prevalence was
found in T. orientalis (4.44%) followed by T. annulata (1.66%) and T. ovis (1.11%). T. ovis was
found only in B. microplus. T. annulata was observed in Hy. anatolicum and Hy. dromedarii
whereas T. orientalis was identified in Hy. anatolicum, Rh. sanguineus and B. microplus.
Theleria species was highly found in B. microplus.The prevalence of Babesia species was
highest in B. bigemina (3.33%) as compared to B. bovis (1.11%). The species of B. bigemina
was found in Hy. anatolicum and B. microplus while B. ovis were found only in B. microplus . B.
coballi was not detected in this zone. The estimates of overall prevalence of several Anaplasma
species were significantly different in this zone, Punjab (Table 4.26). The prevalence of A.
marginale (9.44%) was maximum, followed by A. Centrale (1.66%) and A. ovis (1.11%) in this
zone. Prevalence of Anaplasma species was found highest in B. microplus. Both A. ovis and A.
Centrale was only detected in B. microplus. Ehrlichia species prevalence estimate in this zone
was found significantly different. The prevalence of both E. spp. 1 and E. spp. Omatjenne was
similar (6.45%) and these were mainly present in Hy. anatolicum.
81
Table 4.27. Species of Babesia, Theleria, Anaplasmosis and Ehrlichia isolated from different tick species in Northern zone Punjab; Pakistan.
Diseases TBP
species
Hy.anatolicum Hy.marginatum Hy.
dromeddari
Rh.
sanguineus
Rh.
appendiculatus
B.
microplus
B.
decolaratus
Total
Theleriosis T.
annulata
1 0 0 0 0 1 0 2 (1.66%)
T. ovis 0 0 0 0 0 1 0 2 (1.66%)
T.
orientalis
1 0 0 0 0 5 0 6 (5.00%)
Babesiosis B.
bigemina
2 0 1 0 0 2 0 5 (3.33%)
B. bovis 0 0 0 0 0 1 0 1 (0.83%)
B. caballi 0 0 0 0 0 0 0 0
Anaplasmosis A.
Centrale
0 0 0 0 0 2 0 2 (1.66%)
A.
marginale
1 0 0 1 0 10 0 12
A. ovis 0 0 0 0 0 1 0 1 (0.83%)
Ehrlichiosi
E. spp. 1 4 0 0 0 0 3 0 7 (5.83%)
E. spp.
Omatjenne
5 0 0 0 0 3 0 8 (6.66%)
82
The estimates of overall prevalence of several Theleria species were significantly
different in Northern zone, Punjab (Table 4.27). Among Theleria species highest prevalence was
found in T. orientalis (5%) followed by T. annulata (1.66%) and T. ovis (1.66%). T. ovis was
found only in B. microplus. T. annulata and T. orientalis were identified in Hy. anatolicum and
B. microplus. Theleria species was highly found in B. microplus. The prevalence of Babesia
species was highest in B. bigemina (3.33%) as compared to B. bovis (0.83%). The species of B.
bigemina was observed in Hy. anatolicum, Hy. dromedarii and B. microplus while B. ovis were
found only in B. microplus. B. coballi was not detected in this zone. The estimates of overall
prevalence of several Anaplasma species were significantly different in this zone, Punjab (Table
4.27). The prevalence of A. marginale (10%) was maximum, followed by A. Centrale (1.66%)
and A. ovis (0.83%) in this zone. Prevalence of Anaplasma species was found highest in B.
microplus. A. marginale was detected in Hy. anatolicum and Rh. sanguineus. Prevalence of
Ehrlichia species estimate in this zone was found significantly different (p> 0.01). The highest
prevalence was detected in E. spp. 1 (6.66%) as compared to E. spp. Omatjenne (5.83%). Both
species were found in Hy. anatolicum and B. microplus.
83
Figure 13. showed the Anaplasma and Ehrlichia spp. M represent the molecular marker. 1-4
samples were loaded in agarose gel for the analysis of pathogens. A. marginale, A. ovis and
Ehrlichia spp were observed in loaded samples.
In figure 13 365bp showed A. marginale, 347bp showed A. ovis and 480bp showed Ehrlichia
species.
84
Figure 14. Agarose gel electropherosis for the presence of Babesia and Theileria spp.
In figure 14 480bp showed Babesia, and 470bp showed Theileria.
85
Figure 15. shows the Babesia and Theleria species M represent the molecular marker. 1-7
samples were loaded in agarose gel for the analysis of pathogens. B. bigemina, B. bovis, B.
caballi, T. annulata, A. ovis and T. orientalis were observed in loaded samples. Lane 7 was
negative control.
86
4.5. Control of tick species
Table 4.28. Lethal concentration of selected plant extracts against Hy. anatolicum
Plant extracts Time
(hrs)
LC50±SE Confidence interval at
95%
P value
Lower limit Upper limit
C. procera 24 12.25±2.26 9.14 21.39 0.04
48 10.77±2.53 7.42 24.98 0.39
72 5.91±1.02 3.97 8.62 0.25
96 2.57±0.92 0.11 4.26 0.07
B. rapa 24 11.87±2.04 8.99 19.56 0.02
48 9.60±1.93 6.83 17.87 0.26
72 5.66±1.07 3.54 8.5 0.07
96 2.47±0.81 0.39 3.95 0.05
S. nigrum 24 9.28±1.30 7.25 13.27 0.03
48 6.26±0.86 4.68 8.42 0.00
72 3.75±0.93 1.50 5.68 0.07
96 2.02±0.02 0.94 3.80 0.16
T. foenum-graecum 24 16.79±4.34 11.57 44.62 0.12
48 10.95±1.89 8.24 18.03 0.02
72 7.27±1.15 5.81 11.1 0.00
96 3.88±0.98 1.5 50.96 0.03
C. colocynthis 24 12.15±2.05 9.25 19.78 0.06
48 10.41±1.26 7.31 21.49 0.32
72 6.55±1.25 4.29 10.44 0.17
96 3.26±0.79 1.38 4.81 0.14
LC: Lethal Concentration; SE: Standard Error; CI: Confidence Interval
87
Different concentrations (0.75 or 1.5 or 3.00 or 6.00 or 12.00%) of selected plant extracts
were used to check the LC50 for tick species Hy. anatolicum. The table 4.28 shows that LC50
values of C. procera were 12.25, 10.77, 5.91and 2.57% for 24, 48, 72 and 96 hrs, respectively.
Above mentioned same concentrations of B. rapa were showed 11.87, 9.60, 5.66 and 2.47%
LC50 values after 24, 48, 72 and 96 hrs. S. nigrum showed the 9.28, 6.26, 3.75and 2.02% LC50
values were after 24, 48, 72 and 96 hrs time interval. Similar concentrations and time interval
were used for T. foenum graceum to evaluate LC50 values which were 16.79, 10.95, 07.27,
3.88% and 12.55, 10.41, 06.55and 3.26% for C. colocynthis. The result revealed that S. nigrum
showed the highest mortality in tick species and the time and dose dependent toxicological
effects on tick species.
88
Table 4.29. Lethal time of selected plant extracts against Hy. anatolicum
.
Plant extracts Conc.
(%)
LT50±SE
(hrs)
Confidence interval at
95% P value
Lower limit Upper limit
C. procera 0.75 134.58±2.28 103.7 332.08 0.28
1.50 99.04±1.89 77.92 189.75 0.91
3.00 72.88±1.28 52.78 119.74 0.87
6.00 58.40±1.21 38.54 76.92 0.03
12.00 39.88±0.92 9.44 54.48 0.02
B. rapa 0.75 134.58±2.28 103.7 332.08 0.28
1.50 101.92±1.97 81.19 182.66 0.13
3.00 66.79±1.26 46.94 96.76 0.92
6.00 51.08±1.08 27.91 66.79 0.81
12.00 38.99±0.71 9.89 53.21 0.68
S. nigrum 0.75 107.90±1.34 94.96 145.6 0.22
1.50 92.65±1.76 68.96 294.99 0.96
3.00 61.91±1.28 35.43 92.17 0.84
6.00 32.99±0.88 36.41 52.18 0.89
12.00 5.42±0.60 263.08 34.36 0.95
T. foenum-graecum 0.75 100.58±1.84 0.00 0.00 1.00
1.50 97.45±1.24 79.02 156.47 0.97
3.00 89.40±1.04 71.59 144.37 0.82
6.00 65.06±0.88 45.17 91.48 0.83
12.00 54.55±0.10 36.35 69.23 0.97
C. colocynthis 0.75 134.58±2.28 103.7 332.08 0.28
1.50 107.77±1.34 83.58 226.16 0.97
3.00 84.35±1.71 61.09 258.84 0.96
6.00 55.57±0.57 35.86 71.88 0.81
12.00 41.77±0.49 9.43 57.19 0.63
LT: Lethal Time; SE: Standard Error; CI: Confidence Interval
89
Table 4.29 displays the lethal concentration of selected plant extracts against tick species.
Different time intervals (24 hrs or 48 hrs or 72 hrs or 96 hrs) were used to check the LT50 for tick
species Hy. anatolicum. The table 4.29 shows that LT50 values of C. procera at 0.75, 1.5, 3.00,
6.00 or 12.00 % were 134.58, 99.04, 72.88, 58.40and 39.88 hrs, respectively. Above mentioned
same concentrations of B. rapa were showed 134.58, 101.92, 66.79, 51.08 and 38.99 hrs LT50
values after 24, 48, 72 and 96 hrs. S. nigrum showed the 107.90, 92.65, 61.91, 32.99 and 5.42 hrs
LT50 values were at 0.75, 1.5, 3.00, 6.00 or 12.00 %. Similar concentrations and time interval
were used for T. foenum-graceum to evaluate LT50 values which were 100.58, 97.45, 89.40,
65.06 and 54.55 hrs and 134.58, 107.77, 84.35, 55.57and 41.77 hrs for C. colocynthis. The result
showed that S. nigrum exhibited the highest mortality in tick species and the time and
concentration dependent toxicological effects on tick species.
Figure 16. Mortality (%) of Hy. anatolicum after 24, 48, 72 and 96 hrs against different
concentration of plants extract
0
10
20
30
40
50
60
70
80
90
100
C
ontr
ol
0.7
5%
1.5
0%
3.0
0%
6.0
0%
12.0
0%
0.7
5%
1.5
0%
3.0
0%
6.0
0%
12.0
0%
0.7
5%
1.5
0%
3.0
0%
6.0
0%
12.0
0%
0.7
5%
1.5
0%
3.0
0%
6.0
0%
12.0
0%
0.7
5%
1.5
0%
3.0
0%
6.0
0%
12.0
0%
C. procera B. rapa S.nigrum T. foenum
graecum
C. colocynthis
% M
ort
ali
ty
Used Plants
24 hours 48 hours 72 hours 96 hours
90
The percent mortality of tick species Hy. anatolicum with different concentration (0.75,
1.5, 3.00, 6.00 and 12.00 %) of plants extract at different post treatment time intervals i.e. 24, 48,
72 and 96 hrs were shown in figure 16. As the time and concentration of extract increased, the
mortality of tick also increased. Percent mortality of tick species were time and concentration
dependent. After 96 hrs the percent mortality of tick species Hy. anatolicum was seen about 85%
for B. rapa and S. nigrum at 12.00 % concentration of extract. In C. procera percent mortality
was observed 83% after 96hrs at 12.00 % concentration of extract while in case of T. foenum-
graecum (74%) and C. colocynthis (83%) percent mortality was observed after 96hrs at 12.00 %
concentration of plants extract.
Table 4.30. Lethal concentration of selected acaricides against Hy. anatolicum.
Acaricides Time
(hrs)
LC50±SE Confidence interval at 95% P value
Lower limit Upper limit
Cypermethrin 24 2.38±0.41 1.68 3.64 0.28
48 1.77±0.88 6.47 3.81 0.00
72 2.70±2.47 56.79 0.002 0.00
96 2.10±1.23 7.75 0.51 0.00
Emamectin 24 2.64±0.64 1.64 6.11 0.42
48 0.74±0.32 0.16 1.32 0.17
72 0.178±0.244 0.56 0.56 0.06
96 0.176±0.118 0.28 0.34 0.96
Fipronoil 24 83.59±12.42 64.65 147.12 0.73
48 0.76±0.19 0.28 1.12 0.50
72 0.31±0.14 0.12 0.55 0.91
96 0.15±0.12 0.33 0.33 0.85
LC: Lethal Concentration; SE: Standard Error; CI: Confidence Interval
Different concentrations (0.25 or.5 or 1.00 or 2.00 or 4.00%) of selected acaricides were
used to check the LC50 for tick species Hy. anatolicum. The table 4.30 shows that LC50 values of
Cypermethrin were 2.38, 1.77, -2.70, and -2.10% for 24, 48, 72 and 96 hrs, respectively. Above
mentioned same concentrations of Emamectin were showed 2.64, 0.74, 0.178 and 0.176 % LC50
values after 24, 48, 72 and 96 hrs. Fipronoil showed the 83.59, 0.76, 0.31 and 0.15 % LC50
91
values were after 24, 48, 72 and 96 hrs time interval. The result revealed that cypermethrin
showed the highest mortality in tick species Hy. anatolicum and the time and dose dependent
toxicological effects on tick species.
Table 4.31. Lethal time of selected Acaricides against Hy. anatolicum
Acaricides
Concen.
%
LT50±SE
hrs
Confidence interval at 95% P value
Lower limit Upper limit
Cypermethrin 0.25 99.43±1.35 78.84 180.75 0.92
0.5 51.52±0.14 39.48 61.5 0.63
1.00 35.87±0.02 22.84 44.56 0.17
2.00 25.98±0.29 7.28 35.96 0.34
4.00 16.50±0.37 12.95 28.7 0.48
Emamectin 0.25 88.64±1.42 68.17 178.7 0.00
0.5 54.55±1.10 36.35 69.23 0.00
1.00 30.81±0.76 1.78 44.34 0.04
2.00 25.53±0.38 9.73 14.19 0.01
4.00 19.92±0.67 1.95 30.01 0.91
Fipronoil 0.25 88.64±1.42 68.17 178.7 0.01
0.5 53.74±0.38 38.02 66.59 0.01
1.00 8.20±0.09 43.04 28.87 0.60
2.00 23.62±0.94 5.48 32.95 0.72
4.00 0.28±0.18 240.77 17.18 0.95
LT: Lethal Time; SE: Standard Error
Different time intervals (24 hrs or 48 hrs or 72 hrs or 96 hrs) were used to check the LT50
for tick species Hy. anatolicum. The table 4.31 showed that LT50 values of cypermethrin at 0.25,
.50, 1.00, 2.00 or 4.00 % were 99.43, 51.52, 35.87, 25.98 and 16.50 hrs, respectively. Similar
concentrations and time interval were used for Emamectin to evaluate LT50 values which were
88.64, 54.55, 30.81, 25.53 and 19.92 hrs and 88.64, 53.74, 8.20, 23.62 and 0.28 hrs for Fipronoil
The result showed that Fipronoil exhibited the highest mortality in tick species Hy. anatolicum
and the mortality is time and concentration dependent toxicological effects on tick species.
92
Figure 17. Mortality (%) of Hy. anatolicum after 24, 48, 72 and 96 hrs against different concentration of
acaricides
Percent mortality of Hy. anatolicum tick species were recorded with the application of
different concentrations (.25, .5, 1.00, 2.00 & 4.00%) of acaricides i.e. cypermethrin, emamectin
and fipronoil. Mortality was recorded after different time intervals 24 hrs, 48 hrs, 72 hrs and 96
hrs. In case of all used acaricides i.e. cypermethrin, fipronoil and emamectin mortality was
recoded 100% after 96hrs of time interval and at 4.00% concentration of used acaricides. We
observed from the results that percent mortality was concentration and time dependent.
0
20
40
60
80
100
120
Con
tro
l
0.2
5%
0.5
0%
1.0
0%
2.0
0%
4.0
0%
0.2
5%
0.5
0%
1.0
0%
2.0
0%
4.0
0%
0.2
5%
0.5
0%
1.0
0%
2.0
0%
4.0
0%
Cypermethrin Emamectin Fipronoil
% M
ort
ali
ty
Acaricides tested in the study
24 hours 48 hours 72 hours 96 hours
93
4.6. Phytochemical analysis
Phytochemical analysis of five selected plants i.e C. procera, B. rapa, T. foenum-
graecum, S. nigrum and C. colocynthis presented in (table 4.26). The results revealed the
presence of medically active constituents in the studied plants. Flavonoids, terpenoids and
alkaloids were present in all studied plants while steroids were found in all except C. procera.
Phenols, saponins and tanins have been recognized for many biological effects. The methanolic
extracts of these plants are evaluated in-vitro for their acaricidal activity against ticks.
Table 4.32. Qualitative phytochemical analysis of selected plants.
Sr.
No
Selected
plant
species
Common
Name
Plant
Part
Alkaloids Flvonoids Steroids Terpenoids Tannins Saponins Phenols
1 C.
procera
Auk Leaves,
flowers
and
stem
+ ++ - + - + +
2 B. rapa Surso Leaves,
flowers
and
stem
++ +++ + ++ + - +
3 T. foenum
-graecum
Maithe
Leaves,
flowers
and
stem
+ ++ + + - ++ -
4 S. nigrum Makoi Leaves,
fruit
and
stem
++ +++ + - ++ ++ -
5 C.
colocynthis
Kurtuma Fruit + ++ + + + + +
Sign; + weak positive, ++ low weak, +++ strong positive; - absent
94
DISCUSSION
In tropical and subtropical zone of the world ticks are the most significant pest of
ruminants (Admassu et al., 2015). On animal and human health ticks and TBDs have a vast
effect. Animals condition is effected from ticks by biting stress that is responsible for the
production loss, physical injury, poisoning, and pathogens distribution comprising rickettsia,
protozoa, viruses, spirochetes, bacteria and filarial nematodes (Satta et al., 2011; Gosh & Nagar
2014; Jabbar et al., 2015; Kaur et al., 2015). However, financial crisis associated with ticks are
generally due to the diseases which they spread to the host (Sultana et al., 2015). Economic
losses related with niggling irritation which results in reduction of the value of skins and furs (up
to 20-30%) are also important (Sultana et al., 2015). The current study was conducted to evaluate
the tick prevalence, their control and the tick borne pathogens in four agro-ecological regions of
Punjab, Pakistan.
4.6. Prevalence of ticks in agro-ecologic zones
The results of current research showed that all the animals farms which studied were
observed infested with one or many species of ticks. Differences were existing in the ticks
prevalence infestation within farms of similar research zones. The ticks prevalence in Western
(35.83%), Central (40.43%), Southern (36.33%) and Northern zones (33.47%) was observed.
These differences in prevalence of ticks were because of the topographical situation, temperature
and weather situations of several research part of Province, Punjab (Iqbal et al., 2014). The ticks
prevalence in earlier study from Pakistan did not study the agro-ecologic regions and were
centered on specific area merely (Jabbar et al., 2015) or variations in the ticks prevalence had
been described in several parts of the related region (Iqbal et al., 203). The data with respect to
the ticks prevalence in several animals species were noted in various seasons of the year. The
ticks Prevalence of infestation on different animals species in dissimilar seasons of the year in
Summer, Spring, Autumn and Winter was found 55.30%, 41.30%, 29.57% and 19.33%
respectively.
The results of the present research showed the utmost prevalence of ticks infestation in
Summer season because in Summer the climate was warm and moist that maintained the
existence of infestation of tick. Though, all over the year the animals remained infested with
ticks. Difference in tick infestation might be because of topographical situations and weather
95
circumstances of several research areas. Dissimilar environmental effects comprising humidity,
rainfall and temperature support the survival of tick in any zone (Greenfield et al., 2011), several
additional factors such as season, status of nutrition in animals, host availability (Teel et al.,
1996; Alonso et al., 2007) and agricultural aplications (Sajid et al., 2011) also influence ticks
infestation rate. The outcomes of present study were in similar with the previous studies of
Ghosh et al. (2007), Durrani and Shakoori, (2009), Rony et al. (2010), Sultana et al. (2015) and
Ali et al. (2016) who also reported highest ticks infestation in Summer season. The outcomes of
present study was also in line with Mustafa et al. (2014) who described the prevalence of ticks
highly from June to August and Atif et al. (2012) who observed the maximum ticks infestation
in the research zones of Sargodha district Punjab, Pakistan, in the months of June and July. The
results of current study were also in agreement with the results of Kabir et al. (2011) who found
more prevalence of ticks in Summer (41.66%) followed by Winter season (31.5%) in
Bangladesh.
In the present study total 12,000 animals (2800 goats, 2800 sheep, 3200 buffaloes and
3200 cows) were observed in 120 livestock farms in twelve districts of Punjab, Pakistan. The
results showed that the total ticks prevalence in animals was 36.52% (4382/12,000). The present
research had been carried out in four different seasons in various agro-ecologic zones of Punjab
to observe the ticks prevalence in livestock. The prevalence results of present study were in
agreement with the results of Iqbal et al. (2013) who reported prevalence of tick species 31%
from Pakistan. Though, the findings of this research were in contradicted with the findings of
Mustafa et al. (2014) who observed tick prevalence 85% in Sargodha district Punjab, Pakistan.
This variance in the ticks prevalence could be due to the difference in weather and topographical
conditions of the research regions, research times, target populations and husbandry rehearses
(Iqbal et al., 2014). In Africa and Asia, ticks prevalence in livestock was plentiful than the other
continents (Sajid et al., 2011). Higher tick infestation in these continents is due to the warmer
weather which supports favorable situations for the ticks development, difference in housing
panaches, farming rehearses and tactics for tick management.
It was noted that the prevalence of ticks in the province Punjab had been growing
quickly in previous few years, which could be because of the resistance of acaricides (Sajid et
al., 2008; Sajid et al., 2009a; Ali et al., 2013; Mustafa et al., 2014; Tasawar et al., 2014). The
96
acaricides resistance had been reported by Abbas et al. (2014) in tropical and subtropical areas of
the world however; in Pakistan no study has yet reported resistance of acaricides (Jabbar et al.,
2015). The prevalence was significantly maximum in the Central region in present research
because of highly temperature that presented optimal conditions for the tick growth as compared
to the Northern area where temperature was low.
Ticks prevalence in the current study areas were observed in animals in following order
cows>buffaloes>goats>sheep (42.41>37.53>36.14>29.00%), respectively. It was obvious with
the findings that the tick prevalence was considerably different between species of animal in the
present study which was in similar with the earlier studies of Ghosh et al. (2007) and Sajid et al.
(2008) who described the ticks prevalence higher in cows as compared buffaloes from lower
Punjab, Pakistan. The outcomes of current study revealed that in animals the prevalence of ticks
was highest in cows as compared to buffaloes, that was in agreement with the earlier studies of
Rehman et al. (2004), Sajid et al. (2009a) and Ali et al. (2013) who also reported the higher
prevalence of ticks in cows than buffaloes in Pakistan. The higher ticks prevalence in cows than
buffaloes may be related with the drier residences and thinner skin of cow than the marshy
habitations and denser buffaloes skin (Sajid et al., 2009a), and heredities of host could also show
a part (Jonsson et al., 1998). The ticks prevalence in cows was found 42.41 % in the current
study areas of Punjab, Pakistan which was statistically in line with the results of Perveen et al.
(2011) and Khan et al. (2013) which reported prevalence of ticks in cows was 48.35%, in
Pakistan.
The outcomes of current research were indisagreement with the outcomes of Sajid et al.
(2008), Sajid et al. (2009a), Soomro et al. (2014), Sultana et al. (2015) and Ali et al. (2016) who
reported the prevalence of ticks in Pakistan 75.1%, 72.9%, 22.38%, 55.5%, 71.9%,
correspondingly. In the present research, the ticks prevalence was 37.53% in buffaloes which is
statistically at per with the findings of Sajid et al. (2008), who described 40.1%, Sajid et al.
(2009a) who reported 47.3% & Perveen et al. (2011) who also described 43.85% respectively in
Pakistan. The results of this findings were contradict with Mustafa et al. (2014) and Rehman et
al. (2017), who described prevalence of ticks in buffaloes 84.3% & 81.44% respectively, in
Punjab, Pakistan while the results of current study were somewhat different from Ali et al.
(2016), Sultanta et al. (2015), Soomro et al. (2014), Tasawar et al. (2014) and Khan et al. (2013),
97
who reported prevalence of ticks 62.03%, 51.03%, 52.5%, 24.75%, and 51.65%, respectively in
Pakistan. The ticks prevalence in goats was observed 36.14% which was statistically in similar
with the findings of Irshad et al. (2010) who described 41.43% ticks prevalence in goats in
Islamabad and Riaz et al. (2017) who reported (43.6%) ticks prevalence in goats in Multan
districs Punjab, Pakistan. The findings were not in contract with the result of Manan et al. (2007)
12.1%, Sajid et al. (2008) 51.6%, Perveen et al. (2011) 14.8%, Mustafa et al. (2014) 86.5% and
Rehman et al. (2017), 60% respectively in Pakistan. Ticks prevalence in sheep was observed
29.00% which was in contrast by the results of Manan et al. (2007), Irshad et al. (2010), Perveen
et al. (2011), Riaz et al. (2017) and Rehman et al. (2017) which described the prevalence of ticks
in sheep 12.8%, 43.37%, 3.3%, 11.1% and 50.0% respectively, in Pakistan. Aasma et al. (2014)
observed the prevalence of ticks infestation in cattle followed by goats buffaloes and sheep
which was (60.5%, 25.9%, 17.8% and 14.8%), respectively in Egypt.
In the current study total 10 different ticks species were identified i.e. Hy. anatolicum
(25.92%), Hy. marginatum (14.05%), Hy. dromedarii (5.62%), Hy. truncatum (2.44%), Hy.
rufipes (1.79%), Rh. sanguineus (16.33%), Rh. appendiculatus (12.39%), B. microplus (14.2%),
B. decolratus (5.15%) and A. percicus (2.02%) respectively. On the basis of morphologic
characters the ticks were recognized. The identification of ticks in present study revealed that Hy.
anatolicum species was most plentiful in study areas. It parasitized all the sheep, goats, buffaloes
and cows in all four agro ecological zones. The findings of current study were in agreement with
Sajid et al. (2008), Sajid et al. (2009a), Perveen et al. (2011), Ali et al. (2013), Iqbal et al. (2014),
Sultana et al. (2015), Karim et al. (2017), Riaz et al. (2017) and Rehman et al. (2017) who
observed the high infestation rate of Hy. anatolicum in Punjab, Pakistan. The results of present
research were also in agreement from the neighboring states such as in Iran (Ganjali et al., 2014;
Hosseini-Chegeni et al., 2013; Nasiri et al., 2010) and in India (Chhillar et al., 2014) that the
most abundant tick species was Hy. anatolicum. The results of current research revealed that the
species of tick B. microplus was observed from all the livestock species in all agro-ecological
regions which is in line with the results of khan et al. (1993), Gosh et al. (2007), Sajid et al.
(2009a), Irshad et al. (2010), Perveen et al. (2011), Iqbal et al. (2014), Mustafa et al. (2014),
Tasawar et al. (2014) and Karim et al. (2017) who also observed B. microplus in the region of
Punjab, Pakistan.
98
Hy. marginatum was also detected from the study area Punjab; Pakistan. The outcomes of
present research were in agreement with the outcomes of Gosh et al. (2007), Mustafa et al.
(2014) and Iqbal et al. (2015) who also observed the presence of Hy. marginatum in Punjab,
Pakistan. The result of current research was also in agreement by the results of Hosseini-Chegeni
et al. (2013) and Gharekhani et al. (2015) who observed Hy. marginatum from Iran. Hy.
dromedarii was observed in the present study but Hy. dromedarii is limited to Bhakar and
Bahawalpur district in the Southern and Western zone. The most part of Bhakar and Bahawalpur
district comprises on deserts where the production of camel was common and Hy. dromedarii
species of tick is particular to fodder on camel. Therefore, the existence of Hy. dromedarii in
cows, buffaloes and goats except sheep might be transferred from camel. The results of my
findings were similar with the findings of Hussain and Kumar, (1985), Siddiqi and Jan, (1986)
Gosh et al. (2007), Perveen et al. (2011), Rehman et al. (2017 & Karim et al. (2017) who
reported Hy. dromedarii species in Pakistan. In Western Punjab, Pakistan, only Hy. truncatum
and Hy.rufipes were found which was not reported in other zones these results were in line with
the study of Gosh et al. (2007) who described Hy. truncatum and Hy.rufipes from Pakistan and
also in contract with the results of Karim et al. (2017) who described Hy. truncatum in Punjab,
Pakistan.
The findings of our research were also in agreement with the outcomes of Paul et al.
(2017) who observed this in Nigeria from cattle population and Hosseini-Chegeni et al. (2013)
who observed from Iran. In present study Rh. sanguineous specie was identified which was in
line with the findings of Khan et al. (1993), Durrani et al. (2008), Sajid et al., (2008), Sajid et al.
(2009a), Mustafa et al. (2014), Karim et al. (2017) and Riaz et al. (2017) who also reported that
presence in Punjab, Pakistan. The outcomes of this research were also in agreement with the
outcomes of Islam et al., (2006) who observed from Bangladesh, Kabir et al. (2011), Musa et al.
(2014) described from Nigeria, Monfared et al. (2015), Gharekhani et al. (2015) who reported
from Iran, and Hossain et al. (2016) from Bangladesh who reported Rh. sanguineous species
from the livestock population. The Rh. appendicluatus was identified from the 3 zones expect
Northern zone which may be due to the difference in weather and geographical conditions.
Earlier this species was reported only in one study Gosh et al. (2007) in Pakistan. The Rh.
decolratus was identified from the current study areas but in previous study this species was not
described. The Argas percicus was identified from the infested cow and goats from Central
99
Punjab. The findings of the current research were in line by the results of Khan et al. (2001) who
described Argas percicus from Faisalabad. The outcomes were also in line with the outcomes of
Qamar et al. (2009) and Shahnaz et al. (2016) who observed Argas percicus from poultry in
Punjab, Pakistan. Our findings were in line with the results of Singh and Chhabra (1973) and
Chhabra and Donora (1994) who reported Argas percicus in the other countries of world.
4.7. Tick-borne Pathogens
A wider range of contagious agents are transferred in livestock and humans by ticks as
well as they cause direct harms to domestic animals than other parasites (blood suckling
arthropod) (Munderloh et al., 2005). The pathogens i.e. fungi, protozoa, bacteria and viruses
were transmitted by ticks (de La Fuente et al., 2015). In animals, ticks and TBPs become the
cause of global economic loss annually which was estimated in dollars in billions (13.9 billion-
18.7 billion US$) (de Castro, 1997; Jongejan and Uilenberg, 2004). During last few years, a
number of TBDs (> 16) of humans and animals (about 19) had been identified (Sonenshine &
Roe, 2014), the variety of TBDs had been reported like ehrlichiosis, borreliosis, anaplasmosis
and rickettsiosis (Dantas-Torres et al., 2012). For the recognition of various new pathogens,
currently recognized molecular biological tools (Doudier et al., 2010; Dantas-Torres et al., 2012;
Ehounoud et al., 2016) and latest molecular diagnostic methods, like PCR are known to be
effective technique to accurately evaluate prevalence of pathogen and to recognize co-infected
hosts (Lorusso et al., 2016; Bilgic et al., 2017). In the current study, total 675 species of ticks i.e.
(Hy. anatolicum= 341, Hy. marginatum= 20, Hy. dromedarii= 39, Rh. sanguineus= 35, Rh.
appendiculatus= 14, B. microplus= 204 and B. decolaratus= 21) tick pools (Southern 271,
Western 98, Central 186 and Northern 120) were analysed by PCR methods for the existence of
DNA TBPs i.e. Theileria, Babesia, Anaplasma, and Ehrlichia species. The PCR primers in 16S
rRNA gene, V1 hyper-variable region was targeted by Anaplasma/Ehrlichia and in 18S rRNA
gene, V4 hyper-variable region was targeted by Babesia/Theileria, and all members of these
genera to date have been found to be conserved (Gubbels et al., 1999; Bekker et al., 2002).
Tick-borne pathogens were found in 259 pools out of complete 675 tick pools DNA from
one or more ticks. In the current study the total prevalence of tick-borne pathogens were
(38.37%) in the study areas in Punjab, Pakistan. Highest prevalence of pathogens was found in
Ehrlichia spp. (16%), followed by Anaplasma spp. (9.1%), Theileria spp. (9.03%) and Babesia
100
spp. (4.14%) respectively. The findings of current research showed that the prevalence of
Ehrlichia spp. in the Southern (23.24%) was significantly higher than in the Western (2.21%),
Central (8.85%) and Northern zone (5.53%). In all agro-ecologic zones of Punjab, Babesia spp.
was the minimum prevalent tick-borne pathogens both in buffaloes and cows the study area was
endemic for TBDs, also reported by (Durrani et al., 2008). For the diagnosis of tick borne
diseases in the previous studies mostly researchers in Pakistan depend on blood smear analysis.
Like this, the blood smear method was used for the detection of TBPs and their genetics which
was based on morphologic analysis (Jabbar et al., 2015). However, the more specific and
sensitive advanced molecular methods like PCR assay was used to differentiate multiple
pathogens instantaneously. Therefore, in the current study the molecular techniques were used
for the identification of tick-borne pathogens to develop more dependable record for upcoming
studies.
In the present study, three Anaplasma species were detected i.e. A. Centrale, A. ovis and
A. marginale in seven species of ticks from four agro-ecological zones of the study zones. The
findings of the current research showed the highest prevalence of A. marginale as compared to
the other Anaplasma species. In this research A. marginale was identified in Hy. anatolicum, Rh.
microplus and Rh. sanguineus ticks through PCR from study area. The results of the present
research was in line with the results of Ashraf et al. (2013) and Atif et al. (2013) who reported A.
marginale in bovines by blood smears method in Pakistan, and also by PCR-restriction fragment
length polymorphism (RFLP)-based study and serological process (complement-enzyme linked
immuno sorbent assay) (cELISA). The outcomes of current research were also similar with other
areas of the world pathogen has been identified in Rh. microplus ticks reported by (Pesquera et
al., 2015; Ehounoud et al., 2016).
In Pakistan a latest research explained that the Hyalomma and Rhipicephalus ticks might
be the possible vectors in the diffusion of Anaplasma species and was also reported by (Jabbar et
al., 2015). A. marginale has a universal spreading in subtropical and tropical areas in buffaloes
and cattle. It is considered that one of the utmost abundant TBPs causing high mortality and
morbidity (Kocan et al., 2010). All around the world, including Pakistan the majority of clinical
cases are due to pathogens (Sajid et al., 2014). In the current research a considerably maximum
prevalence of A. marginale is in the Central zone as compared to other zones (Southern, Western
and Northern) could be related to B. microplus with the maximum prevalence, which is mainly
101
accountable for the diffusion of A. marginale. The outcomes of current research were in line with
the findings of Rehman et al. (2017) who described A. marginale in Hy. anatolicum and B.
microplus in Punjab, Pakistan. The results of present research indicated that DNA of A. ovis was
existing in 7 (1.03%) tick pools. The findings of this research were in agreement with the study
of Talat et al. (2005) who observed the presence of A. ovis in small animals from KPK province
and Rehman et al. (2017) who reported A. ovis in Punjab, Pakistan. The outcomes of current
research was in linet with the results of Noaman (2012), Jalali et al. (2013) and Aktas (2014)
who described A. ovis in other parts of the world such as in Turkey and Iran. A. ovis infestions
had been molecularly confirmed. In this research, A. ovis was observed in Hy. dromedarii, Hy.
anatolicum, and B. microplus ticks. However, in Iran Hy. anatolicum had been latest revealed as
one of the significant vectors in charge for the diffusion of bovine anaplasmosis (Noaman, 2012;
Jalali et al., 2013).
In the current study, two Ehrlichia species, i.e. Ehrlichia sp. 1 and Ehrlichia sp.
Omatjenne were detected in three tick species (Hy. anatolicum, Hy. dromedarii and B.
microplus). In domestic animals, life-threatening diseases were caused by emerging and re-
emerging tick-borne pathogens i.e Ehrlichia species (Cabezas-Cruz et al., 2015). The outcomes
of the current study are statistically at per with results of Rehman et al. (2017) who reported
Ehrlichia species from Pakistan. Currently, an occasion report designated that Ehrlichia canis
ensued as a co-infection in a canine blood sample with Babesia gibsoni, but, the researchers used
only the blood smear analysis and for further confirmation of the species had not used any
molecular method (Abbas et al., 2015). The disease ehrlichiosis was not observed due to lack of
clinical and laboratory-based diagnostic method. However, the result of current study was also in
line with the border countries which reported many Ehrlichia species in tick samples in China
(Wen et al., 2002; Wen et al., 2003) and in India (Rani et al., 2011; Das & Konar, 2013).
However, Ehrlichia species was first time discovered in Canadian cattle blood samples
(Gajadhar et al., 2010) and later in Brazil was found in haemolymph of Rh. microplus ticks (Cruz
et al., 2012; Aguiar et al., 2014). The results of the present study showed that DNA from
Ehrlichia spp. was existing in Hy. anatolicum (79 tick pools), Hy. dromedarii (6) and B.
microplus (23). Additionally, in Pakistan this new Ehrlichia genetic factor was widely circulated
in all the agro-ecologic zones. The initial sequencing findings attained for the Ehrlichia spp.
recommend the existence of a potential novel Ehrlichia spp. Though, further research is
102
necessary to check whether this new genetic type relates to a new Ehrlichia species or if it is a
type of an earlier described species. The findings of current study that Ehrlichia spp. 1 was the
most mutual Ehrlichia species followed by Ehrlichia spp. Omatjenne. The findings of this
research were in agreement with the findings of Rehman et al. (2017) who observed Ehrlichia
spp fom Pakistan. The result of this study was also in agreement with the results of Aktas et al.
(2011) who described Ehrlichia spp. Firat was primarily found from Hy. anatolicum ticks
together from an animal housing in Turkey. However, Ehrlichia spp. Omatjenne was detected
from Hy. anatolicum, Hy. dromedarii and B.microplus ticks from all zone except Western zone.
In previous study Ehrlichia spp. Omatjenne was reported from Namibia, Ehrlichia spp.
Omatjenne first time detected from Hy. truncatum tick (Allsopp et al., 1997). Our outcomes
were also in line with the results of Mtshali et al. (2004) and Aktas and Özübek, (2015) who
reported Ehrlichia spp. Omatjenne in blood samples from naturally infested cow. The results of
present study revealed that Hy. anatolicum ticks could be a strong vector responsible for the
diffusion of Ehrlichia spp.
The results of this research revealed the existence of three babesia species i.e. B. caballi,
B. bigemina and B. bovis in five species of ticks (Hy. anatolicum, Hy. marginatum, Hy.
dromedarii, B. microplus and Rh. sanguineus) from Punjab province. The results of this research
were in line with the results of Chaudhry et al. (2010), Atif et al. (2012), Zulfiqar et al. (2012),
Ahmad et al. (2014) and Hussain et al (2014) who reported B. bovis and B. bigemina in blood
samples of bovine in Pakistan. The major influence of animal babesiosis was on dairy
production, though, it was also reported from other animal species, comprising dogs, horses,
goats, sheep and pigs (Chaudhry et al., 2010; Carter & Rolls, 2015). B. bovis is predominant in
Asia, Central and South America, Africa, Australia and Europe, however B. bigemina has been
described from the Far East Africa too (Bram, 2016). In the current study B. bovis and B.
bigemina were least observed in the Northern zone. The findings of this resarch were in
agreement with the results of Rehman et al. (2017) who observed B. microplus in Pakistan. The
outcomes of this research was also in agreement with the outcomes of Figueroa et al. (2010) and
OIE (2010) who reported that Rh. microplus ticks was the main vector for the transmission of B.
bovis and B. bigemina pathogens. Though, earlier findings from Pakistan sure the danger of
babesiosis in several species of animals with difference in prevalence approximate within various
areas of the country. The results of this work were in agreement with the findings of Rehman et
103
al. (2017) who observed B. bovis and B. bigemina in Pakistan. Previously is reported in China
(Yu et al., 2016) through the sequence analysis. In South Africa in 1981 Babesia occultans was
first time identified from Hyalomma marginatum rufipes (Gray & De Vos, 1981). Subsequently,
for a long time, the topographical dissemination of this species was only found to sub-Saharan
African countries (Dipeolu & Amoo, 1984; Ros-García et al., 2011), but previously this species
had been recognized in Hyalomma ticks and cattle blood from Tunisia - Northern Africa (Ros-
García et al., 2011), Southern part of Italy (Decaro et al., 2013), the Balearic Islands, Spain (Ros-
García et al., 2012), and Turkey (Aktas & Ozubek, 2015). Furthermore, in India the parasite had
been found in blood samples gathered from dogs (Mandal et al., 2014). In the current study B.
bigemina and B. caballi were most in the Southern region which may be because of the presence
of Hylomma ticks. The results of this study were in agreement with the results of Ros-García et
al. (2011), Ros-García et al. (2012), Aktas et al. (2014) and Orkun et al. (2014), who described
Hylomma ticks as the significant vector of B. bigemina and B. caballi pathogens.
In Pakistan the most studied bovine tick-borne disease was theileriosis. In the current
research three species of Theileria (T. ovis, T. annulata and T. orientalis) were observed from
five species of tick (Hy. anatolicum, Hy. dromedarii, Hy. marginatum, B. microplus and Rh.
sanguineus) from Punjab province. The findings of current study were in line by the results of
Durrani et al. (2012), Khattak et al. (2012), Ali et al. (2013) and Shahzad et al. (2013) who
observed T. ovis and T. annulata pathogens except T. orientalis in animal and tick species in
Pakistan. The findings of current study revealed the prevalence of T. annulata was maximum
(5.33%), followed by T. orientalis (3.25%), and T. ovis (0.59%). Between these species, T.
annulata was the most infectious and has many types which are largely dispersed in dissimilar
topographical areas of the globe. T. annulata yielded a serious and hypothetically lethal disease
in cows, consequential in significant losse of economy in the dairy sector in Asia and Africa
(Bishop et al., 2009; Jabbar et al., 2015). In exotic and hybridized cows the disease was more
severe, where the case-mortality level could range up to 80%, than the local cows, where the
death ratio was commonly about 20% (Jabbar et al., 2015). The results of current research were
in agreement with the results of Ali et al. (2013), Karim et al. (2017) and Rehman et al. (2017)
who described T. annulata in Hy. dromedarii and Hy. anatolicum ticks detached from cows. The
outcomes of this research were in similar with the outcomes of Ali et al. (2013) who observed T.
annulata in Hy. dromedarii and Hy. anatolicum ticks in cattle and buffaloes in Punjab, Pakistan.
104
The findings of this research were in similar with the findings of Durrani and Kamal, (2008) who
reported T. annulata in Punjab, Pakistan. The results of this study showed that Hyalomma spp. is
primarily responsible for dispersion of Theileria infestions in the animals population in Pakistan.
The current research characterizes the indication of the existence of T. orientalis in Pakistan.
While T. orientalis infestions have been recognized in cow, water buffaloes and African
buffaloes from all the main regions of the world (Chaisi et al., 2013; Sivakumar et al., 2014), as
well as bordering countries of Pakistan, e.g. Sri Lanka (Sivakumar et al., 2014) and India
(Aparna et al., 2011; Kakati et al., 2015). In previous studies T. orientalis was reported in several
countries comprising in India (Aparna et al., 2011), in Korea (Baek et al., 2003), in China (Liu et
al., 2011), in Japan (Yokoyama et al., 2012), in New Zealand (McFadden et al., 2011) and in
Australia (Islam et al., 2011; Eamens et al., 2013). It is indistinct how T. orientalis was presented
into Pakistan, but it might be wondered that this could have followed by the introduction of cows
from the Government of Victoria in Australia (Jabbar et al., 2015), wherever the pathogen
prevaled (Perera et al., 2014).
Thousands of dairy livestock were introduced to Pakistan and samples of blood from
these livestock are not observed by applying molecular techniques to check the piroplasms
earlier to transfer (Jabbar et al., 2015). Furthermore, it had earlier been recommended that in
cattle the prevalence and concentration of T. orientalis should be considered upon entrance to
Pakistan (Jabbar et al., 2015). Including this, there is a substantial prohibited live animal
transportation between India and Pakistan where it had been earlier observed (Appleby et al.,
2008; Kakati et al., 2015). In exotic animals the unintentional introduction of ticks in the
worldwide movement of live livestockhas also played a vital part for the transmission of species
of tick and tick-borne diseases (de La Fuente et al., 2015). The outcomes of current research
were in line with the results of Durrani and Kamal, (2008) who observed that T. orientalis was
mostly transferred by Haemaphysalis ticks that have been observed from bovines in Pakistan.
Therefore, the T. orientalis pathogen has been observed in Rh. microplus in Vietnam (Khukhuu
et al., 2011), in India (Kakati et al., 2015) and Dermacentor nuttalli in Mongolia (Altangerel et
al., 2011).
105
4.8. Tick control
Ticks are the important ectoparasite in many tropical and sub-tropical countries of the
world. In Pakistan the livestock is also at risk from being infected with several species of tick as
well as tick borne diseases that cause important economic loses. It shows one of the foremost
restrictions to cost-effective production. It is the vector of significant pathogens due to its direct
parasitic actions. Primary process of tick control is the use of synthetic acaricides so, it would be
vital to develop tactics to reserve the efficiency of existing acaricides. An extensive variety of
acaricides, such as arsenical, organophosphates, chlorinated hydrocarbons, synthetic pyrethroids
and carbamates are being applied for controlling cattle ticks (George et al., 2008). As acaricides
cause resistance development in ticks, environmental pollution, health hazards in animals and
human beings, so this study was proposed to check the efficacy of medicinal plants along with
acaricides. In the current study acaricides and medicinal plants were used to control species of
tick Hy. anatolicum.
The acaricides which used were cypermethrin, emamectin, fipronoil and medicinal plants
including C. procera, B. rapa, S. nigrum, C. colocynthis and T. foenum-graecum. These are most
abundantly used worldwide. In this study the results in vitro bioassays by adult immersion test
showed an efficacy of 100% cypermethrin, fipronoil and emamectin against the ticks.
Cypermethrin act on the membrane of nerve cells through re-polarization and close the Na+
channel gates. This action powerfully interrupts the nervous impulses transmission. Emamectin
and fipronoil works as a chloride channel activator by binding gamma aminobutyric
acid (GABA) receptor and glutamate-gated chloride channels disrupting nerve signals within
arthropods (Tingel et al., 2003; Barbara et al., 2005; Singh et al., 2012). At low concentrations
insects undergo hyperactive and at high concentrations paralyzed and die. The result obtained
strongly suggests that as the concentration of solution and time interval increased the percent
mortality also increased. These findigs are in similar with the previous researchers (Petro et al.,
2012 & Brito et al., 2011).
But with chemical acaricides, control of ticks had become difficult due to the
development of resistance (Rajput et al., 2006). However, these chemicals were also lethal and
costly (Abbas et al., 2014). Insecticide resistance and toxicity problems had forced researchers to
find an alternate to use plants as acaricides. Numerous secondary metabolites are produced from
plants to defend themselves from the constant attack of naturally occurring pathogens, pests and
106
insects. (Nithya et al., 2015). Over the earlier few years, the extracts of plant had been
extensively used to control ticks, mosquitoes and pests etc. It also kept several bio-efficacies
such as ovicidal, repellent and acaricidal activities. In developing countries about 80%
populations depend out on traditional medicines for treatment of various abnormartilies in
domestic animals as well in humans (FAO, 2004). In Asia more than 6500 species of medicinal
plants have been recognized (Rahuman, 2008). In contrast to artificial acaricides, natural herbal
mixtures have no residual effect, friendly flora and fauna, can easily biodegradable. The plants
have a variety of chemically active components which can disturb the life cycle of the insects,
and the plants recognize as an incorporated measure of ethno-veterinary rehearses (Habeeb 2010;
Zaman et al. 2012). The probability of using medicinal plants for the control of insects of
veterinary significance has been reviewed that a few plants were recognized as most encouraging
acaricide against ticks (Ghosh & Ravindran, 2014). The results of current study of
phytochemical analysis in selected plants i.e. C. procera, C. colocynths, B. rapa, S. nigrum and
T. foenum-graceum showed significant phytochemical compounds includings flavonoids,
alkaloids, terpenoids, steroids, tanins and saponins.
The previous readings also described the presence of phytochemical or bioactive
compounds in selected plants (C. procera, C. colocynths, B. rapa, S. nigrum and T. foenum-
graceum) (Mishra et al., 2016; Nora et al., 2015; Patil et al., 2015; Tiwari et al., 2014; Benariba
et al., 2013; Saddiqe et al., 2013; Shrivastava et al., 2013; Najafi et al., 2010 & Ahmad et al.,
2001). The results of current study of plant extract of selected plants C. procera, C. colocynths,
B. rapa, S. nigrum and T. foenum-graceum showed significant mortality against the cattle ticks
Hy. anatolicum. These selected plants were included in the study on the source of their described
acaricidal actions, easily available in the studied area and cost of their usage. The extract of all
these plants contained strong anti-tick activity. The mortality data of selected plants showed
percent mortality in following order S. nigrum>B. rapa>C. procera> C. colocynthis> T. foenum
graecum. The findings of present study showed that mortality of tick was time and concentration
dependent. The findings of present study were in line with the results of Morsy et al. (2001) who
observed the efficacy of B. rapa and C. procera extracts.
Hydroethanolic extract of root showed up to 20 % mortality in Rh. microplus after 72 hrs
of treatment reported by Gosh et al. (2011). Al-Rajhy et al. 2003 described the acaricidal activity
107
of C. procera against camel tick Hy. dromedarii and they observed that the acaricidal activity is
due to the inhibition of Na+, K+-ATPase in ticks. The findings of this study were in agreement
with the findings of Nithya et al. (2015) and Shyma et al. (2014) who observed the acaricidal
activity of C. procera against the tick B. microplus and this activity were related with time and
concentration dependent. The results of this study were in line with the results of Durrani et al.
(2009) who described that the animals infested with Theleria annulata also treated with C.
procera and animals were recovered from the treatment of C. procera. They observed the
activity of this plant against all forms of diseases. The latex of C. procera were contained the
anthelmintic activity reported by Iqbal et al. (2012). Reported the anthelmintic efficacy and for
the cure of parasitic infection (Murti et al., 2015) and (Cavalcante et al., 2016) also described C.
procera for the cure of parasites in small ruminants.
In Pakistan the previous studies reported that B. rapa and C. colocynthis had anti-
microbial and anti-parasitic activity through (Jabbar et al., 2006; Farooq et al., 2008; Hussain et
al., 2008; Sindhu et al., 2010 and Dilshad et al,. 2008). Mirania at al. (2016) reviewed that C.
colocynthis were also used to control ecto and endo-parasites of cattle and buffaloes. C.
colocynthis B. rapa were used to control the helminthiasis and infestation of different parasites
such as ticks, fly and lice described by Sindhu et al. (2012) and Babar et al. (2012) from Bhaker,
Pakistan reported B. rapa and C. colocynthis as parasitic activity to control ticks and
gastrointestinal parasites from animals. (Ullah et al., 2015) reprted that C. colocynthis have anti-
tick and parasitic activity and also assess its acaricidal activity to control Rh. microplus. The
results of current study were also in agreement with the results of Sindhu et al. (2012) who
described that T. foenum-graecum is used to control infestation of tick.
108
Chapter 5
SUMMARY
Ticks are cosmopolitan in spreading but mostly present in tropical and subtropical areas
of world. Pakistan is a tropical country which offers favourable environmental circumstances for
growth and development of ticks. Tick animals of Pakistan are rich in number of genera and
species. A total of 12,000 ruminants (2800 goats, 2800 sheep, 3200 buffaloes and 3200 cows)
were observed from 120 livestock farms from selected 12 districts, covering four agro-ecological
zones of Punjab, Pakistan comprised in the study differentiated by urban and rural locality. Ticks
were collected from selected animals during four seasons (Spring, Summer, Autumn and Winter)
of the year and stored in 70% methanol. Gathered ticks were observed under low power and then
highest power amplification of microscope. Identification of different adult ticks was
accomplished with the aid of the anatomical and morphologic features in the research lab using
dichotomizing and compound microscopes with respect to the guide. Ticks were identified at the
species level under a stereoscopic (OPTICA SZM-1: Italy) with 40-fold amplification. The total
prevalence of tick-infected animals was 36.52% (4382/12,000). Tick prevalence was
considerably least in the Northern zone (33.47%) than the 36.33% Southern, 35.83% Western
and 40.43% Central zones, respectively. The overall ten species of ticks were identified i.e. Hy.
anatolicum 25.92%, Hy. marginatum 14.05%, Hy. dromedarii 5.62%, Hy. truncatum 2.44%, Hy.
rufipes 1.79%, Rh. sanguineus 16.33%, Rh. appendiculatus 12.39%, B. microplus 14.2%, B.
decolratus 5.15% and A. percicus 2.02%. Hy. anatolicum and Hy. marginatum were the most
pravelent ticks spcies in all selected zones. Argas percicus was found only in Central zone. Hy.
truncatum and Hy. rufipes were observed only in Western zone. In all the selected districts
multiple species of ticks were found. . The total prevalence of infestation of ticks in all ruminants
was 36.52% and it was considerably dissimilar in all species of animal. It was obsrved in
buffaloes, cows, goats and sheep 37.53%, 42.41%, 36.14%, 29.00%, respectively. After
identification of ticks, 675 species of ticks i.e. (Hy. anatolicum= 341, Hy. marginatum= 20, Hy.
dromedarii= 39, Rh. sanguineus= 35, Rh. appendiculatus= 14, B. microplus= 204 and B.
decolaratus= 21) tick pools (Southern zone 271, Western zone 98, Central zone 186 and
Northern 120) were screened for the existence of DNA TBPs by PCR assay i.e. Theileria,
Babesia, Anaplasma, and Ehrlichia species. The prevalence of overall evaluations of TBPs in all
109
agro-ecologic zones was significantly different. Highest prevalence was found in Ehrlichia spp
(16%) followed by Anaplasma spp. (9.1%), Theileria spp. (9.03%) and Babesia spp. (4.14%).
There was no arithmetical significant difference detected between the Southern zone (41.69%,
CI: 35.76-47.82), Western zone (34.69%, CI: 25.36-44.98), Central zone 36.02%, CI: 29.13-
43.37) and Northern zone 37.5%, CI: 28.83-46.80) in the overall tick-borne pathogens
prevalence. The 3 species of anaplsma (A. Centrale, A. marginale and A. ovis) and 3 species of
babesis namely (B. bigemina, B. bovis and B. caballi) were identified. Moreover, 3 species of
theleria (T. annulata, T. ovis and T. orientalis) and 2 species of ehrlichia (E. sp 1 and E. sp.
Omatjenne) were identified from four agro-ecologic zones of Punjab, Pakistan. The infection
ratio of overall of TBPs was maximum in Hy. anatolicum (43.10%), followed by B. microplus
(42.15%), Rh. Sanguineus (28.57%), Hy. dromedarii (28.20%), Hy. marginatum (10%), B.
decolaratus (9.5%) and Rh. appendiculatus (7.15%). In the Southern zone, the percentage of
infested ticks was higher in Hy. anatolicum (47.26%) followed by B. microplus (31.03%), Rh.
sanguineus (27.27%) and B. decolaratus (2.5%), however in the Western zone, B. microplus
ticks were found more frequently infested (46.67%) followed by Hy. anatolicum (37.83%), Rh.
sanguineus (35.71%), Hy. dromedarii (33.3%), Hy. marginatum (30%) and B. decolaratus
(14.28%). In the Central region, the percentage of infested ticks was highest in B. microplus
(47.12%) followed by Hy. anatolicum (30.37%), Rh. sanguineus (20%) and Hy. dromedarii
(16.67%), however in the Northern region, Hy. anatolicum ticks were observed more frequently
infested (48.27%) followed by B. microplus (39.72%), Hy. dromedarii (33.34%) and Rh.
sanguineus (20%). It was concluded that there is broad diversity of ticks and TBPs is existent in
Pakistan as compared to especially in previous studies reported. The ticks were mostly controlled
by chemicals but in present study the significantly results showed that ticks can be controlled by
the extracts of selected plant (C. procera, C. colocynths, B. rapa, S. nigrum and T. foenum-
graceum) used in the study. It is estimated that the consequences of this research will be suitable
in the development of incorporated control policies for ticks and TBDs in Pakistan.
110
Conclusion
The research was aimed to check the prevalence of ticks and tick-borne pathogens in
Punjab, Pakistan.
Following conclusions were drawn from this study
From the different animal species i.e. buffaloes, cows, goats and sheep of Punjab, ten tick
species belonging to four genera i.e. Hy. anatolicum followed by B. microplus, Hy.
marginatum, Hy. dromedarii, Rh. sanguineus, Rh. appendiculatus and B. decolaratus,
Hy. rufipes, Hy. truncatum and Argas percicus were found. From the study results, we
revealed that Argas percicus was found only in Central zone of Punjab, while Hy. rufipes,
Hy. truncatum were found only in Western zone. We concluded that Hy. anatolicum
followed by B. microplus, Hy. marginatum were most dominant ticks on infected animals
of these zones.
The results revealed that the prevalence of tick infestation was related with ruminants
types, season and research zone. Highest tick prevalence was observed in Summer season
followed by Spring, Autumn and Winter.
The results of PCR assay confirmed the presence of Theleria, Babesia, Anaplasmoisis
and Ehrlichia species isolated from several species of ticks from all selected zones of
Punjab. Hy. anatolicum and B. microplus are the main vectors of these pathogens.
The use of acaricides (cypermethrin, emamectin and fipronoil) revealed 100% mortality
against Hy. anatolicum.
The use of extracts of selected plants (C. procera, B. rapa, C. colcynthis, S. nigrum and
T. foenum-graceum) showed significant mortality (85%) against Hy. anatolicum.
Phytochemical analysis of selected plants showed significant presence of phytochemical
compounds (flavonoids, alkaloids, terpenoids, steroids, tanins and saponins).
It is concluded that the chance of drug resistance against plants extract is lower than the
chemical acaricides. Consequently, medicinal plants extract are used for the management
of livestock parasitism. In developing countries this method is appropriate to control ticks
and much more economical as compared to using acaricides.
111
Recommendations
After a comprehensive study on the ticks prevalence, tick-borne pathogens and control
measure it could be recommended that
More sensitive analytical techniques (RLB) should be used to investigate epidemiological
research.
Awareness about the ticks and tick-borne pathogens should be given to livestock owners
to reduce infestation.
The mode of transmission of different pathogens should be investigated through
experimental studies.
The combined livestock husbandry with an open farming system and rural poultry should
be stimulated in small dairy owners to meet the challenge of optimum environmental
conditions in Pakistan.
In Pakistan CCHF virus is prevalent and its main vector i.e. Hyalomma ticks, is spread
throughout the country. Hence, however eradicating ticks physically, attention should be
assumed to the possible danger to humans due to the potential existence of CCHF virus in
the ticks. More significantly, alertness programs should be arranged to notify farmers
about the prospect of CCHF transmission through ticks. Furthermore, ticks should be
observed for the existence of CCHF virus.
Since the most of the recognized Ehrlichia species cause human diseases, it is
recommended that more research should be conducted to identify about their vector-
competence of different tick species, the pathogenicity of the identified Ehrlichia species
and latent suggestions to the health of animal and human. Moreover, human and
veterinary sciences should deliberate ehrlichiosis between the differential diagnoses when
tick-borne diseases are doubted.
The acaricidal resistance in ticks should be evaluated in Pakistan.
The alternative sources like medicinal plants (whole arial parts at flowering stage) should
be used to control infestation of ticks in animals
The farmer can also use concentrated aqueous extract of these plants to control ticks.
The movement of animals particularly from bordering areas into the country should be prohibited.
The imported animals should be screened out for the presence of TBD before entering in
Pakistan.
112
REFERENCES
Abbas, R. Z., Zaman, M. A., Colwell, D. D., Gilleard, J., & Iqbal, Z. (2014). Acaricide resistance
in cattle ticks and approaches to its management: The state of play. Veterniary
Parasitology, 203(1-2), 6-20.
Abbas, G., Mughal, M. N., Munir, A., & Azeem, W. (2015). Lahore canine fever in a racing
greyhound. Advances in Animal and Veterinary Sciences, 3, 332-333.
Abbott, W. S. (1925). A method of computing the effectiveness of an insecticide. Journal of
Economic Entomology, 18(2), 265-267. https://doi.org/10.1093/jee/18.2.265a
Adenubi, O. T., Fasina, F. O., McGawa, L. J., Eloff, J. N., & Naidoo, V. (2016). Plant extracts to
control ticks of veterinary and medical importance: A review. South African Journal of
Botany, 105, 178-193.
Admassu, B., Yeneneh, H., Shite, A., Haile, B., & Mohammed, S. (2015). Prevalence and
identification of major Ixodid tick genera of cattle in Dangila district, Awi Zone, North
West Ethiopia. Acta Parasitologica Globalis, 6(2), 129-135.
Aguiar, D. M., Ziliani, T. F., Zhang, X., Melo, A. L. T., Braga, I. A., Witter, R., Freitas, L. C.,
Rondelli, A. L. H., Luis, M. A., Sorte, E. C. B., Jaune, F. W., Santarém, V. A., Horta, M.
C., Pescador, C. A., Colodel, E. M., Soares, H. S., Pacheco, R. C., Onuma, S. S. M.,
Labruna, M. B., & McBride, J. W. (2014). A novel Ehrlichia genotype strain
distinguished by the TRP36 gene naturally infects cattle in Brazil and causes clinical
manifestations associated with ehrlichiosis. Ticks Tick Borne Diseases, 5, 537-44.
Ahmad, I., Khawja, A., Shams, S., Ayaz, S., Khan, S., & Akbar, N. 2014. Detection of
babesiosis and identification of associated ticks in cattle. International Journal
Bioassays, 3, 3195-3199.
Ahmed A. H., Kamal I. H., & Ramzy, R. M. (2001). Studies on the molluscicidal and larvicidal
properties of Solanum nigrum L. leaves ethanol extract. Journal of the Egyptian Society
of Parasitology, 31(3), 843-52.
Akbar, H., Rashid, M. I., Shehzad, W., Saeed, K., & Oneeb, M. (2014). Parasitic Challenges to
booming dairy industry of Pakistan. Science International, (Lahore), 26(3), 1201-1204.
113
Aktas, M., & Ozubek, S. (2015). Molecular and parasitological survey of bovine piroplasms in
the black sea region, including the first report of babesiosis associated with Babesia
divergens in Turkey. Journal of Medical Entomology, 52, 1344-50.
Aktas, M., Altay, K., & Dumanli, N. (2011). Molecular detection and identification of
Anaplasma and Ehrlichia species in cattle from Turkey. Ticks and Tick Borne Diseases,
2, 62-65.
Aktas, M., Vatansever, Z., & Ozubek, S. (2014). Molecular evidence for trans-stadial and
transovarial transmission of Babesia occultans in Hyalomma marginatum and
Rhipicephalus turanicus in Turkey. Veterniary Parasitology, 204, 369-371.
Ali, S., Ijaz, M., Durrani, A. Z., Maqbool, A., Ali, M. M., & Mehmood, K. (2016).
Epidemiological aspects of bovine tick infestation in the river Ravi region, Lahore.
Pakistan Journal of Zoology, 48(2), 563-567.
Ali, Z., Maqbool, A., Muhammad, K., Khan, M. S., & Younis, M. (2013). Prevalence of
Theileria annulata infected hard ticks of cattle and buffalo in Punjab, Pakistan. Journal
of Animal and Plant Sciences, 23(1), 20-26.
Alim, M. A., Das, S., Roy, K., Masuduzzaman, M., Sikder, S., Hassan, M. M., Siddiki, A. Z., &
Hossain, M. A. (2011). Prevalence of hemoprotozoan diseases in cattle population of
Chittagong division, Bangladesh. Pakistan Veterinay Journal, 32(2), 221-224.
Allardice. P. (1993). A - Z of Companion Planting. Cassell Publishers Ltd.
Allsopp, M., Visser, E. S., du Plessis, J. L., Vogel, S. W., & Allsopp, B. A. (1997). Different
organisms associated with heartwater as shown by analysis of 16S ribosomal RNA gene
sequences. Veterniary Parasitology, 71, 283-300.
Alonso, D. M. A., Lopez, S. B. J., Leme, D. L. A. C., & Rodriguez, V. R. I. (2007). Infestacion
natural de hembras de Boophilus microplus Canestrini, 1887 (Acari: Ixodidae) en dos
genotipos de bovinos en el tropico humedo de Veracruz, Mexico. Veterniary Mexico, 38,
503-509.
Al-Rajhy, D. H., Alahmed, A. M., Hussein, H. I., & Kheir, S. M. (2003). Acaricidal effects of
cardiac glycosides, azadirachtin and neem oil against the camel tick, Hyalomma
dromedarii (Acari: Ixodidae). Pest Management Sciences, 59, 1250-1254.
114
Altangerel, K., Battsetseg, B., Battur, B., Sivakumar, T., Batmagnai, E., Javkhlan, G.,
Tuvshintulga, B., Igarashi, I., Matsumoto, K., Inokuma, H., & Yokoyama, N. (2011).
The first survey of Theileria orientalis infection in Mongolian cattle. Veterniary
Parasitology, 182, 343-348.
Altay, K., Aktas, M., Dumanli, N., & Aydin, M. F. (2008). Evaluation of a PCR and comparison
with RLB for detection and differentiation of Theileria sp. MK and other Theileria and
Babesia species of small ruminants. Parasitology Research, 103, 319-23.
Aparna, M., Ravindran, R., Vimalkumar, M. B., Lakshmanan, B., Rameshkumar, P., Kumar, K.
G. A., Promod, K., Ajithkumar, S., Ravishankar, C., Devada, K., Subramanian, H.,
George, A. J., & Ghosh, S. (2011). Molecular characterization of Theileria orientalis
causing fatal infection in crossbred adult bovines of South India. Parasitology
International, 60, 524-529.
Apanaskevich, D., & Horak, I. (2005). The genus Hyalomma Koch, 1844. II. Taxonomic status
of H. (Euhyalomma) anatolicum Koch, 1844 and H. (e.) excavatum Koch, 1844 (Acari,
Ixodidae) with redescriptions of all stages. Acarina 13, 181-197.
Appleby, M., Cussen, V., Garcés, L., Lambert, L., & Turner, J. (Eds.). (2008). Long distance
transport and welfare of farm animals. CAB International, London, 480p.
Ashfaq M., Razzaq, A., Shamsheer-ul-Haq., & Muhammad, G. (2015). Economic analysis of
dairy animal diseases in Punjab: a case study of Faisalabad district. The Journal of
Animal & Plant Sciences, 25(5), 1482-1495.
Ashraf, Q. U. A., Khan, A. U., Khattak, R. M., Ali, M., Shaikh, R. S., Ali, M., & Iqbal, F.
(2013). A report on the high prevalence of Anaplasma spp. in buffaloes from two
provinces in Pakistan. Ticks and Tick-borne Diseases, 4, 395-398.
Aslam, B., Hussain, I., Zahoor, M. A., Mahmood, M. S., & Rasool, M. H. (2015). Prevalence of
Borrelia anserina in Argas ticks. Pakistan Journal of Zoology, 47, 1125-1131.
Asmaa, N. M., ElBably, M. A., & Shokier, K. A. (2014). Studies on prevalence, risk indicators
and control options for tick infestation in ruminants. Beni-suef University Journal of
Basic and Applied Chemistry, 3, 68-73.
Atif, F. A., Khan, M, S., Iqbal, H. J., Arshad, G. M., Ashraf, E., & Ullah, S. (2012). Prevalence
of Anaplasma marginale, Babesia bigemina and Theileria annulata infections among
115
cattle in Sargodha district, Pakistan. African Journal of Agricultural Research, 7(22),
3302-3307.
Atif, F. A., Khan, M. S., Roheen, T., Muhammad, F., Younus, M., Avais, M., & Ullah, S. (2013).
Seroprevalence of anaplasma marginale infection among cattle from three districts of
the Northern Punjab, Pakistan. Journal of Animal and Plant Sciences, 23(4), 995-998.
Avinash, B., Supraja, N., Prasad, T. N. V. K. V., & Priya, C. S. (2017). Evaluation of acaricidal
activity of Azadirachta indica extracts against Rhipicephalus (Boophilus) microplus and
its GC-MS analysis. International Journal of Science, Environment and Technology,
6(1), 980-992.
Babar, W., Iqbal, Z., Khan, M. N., & Muhammad, G. (2012). An inventory of the plants used for
parasitic ailments of animals. Pakistan Veterniary Journal, 32(2), 183-187.
Baek, B. K., Soo, K. B., Kim, J. H., Hur, J., Lee, B. O., Jung, J. M., Onuma, M., Oluoch, A. O.,
Kim, C. H., & Kakoma, I. (2003). Verification by polymerase chain reaction of vertical
transmission of Theileria sergenti in cows. Canadian Journal of Veterinary Research
journal, 67, 278-82.
Barbara, G. S., Zube, C., Rybak, J., Gauthier, M., & Grünewald, B. (2005). Acetylcholine,
GABA and glutamate induce ionic currents in cultured antennal lobe neurons of the
honeybee, Apis mellifera. Journal of comparative physiology, 191, 823-836.
Bargah, R. K. (2015). Preliminary test of phytochemical screening of crude ethanolic and
aqueous extract of Moringa pterygosperma Gaertn. Journal of Pharmacognosy and
Phytochemistry, 4(1), 07-09.
Barghash, S. M., Darwish, A. M., & Abou-ElNaga, T. R. (2016). Molecular Characterization and
Phylogenetic Analysis of Trypanosoma evansi from Local and Imported Camels in
Egypt. Journal of Phylogenetics & Evolutionary Biology 4, 3. DOI: 10.4172/2329-
9002.1000169
Bekker, C. P., de Vos, S., Taoufik, A., Sparagano, O. A., & Jongejan, F. (2002). Simultaneous
detection of Anaplasma and Ehrlichia species in ruminants and detection of Ehrlichia
ruminantium in Amblyomma variegatum ticks by reverse line blot hybridization.
Veterinary Microbiology, 89, 223-238..
116
Benariba, N., Djaziri, R., Bellakhdar, W., Belkacem, N., Kadiata, M., Malaisse, W. J., & Sener,
A. (2013). Phytochemical screening and free radical scavenging activity of Citrullus
colocynthis seeds extracts. Asian Pacific Journal of Tropical Biomedicine, 3(1), 35-40.
Bilgic, H. B., Bakırcı, S., Kose, O., Unlu, A. H., Hacılarlıoglu, S., Eren, H., Weir, W., &
Karagenc, T. (2017). Prevalence of tick-borne haemoparasites in small ruminants in
Turkey and diagnostic sensitivity of single-PCR and RLB. Parasites & Vectors, 10, 211.
Bilgic, H. B., Karagenc, T., Shiels, B., Tait A., Eren, H., & Weir, W. (2010). Evaluation
of cytochrome b as a sensitive target for PCR based detection of T. annulata carrier
animals. Veterniary Parasitology, 174, 341-347.
Bilgic, H. B., Karagenc, T., Simunza, M., Shiels, B., Tait A., Eren, H., & Weir, W. (2013).
Development of a multiplex PCR assay for simultaneous detection of Theileria
annulata, Babesia bovis and Anaplasma marginale in cattle. Experimental Parasitology,
133(2), 222-229.
Bishop, R., Odongo, D., Mann, D., Pearson, T., Sugimoto, C., Haines, L., Al., E. (2009).
Theileria. In: Nen, V., Kole, C. (Eds.), Genome Mapping and Genomics in Animal-
Associated Microbes. Berlin Heidelberg: Springer, pp. 191-231.
Bram, R. A. (2016). World Animal Review. URL
http://www.fao.org/docrep/004/x6538e/x6538e02.htm (accessed 5.2.16).
Brito, L. G., Barbieri, F. S., Rocha, R. B., Oliveira, M. C. S., & Ribeiro, E. S. (2011). Evaluation
of the efficacy of ecaricides used to control the cattle tick, Rhipicephalus microplus, in
dairy herds raised in the Brazilian SouthWestern Amazon. Veterinary Medicine
International, 6 pages.
Bursali, A., Keskin, A., & Tekin, S. (2013). Ticks (Acari: Ixodida) infesting humans in the
provinces of Kelkit Valley, a Crimean-congo hemorrhagic fever endemic region in
Turkey, Experimental & Applied Acarology, 59(4), 507-15.
Cabezas-Cruz, A., Zweygarth, E., Broniszweska, M., Passos, L. M. F., Ribeiro, M. F. B.,
Manrique, M., Tobes, R., & de la Fuente, J. (2015). Complete Genome Sequence of
Ehrlichia mineirensis, a Novel Organism Closely Related to Ehrlichia canis with a New
Host Association. Genome Announcement, 3(1), e01450-14.
doi: 10.1128/genomeA.01450-14
117
Carter, P. D., & Rolls, P. (2015). Babesiosis: Blood Parasites: The Merck Veterinary Manual, 5,
2-16.
Cavalcante, G. S., De Morais, S. M., Andre, W. P., Ribeiro, W. L., Rodrigues, A. L., De Lira,
F. C., Viana, J. M., & Bevilaqua, C. M. (2016). Chemical composition and in vitro
activity of Calotropis procera (Ait.) latex on Haemonchus contortus. Veterniary
Parasitology, 226, 22-25.
Chaisi, M. E., Collins, N. E., Potgieter, F. T., & Oosthuizen, M. C. (2013). Sequence variation
identified in the 18S rRNA gene of Theileria mutans and Theileria velifera from the
African buffalo (Syncerus caffer), Veterinary Parasitology, 191, 132-137.
Chansiri, K., & Bagnara, A. S. (1995). The structural gene for carbamoyl phosphate synthetase
from the protozoan parasite. Babesia bovis. Molecular Biochemistry Parasitology, 74,
239-43.
Chaudhry, Z. I., Suleman, M., Younus, M., & Aslim, A. (2010). Molecular detection of Babesia
bigemina and Babesia bovis in crossbred carrier cattle through PCR. Pakistan Journal of
Zoology, 42(2), 201-204.
Chawech, R., Mhalla, D., Trigui, M., Mihoubi, M., Fabre, N., & Jarraya, R. (2015). Chemical
composition and antibacterial activity of extracts and compounds isolated from Citrullus
colocynthis (L.) Schrad. Journal of Pharmacognosy and Phytochemistry, 4(4), 197-203.
Chen, Z., Liu, Q., Liu, J., Xu, B., Lv, S., Xia, S., & Zhou, X. (2014). Tick-borne pathogens and
associated co-infections in ticks collected from domestic animals in central China.
Parasites & Vectors, 7, 237.
Chhabra, R. E., & Donora. N. (1994). Ectoparasites of poultry in Zimbabwe and their control.
Zimbabwe Veterniary Journal, 25, 26-32.
Chhillar, S., Chhilar, J. S., & Kaur, H. (2014). Investigations on some hard ticks (Acari:
Ixodidae) infesting domestic buffalo and cattle from Haryana, India. Journal of
Entomology and Zoology Studies, 2(4), 99-104.
Coventry. B. O. (1923). Wild Flowers of Kashmir Raithby, Lawrence and Co. London. A nice
little pocket guide to 50 wildflowers of Kashmir.
Cruz, A. C., Zweygarth, E., Ribeiro, M. F. B., da Silveira, J. A. G., de la Fuente, J., Grubhoffer,
L., Valdés, J. J., & Passos, L. M. F. (2012). New species of Ehrlichia isolated from
118
Rhipicephalus (Boophilus) microplus shows an ortholog of the E. canis Major
immunogenic glycoprotein gp36 with a new sequence of tandem repeats. Parasite &
Vectors, 5, 291.
da Silva, J. A. T., & Hussain, A. I. (2017) Citrullus colocynthis (L.) Schrad. (colocynth):
Biotechnological perspectives. Emirates Journal of Food and Agriculture, 29(2), 83-90.
Dantas-Torres, F., Chomel, B. B., & Otranto, D. (2012). Ticks and Tick-borne diseases: a One
Health perspective. Trends Parasitology, 28, 437-446.
Das, M., & Konar, S. (2013). Clinical and hematological study of canine Ehrlichiosis with other
hemoprotozoan parasites in Kolkata, West Bengal, India. Asian Pacific Journal of
Tropical Biomedicine, 3, 913-915.
de Castro, J., 1997. Sustainable tick and tickborne disease control in livestock improvement in
developing countries. Veterniary Parasitology, 71, 77-97.
de La Fuente, J., Kocan, K. M., & Contreras, M. (2015). Prevention and control strategies for
ticks and pathogen transmission. Revue Scientifique Et Technique, 34, 249-64.
Decaro, N., Larocca, V., Parisi, A., Losurdo, M., Lia, R. P., Greco, M. F., Miccolis, A.,
Ventrella, G., Otranto, D., & Buonavoglia, C. (2013). Clinical bovine piroplasmosis
caused by Babesia occultans in Italy. Journal of Clinical Microbiology, 51, 2432-4.
Demessie, Y., & Derso, S. (2015). Tick borne hemoparasitic diseases of ruminants: A Review.
Advances in Biological Research, 9 (4), 210-224.
Dilshad, S. M. R., Rehmana, N. U., Iqbal, Z., Muhammad, G., Iqbal, A., & Ahmad, N. (2008).
An inventory of the ethnoveterinary practices for reproductive disorders in cattle and
buffaloes, Sargodha district of Pakistan. Journal Ethnopharmacology, 117, 393-402
Dinesh, S., & Gopal, G. (2014). A comparative phytochemical screening of various plants of
India. Journal of Medical Pharmaceutical and Allied Sciences, 02, 37-46.
Dipeolu, O. O., & Amoo, A. (1984). The presence of kinetes of a Babesia species in the
haemolymph smears of engorged hyalomma ticks in Nigeria. Veterniary Parasitology,
17, 41-46.
Diyes, G. C. P., & Rajakaruna, R. S. (2015). Diversity and distribution of tick species infesting
goats with two new host records from Sri Lanka. Journal of National Science
Foundation of Sri Lanka, 43(3), 225-234.
119
Doudier, B., Olano, J., Parola, P., & Brouqui, P. (2010). Factors contributing to emergence of
Ehrlichia and Anaplasma spp. as human pathogens. Veterniary Parasitolog, 167, 149-
154.
Durrani, A. A., Maqbool, A., Mahmood, N., Kamal, N., & Shakoori, A. R. (2009).
Chemotherapeutic trials with Calotropis procera against experimental infection with
Theileria annulata in Cross Bred Cattle in Pakistan. Pakistan Journal of Zoology, 41(5),
389-397.
Durrani, A. Z., & Shakoori, A. R. (2009). Study on ecological growth conditions of cattle
Hyalomma ticks in Punjab, Pakistan. Iranian Journal Parasitology, 4(1), 19-25.
Durrani, A. Z., Ahmad, M., Ashraf, M., Khan, M. S., Khan, J. A., Kamal, N., & Mumtaz, N.
(2008). Prevalence of theileriosis in buffaloes and detection through blood smear
examination and Polymerase Chain Reaction test in district Lahore. Journal of Animal
and Plant Sciences, 18, 2-3.
Durrani, A. Z., & Kamal, N., 2008. Identification of ticks and detection of blood protozoa in
friesian cattle by polmerase chain reacton test and estimation of blood parameters in
district Kasur, Pakistan. Journal of Animal Health and Production, 40, 441-447.
Durrani, A. Z., Shakoori, A. R., & Kamal, N. (2008). Bionomics of Hyalomma ticks in three
districts of Punjab, Pakistan. Journal of Animal and Plant Sciences, 18(1), 17-23.
Eamens, G. J., Gonsalves, J. R., Jenkins, C., Collins, D., & Bailey, G. (2013). Theileria
orientalis MPSP types in Australian cattle herds associated with outbreaks of clinical
disease and their association with clinical pathology findings. Veterinary Parasitology,
191, 209-217.
Ehounoud, C. B., Yao, K. P., Dahmani, M., Achi, Y. L., Amanzougaghene, N., Kacou, N.,
Douba, A. N., Guessan, J. D., Raoult, D., Fenollar, F., & Mediannikov, O. (2016).
Multiple Pathogens Including Potential New Species in Tick Vectors in Côte d‟Ivoire.
PLOS Neglected Tropical Diseases, 10(1), e0004367. doi:
10.1371/journal.pntd.0004367.
Elimam, A. M., Elmalik, K. H., & Ali, F. S. (2009). Larvicidal, adult emergence inhibition and
oviposition deterrent effects of foliage extract from Ricinus communis L. against
120
Anopheles arabiensis and Culex quinquefasciatus in Sudan. Tropical Biomedicine, 26,
130-139.
Ellis, J., Hefford, C., Baverstock, P. R., Dalrymple, B. P, Johnson, A. M. (1992). Ribosomal
DNA sequence comparison of Babesia and Theileria. Molecular and Biochemical
Parasitology, 54, 87-96.
Estrada-Peña, A., Bouattour, A., Camicas, J. L., Guglielmone, A., Horak, I., Jongejan, F., Latif,
A., Pegram, R., & Walker, A. R. (2006). The known distribution and ecological
preferences of the tick subgenus Boophilus (Acari: Ixodidae) in Africa and Latin
America. Experimental and Applied Acarology, 38, 219-235.
Estrada-Pena, A., Bouattour, A., Camicas, J., Walker, A., 2004. Ticks of Domestic Animals in
the Mediterranean Region. A Guide to Identification of species. University of Zaragoza,
Spain.
FAO, (2004). Pakistan Livestock Sector Survey Report No. 32/74/Pak/7, pp: 11-14. FAO/World
Bank Cooperative Programme, Italy.
Farooq, Z., Iqbal, Z., Mushtaq, S., Muhammad, G., Iqbal, M. Z., & Arshad, M. (2008).
Ethnoveterinary practices for the treatment of parasitic diseases in livestock in Cholistan
desert (Pakistan). Journal Ethnopharmacology, 118, 213-219.
Figueroa, J., L‟Hostis, M., Camus, E., 2010. Bovine babesiosis. In: Lefevre, P.-C., Blancou, J.,
Chermette, R., Uilenberg, G. (Eds.), Infectious and Parasitic Diseases of Livestock:
Bacterial Diseases, Fungal Diseases, Parasitic Diseases. Lavoisier, Paris, France, pp.
1819-38.
Finney, D. J. (1971) Probit Analysis. 3rd Edition, Cambridge University Press, Cambridge.
Gajadhar, A. A., Lobanov, V., Scandrett, W. B., Campbell, J., & Al-Adhami, B. (2010). A novel
Ehrlichia genotype detected in naturally infected cattle in North America. Veterniary
Parasitology, 173, 324-9.
Ganjali, M., Dabirzadeh, M., & Sargolzaie, M. (2014). Species diversity and distribution of ticks
(Acari: Ixodidae) in Zabol Country, Eastern Iran. Journal of Arthropod-Borne Diseases,
8(2), 219-223.
George, J., Pound, J., & Davey, R. (2008). Acaricides for controlling ticks on cattle and the problem
of acaricidal resistance. In: Bowman, A., Nuttall, P. (Eds.), Ticks: Biology, Disease and
Control. Cambridge, UK, pp. 408-423.
121
Gharekhani, J., Gerami-Sadeghian, A., Sadeghi-Dehkordi, Z., & Youssefi, M. (2015).
Determination of hard tick species (Acarina: Ixodidae) on sheep and cattle in Hamedan
Province, Iran. Journal of Coastal Life Medicine, 3(8), 612-615.
Ghosh, S., & Nagar, G. (2014). Problem of ticks and tick-borne diseases in India with special
emphasis on progress in tick control research. Journal of Vector Borne Diseases, 51,
259-270.
Ghosh, S., & Ravindran, R. (2014). Progress in the development of plant bopesticides for the
control of arthropods of veterinary importance. Advances in Plant Biopesticides, 207-
241.
Ghosh, S., Bansal, G. C., Gupta, S. C., Ray, D., Khan, M. Q., Irshad, H., Shahiduzzaman, M.,
Seitzer, U., & Ahmed, J. S. (2007). Status of tick distribution in Bangladesh, India and
Pakistan. Parasitology Research, 101 Suppl, S207-16.
Ghosh, S., Sharma, A. K., Kumar, S., Tiwari, S. S, Rastogi, S., Srivastava, S., Singh, M., Kumar,
R., Paul, S., Ray, D. D., Chaudhri, P., & Rawat, A. K. S. (2011) In vitro and in vivo
efficacy of Acorus calamus extract against Rhipicephalus (Boophilus) microplus.
Parasitology Research, 108, 361-370.
Gosh, S., Tiwari, S. S., Kumar, B., Srivastava, S., Sharma, A. K, Kumar, S., Bandyopadhyay, A.,
Julliet, S., Kumar, R., & Rawat, A. K. (2015). Identification of potential plant extracts
for anti-tick activity against acaricide resistant cattle ticks, Rhipicephalus (Boophilus)
microplus (Acari: Ixodidae). Experimental and Applied Acarology, 66(1), 159-71.
Gray, J. S., & De Vos, A. J. (1981). Studies on a bovine Babesia transmitted by Hyalomma
marginatum rufipes Koch, 1844. Onderstepoort. Journal of Veterniary Research, 48,
215-23.
Greenfield, B. P. J. (2011). Environmental parameters affecting tick (Ixodes ricinus) distribution
during the Summer season in Richmond Park, London. The International Journal of
Student Research, 4(2, 1), 140-148.
Gubbels, J. M., de Vos, A. P., van der Weide, M., Viseras, J., Schouls, L. M., de Vries, E., &
Jongejan, F. (1999). Simultaneous detection of bovine Theileria and Babesia species by
reverse line blot hybridization. Journal of Clinical Microbiology, 37, 1782-9.
122
Guclu, H. Z., & Karaer, K. Z. (2007). Detection of Babesia caballi (Nuttall, 1910)
and Theileria equi (syn Babesia equi, Laveran, 1901) by polymerase chain reaction
(PCR) in show and sport horses in the region of Ankara. Turkish Journal of
Parasitology, 31(2), 89-93.
Guglielmone, A. A., Robbins, R. G., Apanaskevich, D. A., Petney, T. N., & Estrada-Pena A.
(2010). The Argasidae, Ixodidae and Nuttalliellidae (Acari: Ixodida) of the world: a list
of valid species names. Zootaxa, 2528, 1-28.
Gurudeeban, S., Satyavani, K., & Ramanathan, T. (2010). "Bitter Apple (Citrullus colocynthis):
An Overview of Chemical Composition and Biomedical Potentials". Asian Journal of
Plant Sciences, 9(7), 394-401.
Habeeb, S. M. (2010) Ethno-veterinary and medical knowledge of crude plant extracts and its
methods of application (traditional and modern) for tick control. Journal of World
Applied Sciences, 11, 1047-1054.
Hibasami, H., Moteki, H., Ishikawa, K., Katsuzaki, H., Imai, K., Yoshioka, K., Ishii, Y., &
Komiya, T. (2003). "Protodioscin isolated from fenugreek (Trigonella foenumgraecum
L.) induces cell death and morphological change indicative of apoptosis in leukemic cell
line H-60, but not in gastric cancer cell line KATO III." International Journal of
Molecular Medicine, 11(1), 23-26.
Hossain, M., Bhuiyan, M. D. U., & Digonto, M. T. H. I. (2016). Epidemiology of Ecto-Parasitic
Infestation of Cattle in Milk Shed Areas of Baghabari of Shahjadpur Upazila of
Sirajgonj District, Bangladesh. The Journal of Advances in Parasitology, 3(2), 56-60.
Hosseini-Chegeni, A., Hosseini, R., Tavakoli, M., Telmadarraiy, Z., & Abdigoudarzi, M. (2013).
The Iranian Hyalomma (Acari: Ixodidae) with a key to the identification of male species.
Persian Journal of Acarology, 2(3), 503-529.
Hussain, A. I., Rathore, H. A., Sattar, M. Z. A., Chatha, S. A. S., Sarker, S. D., & Gilani, A. H.
(2014). Citrullus colocynthis (L.) Schrad (bitter apple fruit): A review of its
phytochemistry, pharmacology, traditional uses and nutritional potential. Journal of
Ethnopharmacology, 155(1), 54-66.
123
Hussain, S. I., & Kumar, G. A. (1985). The incidence of ticks (Ixodidea: Ixodidae) infesting
sheep and goats in Sind province, Pakistan. Pakistan Journal of Zoology, 17, 89-97.
Iqbal, A., Sajid, M. S., Khan, M. N., & Khan, M. K. (2013). Frequency distribution of hard ticks
(Acari: Ixodidae) infesting bubaline population of district Toba Tek Singh, Punjab,
Pakistan. Parasitology Research, 112, 535-541.
Iqbal, A., Siddique, F., Fatima, N., & Saleem, I. (2015). Tick infestation in sheep: prevalence,
associated determinants and in vivo chemotherapeutic control in Central Punjab,
Pakistan. Scholar’s Advances in Animal and Veterinary Research, 2(1), 41-54.
Iqbal, A., Siddique, F., Mahmood, M. S., Shamim, A., Zafar, T., Rasheed, I., Saleem, I., &
Ahmad, W. (2014). Prevalence and impacts of ectoparasitic fauna infesting goats (Capra
hircus) of district Toba Tek Singh, Punjab, Pakistan. Global Veterinaria, 12(2), 158-164.
Iqbal, F., Khattak, R. M., Ozubek, S., Khattak, M. N. K., Rasul, A., & Aktas, M. (2013).
Application of the reverse line blot assay for the molecular detection of Theileria and
Babesia sp. in sheep and goat blood samples from Pakistan. Iranian
Journal of Parasitology, 8, 289-295.
Iqbal, Z., Babar, W., Sindhu, Z. D., Abbas, R. Z., & Sajid, M. S. (2012). Evaluation of
anthelmintic activity of different fractions of Azadirachta indica A. Juss seed extract.
Pakistan Veterinary Journal, 32, 579-583
Irshad, N., Qayyum, M., Hussain, M., & Khan, M. Q. (2010). Prevalence of tick infestation and
theileriosis in sheep and goats. Pakistan Veterniary Journal, 30(3), 178-180.
Islam, M. K., Alim, M. A. Tsuji, N., & Mondal, M. (2006). An investigation into the distribution,
host- preference and population density of ixodid ticks affecting domestic animals in
Bangladesh. Tropical Animal Health Production, 38, 485-490.
Islam, M. K., Jabbar, A., Campbell, B. E., Cantacessi, C., & Gasser, R. B. (2011). Bovine
theileriosis an emerging problem in south-eastern Australia. Infection Genetic
Evoloution, 11, 2095-2097.
Jabbar, A., Abbas, T., Sandhu, Z. U. D. U., Saddiqi, H. A., Qamar, M. F., & Gasser, R. B.
(2015). Tick-borne diseases of bovines in Pakistan: major scope for future research and
improved control. Parasites & Vectors, 8, 283.
124
Jabbar, A., Raza, M. A., Iqbal, Z., & Khan, N. (2006). An inventory of the ethnobotanicals used
as anthelmintics in the Southern Punjab (Pakistan). Journal Ethnopharmacology, 108,
152-4.
Jabin, F., & Nasreen, S. (2016). Phytochemical analysis of some medicinal plants. International
Journal of Applied Research, 2(8), 293-295.
Jalali, S. M., Khaki, Z., Kazemi, B., Bandehpour, M., Rahbari, S., Razi Jalali, M., & Yasini, S. P.
(2013). Molecular detection and identification of Anaplasma species in sheep from
Ahvaz, Iran. Iranian Joural Veterniary Research, 14, 50-56.
Javed, K., Ijaz, M., Ali,M. M., Khan, I., Mehmood, K., & Ali, S. (2014). Prevalence and
hematology of tick borne hemoparasitic diseases in equines in and around Lahore.
Pakistan Journal of Zoology, 46(2), 401-408.
Jongejan, F., & Uilenberg, G. (2004). The Global importance of ticks. Parasitology, 129, 3-14.
Jonsson, N. N., Mayer, D. G., Matschoss, A. L., Green P. E., & Ansell, J. (1998). Production
effects of cattle tick (Boophilus microplus) infestation of high yielding dairy cows.
Veterniary Parasitology, 78, 65-77.
Joshi, R., & Rajni, M. (2007). "Lipid profile of rats fed on domestically processed fenugreek.
Journal of Food Science and Technology, 44(5), 542-544.
Kabir, M. H. B., Mondal, M. M. H., Eliyas, M., Mannan, M. A., Hashem, M. A., & Debnath, N.
C. (2011). An epidemiological survey on investigation of tick infestation in cattle at
Chittagong district, Bangladesh. African Journal Microbiology Research, 5, 346-352.
Kakati, P., Sarmah, P. C., Ray, D., Bhattacharjee, K., Sharma, R. K., Barkalita, L.M., Sarma, D.
K., Baishya, B. C., Borah, P., & Stanley, B. (2015). Emergence of oriental theileriosis in
cattle and its transmission through Rhipicephalus (Boophilus) microplus in Assam, India.
Veterniary world, 8, 1099-104.
Kamboj, A., & Pathak, H. (2013). Crimean-Congo hemorrhagic fever: a comprehensive review.
Veterinary World, 6(10), 812-817.
Karim, S., Budachetri, K., Mukherjee, N., Williams, J., Kausar, A., Hassan, M. J., Adamson, S.,
Dowd, S. E., Apanskevich, D., Arijo, A., Sindhu, Z., Kakar, M. A., Khan, R. M. D.,
125
Ullah, S., Sajid, M. S., Ali, A., & Iqbal, Z. (2017). A study of ticks and tick-borne
livestock pathogens in Pakistan. PLOS Neglected Tropical Diseases, 11(6), 1-17.
Katuri R. N., Das, G., Chalhotra S. K., & Singh A. K. (2013). Analysis of site of prediliction for
the ticks of family ixodidae. International Journal of Food, Agriculture and Veterinary
Sciences, 3(2), 42-46.
Kaur, D., Jaiswal, K., & Mishra, S. (2015). Studies on Prevalence of ixodid ticks infesting cattle
and their control by plant extracts. Journal of Pharmacy and Biological Sciences. 10(6),
01-11.
Kemal, J., Tamerat, N., & Tuluka, T. (2016). Infestation and identification of ixodid tick in
cattle: the case of Arbegona district, Southern Ethiopia. Journal of Veterinary Medicine,
8 pages. doi.org/10.1155/2016/9618291
Khan, A., Mushtaq, M. H., Ahmad, M., Tipu, Y., & Khan, A. (2013). Tick infestation rate in
cattle and buffalo in different areas of Khyber Pakhtunkhwa. Journal of Veterinary
Animal Sciences, 3, 31-35.
Khan, A., Mushtaq, M. H., Ahmad, M., Tipu, Y., Khan, A., & Munibullah. (2016). Tick
infestation rate in cattle and buffalo in different areas of Khyber Pakhtunkhwa, Pakistan.
Journal of Animal and Plant Sciences, 3(1-2), 31-35.
Khan, A., Rehman., A. U., Hisham, M., Khan, A. Z., Rehman., H. U., Khan, M. I., Quershi, M.
F., & Ameen, M. A. (2016). Burden of babesiosis among domestic cattle of Southern
Khyber Pakhtunkhwa, Pakistan. Journal of Entomology and Zoology Studies, 4(5), 305-
307.
Khan, M. N., Hayat, C. S., Iqbal, Z., Hayat, B., & Naseem, A. (1993). Prevalence of ticks on
livestock in Faisalabad. Pakistan Veterniary Journal, 13, 182-184.
Khan, M. N., Khan, L. A., Mahmood, S., & Qudoos, A. (2001). Argas persicus infestation:
prevalence and economic Significance in poultry. Pakistan
Journal of Agricultural Sciences, 38, 3-4.
Khan, M., Zahoor, A., Jahangir, M. & Mirza, M. A. (2004). Prevalence of blood parasites in
cattle and buffaloes. Pakistan Veterinary Journal, 24, 193-194.
126
Kharb, S., & Singh, V. (2004) Nutriceuticals in health and disease prevention. Indian Journal
Clinical Biochemical, 19(1), 50-3.
Khattak, R. M., Rabib, M., Khan, Z., Ishaq, M., Hameed, H., Taqddus, A., Faryal, M., Durranis,
S., Gillani, Q. U. A., Allahyar, R., Shaikh, R. S., Khan, M. A., Ali, M., & Iqbal, F.
(2012). A comparison of two different techniques for the detection of blood parasite,
Theileria annulata, in cattle from two districts in Khyber Pukhtoon Khwa Province
(Pakistan). Parasite, 19, 91-95.
Khukhuu, A., Lan, D. T. B., Long, P. T., Ueno, A., Li, Y., Luo, Y., Macedo, A. C. C. de,
Matsumoto, K., Inokuma, H., Kawazu, S.-I., Igarashi, I., Xuan, X., & Yokoyama, N.
(2011). Molecular epidemiological survey of Theileria orientalis in Thua Thien Hue
Province, Vietnam. Journal of Veterinary Medicine Science, 73, 701-5.
Kocan, K. M., de la Fuente, J., Blouin, E. F., Coetzee, J. F., & Ewing, S. A. (2010). The natural
history of Anaplasma marginale. Veterniary Parasitology, 167, 95-107.
Koné, W. M., & Atindehou, K. K. (2008). Ethnobotanical inventory of medicinal plants used in
traditional veterinary medicine in Northern Côte d'Ivoire (West Africa). South African
Journal of Botany, 74(1), 76-84.
Krishna, T. P. A., Krishna, T. P. A., Chithra, N. D., Deepa,
P. E., Darsana, U., Sreelekha, K. P.,
Juliet, S., Nair, S. N., Ravindran,
R., Kumar, K. G. A., & Ghosh, S. (2014). Acaricidal
activity of petroleum ether extract of leaves of Tetrastigm leucostaphylum (Dennst.)
Alston against Rhipicephalus (Boophilus) annulatus. The Scientific World Journal, 6
pages. doi.org/10.1155/2014/715481
Kumar, V., Kaur, P., Wadhawan, V. M., Pal, H., Sharma, H., & Kumar, P. (2015). Theileriosis in
cattle: prevalence and seasonal incidence in Jalandhar district of Punjab (India).
International Journal of Recent Scientific Research, 6(3), 2998-2999.
Latif, A. A., Putterill, J. F., de Klerk, D. G., Pienaar, R., & Mans, B. J. (2012). Nuttalliella
namaqua (Ixodoidea: Nuttalliellidae): first description of the male, immature stages and
re-description of the female. PLOS ONE, 7(7), e41651.
doi: 10.1371/journal.pone.0041651
127
Leschnik, M., Feiler, A., Duscher, G. G., & Joachim, A. (2013). Effect of owner-controlled
acaricidal treatment on tick infestation and immune response to tickborne pathogens in
naturally infested dogs from Eastern Austria. Parasites & Vectors, 6, 62.
doi: 10.1186/1756-3305-6-62
Liu, A. H., Guan, G. Q., Liu, J. L., Liu, Z. J., Leblanc, N., Li, Y. Q., Gao, J. L., Ma, M. L., Niu,
Q. L., Ren, Q. Y., Bai, Q., Yin, H., & Luo, J. X. (2011). Polymorphism analysis of
Chinese Theileria sergenti using Allele-Specific Polymerase Chain Reaction of the major
piroplasm surface protein gene. http://dx.doi.org/10.1645/GE-2444.1.
Livestock and Dairy Development Department Punjab. (2015). Punjab Livestock Policy paper.
Lahore.
Liyanaarachchi, D. R., Jinadasa, H. R. N., Dilrukshi, P. R. M. P., & Rajapakse, R. P. V. J.
(2013). Epidemiological study on ticks in farm animals in selected areas of Sri Lanka.
Tropical Agricultural Research, 24(4), 336-346.
Lorusso, V., Wijnveld, M., Majekodunmi, A. O., Dongkum, C., Fajinmi, A., Dogo, A. G.,
Thrusfield, M., Mugenyi, A., Vaumourin, E., Igweh, A. C., Jongejan, F., Welburn, S. C.,
& Picozzi, K. (2016). Tick-borne pathogens of zoonotic and veterinary importance in
Nigerian cattle. Parasites & Vectors, 9, 217. doi: 10.1186/s13071-016-1504-7
Madder, M., Horak, L., & Stoltsz, H. (2004). Ticks: Tick identification. Licensed under a
creative commons attributes license.
Mahajan, S. S., & Kumawat, R. N. (2013). Study of seed dormancy in colocynth (Citrullus
colocynthis L.) with after-ripening of fruits, seed extraction procedures and period of seed
storage. National Academy Science Letters, 36(4), 373-378.
Manan, A., Khan, Z., Ahmad, B., & Abdullah. (2007). Prevalence and identification of ixodid
tick genera in frontier region Peshawar. Journal of Agricultural and Biological Science,
2(1), 21-25.
Mandal, M., Banerjee, P. S., Garg, R., Ram, H., Kundu, K., Kumar, S., & Kumar, G. V. (2014).
Genetic characterization and phylogenetic relationships based on 18S rRNA and ITS1
128
region of small form of canine Babesia spp. from India. Infection Genetic Evoloution,
27, 325-331.
Mans, B. J., & Neitz, A. W. (2004). Adaptation of ticks to a blood-feeding environment:
evolution from a functional perspective. Insect Biochemistry and Molecular Biology, 34,
1-17.
Mather, T. N., & Abdullah, G. A. (2015). Building molecular biology capacity for preventing
tick-transmitted diseases in Pakistan. Pakistan – United States
Science and Technology Cooperation Program, 11, 23-15.
McFadden, A. M. J., Rawdon, T. G., Meyer, J., Makin, J., Morley, C. M., Clough, R. R., Tham,
K., Mullner, P., & Geysen, D. (2011). An outbreak of haemolytic anaemia associated
with infection of Theileria orientalis in naive cattle. Veterniary Journal, 59, 79-85.
McCarthy, V.C. 1967. Ixodid Ticks (Acarina, Ixodidae) of West Pakistan. University of
Maryland.
Memon, M. I., Memon, N., Kachiwal, A. B., Memon, M. R., & Bhutto, B. (2016). Prevalence of
theileriosis and its impact on haemotological values in naturally infected buffaloes at
Hyderabad. Pakistan Journal of Agricultural Engineering and Veterinary, 32(1), 85-94.
Mirania, A. H., Akhtara, N., Shaha, M. G., Memona, A. A., & Jatoib, A. S. (2016).
Documentation of ethnoveterinary plants for the treatment of different cattle and buffalo
ailments in Tharparker, Sindh, Pakistan. The Journal of Ethnobiology and Traditional
Medicine, 120, 1219-1230.
Mishra, D. R., Mandloi, S., Yadav, N., & Choithani, J. (2016). Phytochemical analysis of
Trigonella foenum-graecum and its antibacterial activity against Staphylococcus aureus.
World Journal of Pharmacy and Pharmaceutical Sciences, 5(6), 1408-1423.
Mkangara, M., Erasto, P., & Chacha, M. (2014). Acaricidal Activity of Commiphora
Swynnertonii (Burtt) stem bark extracts against adult Rhipicephalus Appendiculatus
Newman and Amblyomma Variegatum. American Journal of Research Communication,
2(9), 82-92.
129
Moges, N., Bogale, B., & Fentahun, T. (2012). Hard ticks (Ixodidae): species composition,
seasonal dynamics and body site distribution on cattle in Chilga district, Northwest
Ethiopia. Asian Journal of Agricultural Sciences, 4(5), 341-345.
Monfared, A. L., Mahmoodi, M., & Fattahi, R. (2015). Prevalence of ixodid ticks on cattle,
sheep and goats in Ilam County, Ilam Province, Iran. Journal of Parasitic Diseases,
39(1), 37-40.
Kor, M. N., Didarshetaban, M. B., & Pour, H. R. S. (2013). Fenugreek (Trigonella foenum-
graecum L.) As a Valuable Medicinal Plant. International journal of Advanced
Biological and Biomedical Research, 1(8), 922-931.
Morsy, T. A., Rahem M. A., & Allam, K. A. (2001). Control of Musca domestica third instar
larvae by the latex of Calotropis procera (Family: Asclepiadaceae). Journal of the
Egyptian Society of Parasitology, 31(1), 107‐110.
Mtshali, M. S., DeWall, D. T., & Mbati, P. A. (2004). A sero epidemiological survey of blood
parasites in cattle in the north-eastern Free State, South Africa. Journal of Veterinary
Research, 71, 67-75.
Munderloh, U. G., Jauron, S. D., & Kurtti, T. J. (2005). The tick: a different kind of host for
human pathogens. In: Goodman, J. L., Dennis, D. T., Sonenshine, D. E. (Eds.), Tick-
Borne Diseases of Humans. ASM Press, Washington, DC, pp. 37-64.
Murti, Y., Sharma, S., & Mishra, P. (2015). In vitro anthelminthic activity of calotropis procera
(AIT.) R. BR. leaves. Asian Journal Pharmacology Clinical Research, 8, 188-190.
Musa, H. I., Jajere, S. M., Adamu, N. B., Atsanda, N. N., Lawal, J. R., Adamu, S. G., & Lawal
K. (2014). Prevalence of tick infestation in different breeds of cattle in Maiduguri,
Northeastern Nigeria. Bangl. Journal of Veterniary Medicine, 12(2), 161-166.
Mustafa, I., Shabbir, R. M. K., Subhani, M., Ahmad, I., Raza, A., Jamil, S., Muqaddas, H.,
Shabbir, R. G., Ghani, A., Mahmood, T., Aslam, M., Khan, M. R., Asif, S., Malik, I. U.,
Raza, A. B. M., Aqeel, M. A., Qayyum, M., Waqas, A., & Ahmed, H. (2014). Seasonal
activity of tick infestation in goats and buffalo of Punjab Province (District Sargodha),
Pakistan. Kafkas Üniversitesi Veteriner Fakültesi Dergisi, 20(5), 655-662.
130
Najafi, S., Sanadgol, N., Nejad, B. S., Beiragi, M. A., & Sanadgol, E. (2010). Phytochemical
screening and antibacterial activity of Citrullus colocynthis (Linn.) Schrad against
Staphylococcus aureus. Journal of Medicinal Plants Research, 4(22), 2321-2325.
Najar, A. A., & khare, S. (2017). Improvement of quality control parameters for the
Standardization of calotropis procera L. Leaf and flower. International Journal of
Pharma and Bio Sciences, 8(1), 433-439.
Nasiri, A., Telmadarraiy, Z., Vatandoost, H., Chinikar, S., Moradi, M., Oshaghi, M., Salim
Abadi, Y., & Sheikh, Z. (2010). Tick infestation rate of sheep and their distribution in
abdanan county ilam province, iran, 2007-2008. Iran. Journal of Arthropod-Borne
Diseases, 4, 56-60.
Nawaz, M., Sajid, S. M., Ahmed, Z., Waqas, M., Ahmed, T., Hussain, A., Mohi-ud-Din, A.,
Shamim, A., Zubair, M., & Khalid, I. (2015). Anti-tick activity of leaves of Azadirachta
indica, Dalbergia sisso and Morus alba against Rhipicephalus microplus (Acari:
Ixodidae). Acta Parasitologica Globalis, 6(1), 60-64.
Naz, S., A. Maqbool, A., Ahmed, S., Ashraf, K., Ahmed, N., Saeed, K., Latif, M., Iqbal, J., Ali,
Z., Shafi, K., & Nagra, I. A. (2012). Prevalence of theileriosis in small ruminants in
Lahore. Pakistan. Journal of Veterniary Animal Sciences, 2, 16-20.
Nithya, V., Kamalam, M., & Umakanthan, T. (2015). Screening of indigenous medicinal plants
for their acaricidal activity against cattle ticks under in vivo condition. International
Journal of Pharmaceutical Sciences and Research, 6(7), 3049-3052.
Noaman, V. (2012). Identification of hard ticks collected from sheep naturally infected with
Anaplasma ovis in Isfahan province, Central Iran. Comparative Clinical Pathology, 21,
367-369.
Nora, N. B., Hamid, K., Snouci, M., Boumediene, M., & Abdellah, M. (2015). Phytochemical
and antibacterial screening of Citrullus colocynthis of South-west Algeria. Journal of
Chemical and Pharmaceutical Research, 7(5), 1344-1348.
Nyahangare, E. T., Mvumi, B. M., & Maramba, T. (2016). Acute oral mammalian toxicity and
effect of solvents on efficacy of Maerua edulis (Gilg. & Ben.) De Wolf against
Rhipicephalus (Boophilus) decoloratus Koch, 1844 (Acarina: Ixodidae), Tick Larvae.
BioMed Research International, 8 pages.
131
doi.org/10.1155/2016/7078029
Nyigo, V. A., Mdegela, R. H., Malebo, H. M., Mabiki, F. P., & Fouche, G. (2016). Evaluation of
acaricidal efficacy of Synadenium glaucescens (Euphorbiaceae) against Boophilus
species. Journal of Medicinal Plants Research, 10(21), 278-285.
Ohimain, E. I., Angaye, T. C. N., Bassey, S. E., & Izah, S. C. (2015). Acaricidal activities of
Hyptis suaveolens and Ocimum sanctum against African dog tick (Rhipicephalus
sanguinneus). European Journal of Medicinal Plants, 8(3), 149-156.
OIE, 2010. Bovine babesiosis. In: OIE Terrestrial Manual. World Organisation for Animal
Health (OIE), Paris, France, pp. 1-15.
Opiro, R., Osinde, C., Okello-Onen, J., & Akol, A. M. (2013).Tick-repellent properties of four
plant species against Rhipicephalus appendiculatus Neumann (Acarina: Ixodidae) tick
species. E3 Journal of Agricultural Research and Development, 3(2), 017-021.
Orkun, O., Karaer, Z., Çakmak, A., & Nalbantoğlu, S. (2014). Identification of tick-borne
pathogens in ticks feeding on humans in Turkey. PLOS Neglected Tropical Diseases,
8(8), e3067. doi.org/10.1371/journal.pntd.0003067
Ota, N., Mizuno, D., Kuboki, N., Igarashi, I., Nakamura, Y., Yamashina, H., Hanzaike, T., Fujii,
K., Onoe, S., Hata, H., Kondo, S., Matsui, S., Koga, M., Matsumoto, K., Inokuma, H. &
Yokoyama, N. (2009). Epidemiological survey of Theileria orientalis infection in grazing
cattle in the eastern part of Hokkaido, Japan. Journal of Veterinary Medical Science
71(7), 937-944.
Parveen, S., Godara, R., Katoch, R., Yadav, A., Verma, P. K., Katoch, M., & Singh, N. K.
(2014). In vitro evaluation of ethanolic extracts of Ageratum conyzoides and Artemisia
absinthium against cattle tick, Rhipicephalus microplus. The Scientific World Journal,
Article ID 858973, 6 pages. doi.org/10.1155/2014/858973
Patel, G., Shanker, D., Jaiswal, A. K., Sudan, V., & Verma, S. K. (2013). Prevalence and
seasonal variation in ixodid ticks on cattle of Mathura district, Uttar Pradesh. Journal of
parasitic diseases, 37(2), 173-176.
Patil, D., Patil, A., Vadera, K., & Ansari, A. (2015). Standardization and quality control
parameters of aerial parts (Leaves and Stem) of Trigonella foenum- graecum L.-An
132
important medicinal plant. Journal of Chemical and Pharmaceutical Research, 7(3), 163-
170.
Paul, B. T., Mustapha, K. U., Musa, N., Gadzama, M. A., Ali, M., Mbaya, A. W., & Biu, A. A.
(2017). Experimental studies on the reproductive biology of Hyalomma truncatum
(Acari: Ixodidae) in Maiduguri, Nigeria. Journal of Parasitology and Vector Biology,
9(5), 57-63.
Perera, P. K., Gasser, R. B., Firestone, S. M., Anderson, G. A., Malmo, J., Davis, G., Beggs, D.
S., & Jabbar, A. (2014). Oriental theileriosis in dairy cows causes a significant milk
production loss. Parasite & Vectors, 7, 73. doi: 10.1186/1756-3305-7-73
Perveen, F. (2011). Distribution and identification of ixodid tick species on livestock in Northern
Pakistan. Journal of Agricultural Science and Technology, 1, 73-80.
Pesquera, C., Portillo, A., Palomar, A. M., & Oteo, J. A. (2015). Investigation of tick-borne
bacteria (Rickettsia spp., Anaplasma spp., Ehrlichia spp. and Borrelia spp.) in ticks
collected from Andean tapirs, cattle and vegetation from a protected area in Ecuador.
Parasite & Vectors, 8, 46. doi.org/10.1186/s13071-015-0662-3
Petro, Y., Kasege, P., Kilasara, D., Kawiche, E., Temba, V., Kaunda, E., & Sungi, I. (2012). The
efficacy of cypermethrin (vapco cypermethrin against cattle ticks in Tanzania. Journal of
Biology, Agriculture and Healthcare, 2(11).
Qamar, M. F., Sulehria, A. Q. K. & Zahra, N. (2009). Prevalence of Argas persicus in rural
poultry at Lodhran, Pakistan. Biologia (Pakistan), 55 (1&2), 87-92.
Qamar, M. F., Sulehria, A. Q. K., Raza, I., Abass, S. & Maqbool, A. (2009). Prevalence of blood
protozoans in buffaloes at Rahim Yar Khan, Pakistan. Biologia (Pakistan), 55(1&2), 73-
77.
Qiu, H., Kelly, P. J., Zhang, J., Luo, Q., Yang, Y., Mao, Y., Yang, Z., Li, J., Wu, H.,
& Wang, C. (2016). Molecular Detection of Anaplasma spp. and Ehrlichia spp. in
Ruminants from Twelve Provinces of China. Canadian Journal of Infectious Diseases
and Medical Microbiology, 9 pages. doi: 10.1155/2016/9183861
Rahuman, A. A., & Venkatesan, P. (2008). Larvicidal efficacy of five cucurbitaceous plant leaf
extracts against mosquito species. Parasitology Research, 103(1), 133-139.
133
Rajput, Z. I., Hu, S., Chen, W., Arijo, A. G., & Xiao, C. (2006). Importance of ticks and their
chemical and immunological control in livestock. Journal of Zhejiang University-
Science B, 7(11), 912-921.
Ramzan, M., Khan, M. S., Avais, M., Khan, J. A., Pervez, K., & Shahzad, W. (2008).
Prevalence of ecto parasites and comparative efficacy of different drugs against tick
infestation in cattle. Journal of Animal and Plant Sciences, 18, 17-19.
Rani, P. A. A., Irwin, P. J., Coleman, G. T., Gatne, M., & Traub, R. J. (2011). A survey of canine
tick-borne diseases in India. Parasite and Vectors, 4, 141.
doi.org/10.1186/1756-3305-4-141
Ravindran, R., Juliet, S., Gopalan, A. K. K., Kavalimakkil, A. K., Ramankutty , S. A., Nair, S.
N., Narayanan, P. M., & Ghosh, S. (2011). Toxicity of DMSO, Triton X 100 and Tween
20 against Rhipicephalus (Boophilus)annulatus. Journal of parasitic diseases, 35(2), 237–
239. DOI 10.1007/s12639-011-0054-3
Regnery, R., Spruill, C. L., & Plikaytis, B. D. (1991). Genotypic identification of Rickettsiae and
estimation of intraspecies sequence divergence for portions of two Rickettsial Genes.
Journal of Bacteriology, 173(5), 1576-1589.
Rehman, A., Nijhof, A. M., Sauter-Louis, C., Schauer, B., Staubach, C., & Conraths, F. J.
(2017). Distribution of ticks infesting ruminants and risk factors associated with high
tick prevalence in livestock farms in the semi arid and arid agro-ecological zones of
Pakistan. Parasites & Vectors, 10(1), 190.
Rehman, W. U., Khan, I. A., Qureshi, A. H., & Hussain, S. (2004). Prevalence of different
species of ixodidae (hard-tick) in Rawalpindi and Islamabad, Pakistan. Journal of
Medicine Research, 43, 52-55.
Riaz, M., Tasawar, Z., & Ullah, M. Z. (2017). An epidemiological survey on diversity and
seasonal distribution of hard ticks in sheep and goats in Multan, Pakistan. Journal of
Biodiversity and Environmental Sciences, 10(3), 50-61.
Rony, S. A., Mondal, M. M. H., Begum. N., Islam, M. A., & Affroze, S. (2010). Epidemiology
of ectoparasitic infestations in cattle at Bhawal forest area, Gazipur. Bang. Journal
Veterniary Medicine, 8, 27-33.
134
Ros-García, A., García-Pérez, A. L., Verdera, J., Juste, R. A., & Hurtado, A. (2012). Monitoring
piroplasms infection in three cattle farms in Minorca (Balearic Islands, Spain) with
previous history of clinical piroplamosis. Veterniary Parasitology, 190, 318-325.
Ros-García, A., M‟Ghirbi, Y., Bouattour, A., & Hurtado, A. (2011). First detection of Babesia
occultans in Hyalomma ticks from Tunisia. Parasitology, 138, 578–82.
Saad, F., Khan, K., Ali, S., & Akbar, N. U. (2015). Zoonotic significance and prophylactic
Measure against babesiosis. International Journal of Current
Microbiology and Applied Sciences, 4(7), 938-953.
Saddiqe, Z., Maimoona, A., & Khalid, S. (2013). Phytochemical analysis and anthelmintic
activity of extracts of aerial parts of Solanum nigrum L. Biologia (Pakistan), 59(2), 205-
211.
Sajid, M. S., Iqbal, Z., Khan, M. K. N., Muhammad, G., Needham, G., & Khan, M. K. N. (2011).
Prevalence, associated determinants, and in vivo chemotherapeutic control of hard ticks
(Acari: Ixodidae) infesting domestic goats (Capra hircus) of lower Punjab, Pakistan.
Parasitology Research, 108, 601-609.
Sajid, M. S., Iqbal, Z., Khan, M. N., & Muhammad, G. (2008). Point prevalence of hard ticks
(Ixodids) infesting domestic ruminants of lower Punjab, Pakistan. International Journal
of Agriculture and Biology, 10, 349-51.
Sajid, M. S., Iqbal, Z., Khan, M. N., & Muhammad, G. (2009a). In vitro and in vivo efficacies of
Ivermectin and Cypermethrin against the cattle tick Hyalomma anatolicum anatolicum
(Acari: Ixodidae). Parasitology Research, 105, 1133-1138.
Sajid, M. S., Iqbal, Z., Khan, M. N., Muhammad, G., & Khan, M. K. (2009b). Prevalence and
associated risk factors for bovine tick infestation in two districts of lower Punjab,
Preventive Veterinary Medicine, 92, 386-391.
Sajid, M. S., Siddique, R. M., Khan, S. A., Iqbal, Z., & Khan, M. N. ( 2014). Prevalence and risk
factors of anaplasmosis in cattle and buffalo populations of district Khanewal, Punjab,
Pakistan. Global Veterinaria, 12(1), 146-153.
135
Satta, G., Chisu, V., Cabras, P., Fois, F., & Masal, G. (2011). Pathogens and symbionts in ticks:
a survey on tick species distribution and presence of tick- transmitted micro-organisms
in Sardinia, Italy. Journal of Medical Microbiology, 60, 63-68.
Shahnaz, Z., Chaudry, F. R., Shamim, A., Zafar, M. A., Hasan, M., Iqbal, M. F., & Riaz, A.
(2016). Research soft tick (Argas persicus) infestation at government layer farms of
Pothwar region of Punjab, Pakistan. Journal of Entomology and Zoology Studies, 4(4),
664-667.
Shahzad, W., Noor, H., Ahmad, M., Munir, R., Saghar, M. S., Mushtaq, M. H., Ahmad, N.,
Akbar, G., & Mehmood, F. (2013). Prevalence and Molecular Diagnosis of Babesia ovis
and Theileria ovis in lohi sheep at livestock experiment station (LES), Bahadurnagar,
Okara, Pakistan. Iranian Journal of Parasitology, 8, 570-578.
Shams, S., Ayaz, S., Ali, I., Khan, S., Gul, I., Gul, N., & Khan, S. N. (2013). Sensitivity and
Specificity of PCR & Microscopy in detection of Babesiosis in domesticated cattle of
Khyber Pakhtunkhwa, Pakistan. International Journal of Advancements in Research &
Technology, 2(5), 37-41.
Sharifinia, N., Rafinejad, J., Hanafi-Bojd, A. A., Chinikar, S., Piazak, N., Baniardalani, M.,
Biglarian, A., & Sharifinia, F. (2014). Hard ticks (Ixodidae) and Crimean-Congo
Hemorrhagic Fever Virus in South West of Iran. Acta Medica Iranica, 53(3), 177-181.
Shkap, V., Molad, T., Fish, L., & Palmer, G. H. (2002). Detection of the Anaplasma Centrale
vaccine strain and specific differentiation from Anaplasma marginale in vaccinated and
infected cattle. Parasitology Research, 88, 546-552.
Shrivastava, A., Singh, S., & Singh, S. (2013). Phytochemical investigation of different plants
parts of Calotropis procera. International Journal of Scientific and Research
Publications, 3(8), 1-4.
Shyma, K. P., Gupta, J. P., Ghosh, S., Patel, K. K., & Singh, V. (2014). Acaricidal effect of
herbal extracts against cattle tick Rhipicephalus (Boophilus) microplus using in vitro
studies. Parasitology Research, 113(5), 1-8.
Siddiqi, M. N., & Jan, A. H. (1986). Ixodid ticks Ixodidae of N.W.F.P. Pakistan. Pakistan
Veterniary Journal, 6, 124-6.
136
Sindhu, Z. U. D., Iqbal, Z., Khan, M. N., Jonsson, N. N., & Siddique, M. (2010). Documentation
of ethno-veterinary practices used for treatment of different ailments in selected a hilly
area of Pakistan, International Journal of Agriculture & Biology, 12, 353-358.
Sindhu, Z. U. D., Ullah, S., Abbas, R. Z., Iqbal, Z., & Hameed, M. (2012). Inventory of ethno-
veterinary practices used for the control of parasitic infections in district Jhang, Pakistan.
International Journal of Agriculture & Biology, 14, 922-928.
Singh, A. K., Tiwari, M. N., Prakash,
O., & Singh, M. P. (2012). A current review of
cypermethrin-induced neurotoxicity and nigrostriatal dopaminergic neurodegeneration.
Current Neuropharmacology, 10(1), 64-71.
Singh, A., & Chhabra, R. E. (1973). Incidence of arthropod pests of domesticated animals and
birds Indian. Animal Sciences, 43, 393-397.
Singh, H., Singh, N. K., & Rath, S. S. (2012). Occurrence of canine hepatozoonosis in and
around Ludhiana district (Punjab). Indian Journal of Canine Practice, 4(1), 64-66.
Singh, N. K. & Rath, S. S. (2013). Epidemiology of ixodid ticks in cattle population of various
agro-climatic zones of Punjab, India. Asian Pacific Journal of Tropical Medicine, 947-
951.
Sivakumar, T., Hayashida, K., Sugimoto, C., & Yokoyama, N. (2014). Evolution and genetic
diversity of Theileria. Infection Genetic Evoloution, 27, 250-263.
Sonenshine, D. E., & Roe, R. M. (Eds.), 2014. The biology of ticks. Oxford University Press,
New York.
Soomro, M. H., Soomro, S. P., Bhutto, M. B., Akbar, Z., Yaqoob, M., & Arijo, A. G. (2014).
Prevalence of Ticks in Buffaloes in the Upper Sindh Pakistan. Buffalo Bulletin, 33(3),
323-327.
Sultana, N., Shamim, A., Awan, M. S., Ali, U., Hassan, M. U., & Siddique, R. M. (2015). First
pilot study on the prevalence of tick infestation in livestock of tehsil Hajira, Rawalakot,
Azad Kashmir. Advances in Animal and Veterinary Sciences, 3(8), 430-434.
Talat, R., Khanum, T., & Hayat, A. (2005). Studies on mammalian haematozoan parasites of
NWFP Pakistan. Pakistan Journal of Biological Sciences, 8, 726-729.
137
Tasawar, Z., Nasim, S., & Lashari, M. S. (2014). The Prevalence of ixodid ticks on buffaloes at
private animal farm Bibipur, Multan. Global Veterinaria, 12(2), 154-157.
Teel, P. D., Marin, S. L., & Grant, W. E. (1996). Simulation of host parasite landscape
interactions: influence of season and habitat on cattle fever tick (Boophilus sp.)
population dynamics. Ecological Modeling, 84, 19-30.
Tingle, C. C. D., Rother, J. A., Dewhurst, C. F., Lauer, S., & King, W. J. (2003). Fipronil:
environmental fate, ecotoxicology and human health concerns. Reviews
of Environmental Contamination and Toxicology, 176, 1-66.
Tiwari, D. A., Singh, S., & Singh, S. (2014). Chemical analysis of leaf extracts of Calotropis
procera. International Journal of Scientific and Research Publications, 4(1), 1-3.
Ullah, A., Hassan, S., Khan, M. I., Rizwan, M., Ullah, Z., & Shah, M. (2016). Antioxidant,
phytotoxic and cytotoxic activity of methanolic extract of Trigonella foenum-graecum.
Journal of Coastal Life Medicine; 4(5), 386-389.
Ullah, S., Khan, M. N., Sajid, M. S., Iqbal, Z., & Muhammad, G. (2015). Comparative efficacies
of Curcuma longa, Citrullus colocynthis and Peganum harmala against Rhipicephalus
microplus through modified larval immersion test. International Journal of Agriculture
& Biology, 17, 216-220.
Walker, A., Bouattour, A., Camicas, J., Estrada- Pena, A., Horak, I., Latif, A., Pegram, R., &
Preston, P. (2003). Ticks of Domestic Animals in Africa. A Guide to Identification of
Species. Bioscience Reports, London, UK.
Wamuyu, L., Obanda, V., Kariuki, D., Gakuya, F., Makanda, M., Otiende, M., & Ommeh, S.
(2015). Molecular detection and characterization of theileria infecting wildebeest
(Connochaetes taurinus) in the Maasai Mara National Reserve, Kenya. Pathogens, 4,
626-638.
Wen, B., Cao, W., & Pan, H. (2003). Ehrlichiae and Ehrlichial diseases in China. Animals of
the New York Academy of Sciences, 990, 45-53.
Wen, B., Jian, R., Zhang, Y., & Chen, R. (2002). Simultaneous detection of Anaplasma
marginale and a new Ehrlichia species closely related to Ehrlichia chaffeensis by
sequence analyses of 16S ribosomal DNA in Boophilus microplus ticks from Tibet.
Journal of Clinical Microbiology, 40, 3286-90.
138
Yokoyama, N., Sivakumar, T., Ota, N., Igarashi, I., Nakamura, Y., Yamashina, H., Matsui, S.,
Fukumoto, N., Hata, H., Kondo, S., Oshiro, M., Zakimi, S., Kuroda, Y., Kojima, N.,
Matsumoto, K. & Inokuma, H. (2012). Genetic diversity of Theileria orientalis in tick
vectors detected in Hokkaido and Okinawa, Japan. Infection, Genetics and Evolution, 12,
1669-1675.
Yousefi, A., Rahbari, S., Shayan, P., Sadeghi-dehkordi, Z., & Bahonar, A. (2017). Molecular
detection of Anaplasma marginale and Anaplasma ovis in sheep and goat in west
highland pasture of Iran. Asian Pacific Journal of Tropical Biomedicine, 7(5), 455-459.
Yu, P. F., Niu, Q. L., Liu, Z. J., Yang, J. F., Chen, Z., Guan, G. Q., Liu, G. Y., Luo, J. X., & Yin,
H. (2016). Molecular epidemiological surveillance to assess emergence and re-
emergence of tick-borne infections in tick samples from China evaluated by nested
PCRs. Acta Tropical, 158, 181-188.
Zaman, M. A., Iqbal, Z., Sandhu, Zia-ud-Din., Abbas, R. Z., & Qamar, M. F. (2012).
International Journal of Agriculture & Biology, 00: 000-000
Zorloni, A., Penzhornb, B. L., & Eloffa, J. N. (2010). Extracts of Calpurnia aurea leaves from
Southern Ethiopia attract and immobilise or kill ticks. Veterinary Parasitology, 168(1-2),
160-4.
Zulfiqar, S., Shahnawaz, S., Ali, M., Bhutta, A. M., Iqbal, S., Hayat, S., Qadir, S., Latif, M.,
Kiran, N., Saeed, A., Ali, M., & Iqbal, F. (2012). Detection of Babesia bovis in blood
samples and its effect on the hematological and serum biochemical profile in large
ruminants from Southern Punjab. Asian Pacific Journal of Tropical Biomedicine, 2(2),
104-8.
Recommended