Prediction

PredictionAuthor(s): Morris GilbertSource: Poetry, Vol. 20, No. 4 (Jul., 1922), p. 200Published by: Poetry FoundationStable URL: http://www.jstor.org/stable/20573661 .

Accessed: 14/05/2014 14:43

Your use of the JSTOR archive indicates your acceptance of the Terms & Conditions of Use, available at .http://www.jstor.org/page/info/about/policies/terms.jsp

.JSTOR is a not-for-profit service that helps scholars, researchers, and students discover, use, and build upon a wide range ofcontent in a trusted digital archive. We use information technology and tools to increase productivity and facilitate new formsof scholarship. For more information about JSTOR, please contact support@jstor.org.

Poetry Foundation is collaborating with JSTOR to digitize, preserve and extend access to Poetry.

http://www.jstor.org

This content downloaded from 195.78.108.54 on Wed, 14 May 2014 14:43:22 PMAll use subject to JSTOR Terms and Conditions

POETRY: id Magazine of Verse

PREDICTION

In some inimical starry night When the worthies are abed, Suddenly will come a flight Of baleful things about your head. These will not be simply bats (These, imponderable as leaves), These will not be timid gnats These will be audacious thieves:

Devils of the midnight's action, Wrong ones of the twisted spheres, A fluttering unholy faction Of Port Havoc mutineers.

In your spirit's corridors There will, that night, be strange things: What were dances will be wars, There will be vain imaginings Slaughter and knavery and laughter, Sights to make a man afraid, Boozing, cajoling, boasts, and after (I need not say) you'll be betrayed. . ..

Since the story is so bitter The quaint world will find its proofs What is left of you will flitter Like a grey cat on the roofs.

Morris Gilbert

This content downloaded from 195.78.108.54 on Wed, 14 May 2014 14:43:22 PMAll use subject to JSTOR Terms and Conditions

Prediction

Documents

Commodity Price Prediction using An Artificial Prediction Market based Approach · · 2017-09-07Commodity Price Prediction using An Artificial Prediction Market based Approach July

Earthquake Prediction and Earthquake Damage Prediction

Gene prediction. Gene Prediction: Computational Challenge aatgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatg ctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgc

earthquake prediction

Prediction Markets 2018 - VirtualPrivateLibrarywhitepapers.virtualprivatelibrary.net/Prediction Markets.pdfPrediction Markets 2018 White Paper Link Compilation ... enric/papers/prediction-markets-ArgMAS.pdf

10/24/05 Promoter Prediction RNA Structure & Function Prediction

Multiclass Prediction Model for Student Grade Prediction

Gene prediction in flies ● Background ● Gene prediction pipeline ● Resources

Amazing prediction

Algorithms for context prediction in Ubiquitous Systems ... · Prediction with self organising maps Stochastic prediction approaches: ARMA and Kalman lter Alternative prediction approaches

D3.2 Link prediction models - redalertproject.euredalertproject.eu/.../D3-2-Link-prediction-models... · D3.2 Link prediction models Report: Link prediction models Project acronym:

Ashtakavarga Prediction

Panchapakshi Prediction

Data Mining: Classification. Classification and Prediction zWhat is classification? What is prediction? zIssues regarding classification and prediction

Dasha Prediction

Decadal prediction of sustainable agricultural and forest management - Earth system prediction differs from climate prediction

Housing Prediction

Ehp Prediction

Assessment of prediction error of risk prediction models

Classification and Prediction. What is classification? What is prediction? Issues regarding classification and prediction Classification by decision