View
2
Download
0
Category
Preview:
Citation preview
Phylogenetic relationships in Apocynaceae based on both nuclear and plastid molecular datasets
A Dissertation Submitted in the Partial Fulfilment of the Requirements for the Degree of Doctor of Philosophy in PLANT SCIENCES
BY
NAZIA NAZAR
DEPARTMENT OF PLANT SCIENCES, FACULTY OF BIOLOGICAL SCIENCES,
QUAID-I-AZAM UNIVERSITY ISLAMABAD, PAKISTAN
2012
Phylogenetic relationships in Apocynaceae based on both nuclear and plastid molecular datasets
Doctor of Philosophy in Plant Sciences
BY
NAZIA NAZAR
DEPARTMENT OF PLANT SCIENCES, FACULTY OF BIOLOGICAL SCIENCES,
QUAID-I-AZAM UNIVERSITY ISLAMABAD, PAKISTAN
2012
Dedicated
To
My Parents
Table of Contents
Index of figures i
Index of tables ii
Acknowledgements iii
List of abbreviations iv
Abstract v
Chapter One — General Introduction 1
1.1 Distribution of Apocynaceae 1
1.1.1 Asclepiadoideae 1
1.1.2 Secamonoideae 2
1.1.3 Periplocoideae 2
1.1.4 Apocynoideae and Rauvolfioideae 3
1.2 Economic importance of Apocynaceae 3
1.3 Apocynaceae ─ since Brown’s treatise 4
1.4 An overview of subfamilies in Apocynaceae sensu lato 7
1.4.1 Rauvolfioideae 7
1.4.2 Apocynoideae 10
1.4.3 Periplocoideae 13
1.4.4 Secamonoideae 15
1.4.5 Asclepiadoideae 17
1.5 The use of molecular data in cladistic analysis 20
1.6 Utility of plastid and nuclear regions for phylogenetic reconstruction in plants 21
1.7 Nuclear gene (Phytochrome A) 22
Chaper two — Materials and Methods 25
2.1 Taxon sampling 25
2.2 DNA extraction 25
2.3 Polymerase chain reaction (PCR) 34
2.3.1 trnL-F intron-spacer region 37
2.3.2 Nuclear gene PHYA 37
2.3.3 Promoter region of atpB gene 37
2.4 Purification of amplified products 37
2.5 Sequencing 38
2.6 Data analysis 38
2.6.1 Parsimony analysis 38
2.6.2 Bayesian analyses 38
Chapter three — Results 55
3.1 DNA extraction and PCR 55
3.2 Purification and sequencing of amplified products 55
3.3 Phylogenetic analysis based on plastid trnL-F intron region sequences 55
3.4 Phylogenetic analysis of Apocynaceae by using nuclear region (PHYA) 63
3.5 Combined phylogenetic analyses (PHYA and trnL-F) of Apocynaceae 64
3.6 Phylogenetic analysis based on promoter region of atpB gene promoter 79
Chapter four — Discussion 82
4.1 Incongruence 82
4.2 Asclepiadoideae 83
4.2.1 Fockeeae 83
4.2.2 Ceropegieae 83
4.2.3 Marsdenieae 87
4.2.4 Asclepiadeae 88
4.2.5 Asclepiadeae – ACT group 88
4.2.6 Asclepiadeae ─ MOG group 88
4.3 Secamonoideae 91
4.4 Periplocoideae 92
4.5 Apocynoideae 93
4.5.1 APSA clade 93
4.5.2 Nerieae 96
4.5.3 Malouetieae 96
4.5.4 Odontadenieae 97
4.5.5 Mesechiteae 97
4.5.6 Echiteae 98
4.5.7 Apocyneae 98
4.5.8 Baisseeae 98
4.6 Rauvolfioideae 99
4.6.1 Alstonieae and Aspidospermeae 100
4.6.2 Alyxieae 100
4.6.3 Vinceae 100
4.6.4 Plumerieae 103
4.6.5 Tabernaemontaneae 103
4.6.6 Melodineae 104
4.6.7 Carisseae 104
4.7 Phytochrome A 104
4.8 Conclusion 105
Chapter five — References 106
Appendix One 128
QIAquick PCR purification kit protocol 128
Appendix two 129
Cycle sequencing 129
Purification of cycle sequencing product 129
i
Index of figures
Figure 1.1 A summary of the relationships among five subfamilies and twenty two
tribes of Apocynaceae..................................................................................................24
Figure 2.1 Map showing the areas of plant collection in Pakistan..............................32
Figure 2.2 Map showing different countries of the world, from where different taxa of
Apocynaceae were collected and stored in herbarium or as living collection in The
Royal Botanic Gardens, Kew, London.........................................................................33
Figure 2.3 Showing locations of primers used to amplify different regions of plastid
and nuclear genomes....................................................................................................35
Figure 3.1 Extraction of genomic DNA and amplified products of different plastid
and nuclear regions.......................................................................................................56
Figure 3.2 One of the most parsimonious trees for Apocynaceae based on the
sequences of plastid trnL-F region...............................................................................58
Figure 3.3 The Bayesian tree resulting from the analysis of the trnL-F sequences for
Apocynaceae................................................................................................................60
Figure 3.4 Parsimony analysis of only PHYA sequences from different taxa of
Apocynaceae................................................................................................................65
Figure 3.5 Bayesian tree based on only PHYA sequences...........................................67
Figure 3.6 Parsimony analysis of trnL-F sequences of taxa present in combined
analyses........................................................................................................................69
Figure 3.7 Bayesian analysis of trnL-F sequences of taxa present in combined
analyses....................................................................................................................... 71
Figure 3.8 One of the most parsimonious trees for Apocynaceae based on sequences
of the combined dataset (PHYA and trnL-F)................................................................73
Figure 3.9 Bayesian analysis of Apocynaceae by using combined datasets (PHYA and
trnL-F)..........................................................................................................................75
Figure 3.10 Parsimony tree generated by using molecular combined data set (trnL-F,
atpB and PHYA)...........................................................................................................80
Figure 3.11 Majority rule consensus tree based on the Bayesian analysis of the
combined molecular datasets (trnL-F, atpB and PHYA)..............................................81
ii
Index of tables
Table 2.1 A list of the samples from Pakistan and The Royal Botanic Gardens Kew,
London with vouchers information and place of collection.........................................26
Table 2.2 Sequences and sources of different primers used in this study...................36
Table 2.3 A list of taxa with GenBank accession numbers used in trnL-F and PHYA
analyses........................................................................................................................39
Table 4.1 Current phylogenetic positions of taxa in different groups of
Asclepiadoideae............................................................................................................84
Table 4.2 Phylogenetic position of taxa in different groups of Apocynoideae in
comparison with previous studies................................................................................94
Table 4.3 Comparative overview of phylogenetic position of Rauvolfioideae’s taxa
within present phylogenetic analyses and previous classifications............................101
iii
Acknowledgment
In the name of Allah, the Most Gracious and the Most Merciful Alhamdulillah, all
praises to Allah for the strengths and His blessing in completing this thesis. First and
foremost I wish to thank my supervisor Dr. Tariq Mahmood (Department of Plant
Sciences) for his guidance, suggestion and encouragement throughout the Ph.D study.
I wish to express my heartfelt appreciation and deep sense of devotion to Prof. Mark
W. Chase (Royal Botanic Gardens, Kew, London) who was a permanent source of
encouragement and guidance for completion of my research work in Jodrell
laboratory. His scholarly ideas beautified the scientific nature of this research work.
He always directed to enlighten the ways of life as well. I would also like to pay my
cordial thanks to James J Clarkson and David Goyder (from Royal Botanic
Gardens Kew, London) for their continuous cooperation, munificent guidance,
moral inputs, support, unconditional help and valuable advices they offered for
completion of my research. Their continuous encouragement and concern are highly
appreciated. It gives me great pleasure to express my gratitude to Higher Education
Commission of Pakistan, for providing Indigenous and IRSIP scholarships.
I would like to express my gratitude to the Dean, Faculty of Biological Sciences,
Prof. Dr. Asghari Bano and also to the faculty members of Department of Plant
Sciences, Dr. Mushtaq Ahmad and Dr. Mir Ajab Khan for their support and help. I
would also like to thanks late Dr. Muhammad Arshad (Cholistan Institute of Desert
Studies, The Islamia University of Bahawalpur) for providing plant specimens from
Pakistan. My acknowledgement also goes to all the technicians and office staffs of
Department of Plant Sciences for their co-operations.
My special thanks to my friends and fellows Sobia Kanwal, Ishrat Naveed, Faiza
Munir, Shazia Rehman and all junior students of the Lab. I am deeply indebted to
my parents for their support, both emotional and financial, over the years. Last, but
certainly not least, I would like to give special thanks to Muhammad Sarfraz, who is
a great listener and has always been at my side during the highs and lows of this
project.
Nazia Nazar
iv
List of Abbreviations
ACT Asclepiadinae, Cynanchinae and Tylophorinae
AIDS Acquired Immunodeficiency Syndrome
APG Angiosperm Phylogeny Group
APSA Apocynoideae, Periplocoideae, Secamonoideae and
Asclepiadoideae
bp Base Pair
BP Bootstrap
BSA Bovine serum albumin
CI Consistency Index
CsCl-EtBr Cesium Chloride Ethidium Bromide
CTAB Cetyl Trimethyl Ammonium Bromide
EDTA Ethylene diamine Tetra Acetic Acid
ITS Internal Transcribed Spacer
MCMC Monte Carlo Markov chain
MCMC Monte Carlo Markov Chains
Mgcl2 Magnesium Chloride
ML Maximum Likelihood
MOG Metastelmatinae, Oxypetalinae and Gonolobinae
MP Maximum Parsimony
NJ Neighbour Joining
PAUP Phylogenetic Analysis Using Parsimony
PCR Polymerase Chain Reaction
PHYA Phytochrome A
PP Posterior Probability
RI Retention Index
SSC single-site catalysis
TBR Tree Bisection-Reconnection
TE Tris Ethylene Diamine Tetra Acetic Acid
UPGMA Unweighted Pair Group Method with Arithmetic Means
UV Ultra Violet
v
Abstract
The phylogenetic relationships within Apocynaceae were investigated in the present
study. In addition trnL-F intron-spacer region and atpB promoter, a part of PHYA
exon, a low-copy nuclear gene were sequenced from Apocynaceae. Different taxa of
the family were collected from Pakistan and different regions of the world,
representing major groups of the family. Separate phylogenetic trees were constructed
using trnL-F and PHYA sequences and then combined datasets were used for
simultaneous analysis. In the separate trnL-F analyses (comprised of 178 taxa with
updated nomenclature) both parsimony and Bayesian, yield a number of stable clades,
but placement of tribes (Vinceae, Tabernaemontaneae, Hunterieae and Melodineae) in
Rauvolfioideae is uncertain and lack high level of support. A clade comprising
Ceropegieae and Marsdenieae receives good support confirming the monophyly of
both tribes. The grouping of taxa in Asclepiadeae is not satisfactory to define a
subtribal classification. Malagasy Cynanchum group forms a separate clade in both
analyses while the monophyly of New World Cynanchineae is not supported here.
In the combined phylogenetic analyses, 112 taxa were included representing most
major caldes in Apocynaceae. The study confirms that Periplocoideae are nested
within Apocynoideae. The APSA clade (Apocynoideae, Periplocoideae,
Secamonoideae and Asclepiadoideae) is strongly supported here, but the crown clade
of Apocynaceae (comprised of subfamilies Asclepiadoideae, Secamonoideae,
Periplocoideae and Echiteae, Mesechiteae, Odontadenieae and Apocyneae of
Apocynoideae) has only moderate support. The present study places Periplocoideae as
part of the sister group to the rest of the crown clade and the tribe Baisseeae emerges
as sister group of Secamonoideae-Asclepiadoideae clade. Old World Cynanchinae
form a well-supported clade with the New World MOG (Metastelmatinae,
Oxypetalinae and Gonolobinae) tribes rather than with the largely Old World
Asclepiadinae and Tylophorinae, as suggested by earlier studies. By addition of atpB
promoter sequences of Rauvolfioideae’s taxa in combined dataset (trnL-F and PHYA),
the inter-generic resolution was not improved in the subfamily.
In the present study, resolution among most groups (such as inter-tribal relationships
of Asclepiadoideae) is improved in combined analyses as compared to previous
phylogenies, based on only plastid regions. However, there is a need to sequence
vi
more nuclear loci like PHYA from greater number of taxa to further improve
relationships in the family.
Chapter 1
1
Introduction
The traditional family Asclepiadaceae (Milkweed family) according to APG
(Angiosperm Phylogeny Group) II (2003) and III (2009) is now included in
Apocynaceae (dogbane family). The Apocynaceae sensu lato is found throughout the
world, although is very much more diverse in tropics. Species range from large forest
trees to small under storey trees and shrubs and from small twiners to large lianas. It
is one of the ten largest angiosperm families with ~5100 species distributed among
375 genera (Meve, 2002; Rapini et al., 2002; Endress, 2004; Endress et al., 2007a).
1.1 Distribution of Apocynaceae
Species of Apocynaceae are mainly distributed in tropical regions such as rainforest
and swamps, northern Australia, forest of Africa and India, tropical, central, South and
North America, Mediterranean region and continental southern Africa. Good (1947,
1952) was first who mapped the distribution of traditional Asclepiadaceae
(Asclepiadoideae, Secamonoideae and Periplocoideae). He suggested that
Asclepiadaceae is much more diverse in southern Africa and Madagascar regions.
Goyder (2006) after 50 years of Good’s publications re-examined the origin and
region of diversity of the major groups in the traditional Asclepiadaceae.
1.1.1Asclepiadoideae
The subfamily comprises of ~3000 species distributed all over the world, with three
main centres of generic diversity: tropical central and South America, tropical Asia,
eastern and southern Africa (Goyder, 2006). In Madagascar region, generic diversity
is comparatively low with only 12 genera of the subfamily. Meve and Liede (2002)
studied the phytogeographic relationships between genera of African and Madagascar
origin. They concluded that except Cynanchum where events of dispersal are directed
from Madagascar to mainland Africa, all other species which are common in both
regions, pointing the dispersal events in both directions. In a recent study (Rapini et
al., 2007), it is estimated that the subfamily originate in the Old World and then
disperse in New World.
Chapter 1
2
All members of tribe Marsdenieae are largely distributed in Southeast Asia except
Marsdenia, the only genus of the tribe found in New World with few species in
Madagascar and continental Africa (Rapini et al., 2003). Although centre of diversity
of Ceropegieae is southern Africa, but genera are also found in tropical Asia and
Madagascar regions (Goyder, 2006). Asclepiadeae, the largest tribe of the subfamily
has divided into two vicariant groups by Rapini et al. (2003). One clade comprises of
subtribes Asclepiadinae, Cynanchinae and Tylophorinae (ACT) centred in Old World
eastern and southern Africa. Only two genera — Asclepias and subgenus
Mellichampia of Cynanchum are found in New World. The Second vicariant clade
encompasses subtribes Metastelmatinae, Oxypetalinae and Gonolobinae (MOG) is
restricted to central and South America with exception of Gonolobus, most probably
this genus recently radiated to West Africa (Goyder, 2006). Early-divergent clades
Fockeeae, Eustegia and Astephaninae of the subfamily are found in arid regions of
Africa and Arabia, suggesting that this dispersal occurred very early during the
evolution of Asclepiadoideae (Court, 1987; Goyder, 2006).
1.1.2 Secamonoideae
Genera of the subfamily are restricted to the Old World and main centre of diversity is
Madagascar and the species moved into Southeast Asia and then Africa (Klackenberg,
1992a, b, 1995a, 2001). Secamone is the diverse genus of the subfamily, mainly found
in Madagascar, Mascarene Islands, Africa, Australia and Asia (Forster and Harold,
1989; Goyder, 1992; Klackenberg, 1992a, b; Klackenberg, 1996a; Klackenberg, 2001;
Bruyns, 2004). Toxocarpus and Genianthus have centred in Asia (Klackenberg,
1995a), while other genera are restricted to Madagascar to Mascarene Islands
(Friedman, 1990; Klackenberg, 1995b; Civeyrel and Klackenberg, 1996; Klackenberg,
1996a, b, 1997, 2005).
1.1.3 Periplocoideae
The subfamily is also entirely exist in Old World’s Asia, Madagascar, Africa,
Australia and Europe (Goyder, 2006). Most of the genera in the subfamily are woody
climbers and found in tropical rain forest, some shrubs inhabiting semi-arid savannah,
herbaceous geophytes dwell in grassland, savannah, semi-desert, and desert and
epiphytes occupy tropical forest (Venter and Verhoeven, 1997, 2001).
Chapter 1
3
1.1.4 Apocynoideae and Rauvolfioideae
The subfamilies are distributed in all over the world. Tribe Wrightieae is exclusively
restricted in Old World (Endress and Bruyns, 2000) also reported in the study of
Livshultz et al. (2007). Whereas Apocyneae and Malouetieae are mainly Old World
tribes with exception of Odontadenia, Apocynum, and Trachelospermum found in
New World and Malouetia in West Africa and central and South America (Zarucchi et
al., 1995; Endress and Bruyns, 2000; Livshultz et al., 2007). Mesechiteae are
completely part of the New World Apocynoideae (Endress and Bruyns, 2000), while
Echiteae have genera endemic both in New and Old World (Morales, 1997). Tall
evergreen tree forest such as Alstonia and Dyera are found in rainforests and swamps
of Indomalaya. India, Malaya in Asia and tropical America are inhabited by shrubs of
Rauvolfioideae (Rauvolfia, Tabernaemontana and Ackokanthera) and Plumeria is
endemic in central America (cited in Middleton, 2007).
1.2 Economic importance of Apocynaceae
The members of this family are economically very important in medicinal industry.
Forest trees such as Alstonia and Dyera species are source of lightweight hardwood
used in the manufacturing of match boxes, drawing boards, pencils etc. (cited in
Soerianegara and Lemmens, 1994). This family is also a rich source of various
alkaloids, like herb ‘Madagascar periwinkle’ is a source of nearly more than 100
alkaloids. Two of them, vinblastine and vincristine’ are also very useful in modern
medicine and used against Hodgkin’s disease and lymphocytic leukaemia,
respectively (Alan and Wilkes, 1964). This plant had also been traditionally used in
Madagascar and Jamaica for the treatment of diabetes (Chin et al, 2006).
Calotropis procera is another well-known medicinal plant and has been used in the
preparation of various Ayurvedic, Unani, Homeopathic medicines (Oudhia et al.,
1999). Different parts of this plant have been reported to exhibit anti-inflammatory,
analgesic, and antioxidant properties (Deepak et al., 1997). Whereas, latex of C.
gigantea have glycoside ‘giganteol’ and is useful in curing leprosy, scabies, ring
worm of the scalp, piles, eruptions on the body, asthma, enlargement of spleen and
liver and cause of vasodilatation effect (Kirtikar and Basu, 1999; Sheelaa et al., 2010).
Another example of medicinal value of this family is the genus Caralluma, the species
Chapter 1
4
are widely exploited for investigation of medicinal properties. Various studies
reported different species of the genus can significantly decrease the glucose level in
blood ultimately control diabetes (Habibuddin et al., 2008).
Ethnobotanically, Caralluma species in Pakistan have been used to cure fever and
rheumatism, while C. tuberculata is consumed as vegetable (Khan and Khatoon,
2008). Beside this other medicinal important genera are Asclepias, Leptadenia,
Pergularia, Cynanchum have also been tested for medicinal properties (Thankamma,
2003). The roots of Rauvolfia serpentine for centuries had been applied for the
treatment of mental diseases and dysentery in India. Recently in an ethnobotanical
survey in India by Dey and De (2011), reported other ethonobotanical use of the plant
such as schizophrenia, hypertension, blood pressure, gastrointestinal diseases,
circulatory disorders, pneumonia, fever, malaria, asthma, skin diseases, scabies, eye
diseases, spleen diseases, AIDS (Acquired Immunodeficiency Syndrome),
rheumatism, body pain, veterinary diseases etc. Almost 50 alkaloids are isolated from
this species and most important are yohimbine, reserpine, ajmaline, deserpidine,
rescinnamine, serpentinine (cited in Dey and De, 2011).
1.3 Apocynaceae ─ since Brown’s treatise
Robert Brown in 1810 segregated Asclepiadeae (Asclepiadaceae) from Jussieu’s
(1789) Apocineae (Apocynaceae) (Brown, 1810) on the basis of Pollinia and attached
translator in the former and their absence in latter (Brown, 1811). Before this
separation, the family Apocineae contained only 24 genera as described by Jussieu
(1789). Three groups were identified by Jussieu using gynoecium, fruit and seed
character in Apocineae. Taxa in Groups 1 and 3 have anthers free from style-head and
non-comose seeds, representing Rauvolfioideae in modern classification (Endress,
2004). Whereas, taxa in the Group 2 showed complicated flowers having anthers
united with the style-head and comose seed. They constitute all other subfamilies in
recent classification and recognised as APSA (Apcynoideae, Periplocoideae,
Secamonoideae and Asclepiadoideae) clade in cladistic analysis (Livshultz et al.,
2007). At that time, Brown was attracted toward complex floral morphology of
Jussieu’s Group 2 and observed ‘the essential characters’ such as pollen coalesced in
to masses (pollinia) and these pollinia are attached to a translator. On the basis of
these characters, Brown excluded some of the genera and then raised the Group 2 to a
Chapter 1
5
separate family ‘Asclepiadeae’. It was realized that pollinia are produced in anthers,
until that it was a common opinion that pollinia are produced by style-head (Brown,
1833).
Despite the fact that Brown’s classification has been universally accepted and
implemented, but the controversies over the delimitation of families has never been
put into rest. Though, they have more similar characters than rest of Gentianales.
Since Brown’s delimitation, three suggestion have appeared to described the
relationship of both families: reunite them as single family (Hallier, 1905; Demeter,
1922; Safwat, 1962; Stebbins, 1974; Stevens, 1976; Thorne, 1976, 1992; Judd et al.,
1994; Struwe et al., 1994; Takhtajan, 1997), as a separate order (Tsiang, 1934;
Hutchinson, 1973) and as a suborder within the Gentianales (Rosatti, 1989; Nicholas
and Baijnath, 1994; Omlor, 1998). After two hundred year later of Brown’s time, new
evidences from more detailed morphological studies either alone or in combination
with molecular information (Judd et al., 1994; Endress and Albert, 1995; Sennblad
and Bremer, 1996; Sennblad, 1997; Civeyrel et al., 1998; Sennblad et al., 1998;
Potgieter, 1999) support the recognition of two families as single entity.
Another significant contribution of Brown was his subdivision of Asclepiadeae into
three groups on the basis of floral characters (Brown, 1833). This infra-familial
subdivision is still valid after 200 year later. The ‘Asclepiadeae verae’ has two pollen
sac and thus two pollinia. This group is known today as the Asclepiadoideae. Another
unnamed group known as Secamonoideae today, has four pollen sacs in each anther
and thus produces four pollinia. The Periplocoideae represent the Brown’s group
‘Periploceae’ has pollen in tetrad or rarely in pollinia, are shed onto a sticky spoon-
like translator (Endress and Bruyns, 2000). Fishbein (2001) generated tree, based on
matK gene, which reflect Brown’s accuracy in recognising subfamilies
Periplocoideae, Secamonoideae and Asclepiadoideae.
Prior to the implementation of modern cladistic analysis, it was considered that
Apocynaceae sensu stricto are not monophyletic without Asclepiadaceae (Schumann,
1895; Demeter, 1922; Macfarlane, 1933). The highly complex flowers of
Asclepiadaceae are believed to be evolved from least modified flowers of
Rauvolfioideae in Apocynaceae (Endress and Bruyns, 2000). The floral characters of
Apocynoideae, Periplocoideae and Secamonoideae represent a series of transition
Chapter 1
6
between traditional Apocynaceae and Asclepiadaceae (Demeter, 1922; Safwat, 1962;
Cronquist, 1981; Rosatti, 1989; Endress, 1994, 2001, 2004; Endress and Bruyns,
2000; Wyatt et al., 2000).
Apocynum with pollen born in tetrads and attached to simple translator are often
regarded as the first stage in this evolution mechanism (Demeter, 1922; Safwat, 1962;
Nilsson et al., 1993). Pollens in tetrads and spoon shaped translators in Periplocoideae
represent next stage in the series. Some Periplocoideae have tetrads coherent into four
pollinia, suggesting an advanced stage of pollen aggregation (Nilsson et al., 1993;
Verhoeven and Venter, 1998). Presence of four pollinia attached to a clip-like
translator (Civeyrel, 1994) and plesiomorphic characters such as four sporangia per
anther, non-linear microspore tetrads (Safwat, 1962) and absence of pollinial wall in
Secamone proposing its intermediate stage between Periplocoideae and
Asclepiadoideae. Whereas, Asclepiadoideae have anthers with two sporangia, and
presence of caudicles (two arms to which translator are attached) connected to a clip-
like corpusculum, linear microspore tetrads, and a pollinial wall (Frye, 1901; Safwat,
1962; Dan Dicko-Zafimahova, 1978; Verhoeven and Venter, 2001; Verhoeven et al.,
2003).
However, nearly two hundred year later, with the introduction of phylogenetic
reconstruction in systematics on the basis of molecular data, brought changes in
Suchmann’s (1895) classification. Now authors (Goyder, 1999, 2001; Endress and
Bruyns, 2000; Endress and Stevens, 2001; Endress, 2003) have united the two
families, as this is the simple way to achieve the monophyly of Apocynaceae. The
most recent and unified classification of Apocynaceae which is accepted today is that
of Endress et al. (2007a). The APSA clade (Livshultz et al., 2007), comprised of
subfamilies Asclepiadoideae, Secamonoideae, Periplocoideae, Apocynoideae of
Apocynaceae has been resolved as a monophyletic group in all cladistic analysis of
the family (Judd et al., 1994; Sennblad and Bremer, 1996, 2002; Civeyrel et al., 1998;
Potgieter and Albert, 2001).
Apocynaceae have been traditionally divided into two subfamilies, the Plumerioideae
(= Rauvolfioideae) and Apocynoideae (named Echitoideae by Schumann, 1895)
which are still exist in classifications (Endress and Bruyns, 2000; Endress et al.,
2007a). Additional subfamilies, such as Tabemaemontanoideae Stapf (1902),
Chapter 1
7
Apocynoideae sensu Woodson (1930), Cerberoideae Pichon (1948a), Carissoideae
Endlicher (1838), have also been described. However, these subfamilies are not
recognised today in Apocynaceae sensu lato due to the ambiguous data.
1.4 An overview of subfamilies in Apocynaceae sensu lato
1.4.1 Rauvolfioideae
The subfamily comprised of taxa having least modified flowers and ecomose seeds.
To delimit the tribes in Apocynoideae, the structure of retinacle (the region of the
stamens by which it attaches to the style-head forming gynostegium) have been used
in Pichon (1950a) and Endress and Bruyns (2000) classification, while retincale are
absent in Rauvolfioideae. However in earlier classifications, systematists had used
fruit characters to delimit tribes in Rauvolfioideae (e.g. Leeuwenberg, 1994).
Rauvolfioideae are characterised by having sinistrorse aestivation of the corolla lobes
in buds and anthers not attached to style-head (cited in Endress and Bruyns, 2000). In
the subfamily, oscillatory evolution has seemed between fleshy and dry, dehiscent and
indehiscent fruit in response to environmental factors. However Endress and Bruyns
(2000) supported the use of the fruit character in classification, but in conjugation with
other characters to reduce weight on a single character.
The most detailed and significant information of the Rauvolfioideae was produced by
Pichon (1948a, b, 1949, 1950a) over the findings presented by Schumann (1895). The
Rauvolfioid were divided into two groups mainly based on single fruit characters.
Carisseae, Ambelanieae, and Macoubeeae are possessing fleshy, indehiscent berry
fruit, while dehiscent follicle with arillate seeds, are characteristic of Chilocarpeae and
Tabernaemontaneae, they all are placed in one group. Pichon’s second group
comprised of ‘Alostonieae’ with paired dehiscent follicles and seed usually winged,
‘Rauvolfieae’ having indehiscent drupe with stony endocarp and ‘Allamandeae’
having characteristic fruit, unilocular capsule with spines. This characterization is so
authentic that the classification of Leeuwenberg (1994) is rarely differing.
Leeuwenberg (1994) classified the Rauvolfioideae and identified nine tribes within the
subfamily: Allamandeae, Alyxieae, Ambelanieae, Carisseae, Cerbereae, Chilocarpeae,
Macoubeae, Tabernaemontaneae and Plumerieae. Prior to the classification of Endress
Chapter 1
8
and Bruyns (2000), the traditional Carisseae was considered the basal most tribe by
reason of syncarpy. However in the molecular phylogenetic analysis (Civeyrel, 1996;
Endress et al., 1996; Sennblad and Bremer, 1996; Sennblad, 1997; Civeyrel et al.,
1998) the traditionally defined Carrisseae does not form natural group. Rather, it was
suggested that syncarpy is not basal condition and has evolved independently in
various groups, thus, this is not a reliable characters to define tribe (Endress et al.,
1996; Potgieter, 1999). However, in the treatment of Endress and Bruyns (2000) the
taxa of traditional Carisseae are dispersed into three new tribes. Carissa and
Acokanthera (Sennblad and Bremer, 2002) are placed into new Carisseae, based on
having hard placentas in the fruit while in other Carisseae placentas are pulpy in the
fruit. The subtribe Pleiocarpinae is also separated from Carisseae and is treated as a
separate tribe ‘Hunterieae’ as was suggested earlier (Fallen, 1986). The rest of the taxa
of Carisseae are grouped together in a new tribe ‘Willughbeeae’. Willughbeeae’s
circumscription by Endress and Bruyns (2000), get strong support in later studies
(Potgieter and Albert, 2001; Sennblad and Bremer, 2002). Floral characteristics of
Willughbeeae such as congenitally syncarpus ovary, fleshy indehiscent fruit having
numerous seeds with horny endosperm had already been defined in previous studies
(Fallen, 1986; Person et al., 1992).
In the revision of Endress and Bruyns (2000), the monotypic Chilocarpeae is
abandoned and Chilocarpus is included into Alyxieae. They also circumscribed
traditional Ambelanieae and Macoubeeae to Tabemaemontaneae by reason of
lignified guide rails of the anthers. This treatment is strongly supported by
morphological/ molecular and chemical evidences (Fallen, 1986; Zhu et al., 1990;
Endress et al., 1996; Sennblad and Bremer, 1996; Sennblad, 1997; Civeyrel et al.,
1998; Potgieter and Albert, 2001; Sennblad and Bremer, 2002). Tabemaemontaneae is
different in having Apocarpous ovary and arillate seed in contrast to syncarpous
condition in Ambelanieae with seeds embedded in pulp and Macoubeeae with arillate
seeds (Zarucchi et al., 1995).
Pichon’s Alstonieae is illustrated as Plumerieae in Leeuwenberg’s classification are
proved to be most heterogeneous tribe in the later studies (Endress et al., 1996;
Sennblad and Bremer, 1996; Sennblad, 1997). However, in the recent classification of
Endress and Bruyns (2000) the Plumerieae is divided into three different tribes. They
Chapter 1
9
combined the earlier Plumeriinae, the Cerbereae and the Allamandeae into the new
Plumerieae, as suggested in prior studies (Coppen and Cobb, 1983; Fallen, 1986;
Nilsson, 1986, 1990; Endress et al., 1996; Sennblad and Bremer, 1996; Sennblad,
1997; Civeyrel et al., 1998), that these groups have close relation. Another segregated
tribe of Leeuwenberg’s Plumerieae is Melodineae comprised of genus Melodinus and
the subtribe Craspidosperminae. Although, Craspidospermum have dry dehiscent fruit
in contrast indehiscent fruits of Melodinus (as noted by Pichon, 1948b). Despite of
these variations, the close association of these two genera get strong support in
different phylogenetic analysis (Sennblad, 1997; Sennblad and Bremer, 2002).
Finally, the ‘Catharanthinae’ of Leeuwenberg’s Plumerieae are given place in Vinceae
on the basis of seed morphology and molecular analysis (Sennblad and Bremer, 1996;
Sennblad, 1997).
The subtribes Alstoniinae and the Aspidosperminae are grouped together in new
Alstonieae: characterized by alternate whorled leaves, corolla tubes with gaps above
the level of stamen insertion. In subsequent cladistic analyses (Potgieter and Albert
2001; Sennblad and Bremer 2000; Sennblad and Bremer 2002) the reference taxa
Alstonia could not form clade with members of Aspidospermeae. Earlier, Simões et
al. (2007) recommended the recognition of Aspidospermeae as a separate tribe from
Alstonieae. The gaps in the corolla tube were first reported by Woodson (1951) to
delimit Aspidosperma having gaps from the Microplumeria, Geissospermum and
Diplorhynchus, in which gaps are absent.
Likewise, Endress and Bruyns (2000) divided Alyxieae (sensu Leeuwenberg, 1994) in
to two tribes: the Vinceae as having vertically differentiated style-head with functional
zone (Fallen, 1986), fleshy mesocarp, nonruminate endosperm, flat seeds, and
colporate pollen and the Alyxieae with secretory style-head, hard mesocarp, ruminate
endosperm, cylindrical seed, and porate pollen. In all Vinceae the fruits are
apocarpous, but variations are noted in some cases such as in Ochrosia and Rauvolfia
fruits are drupes whereas, in Catharanthus, Vinca, Tonduzia, Neiososperma having
dry fruit walls (Sennblad and Bremer, 2002). Previously, Tonduzia was considered to
be synonym of Alstonia by Pichon (1947) and same is observed in subsequent studies
(Gentry, 1983; Morales, 1995; Williams, 1996; Sidiyasa, 1998). Therefore Endress
and Bruyns (2000) placed this genus in Alstonieae with Alstonia. Later, Tonduzia in
Chapter 1
10
addition Laxoplumeria, are included in Vinceae in phylogenetic analyses of Potgieter
and Albert (2001) and Simões et al. (2007).
However in phylogenetic studies the inter-generic relationship is not clear in Vinceae.
The position of Kopsia in Vinceae is suspected in molecular based phylogenetic
studies (Sennblad and Bremer, 2002; Simões et al., 2007). Whereas, morphological
(Middleton, 2004a, b) and former chemotaxanomic (Kisakürek et al., 1983;
Homberger and Hesse, 1984) studies strongly supporting the placement of genus in
Vinceae. In the cladistic studies (Potgieter and Albert, 2001; Sennblad and Bremer,
2002), Vinceae showed close affinities toward Tabernaemontaneae, whereas Alyxieae
come closer to the Plumerieae and Carisseae. In the classification of Apocynaceae
defined by Endress and Bruyns (2000), nine tribes are recognised in Rauvolfioideae;
Alstonieae, Alyxieae, Carisseae, Hunterieae, Melodineae, Plumerieae,
Tabernaemontaneae, Willughbeieae and Vinceae, based on floral, fruit and seed, and
pollen characters also supplemented by available molecular data. Their
circumscription of tribes was notably different from that of Leeuwenberg (1994).
Since Endress and Bruyns (2000), molecular based phylogenetic studies (Potgieter
and Albert, 2001; Sennblad and Bremer, 2002; Nazar et al., in press) have reported
non-monophyletic groups in Rauvolfioideae. To achieve monophyly in
Rauvolfioideae, recently a comprehensive study was conducted by Simões et al.
(2007) and observed six monophyletic tribes (Alyxieae, Carisseae, Hunterieae,
Plumerieae, Tabernaemontaneae and Willughbeieae) in the subfamily and also
reported the extreme polyphyly of Melodineae. Prior this study, Melodineae has
always been remained poorly understood tribe in Rauvolfioideae even in the ‘series
revisions of Apocynaceae’ by Leeuwenberg (2003).
1.4.2 Apocynoideae
Apocynoideae, are characterised (Endress and Bruyns, 2000) by having the dextrosely
contorted corolla lobes in bud, lignified anthers are attached to the style-head forming
a gynostegium (Bentham, 1876), dry follicle fruit and comose seeds. Tribes in the
subfamily are circumscribed by Pichon (1950b), Leeuwenberg (1994) and Endress
and Bruyns (2000) and they all are very different in their description. Pichon (1950b)
classified the subfamily into four tribes — Parsonsieae, Nerieae, Ecdysanthereae, and
Ichnocarpeae, on the basis of single and very difficult to observe character, termed
Chapter 1
11
retinacle. On the other hand, in the classification of Leeuwenberg (1994) —
Apocyneae, Echiteae and Wrightieae are defined. Echiteae and Wrightieae of
Leeuwenberg's correspond to Pichon's Parsonsieae and Nerieae respectively. While
Apocyneae comprised of genera from Pichon’s Ecdysanthereae and Ichnocarpeae.
The tribe Wrightieae was initially described by Don (1838) due to the presence of
chalazal hairs on the surface of seed and comprised of only two genera Kibatalia and
Wrightia. However, this taxanomic treatment was also observed in successive studies
(Endlicher, 1841; de Candonelle, 1844; Ly, 1986). Pichon (1950b) misinterpreted that
the flowers of Carruthersia, Hollarrhena and Spirolobium lacked a gynostegium and
placed them mistakenly in Plumerioideae as subtribe Holarrheninae. This was later
proved as an unnatural group on the basis of pollen morphology and chemical
evidences (Endress et al., 1990; Leeuwenberg, 1994; Endress and Bruyns, 2000) and
these genera are transferred in the tribe Wrighteae. The phylogenetic analysis of
Sennblad et al. (1998) based on rbcL data and retinacle characters demonstrated that
all tribes recognised by Pichon (1950a) and Leeuwenberg (1994) were non-
monophyletic and suggested the revisions of tribes in the subfamily.
In the reclassification of the subfamily by Endress and Bruyns (2000) five tribes were
recognised; Apocyneae, Echiteae, Malouetieae, Mesechiteae and Wrightieae. This
classification was mainly based on retinacle (Sennblad et al., 1998) that also proved to
be useful characters in Pichon’s classification, along with other morphological
characters such as structure of style-head and theca (Endress and Bruyns, 2000).
However, the composition of tribes here is notably differing from those of Pichon and
Leeuwenberg. They restored Mesechiteae that constitute of only nine genera;
Allomarkgrafia, Galactophora, Macrosiphonia, Mandevilla, Mesechites, Quiotania,
Secondatia, Telosiphonia, and Tintinnabularia, rather than 13 as in classification of
Pichon. They also introduced fifth tribe Malouetieae by segregating genera from
Wrightieae and Echiteae of earlier classifications. However, some of the modifications
have been done by Endress and Bruyns (2000), which are briefly described here.
Leeuwenberg dispersed genera such as Galactophora, Neobracea, and Pachypodium
in Echiteae (Pichon’s Parsonsieae) and Funtumia, Kibatalia, Malouetia and
Mascarhensia in Wrighteae (Pichon’s Nerieae). Sennblad et al. (1998) identified the
presence of calcium oxalate packets in the anther stomium and synapomorphy ‘the
Chapter 1
12
absence of vertical ridges on the style-head’ in the Funtumia, Holarrhena,
Mascarenhasia and Pachypodium. They suggested the grouping of these taxa into a
separate tribe Malouetieae, which is later presented as tribe in the classification of
Endress and Bruyns (2000). Following Pichon’s and Leeuwenberg’s classification the
position of Neobraceae is in Echiteae, however in the recent phylogenetic analysis
(Livshultz et al., 2007) this genus appeared in Malouetia clade near to Pachypodium.
Sennblad and Bremer (2002) proposed a new approach in the classification system
based on Linnaean and phylogenetic nomenclature to get rid of all uncertainties
observed in the classification of Endress and Bruyns (2000). Although Endress and
Bruyns (2000) already suggested that their classification is considered to be
preliminary. However, in combined analysis of ndhF and rbcL by Sennblad and
Bremer (2002) six tribes are ascertained in the subfamily with the introduction of
Nerieae, is strongly supported here. All taxa of Nerieae were previously included in
tribe Wrighteae except Isonema, which Leeuwenberg (1994) described in Echiteae,
while Alafia and Farquharia are given place in Malouetieae by Endress and Bruyns
(2000). However, in the recent phylogenetic analysis by Livshultz et al. (2007)
monophyly of Nerium clade is again equivocal and need to be re-circumscribed.
Moreover, Simões et al. (2004) circumscribed tribe Mesechiteae using morphological
and molecular characters. They broadly defined eight genera in Mesechiteae;
Allomarkgrafia, Forsteronia, Macrosiphonia, Mandevilla, Mesechites, Quiotania,
Telosiphonia, and Tintinnabularia. Simões et al. (2004) excluded Galactophora and
Secondatia from Mesechiteae sensu Endress and Bruyns and transferred Forsteronia
into the tribe from Apocyneae. The significant character in Apocynoideae ‘structure of
retinacle’ is not found to be constant in species of the genus. Other two key characters
such as leaf blades with colleters at the base adaxially and anthers with blunt-cordate
to truncate basal appendages, are shared by Forsteronia to other Mesechiteae. The
longitudinal ribs in some species are very well-developed as characteristic of
Mesechiteae with star-like shape in cross-section. However, F. acouci the ribs are not
conspicuous and style-head have somewhat pentagonal shape as in the taxa of
Apocyneae (Simões et al., 2004). So this genus shared morphological characters with
both the tribes. In the earlier study, only Pichon (1950b) believed that Tintinnabularia
are closely related to Forsteronia and both genera are placed in a separate subtribe
Chapter 1
13
Forsteroniinae of tribe Ichnocarpeae. In later classifications, Forsteronia is included in
Apocyneae and Tintinnabularia in tribe Wrightieae.
Likewise, generic composition of New World Echiteae and Mesechiteae was
improved by Endress et al. (2007a) with the introduction of new tribe Odontadenieae.
The monophyly of New World tribes Odontadenieae and Echiteae was not supported
in the analysis of Livshultz et al. (2007). Only Mesechiteae circumscribed by Simões
et al. (2004) were strongly supported (Livshultz et al., 2007).
Macfarlane (1933) suggested that traditional Asclepiadaceae was polyphyletic, as it
has close relationship with some members (Alafia, Baissea and Oncinotis) of
Apocynoideae. In several analyses, Baissea, Motandra and Oncinotis appeared close
to the Asclepiadoideae-Secamonoideae clade (Sennblad, 1997; Sennblad and Bremer,
2000, 2002; Potgieter and Albert, 2001). The grouping of these three genera (Endress
et al., 2007a, Livshultz, 2010) was recognised and given status of a tribe, Baisseeae.
Since publication of the Endress and Bruyns (2000) classification, three more tribes,
the Nerieae (Sennblad and Bremer, 2002), Odontadenieae (Endress et al., 2007a) and
Baisseeae (Livshultz, 2010), have been recognised in Apocynoideae. Furthermore,
recent phylogenetic analyses (Livshultz et al., 2007; Livshultz, 2010) have suggested
that Echiteae and Mesechiteae sensu Endress and Bruyns (2000) are not
monophyletic.
1.4.3 Periplocoideae
In the preliminary classifications (Brown, 1810, 1811; Bentham, 1876; Schumann,
1895) Periplocoideae was placed with Asclepiadoideae. Later, Schlechter (1914,
1924) was the first who segregated the Periplocoideae, having the pollens in tetrads
and loosely deposit on spoon like translator, from the Asclepiadoideae with the status
of a family. This familial status of the Periplocoideae had also been reported by some
botanists until the last decade of 20th century (Kunze 1990, 1993; Venter et al. 1990;
Dave and Kuriachen 1991; Liede and Kunze 1993; Nilsson et al. 1993;
Swarupanandan et al., 1996). But simultaneously, some authors proposed that
Periplocoideae and Asclepiadoideae are not monophyletic, rather they also stated that
Periplocoideae has close relation with Apocynaceae sensu stricto (Kunze, 1996; Judd
Chapter 1
14
et al., 1994; Struwe et al., 1994; Sennblad and Bremer, 1996; Endress, 1997;
Sennblad, 1997).
However, with the generation of new data on floral characters, fact has came out that
many of the genera have pollinia instead of pollen in tetrads (Verhoeven and Venter,
1998). Pollinia have also been observed in Decalepis, Gymnanthera, and Hemidesmus
by Endress and Bruyns (2000). Venter and Verhoeven (1997) were the first who
divided the Periplocoideae into three tribes: Periploceae, Gymnanthere,
Cryptolepidea. Thus, it is injustice to separate the Periplocoideae as a separate family
from the rest of Asclepiadaceae due to the presence/ absence of pollinia, rather this
segregation should based on the presence of viscidium in Periplocoideae versus harder
corpuscle in Asclepiadaceae.
In addition, Kunz’s (1990, 1996) findings mainly based on the differences in the basal
regions of the stamens between Periplocoideae and Asclepiadoideae that supported the
separate familial status of Periplocoideae. In Periplocoideae, stamina basal tube
(swollen region below the filaments) and interpreted as receptacular is present, while,
in Asclepiadoideae such receptacular base of the staminal column was not observed
(Kunz, 1990). Another striking character identified by Kunz (1996) was that filament
tube in Asclepiadoideae is not of receptacular origin, rather evolved from the inwardly
protruding base of the filaments (1996). Consequently, it was stated that ‘basal tube’
in Periplocoideae has differed in origin to the filament tube in Asclepiadoideae,
providing another suitable reason for separation of Periplocoideae.
Endress and Bruyns (2000) also described the structure of stamens in Periplocoideae.
They elaborated that thickened ridge is present at the base of filament, which they
termed as ‘stamina foot’ and made following statements based on the insertion of
stamina foot on the corolla tube and length of the corolla tube.
Firstly, if the corolla tube is relatively long, then satminal foot runs down the tube and
disappear before the base as observed in Gymnanthera, Raphionacme monteiroae, R.
namibiana. This situation is somewhat similar to Rauvolfioideae and Apocynoideae.
Secondly, corolla tube is much shorter then bases of the staminal feet become swollen
around the neck of style (Cryptolepis grayi, Raphionacme procumbens,
Stomatostemma monteiroae) and if the style is shorter, then the base of feet forms
Chapter 1
15
undulating ring around the top of ovary (Cryptolepis oblongifolia, Ectadium). Their
third observation was that if limb of the foot disappear, then adjacent feet fuse
together and form a ‘staminal tube’ around the style (Hemidesmus indicus). The next
to this stage is the complete fusion of filament and form filament tube or completely
lost of filament as observed in Secamonoideae/ Asclepiadoideae.
Beside this, Kunz (1990) proposed that there are also variations in corona of
Periplocoideae and Asclepiadoideae and also noticed that nectaries in the
Periplocoideae are situated at the side of stamina foot, whereas in the Asclepiadoideae
these are located above the filaments. However, overview of the classification of
Apocynaceae by Endress and Bruyns (2000) is suggested that morphological data
proposed by Kunz is insufficient to delimit the Periplocoideae from the rest of
asclepiads up to the level of family. They were also uncertain about the tribal division
of Periplocoideae (Venter and Verhoeven, 1997) due to two reasons: misinterpretation
of genera in different tribes, although they have quite more similarities in floral
structure (e.g. Ischnolepis tuberose and Petopentia natalensis have almost no
differences in flowers, but they were placed in different tribes), another reason is that
this division does not correspond with the molecular analyses (Civeyral, 1996;
Potgieter and Albert, 2001).
From the above discussion, this fact emerge that Periplocoideae is unique among the
five subfamilies of Apocynaceae, as including taxa with and without Pollinia. In
addition, pollinia structure are different in Asian and African Periplocoideae (Venter
and Verhoeven, 2001) suggesting the independent origin of pollinia at different
occasions in the subfamily (Fishbein, 2001). Phylogenetic relationships based on
nuclear ribosomal DNA and plastids region (Ionta and Judd, 2007), also proposed
either three or four independent origins of pollinia within the subfamily.
Thus, Periplocoideae has commonly regarded as a transitional taxon between
Apocynoideae and milkweeds, but the systematic position of the subfamily in the
APSA (Asclepiadoideae, Periplocoideae, Secamonoideae and Apocynoideae) is still
unclear even in recent phylogenetic analyses (Livshultz et al., 2007; Livshultz, 2010).
1.4.4 Secamonoideae
Chapter 1
16
An unnamed group of Brown comprised of only Secamone, having four pollinia in
each anther, is known today as Secamonoideae (Endress, 2004). Based on
morphological characters, Secamonoideae are given place somewhere between
Asclepiadoideae and Periplocoideae (Endress and Bruyns, 2000). Nine genera are
accepted by Endress and Bruyns (2000); Calyptranthera, Genianthus, Goniostemma,
Pervillaea, Rhynchostigma, Secamone, Secamonopsis, Toxocarpus and Trichosandra.
However Klackenberg (2001), put the monotypic African genus Rhynchostigma, as
synonym under Secamone.
In the phylogenetic analysis of Apocynaceae, subfamily Secamonoideae emerged as
sister group of Asclepiadoideae (Sennblad and Bremer, 1996, 2000, 2002; Civeyrel et
al., 1998; Civeyrel and Rowe, 2001; Fishbein, 2001; Potgieter and Albert, 2001;
Lahaye et al., 2005). Based on the closer relationship of these subfamilies, in the
classification of Swarupanandan et al. (1996), Secamonoideae was reduced as tribe of
Asclepiadoideae.
In Secamonoideae, the pollinarium is constituted of pollinia and corpuscle, as in the
Asclepiadoideae. Previously, it was described that pollinia in Secamonoideae are
directly attached to the corpuscle, but in subsequent studies of Civeyrel (1995, 1996)
on genus Secamone reported the presence of short caudicle in several cases between
the pollinia and the corpuscle. It was already mentioned that in Secamonoideae each
anther has four pollinia (as in the Periplocoideae) in contrast to two pollinia in
Asclepiadoideae. In two consecutive studies of Civeyrel (1995, 1996) two interesting
observations in Secamonoideae are being marked: pollinia are produced by one part
of anther are closely adpressed to one another (as in Periplocoideae) and giving
impression that each anther produce one pollinium on either side and thus each
corpuscle has two pollinia attached to it, on other hand, as observed in Secamone,
Secamonopsis and Trichosandra one of the pollinia in each locule is functional while
the other one is smaller and loosely attached to the corpuscle. In these observations,
each pollinarium has two functionally efficient pollinia, which is distinguishing
feature of Asclepiadoideae.
In more detailed pollinial examination it was observed that in Secamonoideae pollinia
are tetrad and held together by cross wall fusion, as this characters is absent in
Asclepiadoideae. In addition, outer wall enclosing the pollinium is absent and this
Chapter 1
17
character is more similar to those genera of Periplocoideae having pollinia (Civeyrel,
1996; Verhoeven and Venter, 1998). Another significant difference between
Asclepiadoideae and Secamonoideae is that all members of former except Fockea
have pollinium covered by a thick wall (Schill and Jӓckel, 1978; Dannenbaum and
Schill, 1991). While a thin outer wall enclosing the pollinium in Secamone
ligustrifolia has been reported in the study of Schill and Jӓckel (1978). So,
Secamonoideae have characters of both the subfamilies Periplocoideae and
Asclepiadoideae (Klackenberg, 1992a, b; Venter and Verhoeven, 2001; Ionta and
Judd, 2007; Lahaye et al., 2007).
Moreover, Lahaye et al. (2005, 2007) studied the inter-generic relationship of
Secamonoideae using molecular and morphological characters, these studies revealed
that Pervillaea and Secamonopsis are monophyletic groups of Secamonoideae while
the largest genus Secamone is not resolved as monophyletic group.
1.4.5 Asclepiadoideae
Unlike the Secamonoideae, the subfamily Asclepiadoideae has two locules in each
anther and consequently produced two pollinia, and each pollinium is covered with a
thick wall (Schill and Jӓckel, 1978; Dannenbaum and Schill, 1991). In preliminary
studies four tribes were recognised and characterised in the subfamily: Asclepiadeae,
Gonolobeae, Marsdenieae, Stapelieae (Ceropegieae) (Woodson, 1941; Kunz, 1995;
Liede, 1997; Omlor, 1998). Presently, Stapelieae are known as Ceropegieae (Endress
and Bruyns, 2000; Meve and Liede, 2004), and Gonolobeae have been reduced to a
subtribe of Asclepiadeae (Swarupanandan et al., 1996). Initially, Stapelieae and
Ceropegieae were described as two separate tribes (Bentham, 1876) due to the
presence of succulent stems in the former. However, except succulent stem character,
other characters of pollinia and anther are extremely alike, thus in later studies
researchers (Bruyns and Forster, 1991; Liede and Albert, 1994) are agreed to placed
them into the same tribe ‘Stapelieae’. The monophyly of succulent and nonsucculent
group is later confirmed in the molecular analysis of Meve and Liede (2004).
A new tribe, the Fockeeae, is described by Kunz et al. (1994) from the Marsdenieae
due to the absence of caudicles and floor in the lower third of corpuscle. Lack of
caudicles is not striking character to delimit tribe, though this character is also
Chapter 1
18
reported in Genianthus and Secamone (Civeyrel, 1994; Klackenberg, 1995b).
Meanwhile, Kunz et al. (1994) suggested another character, ‘stamens with large apical
appendages,’ that is present in Fockea but not found in Cibirhiza, another genera of
Fockeeae, so again it is definitely not significant character for the delimitation of tribe.
Kunz (1990, 1996) also mentioned intermediate position of Fockea between
Secamone and advanced Asclepiadoideae. It has pollinia without outer covering
resembling taxa of Secamonoideae and Periplocoideae with pollinia, instead of having
thick outer covering as in the rest of Asclepiadoideae (Verhoeven and Venter, 2001).
In the study of Endress and Bruyns (2000), Fockea also separately emerged out at the
basal position in the Asclepiadoideae and this could be enough for the support of tribe
Fockeeae. But they also suggested that inadequate taxon sampling of Marsdenieae
could be one reason of Fockeeae’s isolated position, though the tribe Marsdenieae is
so diverse and have more than 570 species. They supported the placement of Fockea
and Cibirhiza again in the tribe Marsdenieae. Nevertheless, recognition of Fockeeae is
consistent with the results of later analyses, such as Meve and Liede (2004), and they
were recognised as such in the revised classifications proposed by Endress and
Stevens (2001) and Endress et al. (2007a).
Marsdenieae are essentially isolated from the Ceropegieae due to lack of hyaline
insertion crest on outer surface of pollinium and absence of an outer corona (Bruyns
and Forster, 1991; Omlor, 1998). The sister relationship of Eustegia and Marsdenieae-
Ceropegieae group (Rapini et al., 2003) is illustrating the paraphyly of Asclepiadeae.
Odd position of monotypic genus Eustegia with pendent pollinia between Ceropegieae
and Fockeeae may also refers the sharing of some morphological characters, which
are widely elaborated in the study of Bruyns (1999). Eustegia and Fockea had also
been placed in the same subtribe by Decaisne (1844). Since the Endress and Bruyns
(2000) publication, only a few have focused on Ceropegieae (Meve and Liede, 2002),
but recent studies (Meve and Liede, 2004; Meve and Liede-Schumann, 2007;
Surveswaran et al., 2009) on the largest genus, Ceropegia, have indicated paraphyly
of the genus, with both Brachystelma and stapeliad genera nested within it.
Both Marsdenieae and Ceropegieae are basically separated from the tribe
Asclepiadeae due to the difference in the orientation of the pollinia in anther.
Marsdenieae and Ceropegieae have upright directed pollinia above the corpuscle and
Chapter 1
19
this condition is primitive (Kunze, 1993) whereas, Asclepiadeae have pendulous
pollinia below the corpuscle. However, Endress and Bruyns (2000) also focused on
floral character such attachment of the pollinia to the caudicle’ to delimit tribes in
Asclepiadoideae. In Endress and Bruyns (2000) classification system, three tribes
were identified in Asclepiadoideae; Ceropegieae, Marsdenieae and Asclepiadeae, and
abandoned Fockeeae.
Asclepiadeae is the largest tribe of Asclepiadoideae and species mainly localized in
Africa and the New World. It consist a group of taxa having large and conspicuously
flattened and pendulous pollinia. So, in Asclepiadeae there is wide variation between
larger pollinia of Asclepias and the Tylophora, where the pollinia are small and
difficult to distinguish whether they are erect or pendulous. Schumann (1895) defined
five tribes in the Asclepiadeae however his system of classification was based only on
corona characters and has not been generally accepted. Liede (1997) identified six
subtribes in Asclepiadeae: Asclepiadinae, Astephaninae Glossonematinae,
Gonolobinae, Metastelmatinae and Oxypetalinae. Later, Liede (2001) introduced a
new subtribe, Tylophorinae, based on the findings of Omlor (1998). Tylophora was
previously included in Astephaninae (Liede, 1994, 1997), which are sister of rest of
Asclepiadeae (Liede, 2001; Rapini et al., 2003) and comprise only three genera
(Goyder, 2006). In addition, Liede-Schumann et al. (2005) relegated the neglected
tribe, Orthosieae (Malme, 1927), as subtribe Orthosiinae.
Nearly 40 % of the species of Asclepiadoideae are from the New World in origin
(Meve, 2002). In most of the phylogenetic studies, Old World Asclepiadoideae have
mainly been focused (Sennblad and Bremer, 1996; Civeyrel et al., 1998; Potgieter and
Albert, 2001; Liede, 2001; Rapini et al., 2003). While the relationships within genera
of New World Asclepiadoideae, have not previously been evaluated on the basis
phylogenetic analyses. For example, Potgieter and Albert’s (2001) survey had
included just seven New World’s genera. Rapini (2002) attempted to estimate
relationships among genera of New World Asclepiadoideae using corona characters,
and later Rapini et al. (2003) produced a broad overview of New World
Asclepiadoideae using molecular data. Four lineages of New World Asclepiadoideae
have emerged. The most diverse MOG clade, and the representative of two groups
Cynanchum L. Subgenus. Mellichampia (A. Gray) of Cynanchinae and Asclepias L.
Chapter 1
20
of Asclepiadinae are nested among the taxa of Old World ACT clade. The fourth
lineage of New World genera is the New World Marsdenia of Marsdenieae, only this
group posses erect pollinia, while other three lineages are from Asclepiadeae and
bearing pendent pollinia (also reviewed in Rapini et al., 2007). In an earlier study by
Liede and Taüber (2002) on the relationships of genera in MOG clade, proposed that
Metastelminae is not monophyletic without Gonolobinae and Oxypetalinae.
A recent study using morphological, molecular, geographical and environmental
characteristics transferred a group of temperate South American Cynanchum species
to Diplolepis (sister genus of the rest of MOG; Hechem et al., 2011). Intra-generic
relationships of New World Asclepiadeae have been assessed by using plastid (Liede-
Schumann et al., 2005) and ITS markers (Rapini et al., 2006), and most of the genera
were found to be non-monophyletic, prompting a great amount of generic realignment
(e.g. Goyder, 2004; Rapini et al., 2011) in Oxypetalinae. Rapini (2012) presented a
narrative of recent developments in the classification of Apocynaceae, with particular
emphasis on Brazilian Asclepiadoideae. Glossonematinae and Cynanchineae (Liede et
al., 2002; Liede and Taüber, 2002; Rapini et al., 2003) were found not to be
monophyletic. A few genera placed in these two tribes (Glossonematinae and
Cynanchineae) are closely allied: these include such as Glossonema and Odontanthera
that form a clade with Pentarrhinum, an African genus of five species belonging to
the Cynanchinae (Liede et al., 2002).
Cynanchinae are split along geographical lines, and Old World succulent Malagasy
Cynanchum species are monophyletic whereas New World sections of the subtribe are
polyphyletic (Liede and Taüber, 2002; Rapini et al., 2006). Evolutionary relationships
have been estimated for the genera of Asclepiadinae (Goyder et al., 2007, Fishbein et
al., 2011). Fishbein et al. (2011) found moderate support for monophyly of Asclepias
sensu stricto covering the New World species of the genus and a clade including all
but one species of the generic complex around Asclepias in Africa. However,
resolution within this complex was low, and the weakly supported clades identified
cut across genera as currently recognised. These studies concluded that
Asclepiadoideae still needs further investigation to detect monophyletic groups and to
find morphological characters by which to recognise them.
1.5 The use of molecular data in cladistic analysis
Chapter 1
21
DNA sequences are generally viewed as providing less biased characters in cladistic
analyses than morphological data because there is no character selection and all data
are normally used. Also, sequences provide themselves better to phylogenetic analyses
because they are composed of naturally discrete rather than continuous characters.
Since 1981, there has been exponential increase in the number of publications
utilizing molecular phylogenetic techniques (Pagel, 1999).
The principles of the modern subject of cladistics were prepared by Hennig (1950,
1966). The most important cladistic concept from a systematics perspective, is the
development of the concept of monophyly. The taxa of a monophyletic group evolved
from a common ancestor and so share certain derived features. Testing monophyly has
become the basis for all modern natural classifications. Flowering plants were the first
major branch of the tree of life to be classified on the basis of cladistic analyses of
DNA sequences (APG I, 1998; APG II, 2003)
There are an ever-increasing number of tree building methods available within
programs such as PAUP (Swofford, 2001). Distance methods convert aligned
sequences into a pairwise distance matrix and then use these data to build trees,
whereas discrete methods consider each nucleotide site individually. Distance
methods include: neighbour joining (NJ) and unweighted pair group method with
arithmetic means (UPGMA). Discrete methods include: maximum parsimony (MP),
maximum likelihood (ML) and Bayesian. Studies have shown that in datasets with
clear signal and low noise most methods yield remarkably similar results (e.g.
Muellner et al., 2003).
A more recent development in the field of phylogenetics is the use of Bayesian
methods of analysis. Like ML, Bayesian estimation of phylogeny is based on the
likelihood function. Tree building is much more mathematically difficult to visualise
than in MP and utilizes a method from probability theory known as the Monte Carlo
Markov chain (MCMC) for estimating posterior probabilities. The MCMC method
considers many possible histories of substitution, weighted by their probability of
occurring in a specific model of evolution (Huelsenbeck et al., 2001).
1.6 Utility of plastid and nuclear regions for phylogenetic reconstruction in
plants
Chapter 1
22
Nuclear genomes are potentially a rich and diverse source of variable molecular
characters for evolutionary studies (Sang, 2002; Small et al., 2004). In comparison of
chloroplast genes, some nuclear genes evolve more rapidly (Wolfe et al., 1987; Gaut,
1998), suggesting that they are more reliable for evaluating the relationship even
among the more closely related species. Though, the fruitful utility of the ITS (internal
transcribed spacer) regions are not refuted in various phylogenetic studies. But their
use has been critical in some cases because of several reasons including; concerted
evolution, a high degree of intra-specific heterogeneity and often produce
unsatisfactory results even among the species (Alvarez and Wendel, 2003).
Furthermore, low-copy number genes have great potential for the improvement of
phylogenetic relationships, particularly where makers based on plastid and nuclear
ribosomal DNA cannot generate strong phylogenetic hypothesis (Small et al., 1998;
Sang and Zhang, 1999; Doyle, et al., 2000). The utility of low-copy nuclear genes has
been tasted at various levels, e.g., inter-familial relationships (Kolukisaoglu, et al.,
1995; Mathews and Donoghue, 1999), relation at inter-generic level (Mathews and
Sharrock, 1996; Galloway et al., 1998; Mathews et al., 2000), and close relationship
at inter-specific level (Sang et al., 1997a, 1997b; Small et al., 1998; Small and
Wendel, 2000). It is concluded that nuclear gene with low-copy number are
remarkable source for the resolution of relationships among groups with strong
support.
1.7 Nuclear gene (Phytochrome A)
It has already been suggested in various studies (Mathews et al., 2000; Simmons et
al., 2001; Samuel et al., 2005; Bennett and Mathews, 2006) that phytochrome genes
(PHYA, PHYB and PHYC) are useful markers for resolving relationships at the sub-
familial level. It was estimated that phytochrome genes have relatively faster rate of
nucleotide substitution than the plastid sequences particularly those which are used in
various phylogenetic studies of Poaceae (Mathews et al., 1995; Olmstead and Reeves,
1995). In the present study first exon of phytochrome A (PHYA) gene has been used to
construct phylogeny of Apocynaceae.
Up to date all molecular phylogenetic studies of family Apocynaceae, are based on
sequences from plastid genome, either singly, or in combination with morphological
Chapter 1
23
dataset. A summary tree is presented here (Figure 1.1) comprised of five sub-families
and twenty two tribes of the family representing present situation in Apocynaceae. To
acquire the monophyly of groups in the family there is an essential need to sequence
regions from nuclear genome and combined them with data of plastid genome. There
are still several areas in Apocynaceae, where natural relationships among the genera
are uncertain. Hence, satisfactory classification of Apocynaceae is still beyond reach.
Livshultz (2010) presented the first study of a low-copy nuclear gene, PHYA, in
derived members of Apocynaceae. Although this approach proved useful in describing
the status of various groups in Apocynaceae, e.g. tribe Baisseeae as a sister group of
milkweeds (i.e. Asclepiadoideae and Secamonoideae) rather Periplocoideae, there are
still areas where resolution is low. In order to resolve these problems in Apocynaceae,
in the present comprehensive study, phylogenetic trees have been constructed on
chloroplast and nuclear datasets using broadly sampled taxa of Apocynaceae. Our
main goals are 1) to improve infra-familial relationships within Apocynaceae; 2)
improve resolution at the tribal level within all subfamilies; 2) to identify the position
of Periplocoideae in Apocynaceae and 3) to improve resolution within the subfamily
Rauvolfioideae.
Chapter 1
24
Figure 1.1 A summary of the relationships among five subfamilies and twenty two
tribes of Apocynaceae. All clades shown are present in the strict consensus trees of
previous phylogenetic studies (Rapini et al., 2007; Simões et al., 2007; Livshultz et
al., 2007; Livshultz, 2010). Outgroups include the other four families in the
Gentianales order (Gelsemiaceae, Gentianaceae, Loganiaceae, and Rubiaceae)
according to APG III (2009).
Chapter 2
25
Materials and Methods
2.1 Taxon sampling
In the present study, an attempt has made to include taxa of Apocynaceae from all
over the world. Species of different genera belonging to subfamilies of Apocynaceae
for the study were collected from tropical and subtropical regions of Pakistan. Species
name, voucher details and locations of the samples are given in table 2.1 and Figure
2.1. For DNA extraction a small piece of each sample was stored in silica gel (Chase
and Hillis, 1991). The voucher specimens were stored in Plant Biochemistry and
Molecular Biology Laboratory, Department of Plant Sciences, Quaid-i-Azam
University Islamabad, Pakistan. Other taxa of Apocynaceae (from Africa, America,
Asia, Australia, and Europe; Figure 2.2) were provided by the Royal Botanical
Garden, Kew, London. The samples were obtained from different sources such as
DNA bank, herbarium and from living collection of Kew Garden (Table 2.1).
2.2 DNA extraction
The species of Apocynaceae are latex containing and it is difficult to obtain good
quality DNA from these samples. In the present study different protocols were
applied.
1. For the extraction of total genomic DNA from the fresh specimens, CTAB
(cetyl trimethyl ammonium bromide) method by Richard (1997) was used with
few modifications, also described by Nazar and Mahmood (2010). According
to this procedure, fresh specimen (0.3-0.5 g) was ground in 1ml of 2× CTAB
preheated (65 °C) buffer by using sterilized pestle and mortar. The completely
homogenized tissues were then transferred in eppendorf tubes and then
incubate them at 65 °C for 30 minutes. After incubation, an equal volume of
chloroform isoamylalcohol (24:1) was added and then followed by
centrifugation at 13,000 rpm for 10 minutes. The transparent supernatant was
then transferred to a new tube, and DNA was precipitated by adding an equal
volume of chilled isopropanol and centrifuged. After washing in 70 % ethanol,
the pellets were dried and DNA was resuspended in 0.1× TE (Tris ethylene
diamine tetra acetic acid) buffer.
Chapter 2
26
Table 2.1 A list of the samples from Pakistan and The Royal Botanic Gardens Kew, London with vouchers information and place of collection.
Taxa Voucher detail Country Regions sequenced
Asclepiadoideae – Asclepiadeae: Metastelmatinae
Blepharodon lineare (Decne.) Decne. Forzza et al. 2027 Argentina trnL-F and PHYA
Asclepiadoideae – Asclepiadeae: Oxypetalinae
Araujia sericifera Brot. Forster 7656 Australia PHYA
Funastrum clausum (Jacq.) Schltr. Mello- Silva et al. 1919 Argentina PHYA
Oxypetalum capitatum Mart. Mello- Silva et al. 1924 Argentina PHYA
Philibertia discolor (Schltr.) Goyder Mello- Silva et al. 1887 Argentina PHYA
Philibertia lysimachioides (Wedd.) T. Mey. Mello- Silva et al. 1886 Argentina PHYA
Asclepiadoideae – Asclepiadeae: Gonolobinae
Matelea pseudobarbata (Pitter) Woodson M. Endress 97-08 Costa Rica PHYA
Schubertia grandiflora Mart. M. Chase South Africa PHYA
Asclepiadoideae – Asclepiadeae: Asclepiadinae
Calotropis procera (Aiton) W. T. Aiton Naz001* Pakistan trnL-F and PHYA
Kanahia laniflora (Forssk.) R. Br. Goyder et al. 3931 Tanzania PHYA
Margaretta rosea Oliv. Goyder et al. 3791 Tanzania PHYA
Pergularia daemia (Forssk.) Chiov. Naz024* Pakistan PHYA
Pergularia tomentosa L. Naz012* Pakistan trnL-F and PHYA
Stenostelma corniculatum (E. Mey.) Bullock Balkwill 10908 South Africa PHYA
Chapter 2
27
Xysmalobium parviflorum Harv. ex Scott-Elliot Killick & Vahrmeijer 3658 South Africa PHYA
Asclepiadoideae – Asclepiadeae: Cynanchinae
Cynanchum viminale (L.) Bassi Chase 731 ** PHYA
Cynanchum jacquemontianum Decne. Naz010* Pakistan trnL-F and PHYA
Cynanchum obtusifolium L.f. P. Bruyns Vch? South Africa PHYA
Asclepiadoideae – Asclepiadeae: Tylophorinae
Tylophora hirsuta (Wall.) Wight Naz014* Pakistan trnL-F, PHYA and atpB
Unplaced genus
Oxystelma esculentum (L. f.) Sm. Naz020* Pakistan TrnL-F and PHYA
Asclepiadoideae – Asclepiadeae: Astephaninae
Eustegia minuta (L. F.) N. E. Br. P. Bruyns 4357 South Africa PHYA
Oncinema lineare (L. F.) Bullock P. Bruyns Vch? South Africa PHYA
Microloma tenuifolium K.Schum. Irwin et al. 31285 Brazil PHYA
Asclepiadoideae – Marsdenieae
Dischidia lanceolata Decne. Chase 734 Indonesia PHYA
Dregea abyssinica K.Schum. Goyder et al. 3918 Tanzania PHYA
Gymnema sylvestre (Retz.) Schultz. Chase 3902 India trnL-F and PHYA
Hoya finalasonii Wight Chase 17138 India PHYA
Hoya manipurensis Deb. Chase 733 Thailand PHYA
Marsdenia carvalhoi Morillo & Carnevali Chase 3904 Brazil trnL-F and PHYA
Rhyssolobium dumosum E. Mey. P. V. Bruyns 3948 South Africa PHYA
Chapter 2
28
Stephanotis floribunda Brongn. Chase 732 Senegal trnL-F and PHYA
Wattakaka volubilis (Linn.f.) Stapf. Naz006* Pakistan trnL-F and PHYA
Asclepiadoideae – Ceropegieae
Boucerosia frerei Dalzell Chase 2861 India PHYA
Caralluma edulis (Edgew.) Hook. F. Naz016* Pakistan trnL-F
Caralluma tuberculata N.E. Br. Naz019* Pakistan trnL-F and PHYA
Ceropegia sandersonii Decne.ex Hook. Chase 17507 ** PHYA
Duvalia polita N. E. Br. Kew ** PHYA
Leptadenia pyrotechnica Decne. Naz018* Pakistan trnL-F, PHYA and atpB
Neoschumannia kamerunensis Chase 3903 Cameroon PHYA
Quaqua incarnata (L. f.) Bruyns Chase 9818 South Africa PHYA
Orthanthera jasminiflora N. E. Br. ex Schinz Chase 3902 South Africa PHYA
Secamonoideae
Pervillaea phillipsonii Klack. Phillipson 4132 Madsgascar trnL-F
Secamone alpini Schult. P. Bruyns Vch? South Africa trnL-F and PHYA
Secamone parvifolia (Oliv.) Bullock Goyder & Masinde 3960 ** trnL-F
Periplocoideae
Cryptolepis buchananii Roemer & Schult. Naz002* Pakistan trnL-F, PHYA and atpB
Cryptolepis decidua (Planch. ex Benth.) N. E. Br. P. V. Bruyns s.n. (east of Fish R.) Namibia trnL-F, PHYA and atpB
Cryptolepis sp. Naz011* Pakistan trnL-F
Hemidesmus indicus (L.) R.Br. ex Schult. Chase 725 Tamil Nadu PHYA
Chapter 2
29
Periploca aphylla Decne. Naz004* Pakistan trnL-F and PHYA
Raphionacme hirsuta (E.Mey.sec.N.E.Brown) R.
A.Dyer CFR 15 South Africa PHYA
Schlechterella abyssinicum (Chiov.) Venter & R. L.
Verh. Chase 720 Ethopia trnL-F and PHYA
Apocynoideae - Malouetieae
Kibatalia gitingensis (Elmer) Woodson Liede 3268 ** trnL-F and PHYA
Pachypodium leallii Welw. Chase 735 South Africa trnL-F and PHYA
Apocynoideae - Nerieae
Adenium obesum (Forssk.) Roem. & Schult. Chase 727 Somalia trnL-F and PHYA
Nerium oleander L. Naz015* Pakistan trnL-F and PHYA
Apocynoideae - Apocyneae
Beaumontia grandiflora (Roxb.) Wall. Naz008* Pakistan trnL-F, PHYA and atpB
Trachelospermum jasminoides (Lindl.) Lem. Naz022* Pakistan trnL-F, PHYA and atpB
Apocynoideae - Echiteae
Fernaldia pandurata (A.DC. ) Woodson M Endress, Zurich ** PHYA and atpB
Apocynoideae – Wrightieae
Pleioceras barteri Baill. Endress, P. 99-10 Ivory Coast PHYA
Rauvolfioideae - Carisseae
Carissa spinarum L. Naz017* Pakistan trnL-F and PHYA
Rauvolfioideae – Plumerieae
Chapter 2
30
Anechites nerium Urb. Bremer et al. 3386 UPS ** PHYA
Plumeria obtusa L. Naz021* Pakistan trnL-F
Plumeria rubra L. Naz009* Pakistan trnL-F
Skytanthus acutus Meyen M. Endress, Zurich ** PHYA
Thevetia peruviana (Pers.) K. Schum. Naz013* Pakistan trnL-F and PHYA
Rauvolfioideae – Vinceae
Catharanthus roseus (L.) G. Don Naz005* Pakistan trnL-F and atpB
Petchia ceylanica (Wight) Livera R. Olmor s. n Germany trnL-F, PHYA atpB
Rauvolfia hirsute (L.) Benth. Naz003* Pakistan trnL-F, PHYA and atpB
Vinca major L. Naz025* Pakistan trnL-F and atpB
Rauvolfioideae: Vinceae Unplaced Genera
Amsonia hurbritchii Woodson Chase 19252 USA PHYA
Rhazya orientalis A.DC. M. Endress s.n. Zurich PHYA and atpB
Rauvolfioideae – Tabernaemontaneae
Tabernaemonta divericata (L.) R. Br.
exRoem.Schult Chase 5571 Bangladesh PHYA and atpB
Rauvolfioideae – Hunterieae
Gonioma kamassi E.Mey. Chase 5806 South Africa trnL-F, PHYA and atpB
Rauvolfioideae – Alyxieae
Alyxia buxifoliaR. Br. Smith, R.J. (RJS202) Australia PHYA
Rauvolfioideae – Alstonieae
Chapter 2
31
*Vouchers specimens are preserved in the Plant Biochemistry and Molecular Biology Laboratory of Quaid-i-Azam University, Islamabad, Pakistan. ** Information not present in Kew’s databases.
Alstonia scholaris (L.) R. Br. Naz007* Pakistan trnL-F, PHYA and atpB
Chapter 2
32
Figure 2.1 Map showing different areas of plant collection in Pakistan.
Chapter 2
33
Figure 2.2 Map showing different countries of the world, from where different taxa of Apocynaceae were collected and stored in herbarium or as living collection in Royal Botanic Gardens, Kew, London.
Chapter 2
34
2. To extract quality DNA from old specimens of herbarium, Doyle and Doyle
(1987) 2× CTAB protocol was used. The herbarium material was ground by
beating the specimen with metal beads in tubes using a GenoGrinder® (SPEX
CertiPrep, Inc.) An equal volume of chloroform isoamylalchol (24:1) was
added in each tube. After centrifugation at 8000 rpm for 10 minutes, aqueous
top layer containing DNA was transferred to new tube. For precipitating DNA
2/3 volume of chilled isopropanol was used and samples were refrigerated for
two weeks. To collect precipitate, the samples were centrifuged at 3000 rpm
for 5 minutes. To purify the DNA, the pellet was dissolved in 70 % ethanol for
30 minutes following centrifugation at 3200 rpm for 3 minutes. The liquid was
poured off and left the tubes with DNA pellet in fume cupboard overnight to
evaporate alcohol completely. The DNA pellet was resuspended in CsCl-EtBr
(cesium chloride ethidium bromide) solution and held at room temperature for
several hours until the pellet was completely dissolved.
Further, for CsCl-gradient purification of DNA, the samples were transferred
into rotor tubes and centrifuged at 5800 rpm for 5 hours. A florescent band
was appeared in each tube when visualized under UV light. Small amount of
solution was discarded above the band and 1.2 ml of band was carefully
removed from each rotor tube and transferred to new transparent, 5ml tubes.
An equal volume of SSC (single-site catalysis) saturated butanol was added for
removal of EtBr. Further for dialysis, dialysis tubes were cut into small strips,
each strip was loaded with DNA sample and clamped lower and upper end. All
the strips were kept in water that was being stirred for 4 hours. The samples
were concentrated by transferring them to a tray and adding sugar for 20
minutes. At end dialysis buffer was added in water and strips were put under
water followed by stirring for overnight. The purified DNA samples were
transferred into new tubes for further processes.
2.3 Polymerase chain reaction (PCR)
For the analysis of phylogenetic relationships in Apocynaceae different regions of
plastid (trnL-F and atpB promoter) and nuclear genomes (PHYA) were sequenced (see
Figure 2.3 for detail). To amplify the target regions, PCR protocols were optimized at
different conditions and temperatures. Primers details of trnL-F region, first exon of
PHYA and atpB gene promoter region are given in table 2.2.
Chapter 2
35
trnL-F intron-spacer region
atpB gene promoter region
First exon of PHYA gene
Figure 2.3 Showing locations of primers used to amplify different regions of plastid and nuclear genomes.
Chapter 2
36
Table 2.2 Sequences and sources of different primers used in this study. Primer region Primer name Primers sequence (5’-3’) Source
trnL-F (~ 900) c (Forward) CGAAATCGGTAGACGCTACG
Taberlet et al. (1991) d (Reverse) GGGGATAGAGGGACTTGAAC
e (Forward) GGTTCAAGTCCCTCTATCCC
f (Reverse) ATTTGAACTGGTGACACGAG
PHYA (~ 1500bp)
2059F GCCTTACGAAGTTCCAATGACTGCTGC
Livshultz (2010) 2971R CAAGCTATCCGTACTYAGMCCHGTTG
2745F ACTCAGACACTYTTGTGTGATATGCTSAT
3560R TACCTTGCAATGCCAATTCCAACATCTTG
atpB gene Promoter (~ 990) Forward CCAGAAGTAGTAGGATTGATTCTCA Designed by using
program Primer3 Reverse TTGGACCTCAAGGTGGACTTCT
Chapter 2
37
2.3.1 trnL-F intron-spacer region
The target region was amplified by using ReddyMix PCR Mastermix (AB Gene,
Epsom, Surrey, UK), in Gene Amp 9700 thermocycler (ABI, Applied Biosystem,
Warrington, Cheshire, UK). The following temperatures were standardized; initial
melting step at 94 °C for 1 minute, followed by 35 cycles of 1 minute at 94 °C, 1
minute at 50 °C , and 3 minutes at 72 °C , with a final extension of 7 minutes at 72 °C.
2.3.2 Nuclear gene PHYA
The region was amplified by using same ReddyMix PCR Mastermix in 25 μl of
reaction mixture. Degraded DNA in some samples did not give amplified product by
using ReddyMix PCR Mastermix (AB Gene, Epsom, Surrey, UK). To amplify the
target regions from degraded DNA especially from herbarium samples, Platinum® taq
DNA polymerase (Invitrogen) was used. Reaction mixture of 25 μl consisted of 2.5 μl
10× buffer, 2 μl MgCl2, 1 μl of BSA (Bovine serum albumin), 0.6 μl of each primer
(0.1 ng/μl), 0.2 μl of 5U/μl of Platinum taq DNA polymerase was prepared and made
up to volume with nuclease free water. The following PCR program was adjusted;
initial denaturation at 94 °C for 2 minutes, followed by 35 cycles of denaturation at 94
°C for 20 seconds, annealing at 50 °C for 30 seconds and extension at 72 °C for 2
minutes. Final extension was carried out at 72 °C for 7 minutes.
2.3.3 Promoter region of atpB gene
The specific region was targeted by using a pair of primers, designed from tobacco
chloroplast genome. A 25 µl PCR mixture containing 25 pmol of each primer, 2.5 µl
of 10× taq buffer, 1.5 µl of 2 Mm dNTPs, 1.5 µl of 25 Mm MgCl2 and 5U of taq
polymerase (MBI Fermentas). The PCR temperatures were optimized using gradient
PCR system (Multigene, Labnet). Following temperature settings were used; pre-
denaturation at 94 °C for 5 minutes, followed by 35 cycles of denaturation at 94 °C
for 45 seconds, primer annealing at 57 °C for 40 seconds and extension at 72 °C for
40 seconds. The final extension occurred at 72 °C for 20 minutes. After PCR, contents
were held at 4 °C till further used.
2.4 Purification of amplified products
Chapter 2
38
PCR products were purified using QIAquick kit following the manufacturer’s
protocol (Appendix I).
2.5 Sequencing
Sequencing reactions were performed on a 3730 automated sequencer using Big Dye
terminator v3.1 chemistry, according to the manufacturer’s protocols, Applied
Biosystems, Inc. For cleaning of cycle sequencing products, precipitation in ethanol
was preferred (Appendix II).
2.6 Data analysis
The electropherograms were edited and assembled using Sequencher version 4.1
(Gene Codes, Inc., Ann Arbor, Michigan, USA). They were aligned by eye in the
matrix following the guidelines provided by Kelchner (2000). To improve the picture
of phylogeny in Apocynaceae, additional genera from previous studies were included
in datasets. In trnL-F based sequence analysis, 143 sequences were added and 45
sequences (Livshultz, 2010) were included in PHYA based sequence matrix
(www.ncbi.nlm.nih.gov; accession numbers are given in table 2.3).
2.6.1 Parsimony analysis
For maximum parsimony (MP) analysis PAUP version 4.0b10, (Swofford, 2002) was
used. The data matrix of trnL-F region comprised of 178 sequences including one
outgroup (Chelonanthus alatus) of family Gentianaceae and the PHYA dataset
consisted of 111 taxa as the ingroup. The gaps were treated in analysis as missing
data. The combined data matrix was analysed using tree bisection-reconnection (TBR)
swapping and 1000 replicates of random taxon addition, holding 10 trees at each step
to reduced time searching islands of equally parsimonious trees. DELTRAN character
optimization was used to illustrate branch lengths (due to reported errors with
ACCTRAN optimization in PAUP version 4.0b). Using the heuristic search strategy
and by randomly adding taxa the bootstrap values (BP) were measured from 500
replicates analyses and only those values were recorded which were according to the
majority rule consensus tree.
2.6.2 Bayesian analysis
Chapter 2
39
Table 2.3 A list of taxa with GenBank accession numbers used in trnL-F and PHYA analyses, previously published in Rapini et al. (2003), Sennblad and Bremer (1998) and Livshultz (2010) with updated nomenclature.
Taxa Accession numbers
trnL-F PHYA atpB
Asclepiadoideae – Asclepiadeae: Metastelmatinae
Barjonia chloraeifolia Decne. AY163667 – –
Blepharodon lineare (Decne.) Decne. AY163668 ** –
Blepharodon mucronatum Decne. AJ290839 – –
Blepharodon nitidum (Vell.) J. F. Macbr. AY163669 – –
Ditassa banksii R. Br. ex Schult. AY163674 – –
Ditassa cordeiroana Fontella AY163676 – –
Ditassa 39irsute Decne AJ704223 – –
Ditassa tomentosa (Decne.) Fontella AJ704486 – –
Hemipogon acerosus Decne. AJ704290 – –
Hemipogon carassensis (Malme) Rapini AY163692 – –
Hemipogon luteus E. Fourn. AY163693 – –
Metastelma linearifolium A. Rich. AJ428809 – –
Metastelma schaffneri A. Gray AJ410216 – –
Metastelma sp. Indet., aff. Parviflora R. Br. AJ428779 – –
Minaria acerosa (Mart.) T. U. P. Konno & Rapini AJ699287 – –
Chapter 2
40
Minaria decussata (Mart.) T. U. P. Konno & Rapini AJ704219 – –
Minaria ditassoides (Silveira) T. U. P. Konno & Rapini AY163678 – –
Minaria grazielae (Fontella & Marquete) T. U. P. Konno & Rapini AJ410204 – –
Minaria magisteriana (Rapini) T. U. P. Konno & Rapini AY163681 – –
Nautonia nummularia Decne. AJ410228 – –
Nephradenia acerosa Decne. AY163705 – –
Nephradenia asparagoides (Decne.) E. Fourn. AY163707 – –
Peplonia organensis (E. Fourn.) Fontella & Rapini AY163688 – –
Petalostelma sarcostemma (Lillo) Liede & Meve AJ428788 – –
Asclepiadoideae: MOG Unplaced Genus
Tassadia berteroana (Spreng.) W. D. Stevens AJ428791 – –
Tassadia obovata Decne. AJ699283 – –
Asclepiadoideae – Asclepiadeae: Oxypetalinae
Araujia sericifera Brot. AJ704332 ** –
Funastrum clausum (Jacq.) Schltr. AJ428794 ** –
Funastrum odoratum Schltr. AJ290862 – –
Oxypetalum appendiculatum Mart. AJ290871 – –
Oxypetalum banksii R. Br. ex Schult. AY163709 – –
Oxypetalum capitatum Mart. AY163710 ** –
Chapter 2
41
Oxypetalum coeruleum (D. Don ex Sweet) Decne. AJ704356 – –
Oxypetalum insigne (Decne.) Malme AY163711 – –
Oxypetalum minarum E. Fourn. AY163713 – –
Oxypetalum strictum Mart. AY163712 – –
Oxypetalum sublanatum Malme AY163715 – –
Oxypetalum sylvestre (Hook. & Arn.) Goyder & Rapini AJ410246 – –
Philibertia candolleana (Hook. & Arn.) Goyder. AJ410177 – –
Philibertia discolor (Schltr.) Goyder AY163700 ** –
Philibertia lysimachioides (Wedd.) T. Mey. AJ290900 ** –
Philibertia parviflora (Malme) Goyder AJ410225 – –
Philibertia picta Schltr. [P. Vaileae (Rusby) Liede] AJ290905 – –
Asclepiadoideae – Asclepiadeae: Gonolobinae
Gonolobus rostratus (Vahl) Schult. AF214208 – –
Gonolobus parviflorus Decne. AY163689 – –
Matelea pseudobarbata (Pitter) Woodson – ** –
Matelea pedalis (E. Fourn.) Fontella & E. A. Schwarz AY163699 – –
Schubertia grandiflora Mart. AJ428827 – –
Asclepiadoideae – Asclepiadeae: Orthosiinae
Cynanchum morrenioides Goyder AJ428686 – –
Chapter 2
42
Ditassa subtrivialis Griseb. AJ428756 –
Jobinia lindbergii E. Fourn. AY163694 – –
Metastelma scoparium (Nutt.) Vail AY163703 – –
Orthosia urceolata E. Fourn. AJ704325 – –
Asclepiadoideae – Asclepiadeae: MOG, Basal Grade
Diplolepis geminiflora (Decne.) Liede & Rapini AJ410183 – –
Diplolepis nummulariifolia (Hook. & Arn.) Liede & Rapini AJ290851 – –
Diplolepis hieronymi (Lorentz) Liede & Rapini AJ410213 – –
Asclepiadoideae – Asclepiadeae: Asclepiadinae
Asclepias alpestris (K. Schum.) Goyder AY163718 – –
Asclepias curassavica L. AY163664 – –
Asclepias mellodora A. St.-Hil. AY163665 – –
Asclepias syriaca L. AJ410180 – –
Aspidoglossum ovalifolium (Schltr.) Kupicha AY163666 – –
Calotropis procera (Aiton) W. T. Aiton HE805509 ** –
Calotropis procera (Aiton) W. T. Aiton AF214170 – –
Glossostelma spathulatum (K. Schum.) Bullock AY163686 – –
Gomphocarpus fruticosus (L.) W. T. Aiton AY163687 – –
Kanahia laniflora (Forssk.) R. Br. AY163695 ** –
Chapter 2
43
Margaretta rosea Oliv. AY163696 ** –
Pachycarpus 43irsute43 (N. E. Br.) Bullock AY163716 – –
Pergularia daemia (Forssk.) Chiov. AJ290893 ** –
Pergularia tomentosa L. HE805514 ** –
Stathmostelma gigantiflorum K. Schum. AY163721 – –
Stenostelma corniculatum (E. Mey.) Bullock AY163722 ** –
Xysmalobium undulatum (L.) W. T. Aiton AY163725 – –
Xysmalobium parviflorum Harv. Ex Scott-Elliot AM295674 ** –
Asclepiadoideae – Asclepiadeae: ACT clade Unplaced Genera
Cynanchum acutum L. AJ428584 – –
Oxystelma esculentum (L. f.) Sm. AJ290887 – –
Oxystelma esculentum (L. f.) Sm. ** ** –
Solenostemma arghel (Delile) Hayne AJ428833 – –
Asclepiadoideae – Asclepiadeae: Cynanchinae
Cynanchum grandidieri Liede & Meve AJ290856 – –
Cynanchum jacquemontianum Decne. HE805511 ** –
Cynanchum insigne (N. E. Br.) Liede & Meve AJ290906 – –
Cynanchum laeve (Michx.) Pers. AJ428653 – –
Cynanchum montevidense Spreng. AJ290850 – –
Chapter 2
44
Cynanchum obovatum (Decne.) Choux. AJ428803 – –
Cynanchum roulinioides (E. Fourn.) Rapini AJ428734 – –
Cynanchum verrucosum Desc. AJ290879 – –
Cynanchum viminale (L.) L. AJ290912 ** –
Cynanchum obtusifoliumL.f. AJ428692 ** –
Glossonema boveanum (Decne.) Decne. AY163685 – –
Metalepis albiflora Urb. AJ428776 – –
Metaplexis japonica Makino (I) AJ428812 – –
Odonthanthera radians (Forssk.) D. V. Field AJ428815 – –
Pentarrhinum insipidum E. Mey. AJ410234 – –
Schizostephanus alatus Hochst. Ex K. Schum. AJ410248 – –
Asclepiadoideae – Asclepiadeae: Tylophorinae
Biondia henryi Tsiang & P. T. Li AJ410192 – –
Diplostigma canescens K. Schum. AJ410201 – –
Goydera somaliensis Liede AJ410210 – –
Pentatropis nivalis (J. F. Gmel.) D. V. Field & J. R. I. Wood AJ410240 – –
Tylophora hirsute (Wall.) Wight HE805515 ** **
Tylophora flexuosa R. Br. AJ290917 – –
Vincetoxicum hirundinaria Medik. AJ410276 – –
Chapter 2
45
Asclepiadoideae – Asclepiadeae: Astephaninae
Astephanus triflorus R. Br. AJ410189 – –
Eustegia minuta (L. f.) N. E. Br. AJ410207 ** –
Microloma tenuifolium K. Schum. AJ410222 ** –
Oncinema lineare (L. f.) Bullock AJ410230 ** –
Asclepiadoideae – Marsdenieae
Cionura erecta Griseb. AJ410174 – –
Dischidia bengalensis Colebr. AF214189 – –
Dischidia lanceolata Decne. – ** –
Dregea abyssinica K. Schum – ** –
Gymnema sylvestre (Retz.) Schultz. HE805512 ** –
Hoya australis R. Br. ex J. Traill AF214213 – –
Hoya manipurensis Deb. AF214227 ** –
Hoya finlaysonii Deb. AF214227 ** –
Marsdenia amorimii Morillo AF214223 – –
Marsdenia carvalhoi Morillo & Carnevali DQ334521 ** –
Marsdenia glabra Costantin EF456114 GU901360 –
Marsdenia suberosa (E. Fourn.) Malme AY163697 – –
Marsdenia zehntneri Fontella AY163698 – –
Chapter 2
46
Rhyssolobium dumosum E. Mey. AM233378 ** –
Stephanotis floribunda Brongn. HE805517 ** –
Wattakaka volubilis (Linn.f.) Stapf. HE805516 ** –
Telosma cordata Merr. AF102493 – –
Asclepiadoideae – Ceropegieae
Boucerosia frerei Dalzell AF214202 ** –
Caralluma edulis (Edgew.) Hook. F. HE805508 – –
Caralluma tuberculata N.E. Br. HE805510 ** –
Ceropegia sandersonii Decne.ex Hook. AF214179 ** –
Ceropegia saxatilis Jum. & H. Perrier AJ410042 – –
Duvalia polita N. E. Br. AJ488374 ** –
Leptadenia pyrotechnica Decne HE805513 ** **
Neoschumannia kamerunensis Schltr. AJ410054 ** –
Quaqua incarnata (L. f.) Bruyns AJ488455 ** –
Stapelia glanduliflora Mass. AJ402151 – –
Stapelia leendertziae N. E. Br. AF214270 – –
Asclepiadoideae – Fockeeae
Fockea edulis K. Schum. AF214199 – –
Secamonoideae
Chapter 2
47
Secamone glaberrima K. Schum. AF214266 – –
Secamone alpini Schult. HE805519 ** –
Secamone parvifolia (Oliv.) Bullock HE805520 ** –
Pervilaeae phillipsonii Klack HE805518 ** –
Secamone elliptica R. Br. EF456116 GU901389 –
Toxocarpus villosus(Blume) Decne EF456117 GU901399 –
Periplocoideae
Cryptolepis buchananii Roemer & Schult. HE805522 ** **
Cryptolepis deciduas (Planch. Ex Benth.) N. E. Br. HE805523 ** **
Cryptolepis sp. HE805521 – –
Finlaysonia insularum (King & Gamble) Venter EF456105 GU901341 –
Gymnanthera oblonga (Burm. F.) P.S. Green EF456106 GU901348 –
Hemidesmus indicus (L.) R.Br. ex Schult. DQ916877 –
Periploca aphylla Decne. HE805524 ** –
Periploca graeca L. AF214244 –
Petopentia natalensis (Schltr.) Bullock EF456109 GU901376 –
Phyllanthera grayi (P.I. Forst.) Venter EF456103 GU901377 –
Raphionacme 47irsute (E.Mey.sec.N.E.Brown) R.A.Dyer AJ581825 **
Schlechterella abyssinicum (Chiov.) Venter & R. L. Verh. HE805525 ** –
Chapter 2
48
Zygostelma benthamii Baill. EF456109 GU901405, –
Apocynoideae; Baisseeae
Motandra guineensis A. DC. EF456210 GU901361 –
Oncinotis tenuiloba Stapf EF456141 GU901368 –
Baissea multiflora A. DC. EF456199 GU901330 –
Apocynoideae; Echiteae
Angadenia berteroi Miers EF456129 GU901324 –
Artia balansae (Baillon) Pichon ex Guillaumin EF456209 GU901329 –
Echites umbellatus Jacq. EF456237 GU901337 –
Fernaldia pandurata Woodson EF456191 ** **
Laubertia contorta (Mart.& Galeotti) Woodson EF456246 GU901358 –
Parsonsia eucalyptophylla F. Muell. EF456142 GU901372 –
Peltastes isthmicus Woodson EF456179 GU901373 –
Pentalinon luteum (L.) B.F. Hansen & R.P. Wunderlin EF456180 GU901375 –
Prestonia lagoensis (Müll. Arg.) Woodson EF456215 GU901380 –
Rhodocalyx rotundifolius Müll. Arg. EF456186 GU901387 –
Stipecoma peltigera Müll. Arg. EF456193 GU901394 –
Temnadenia odorifera (Vell.) J.F. Morales EF456238 GU901396 –
Apocynoideae; Mesechiteae
Chapter 2
49
Mandevilla boliviensis (Hook. F.) Woodson EF456153 GU901359 –
Forsteronia guyanensis Müll. Arg. EF456134 GU901343 –
Apocynoideae – Apocyneae
Aganosma wallichii G. Don. – GU901319 –
Amphineurion marginatum (Roxb.) G. Don. EF456125 GU901323 –
Anodendron paniculatum A. DC. EF456194 GU901327 –
Apocynum androsaemifolium L. AF214308 GU901328 –
Beaumontia grandiflora (Roxb.) Wall. HE805527 ** **
Chonemorpha fragrans (Moon) Alston EF456132 GU901332 –
Cleghornia malaccensis (Hook. F.) King & Gamble EF456241 GU901333 –
Epigynum cochinchinense (Pierre) D.J. Middleton EF456127 GU901340 –
Ichnocarpus frutescens R. Br. EF456136 GU901356 –
Papuechites aambe Markgr. EF456189 GU901370 –
Parameria laevigata (Juss.) Mold. EF456197 GU901371 –
Sindechites henryi Oliv. & Tsiang: EF456244 GU901393 –
Trachelospermum jasminoides (Lindl.) Lem. HE805531 ** **
Urceola lucida Benth.& Hook. F. EF456226 GU901400 –
Vallaris solanacea (Roth) O. Kuntze EF456162 GU901401 –
Apocynoideae – Malouetieae
Chapter 2
50
Mascarenhasia arborescens A. DC. AF214224 – –
Kibatalia gitingensis (Elmer) Woodson HE805528 ** –
Pachypodium leallii Welw. HE805530 ** –
Apocynoideae – Nerieae
Nerium oleander L. AF214232 ** –
Adenium obesum (Forssk.) Roem. & Schult. HE805526 ** –
Apocynoideae; Odontadenieae
Pinochia corymbosa (Jacq.) M.E. Endress & B.F. Hansen EF456167 GU901378 –
Thyrsanthella difformis (Walter) Pichon EF456171 GU901398 –
Elytropus chilensis Müll. Arg. EF456228 GU901339 –
Cycladenia humilis Bentham EF456211 GU901335 –
Odontadenia perrotteti (A. DC.) Woodson EF456140 GU901367 –
Secondatia densiflora A. DC. EF456177 GU901391 –
Apocynoideae – Wrighteae
Pleioceras barteri Baill. EF456251 ** –
Rauvolfioideae – Carisseae
Acokanthera oppositifolia (Lam.) Codd. AF214148 – –
Carissa spinarum L. HE805533 ** –
Rauvolfioideae – Plumerieae
Chapter 2
51
Allamanda indet. AF214150 – –
Anechites nerium (Aubl.) Urb. AM295087 ** –
Plumeria alba Kunth. AF214254 – –
Plumeria obtuse L. HE805537 ** –
Plumeria rubra L. HE805538 ** –
Skytanthus acutus Meyen AF214269 ** –
Thevetia ahouai (L.) A. DC. AF214281 – –
Thevetia peruviana (Pers.) K. Schum. HE805540 ** –
Rauvolfioideae – Vinceae
Catharanthus roseus G. Don AF214175 – –
Catharanthus roseus G. Don HE805534 ** **
Kopsia fruticosa (Ker. Gawl.) A. DC AM295091 – –
Ochrosia nakaiana (Koidz) Fosberg & Sachet. [Neisosperma nakaiana
(Koidz) Fosberg & Sachet.] AF214231 –
–
Ochrosia coccinea (Teijsm. & Binn.) Miq. AM295092 – –
Petchia ceylanica (Wight) Livera AM295093 ** **
Petchia madagascariensis (A. DC.) Leeuwenb. AM295088 – –
Rauvolfia serpentina Benth. ex Kurz. AF214261 – –
Rauvolfia serpentine Benth. ex Kurz. HE805539 ** **
Chapter 2
52
Vinca minor L. AF214295 – –
Vinca major L. HE805541 –
Apocynoideae: Vinceae Unplaced Genera
Amsonia tabernaemontana Walter AF214153 – –
Amsonia hurbritchii Woodson – ** –
Rhazya stricta Decne. AM295095 – –
Rhazya orientalisA.DC. AM295095 ** –
Rauvolfioideae – Tabernaemontaneae
Molongum laxum (Benth.) Pichon AF214229 – –
Tabernaemontana divericata L. AF214277 ** **
Rauvolfioideae – Melodineae
Craspidospermum verticillatum Bojer ex A. DC. AM295090 – –
Rauvolfioideae – Hunterieae
Gonioma kamassi E.Mey. HE805535 ** **
Rauvolfioideae – Alyxieae
Alyxia buxifolia R. Br. AF214152 ** **
Chilocarpus suaveolens Blume. AM295089 – –
Condylocarpon amazonicum (Markgr.) Ducke AF214183 – –
Lepiniopsis ternatensis Valeton AF214220 – –
Chapter 2
53
**Sequences are under process for submission to GenBank.
Plectaneia stenophylla Jum. AF295094 – –
Pteralyxia kauaiensis Caum AM295094 – –
Rauvolfioideae – Alstonieae
Alstonia boonei De. Wild. AF214151 – –
Alstonia scholaris (L.) R. Br. HE805532 ** –
Rauvolfioideae – Aspidospermeae
Aspidosperma quebrachoblanco Schltdl. AF214165 – –
Vallesia antillana Woodson AF214293 – –
Outgroup - Gentianaceae
Chelonanthus alatus (Aubl.) Pulle AY251775 – –
Chapter 2
54
Bayesian analysis was performed using Mr. Bayes (Huelsenbeck and Ronquist, 2001).
The software judges the maximum possibilities of substitution, weighted by their
probability of occurring in a specific model of evolution (Huelsenbeck et al., 2001).
The HKY85 model was specified for analysis in which all transitions and
transversions have potentially different rates. More complex models were also tested,
but these yielded the same tree with similar posterior probabilities (PP). The analysis
was performed with 500,000 generations of Monte Carlo Markov Chains with equal
rates and a sampling frequency of 10. Microsoft excel was used to plot generation
number against InL to find the ‘burn in’. Trees of low PP were deleted, and all
remaining trees were imported into PAUP 4.0b. A Bayesian tree (i.e. a majority rule
consensus tree) was produced showing PP (i.e. frequencies of all observed bi-
partitions).
Chapter 3
55
Results
3.1 DNA extraction and PCR
Total genomic DNA was extracted from fresh leaf tissues or from herbarium
specimens by using different CTAB protocols. Isolated DNA was run on 1 % agarose
gel after treatment with RNase for determining the quality of DNA (Figure 3.1), as
good quality template is desired for the amplification of plastid and nuclear regions. It
was noticed that DNA from herbarium material is technically more difficult to be used
for amplification of low-copy nuclear genes such as PHYA.
By using the genomic DNA as template, amplification of trnL-F intron-spacer region,
atpB promoter region and first exon of PHYA gene was done by using forward and
reverse primers. To amplify large regions such as trnL-F and PHYA, two sets of
primers were used for each (details are given in Table 2.2 Material and Methods
section). The amplified products of different sizes from different regions were
confirmed on 1 % agarose gel (Figure 3.1).
3.2 Purification and sequencing of amplified products
High quality PCR product was purified by using QIAquick kit following the
manufacturer's protocol. The purified product was sequenced by using 3730
automated sequences. Sequences of amplified fragment were edited and analysed
using MP and Bayesian analyses for phylogeny of Apocynaceae. Separate (trnL-F,
atpB and PHYA) phylogenetic trees were constructed by using different software such
as PAUP 4.0b10 and Mr. Bayes. Results are elaborated here separately on the basis of
different regions.
3.3 Phylogenetic analysis based on plastid trnL-F intron region sequences
To estimate the phylogenetic relationships among groups of Apocynaceae 178 taxa
were used in the parsimony analysis of the trnL-F. Of the 1267 characters, of total 411
variable characters 292 were found to be potentially parsimony-informative. Analysis
yielded 2830 equally most-parsimonious trees 1748 steps long, with a consistency
index (CI) of 0.60 and a retention index (RI) of 0.79. In comparison to parsimony
Chapter 3
56
Figure 3.1 Extraction of genomic DNA and amplified products of different plastid and nuclear regions, M = 50bp ladder (Fermentas). a) Isolated genomic DNA from different taxa of Apocynaceae, b) PCR amplification of trnL-F region by using primer c & d, c) PCR product of atpB promoter region, d) PCR product of PHYA by using 2059F and 2971 R.
Chapter 3
57
consensus tree (Figure 3.2) the Bayesian consensus tree (Figure 3.3) has more
resolved nodes. The subfamilies receive strong support in the Bayesian analysis in
contrast to the parsimony results. The exception to this is subfamily Rauvolfioideae,
which receives low Bayesian support (PP 0.79).
In Rauvolfioideae, largely the resolution is low among groups in both parsimony and
Bayesian analyses. Vallesia and Aspidosperma of Aspidospermeae (BP 98; PP 0.9)
appeared as sister to the rest. Alstonieae and Carisseae are strongly supported in both
analyses (BP 100; PP 1.0 and BP 99; PP 1.0). In the Bayesian tree Plumeria and
Allamanda of Plumerieae receive high support (PP 1.0) (Figure 3.3). Vinceae,
Tabernaemontaneae, Hunterieae and Melodineae are not fully resolved (Figures 3.2 &
3.3).
Genera of Vinceae and Alyxieae do not appear in separate distinct clades (Figures 3.2
& 3.3) and are therefore non-monophyletic groups. In Vinceae, the nodes which
delimit the genera are poorly resolved in both consensus trees. The Alyxieae group
forms two distinct clades — Lepiniopsis, Pteralyxia, Alyxia and Plectaneia receive
strong support (PP 1.0) in the Bayesian analysis and weak support in parsimony,
whereas the Chilocarpus and Condylocarpon clade (BP 100; PP 1.0) appears among
the unresolved tribes of Rauvolfioideae (Figure 3.3). Support values for the
Tabernaemontana and Molongum clade are high, BP 100; PP 1.0 (Figures 3.2 & 3.3).
The APSA clade including all examplers of Apocynoideae, Periplocoideae,
Secamonoideae and Asclepiadoideae get significant support with BP 98 and PP 0.98
(Figures 3.2 & 3.3). Apocynoideae is not monophyletic in our analyses, tribe
Malouetieae in the Bayesian tree appears as the sister group of Secamonoideae and
Asclepiadoideae rather than Periplocoideae with weak support (Figure 3.3). Nerieae
and Apocyneae form well-supported clades of Apocynoideae in the Bayesian tree (PP
0.99; PP 0.98 respectively) while their bootstrap values are lower.
The position of the well-supported Periplocoideae clade (BP 100; PP 1.0) remains
unresolved. In Periplocoideae, values which support the relationships between the
genera also vary between both types of analyses (Figures 3.2 & 3.3).
Chapter 3
58
Figure 3.2 One of the most parsimonious trees for Apocynaceae based on the sequences of plastid trnL-F region. Branch lengths are optimised using DELTRAN and shown above branches; bootstrap percentages > 50 and consistent with the strict consensus tree are indicated below branches. BP > 90 are considered high support and < 80 showing weak support. Groups of Apocynoideae are defined here according to the classification of Endress et al. (2007a). Species with (P) were collected from Pakistan.
Chapter 3
59
Figure 3.2 (Continued)
APSA clade
Chapter 3
60
Figure 3.3 The Bayesian tree resulting from the analysis of the trnL-F sequences for Apocynaceae. Posterior probabilities are shown above branches. Values > 0.95 are considered as strong support, > 0.90 showing moderate support and < 0.90 with weak support.
Chapter 3
61
Figure 3.3 (Continued)
APSA clade
Chapter 3
62
The clade comprising of milkweeds (Asclepiadoideae and Secamonoideae) receives
high support (PP 0.98) in the Bayesian tree in contrast to the parsimony phylogeny
(with low support) (Figures 3.2 & 3.3). In Secamonoideae, species of the Secamone
group (PP 0.99) cluster together, but the embedded position in the clade of the genus
Pervillaea is not evident here (Figure 3.3).
Fockeae appear as sister to the rest of Asclepiadoideae. A clade comprising of
Ceropegieae and Marsdenieae receives good support (PP 0.98) confirming the
monophyly of these two tribes. Eustegia is recovered as the sister of the Marsdenieae-
Ceropegieae clade (PP 0.96). Ceropegieae has highly supported subclade (BP 100; PP
0.98) while the monophyly of Marsdenieae is suspected due to basal position of genus
Fockea (Figures 3.2 & 3.3). In the Marsdenieae Hoya and Dischidia are well-
supported (PP 0.1) sister groups.
The monophyly of Asclepiadeae (PP 1.0) and subtribal relationships are well-
supported in the Bayesian tree. ‘Astephaninae’ the basal most tribe of Asclepiadeae
including Microloma, Astephanus and Oncinema receives strong support in both
analyses (BP 100; PP 1.0). Based on the trnL-F region, the ACT (Asclepiadinae,
Cynanchinae and Tylophorinae) and MOG (Metastelmatinae, Oxypetalinae and
Gonolobinae) clades are not well-resolved in the parsimony analysis. The Malagasy
leafless stem succulent group Cynanchinae (represented in the analyses by the
following species C. grandidieri, C. viminale, C. verrucosum, C. insigne and C.
obovatum) forms both a weakly and strongly supported clade in the two analyses
types (BP 59: PP 1.0). Cynanchinae are not monophyletic since other ‘non-Malagasy’
species of Cynanchinae appear in different tribes in the ACT clade with weak support.
The monophyly of subtribes Tylophorinae (PP 1.0) and Asclepiadineae (PP 0.98) are
confirmed in present study. In Tylophorinae Tylophora and Vincetoxicum showed a
strongly supported relationship, likewise Diplostigma and Goydera receive strong
support (PP 1.0) (Figure 3.3). The other large Cynanchinae group is not well-
supported in both analyses and further bifurcates into two strongly supported
subclades (PP 1.0) — New World Cynanchinae (comprised of C. montevidense, C.
roulinioides, C. leave and Metalepis albiflora) and Old World Cynanchum relatives
(Glossonema boveanum, Odontanthera radians and Pentarrhinum abyssinicum). The
Asian C. jacquemontianum is appeared as a problematic taxon because in both the MP
Chapter 3
63
and Bayesian analyses it is not grouped to the rest of the Cynanchum species.
Likewise Mediterranean C. acutum, the type species of the genus, appears with the
unplaced genera Solenostemma and Oxystelma, not with either of the two principal
Cynanchineae clades.
Pergularia is recovered as sister to the remaining genera of Asclepiadineae (PP 0.92).
Strong support (PP 0.99) for the New World Asclepias is observed while the Old
World species A. alpestre appears with Old World members of Asclepiadineae (Figure
3.3).
Within the MOG clade, members of the new subtribe Orthosiinae occupy a basal
position with moderate support (PP 0.97). Monophyletic Gonolobinae are embedded
in Oxypetalinae with weak support (Figure 3.3). Oxypetalum is an unresolved group
and the Araujia-Philibertia clade receives weak support. The Bayesian analysis
confirms Funastrum is sister to rest of the MOG clade (Figure 3.3). The
Metastelmatinae clade receives strong support (PP 1.0). However, inter-generic
resolution in the MOG and ACT clades is low in places (Figure 3.3).
3.4 Phylogenetic analysis of Apocynaceae by using nuclear region (PHYA)
In both Bayesian and parsimony analyses based on PHYA region, the dataset is
comprised of 112 taxa and 1251 characters. Of total taxa included in PHYA
phylogenetic tree, the targeted region of phytochrome A was sequenced from 67 taxa
belonging to different tribes of Apocynaceae and rest of incorporated taxa are from
the study of Livshultz (2010). In parsimony analysis, of 636 variable characters 479
were parsimony informative. MP analysis produced tree length= 2234, CI= 0.43, RI=
0.72.
In PHYA analysis major lineages receives less support at some places like APSA is
supported by 0.85 PP value. Both the subfamilies Apocynoideae and Rauvolfioideae
are also not recovered monophyletic here. In all subfamilies relationships among
tribes and sub tribes receive either moderate support or less supported. In the separate
trnL-F or PHYA analyses relationships among the major lineages are not well-
supported. So, in the next step an attempt was made to construct a phylogenetic tree
based on combined plastid (trnL-F) and nuclear (PHYA) dataset.
Chapter 3
64
In order to check whether these two regions are congruent or not, an incongruence test
was done. Incongruent clades recovered from parsimony and Bayesian analyses of
separate PHYA and trnL-F sequences, received no or less support in one or both
analyses. In some case, trnL-F provided higher support for certain clades than did
PHYA, but in other cases the reverse was true. Overall resolution produced by trnL-F
for both Bayesian and parsimony analyses, was less than with PHYA (Figures 3.4, 3.5,
3.6 & 3.7). So, results are evaluated only on the basis of combined phylogenetic trees
(Bayesian and MP) because they are better resolved and have higher support.
3.5 Combined phylogenetic analysis of Apocynaceae based nuclear region
(PHYA) and plastid region (trnL-F)
The dataset comprises of 112 taxa and 2325 characters, of which 1251 are contributed
by PHYA and 1070 from trnL-F. In the parsimony analysis 701 characters proved
parsimony informative and 419 variable characters are parsimony un-informative.
Analysis produced equally most-parsimonious trees with a tree length of 3284 steps
and a CI is 0.49 and the RI is 0.71. In both cases Alstonia was taken out as an
outgroup to the rest of the member of Apocynaceae. Rauvolfioideae and
Apocynoideae in both analyses appear as non-monophyletic subfamilies, whereas,
monophyly of each subfamily of traditional Asclepiadaceae (Periplocoideae,
Secamonoideae and Asclepiadoideae) receives strong support in both analyses.
Likewise, in Bayesian trees lineages are relatively supported with high PP value as BP
generated by MP analysis (Figures 3.8 & 3.9).
Different taxa representing seven tribes of Rauvolfioideae (Alstonieae, Alyxieae,
Carisseae, Hunterieae, Plumerieae, Tabernaemontaneae and Vinceae) are included in
the analyses. It was observed that the resolution among the groups is low in both
phylogenetic trees (Figures 3.8 & 3.9). The monophyly of Plumerieae recieves low
support in both analyses (BP 59; PP 0.93) while Vinceae is paraphyletic in the MP
analysis and poorly supported in the Bayesian tree (PP 0.83). In both analyses
Tabernaemontana is closely associated with Vinceae, whereas Hunterieae is closer to
the Amsonia-Rhazya clade (BP 100; PP 1.0) but this relationship is not well-supported
(PP 0.91). The position of Carisseae is found here as sister to the APSA clade with BP
59 and PP 0.91.
Chapter 3
65
Figure 3.4 Parsimony analysis of only PHYA sequences from different taxa of Apocynaceae. Bootstrap percentages > 50 and consistent with the strict consensus tree are indicated below branches. Taxa having odd position in the tree are shown here in bold letters. Asterisk (*) indicating taxa defined incertae sedis in Endress et al. (2007a) classification system. Cynanchum (P) = Cynanchum jacquemontianum.
Chapter 3
66
Figure 3.4 (Continued)
Chapter 3
67
Figure 3.5 Bayesian tree based on only PHYA sequences. PP values are indicated above the branches. Values > 0.95 are considered as strong support, > 0.90 showing moderate support and < 0.90 are weak support. Taxa at odd position are in bold letters. Asterisk (*) indicating taxa defined incertae sedis in Endress et al. (2007a) classification system. Cynanchum (P) = Cynanchum jacquemontianum.
Chapter 3
68
Figure 3.5 (Continued)
Chapter 3
69
Figure 3.6 Parsimony analysis of trnL-F sequences of taxa present in combined analyses. Bootstrap percentages > 50 are indicated below branches. Taxa having odd position in the tree are shown here in bold letters. Asterisk (*) indicating taxa defined incertae sedis in the classification of Endress et al. (2007a). Cynanchum (P) = Cynanchum jacquemontianum.
Chapter 3
70
Figure 3.6 (Continued)
Chapter 3
71
Figure 3.7 Bayesian analysis of trnL-F sequences of taxa included in combined analyses. Values > 0.95 are considered as strong support, > 0.90 showing moderate support and < 0.90 are weak support. Taxa having odd position in the tree are shown here in bold letters. Asterisk (*) indicating taxa defined incertae sedis in Endress et al. (2007a) classification system. Cynanchum (P) = Cynanchum jacquemontianum.
Chapter 3
72
Figure 3.7 (Continued)
Chapter 3
73
Figure 3.8 One of the most parsimonious trees for Apocynaceae based on sequences of the combined dataset (PHYA and trnL-F). Bootstrap percentages > 50 and consistent with the strict consensus tree are indicated below branches. Taxa in bold letters appear at odd places. Incertae sedis are highlighted by adding asterisk (*). Cynanchum (P) = Cynanchum jacquemontianum.
Chapter 3
74
Figure 3.8 (Continued)
Chapter 3
75
Figure 3.9 Bayesian analysis of Apocynaceae by using combined datasets (PHYA and trnL-F). Posterior probabilities are shown above branches. Values > 0.95 are considered as strong support, > 0.90 showing moderate support and < 0.90 with weak support. Taxa having odd position in the tree are shown here in bold letters. Asterisk (*) indicating taxa defined incertae sedis in Endress et al. (2007a) classification system. Cynanchum (P) = Cynanchum jacquemontianum.
Chapter 3
76
Figure 3.9 (Continued)
Chapter 3
77
In the APSA clade (BP 99; PP 1.0), monophyly of Apocynoideae is suspected due to
basal parallel lineages representing tribes Nerieae and Malouetieae of Apocynoideae
and subfamily Periplocoideae. Rhabdadenia form an unsupported clade in the MP
analysis with members of Malouetieae (Figure 3.8) while in the Bayesian tree
Rhabdadenia appears as a separate lineage (Figure 3.9). Periplocoideae form a
monophyletic group (BP 100; PP 1.0) and this clade is embedded in the
Apocynoideae. The rest of tribes of Apocynoideae: Odontadenieae, Mesechiteae,
Echiteae and Apocyneae form a well-supported clade in both the parsimony and
Bayesian trees (BP 100; PP 1.0). Odontadenieae, Mesechiteae and Echiteae are from
the New World and a well-supported relationship among the New World’s tribes is
not noted here. Odontadenieae is monophyletic but not well-supported (PP 0.63) in
Bayesian tree and unsupported by MP analysis. Echiteae is non-monophyletic because
of odd position of Rhabdadenia and appearance of Angadenia, Laubertia and
Pentalinon with members of Mesechiteae and rest of Echiteae form a stable clade with
0.98 PP (Figure 3.9). Monophyly and inter-generic relationships of Apocyneae are
also poorly supported (PP 0.84) and unsupported in parsimony tree. In Apocyneae
further two sub-clades appear, basal sub-clade is less supported (PP 0.72) in
comparison to sub-clade comprises of most evolved genera of Apocyneae (PP 1.0)
(Figure 3.9). In basal subclade relationship of Beamontia, Trachelospermum, Vallaris
and Sindechites receives well PP (1.0) value. Likewise in most evolved lineages of
Apocyneae, Aganosma, Epigynum and Ichnocarpus showing strong relationship (PP
1.0). Apocynum and Cleghornia form sister group of Apocyneae.
In Periplocoideae, the Bayesian analysis produced good inter-generic resolution as
compared to parsimony tree. Grooved translator bearing group form a well-supported
clade with 1.0 PP value and less supported by MP analysis (BP 70). Periploca
emerges as sister to rest of Periplocoids. The newly recognised tribe Baisseeae
(comprised of three genera Baissea, Oncinotis and Motandra by Livshultz, 2010) is
supported by 99 BP and 1.0 PP values with Dewevrella (African monotypic genus) as
its sister group. This clade forms a strongly supported sister to the milkweeds in the
Bayesian tree (PP 1.0) and is relatively less supported in the parsimony tree (BP 78).
Sister group of Asclepiadoideae, subfamily Secamonoideae receives strong support in
both analyses (BP 99; PP 1.0). However the genus Secamone (represented here by S.
Chapter 3
78
alpine and S. elliptica) is recovered here non-monophyletic. The Secamonoideae-
Asclepiadoideae clade receives strong support in both analyses (BP 100; PP 1.0). In
Asclepiadoideae the basal position of Fockeeae is confirmed here with 100 BP and 1.0
PP. Members of Ceropegieae form a well-supported clade (BP 99; PP 1.0) in
Asclepiadoideae. Of four subtribes of Ceropegieae members of three tribes
(Stapeliinae, Anisotominae and Leptadeniinae) are included in the present study.
Leptadeniinae emerges as sister group of Stapeliinae (BP 100; PP 1.0) and
Anisotominae (BP 88; PP 1.0) with good support in both MP and Bayesian trees (BP
99; PP 1.0).
The monophyly of Marsdenieae except Fockea receives strong support in the
Bayesian analysis (PP 0.99) as compared to MP (BP 78). Hoya, Dischidia and
Marsdenia form a strongly supported sub-clade in Bayesian tree (PP 1.0) while less
supported in MP analysis (BP 88). However the strong relationship of Hoya and
Dischidia is also noted in parsimony analysis with 100 BP value. Another sub-clade
comprised of Dregea, Wattakaka, Stephanotis, and Gymnema receive high support in
both analyses (BP 97; PP 1.0). Rhyssolobium in MP analysis (BP 78) appears as sister
to Marsdenieae while its position in Bayesian tree (PP 0.54) emerge with basal sub-
clade in Marsdenieae (PP 0.54). The close relationship between these tribes receives
strong support in the Bayesian tree (PP 1.0) while this relationship is not strongly
supported in MP (BP 53). Eustegia is recovered as sister to the Marsdenieae-
Ceropegieae clade (BP 53; PP 1.0).
The major clades in Asclepiadeae are strongly supported in the Bayesian analysis,
while resolution is relatively poor in the parsimony analysis. Subtribe Astephaninae:
here represented by genera Oncinema and Microloma is sister to rest of Asclepiadeae
(BP 71; PP 1.0). The ACT clade is not recovered here as a monophyletic group due to
the position of Cynanchineae (Figures 3.8 & 3.9). Asclepiadineae and Tylophorinae
form a well-supported clade (the AT clade) (PP 1.0) and this relationship is not
supported by parsimony analysis. The subtribe Asclepiadineae receives less support in
both analyses (BP 53; PP 0.89). The genus Oxystelma is recovered here as a sister
group (PP 1.0) of the AT clade.
Cynanchineae comprised of the Old World genus Cynanchum (here represented by C.
viminale, C. jacquemontianum and C. obtusifolium) forms a strongly supported clade
Chapter 3
79
(BP 100; PP 1.0) that is sister to the MOG clade (BP 84; PP1.0). The MOG clade,
containing taxa from the New World, receives strong support in the Bayesian tree (PP
1.0). Within MOG the Gonolobineae are monophyletic with 1.0 PP. Blepharodon
(Metastelmatinae) is weakly supported (PP 0.61) as sister to Funastrum
(Oxypetalinae) resulting in the Oxypetalinae being non-monophyletic. Blepharodon-
Funastrum comes out as sister to rest of Oxypetalinae. Within the Oxypetalinae,
Araujia, Philibertia and Oxypetalum form a well-supported clade in Bayesian tree (PP
1.0) and receive relatively less support in parsimony analysis (BP 85).
3.6 Phylogenetic analysis based on atpB gene promoter
In the phylogenetic trees based on trnL-F and PHYA regions, low resolution among
the groups in Rauvolfioideae was observed. In order to improve inter-generic
relationship in Rauvolfioideae, in addition to plastid region trnL-F and nuclear locus
PHYA, atpB gene promoter was sequenced from taxa of Rauvolfioideae. The
combined dataset comprised of 30 taxa and 3200 characters from three loci (trnL-F,
atpB gene promoter and PHYA). In MP analysis of total variable character 475 were
parsimony informative and produce parsimonious tree with 1836 tree length, 0.74 CI
and 0.64 RI. The subfamily is still recovered non-monophyletic (Figures 3.10 & 3.11).
Tabernaemontaneae appears with members of Vinceae with less PP (0.86) value as
compared to combined phylogenetic analysis of Apocynaceae. Incertae sedis genera
Rhazya and Amsonia also receive high PP (1.0) value with 100 BP support and does
not form clade with Hunterieae. The monophyly of Plumerieae is supported by 0.89
PP value and unsupported in parsimony tree. Sister position of Carisseae to APSA
clade receives 0.97 PP comparatively high to 0.91 in combined analysis of
Apocynaceae. Inter-generic relationship among the tribes is also not well-supported.
Overall support in both analyses (Bayesian and parsimony) to resolve groups in
Rauvolfioideae is found low. In comparison of combined phylogenetic analyses of
Apocynaceae with more number of taxa, here with more number of loci, the
relationships are not strongly supported in Rauvolfioideae.
Chapter 3
80
Figure 3.10 Parsimony tree generated by using molecular combined data set (trnL-F, atpB and PHYA). Asterisk (*) indicating incertae sedis taxa in Endress et al. (2007a) classification. BP values > 50 are shown below branches.
Chapter 3
81
Figure 3.11 Majority rule consensus tree based on the Bayesian analysis of the combined molecular data set. PP values are indicated above the branches. Values > 0.95 are considered as strong support, > 0.90 showing moderate support and < 0.90 with weak support. Asterisk (*) indicating incertae sedis taxa in Endress et al. (2007a) classification.
Chapter 4
82
Discussion
Endress and Bruyns (2000) recognised five subfamilies in Apocynaceae:
Asclepiadoideae, Secamonoideae, Periplocoideae, Apocynoideae and Rauvolfioideae.
With the introduction of modern cladistic analyses, systematists have endeavoured to
identify monophyletic groups for formal recognition in the classifications, and
modern classifications rely on both traditional taxonomic characters and molecular
data. To find the natural relationships among different groups of Apocynaceae, a
range of molecular based approaches have been used in various studies (Potgieter and
Albert, 2001; Rapini et al., 2003; Rapini et al., 2006; Livshultz et al., 2007; Simões et
al., 2007; Livshultz, 2010). From these studies, it is apparent that both subfamilies
Apocynoideae and Rauvolfioideae are paraphyletic. Moreover, instead of
Periplocoideae, Baisseeae of Apocynoideae have appeared as sister to the
Asclepiadoideae-Secamonoideae clade (Livshultz, 2010). In the present study, infra-
familial relationship among subfamilies, position of Periplocoideae in evolutionary
tree, inter-tribal relationships within the subfamilies are addressed with the help of
plastid and nuclear datasets based phylogenetic trees by using PAUPversion 4.0b10
(Swofford, 2002) and Mr. Bayes(Huelsenbeck and Ronquist, 2001) software.
4.1 Incongruence
Comparison of Bayesian and parsimony trees based on trnL-F and PHYA sequences
did not produced any moderately or well-supported incongruent clades, suggesting
that these two regions are not following variable phylogenetic histories. Otherwise
events such as hybridization, paralogy, lineage sorting, etc. can produce different
phylogenies’ for different data sets (Johnson and Soltis, 1998). Results in present
study correspond to the findings of Livshultz (2010). Simultaneous analysis of
combined data can increase cladistic parsimony than separate analyses as stated by
Nixon and Carpenter (1996)and same is appeared in present phylogenetic study.
Overall resolution produced by separate analyses (both Bayesian and parsimony) of
trnL-F and PHYA was lower than for simultaneous analysis. Moreover resolution
power among the groupshas seemed more in Bayesian trees in comparison to MP
analysis of all datasets. Here subfamilies are discussed separately using broader trnl-F
and combined trnL-F plus PHYA (combined) analyses.
Chapter 4
83
4.2 Asclepiadoideae
The subfamily is monophyletic here (Figures 3.2, 3.3, 3.4, 3.5, 3.8 & 3.9) distributed
all over the world with three main centres of generic diversity; tropical central and
South America, tropical Asia, eastern and southern Africa (Goyder, 2006). Currently,
four tribes are recognised in the subfamily: Fockeeae, Ceropegieae, Marsdenieae and
Asclepiadeae (Endress et al., 2007a; Table 4.1).
4.2.1 Fockeeae
TribeFockeeae (Kunze et al., 1994) are sister to the rest of the Asclepiadoideae as
reported in previous phylogenetic studies (Civeyrel et al., 1998; Fishbein, 2001;
Potgieter and Albert, 2001; Rapini et al., 2003; Livshultz et al., 2007; Livshultz,
2010). This placement of Fockeeae has received strong support in both parsimony and
Bayesian analyses (Figures 3.2, 3.3, 3.4, 3.5, 3.8 & 3.9). Fockeeae have pollinia with
tetrads and outer envelops (Kunze, 1996) and may be an intermediate stage between
Secamone and more specialised Asclepiadoideae (Endress and Bruyns, 2000).
Fockeeae share the character of two pollinia per anther with all Asclepiadoideae, in
contrast to the four pollinia found in Secamonoideae. The two genera of Fockeeae are
also differing from all other genera of Asclepiadoideae by the absence of well-
developed caudiculae, thereby linking the pollinia directly to the dorsal side of the
corpusculum. The corpusculum itself differs structurally from these found elsewhere
in the subfamily, with long undifferentiated flank, the lack of a floor connecting these
flanks in the lower part, and the presence of adhesive basal pads fixing the
corpusculum to the inner side of the anther wings (Kunz et al., 1994).
4.2.2 Ceropegieae
Stapelieae are presently known as Ceropegieae (Endress and Bruyns, 2000; Meve and
Liede, 2004) and mainly distributed in southern Africa, but genera are also found in
tropical Asia and Madagascar regions (Goyder, 2006). Meve and Liede (2004)
recognized four subtribes in Ceropegieae, i.e., Anisotominae, Heterostemminae,
Leptadeniinae and Stapeliinae. In our analyses Leptadeniinae comes out as sister to
rest of Ceropegieae whereas Anisotominae are sister to Stapeliinae. Both subtribes
(Anisotominae and Stapeliinae) have many morphological similarities (Meve, 1995;
Chapter 4
84
Table 4.1Phylogenetic position of genera in different groups of Asclepiadoideae in comparison to Rapini et al. (2003) and more recent classification by Endress et al. (2007a).
Genera Distribution Rapini et al. (2003) Endress et al. (2007a) Present Study
Araujia New World Asclepiadeae – Oxypetalinae Asclepiadeae – Oxypetalinae Asclepiadeae – Oxypetalinae Asclepias New World Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Aspidoglossum Old World Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Astephanus Old World Asclepiadeae – Astephaninae Asclepiadeae – Astephaninae Asclepiadeae – Astephaninae Barjonia New World Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Biondia Old World Asclepiadeae – Tylophorinae Asclepiadeae – Tylophorinae Asclepiadeae – Tylophorinae Blepharodon New World Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Boucerosia Old World Ceropegieae Ceropegieae – Stapeliinae Ceropegieae – Stapeliinae Calotropis Old World Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Caralluma Old World *** Ceropegieae – Stapeliinae Ceropegieae – Stapeliinae Ceropegia Old World Ceropegieae Ceropegieae – Stapeliinae Ceropegieae – Stapeliinae Cionura Old World Marsdenieae Marsdenieae Marsdenieae Cynanchum Old World Asclepiadeae – Cynanchinae Asclepiadeae – Cynanchinae Asclepiadeae – Cynanchinae Diplolepis New World Asclepiadeae – Oxypetalinae Asclepiadeae – incertae sedis Basal genera of MOG Diplostigma Old World Asclepiadeae – ACTG Asclepiadeae – Tylophorinae Asclepiadeae – Tylophorinae Dischidia Old World Marsdenieae Marsdenieae Marsdenieae Ditassa New World Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Dregea Old World Marsdenieae *** Marsdenieae Duvalia Old World *** Ceropegieae – Stapeliinae Ceropegieae – Stapeliinae Eustegia Old World Asclepiadeae – Eustegiinae Asclepiadeae – incertae sedis Asclepiadeae – incertae sedis Fockea Old World Fockeeae Fockeeae Fockeeae Folotsia* Old World Asclepiadeae – ACTG Asclepiadeae – Cynanchinae Asclepiadeae – Cynanchinae Funastrum New World Asclepiadeae – MOG Asclepiadeae – Oxypetalinae Asclepiadeae – MOG
Chapter 4
85
Glossonema Old World Asclepiadeae – ACTG Asclepiadeae – Cynanchinae Asclepiadeae – Cynanchinae Glossostelma Old World Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Gomphocarpus Old World Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Gonolobus New World Asclepiadeae – Gonolobinae Asclepiadeae – Gonolobinae Asclepiadeae – Gonolobinae Goydera Old World Asclepiadeae – ACTG Asclepiadeae – Tylophorinae Asclepiadeae – Tylophorinae Gymnema Old World *** Marsdenieae Marsdenieae Hemipogon New World Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Hoya Old World Marsdenieae Marsdenieae Marsdenieae Jobinia New World Asclepiadeae – MOG Asclepiadeae – Orthosiinae Asclepiadeae – Orthosiinae Kanahia Old World Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Karimbolea* Old World Asclepiadeae – ACTG Asclepiadeae – Cynanchinae Asclepiadeae – Cynanchinae Leptadenia Old World *** Asclepiadeae – Leptadeniinae Asclepiadeae – Leptadeniinae Margaretta Old World Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Marsdenia New World Marsdenieae Marsdenieae Marsdenieae Matelea New World Asclepiadeae – Gonolobinae Asclepiadeae – Gonolobinae Asclepiadeae – Gonolobinae Metalepis New World Asclepiadeae – Cynanchineae Asclepiadeae – Cynanchineae Asclepiadeae – Cynanchinae Metaplexis Old World Asclepiadeae – ACTG Asclepiadeae – Cynanchinae Asclepiadeae – Cynanchinae Metastelma New World Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Microloma Old World Asclepiadeae – Astephaninae Asclepiadeae – Astephaninae Asclepiadeae – Astephaninae Minaria New World Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Nautonia New World Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Neoschumannia Old World Ceropegieae Ceropegieae – Anisotominae Ceropegieae – Anisotominae Nephradenia New World Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Odontanthera Old World Asclepiadeae – ACTG Asclepiadeae – Cynanchinae Asclepiadeae – Cynanchinae Oncinema Old World Asclepiadeae – Astephaninae Asclepiadeae – Astephaninae Asclepiadeae – Astephaninae Orthosia New World Asclepiadeae – MOG Asclepiadeae – Orthosiinae Asclepiadeae – Orthosiinae
Chapter 4
86
Oxypetalum New World Asclepiadeae – Oxypetalinae Asclepiadeae – Oxypetalinae Asclepiadeae – Oxypetalinae Oxystelma Old World Asclepiadeae – ACTG Asclepiadeae – incertae sedis Unplaced in ACT Pachycarpus Old World Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Pentarrhinum Old World Asclepiadeae – ACTG Asclepiadeae – Cynanchinae Asclepiadeae – Cynanchinae Pentatropis Old World Asclepiadeae – ACTG Asclepiadeae – Tylophorinae Asclepiadeae – Tylophorinae Peplonia New World Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Pergularia Old World Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Philibertia New World Asclepiadeae – Oxypetalinae Asclepiadeae – Oxypetalinae Asclepiadeae – Oxypetalinae Platykeleba* Old World Asclepiadeae – ACTG Asclepiadeae – Cynanchinae Asclepiadeae – Cynanchinae Quaqua incarnata Old World Ceropegieae Ceropegieae – Stapeliinae Ceropegieae – Stapeliinae Rhyssolobium Old World Marsdenieae Marsdenieae Marsdenieae Sarcostemma* Old World Asclepiadeae – ACTG Asclepiadeae – Cynanchinae Asclepiadeae – Cynanchinae Schizostephanus Old World Asclepiadeae – ACTG Asclepiadeae – Cynanchinae Unplaced in ACT clade Schubertia New World Asclepiadeae – Gonolobinae Asclepiadeae – Gonolobinae Asclepiadeae – Gonolobinae Solenostemma Old World Asclepiadeae – ACTG Asclepiadeae – incertae sedis Unplaced in ACT Stapelia Old World Ceropegieae Ceropegieae – Stapeliinae Ceropegieae – Stapeliinae Stephanotis Old World Marsdenieae Marsdenieae Marsdenieae Stathmostelma Old World Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Stenostelma Old World Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Tassadia New World Asclepiadeae – MOG Asclepiadeae– Metastelmatinae Unplaced in MOG Telosma Old World Marsdenieae Marsdenieae Marsdenieae Tylophora Old World Asclepiadeae – ACTG Asclepiadeae – Tylophorinae Asclepiadeae – Tylophorinae Vincetoxicum Old World Asclepiadeae – ACTG Asclepiadeae – Tylophorinae Asclepiadeae – Tylophorinae Wattakaka Old World *** Marsdenieae Marsdenieae Xysmalobium Old World Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae
*Genera are now included in genus Cynanchum.***Taxa not present in the study.
Chapter 4
87
Meve and Liede, 2001a, b, 2004) which are considered as an effect of parallel
evolution in response to pollinator pressure (Meve and Liede, 1999, 2001a). Meve
and Liede (2004) delimited the subtribes by using anatomical characters and this
delimitation is confirmed by molecular data in the same study.
In Leptadeniinae, the closer relationship (Figures 3.8&3.9) of Leptadenia and
Orthanthera is supported by their geographic distribution, as both genera are covering
Africa and Asia. Another striking character is the presences of at least one species in
both genera with the erect non-branched shrubby growth form, while this feature is
not found in other Ceropegieae. In the present study, results are congruent to Meve
and Liede (2004) subtribal division of Ceropegieae.
4.2.3 Marsdenieae
The tribe is recovered here monophyletic with strong support in Bayesian analysis
oftrnL-F and combined datasets. Inter-generic relationships are also well-supported
here, the closer relation of Hoya and Dischidia receives high support and this
association has previously been supported byPotgieter and Albert (2001), Livshultz
(2002, 2003),Rapini et al. (2003), Meve and Liede (2004) and Wanntorp et al.
(2006a, b). Another well-supported subclade in Marsdenieae is comprised of Dregea,
Gymnema, Stephanotis and Wattakaka. However, the position of Rhyssolobium
seems unclear in both analyses of combined datasets (Figures3.8 & 3.9). In the
Bayesian analysis this genus is sister to the subclade that is sister to the rest, whereas
with MP it is sister to other members of Marsdenieae; in both analyses, the position of
this genus is poorly supported. This result is congruent with Meve and Liede (2004)
and Wanntorp et al. (2006a).
Monophyly of Ceropegieae-Marsdenieae (which possess erect pollinia, regarded as a
primitive condition in Asclepiadoideae;Kunz, 1993) is well-supported in Bayesian
trees based on of trnL-F and combined datasets (Figures3.3 &3.9). So here
monophyly of both tribes receives signals from trnL-F region whereas PHYA
sequences generate less support (see figures 3.4 & 3.5). In earlier studies (Orbigny,
1843; Decaisne, 1844) Ceropegieae and Marsdenieae sensu Endress and Bruyns
(2000) were regarded as single entity. However Endress and Bruyns (2000) treated
Marsdenieae and Ceropegieae as two tribes, due to the lack of hyaline insertion crest
Chapter 4
88
on outer surface of pollinium and absence of an outer corona and milky latex in
former (Bruyns and Forster, 1991; Omlor, 1998; Meve and Liede, 2004). However,
Swarupanandan et al. (1996) again united these two tribes, and this idea was later
supported by molecular phylogenetic analyses (Potgieter and Albert, 2001; Rapini et
al., 2003; Meve and Liede, 2004 and in the present study).
The monotypic South African genus Eustegia of Asclepiadeae with pendant pollinia
appeared as sister to Marsdenieae-Ceropegieae clade. This sister position of the genus
has been noticed in previous phylogenetic studies based on plastid markers (Liede,
2001: Rapini et al., 2003; Meve and Liede, 2004; Goyder et al., 2007). Odd position
of the genus is making subtribe Asclepiadeae non-monophyletic. The genus is treated
in a separate tribe Eustegiinae by Rapini et al. (2003) but recent classification Endress
et al. (2007a)the genus is regarded as incertaesedis in Asclepiadoideae (Table 4.1).
4.2.4 Asclepiadeae
The largest tribe of Asclepiadoideae is not monophyletic due to odd position of
Eustegia which forms stable clade with Marsdenieae and Ceropegieae. Higher levels
of inter-generic resolution in Asclepiadeae are recovered in the Bayesian analysis as
compared to parsimony (Figures3.2, 3.3, 3.4, 3.5, 3.8 & 3.9). Presently eight subtribes
are recognised in Asclepiadeae: Astephaninae, Asclepiadinae, Tylophorinae,
Cynanchinae, Metastelmatinae, Orthosiinae, Oxypetalinae and Gonolobinae (Endress
et al., 2007a). In a broad overview of Apocynaceae conducted by Rapini et al. (2003),
three main clades were defined — Astephaninae comprising of only three genera
Astephanus, Microloma and OncinemasensuLiede (2001), the ACTG and MOG
clades. In present phylogenetic trees, Astephaninae are well-supported as sister to
other subtribes of Asclepiadeae, a result similar to previous morphological and
molecular studies (Liede and Albert, 1994; Liede, 1997; Liede and Taüber, 2002;
Rapini et al., 2003).
4.2.5 Asclepiadeae – ACT group
Asclepiadineae, Cynanchineae and Tylophorinae are component subtribes of ACT
group. In trnL-F analyses, large number of taxa is included in ACT group (Figures3.2
& 3.3) while sampling in this group is relatively low in combined trnL-F and PHYA
Chapter 4
89
analyses (Figures3.8 & 3.9). Cynanchineae appear in two separate clades in trnL-F
analyses, the Malagasy clade is comprised of leafless stem succulent taxa and the
leafy Cynanchumobovatum. The monophyly of Malagasy group supports the earlier
inclusion of other genera (Folotsia, Karimbolea, Platykeleba and Sarcostemma) in
Cynanchum by Liede and Kunze (2002) based on triterpenoid analysis, stem anatomy
and molecular characters. New World Cynanchineae form a clade with Glossonema
and Odonthanthera (Figures 3.2 & 3.3) and this is congruent to previous studies
(Liede and Taüber, 2002; Rapini et al., 2003). The position of the Asian taxa
Metalepisalbiflora embedded in American Cynanchum indicates that it should be
placed in Cynanchum, but had no support previously from morphological and
chemical data (Liede and Kunze, 2002).
The Asian C.jacquemontianum is another problematic taxon because in both the MP
and Bayesian analyses of trnL-F region it is not sister to the rest of the Cynanchum
species. The Mediterranean C. acutum, the type species of the genus, appears with the
unplaced genera Solenostemma and Oxystelma, not with either of the two principal
Cynanchum clades (Figures 3.2 & 3.3). Although Cynanchineae are circumscribed
broadly (Liede, 1997; Liede and Kunze, 2002; Liede and Taüber, 2002; Rapini et al.,
2003), but this subtribe is still unresolved in ACT clade (Rapini et al., 2003) of
Asclepiadeae. In present combined analyses Cynanchineae comprised of only Old
World taxa (Cynanchum viminale, C. jacquemontianum and C. obtusifolium) appears
as a sister group of the MOG clade (members from the New World) (Figures3.8 &
3.9). Here these results can be contrasted with Rapini et al. (2003) and present trnL-F
analyses where Cynanchinae is embedded in the ACT clade (but without support).
Monophyly of Tylophorinae is well-supported (trnL-F analyses) and these results
strengthen the proposal for Tylophorinae to be recognised as a subtribe (Liede, 2001;
Rapini et al., 2003). But the subtribe is weakly supported as sister to Cynanchineae. In
our study only two species of Tylophora (T. flexuosa and T. hirsuta) are included, but
they appear in different sub-clades. A close association between T. hirsuta and
Vincetoxicum hirundinaria is in agreement with Liede et al. (2002); temperate species
are included in Vincetoxicum, and only tropical species should be in Tylophora. An
alternative would be to broaden the circumscription of Vincetoxicum.
Chapter 4
90
Asclepiadineae are monophyletic (Figures 3.2, 3.3, 3.8 & 3.9) and Pergularia
emerges as sister to the rest of Asclepiadinae, as found in previous studies (Liede and
Albert, 1994; Rapini et al., 2003; Goyder et al., 2007). New World Asclepias forms a
moderately supported clade (Figures 3.2, 3.3), whereas Old World A. alpestris
(synonym Schizoglossumalpestre K. Schum.) appears with other African genera in
Asclepiadineae. There is only weak support along the spine of the Asclepiadinae
clade, and current generic limitation is unsatisfactory, as illustrated by Goyder et al.
(2007). The sister group relationship and uncertain position of Oxystelma and
Solenostemma has also been observed in previous analyses (Rapini et al., 2003),
whereas in older works (e.g. Schumann, 1895) both these genera were placed in
Glossonematinae.
Oxystelmais among the incertae sedis of Asclepiadoideae (Liede and Taüber
2000;Endress et al., 2007a), previously Liede (1997) included it in Metastelmatinae.
In subsequent molecular phylogenetic analyses (e.g., Potgieter and Albert, 2001;
Liede and Taüber, 2002; Liede et al., 2002; Rapini et al., 2003) the genus failed to
form a clade with members of Metastelmatinae. Instead, this genus occupied a
position sister to the rest of the ACT clade, as also observed here; however, in
previous molecular phylogenetic analyses using plastid loci this close relationship was
not well-supported. In combined trnL-F and PHYA analyses, Asclepiadineae and
Tylophorinae (represented here by Tylophorahirsuta)form a well-supported clade (AT
clade) with strong support in both Bayesian and parsimony analyses with Oxystelma
as sister to rest of AT clade (Figures3.8 & 3.9). While in trnL-F analyses and in
analyses by Rapini et al. (2003) this clade is not appeared rather Cynanchineae is
embedded in Asclepiadineae and Tylophorinae. Position of Cynanchineae with
MOG’s subtribes could be reasoned by less number of included taxa in combined
trnL-F and PHYA analyses.
4.2.6 Asclepiadeae – MOG group
The New World MOG clade has been widely assessed in various molecular
phylogenetic studies (Rapini et al., 2003, 2006; Liede-Schumann et al., 2005). The
previous studies in addition to our results (Figures 3.2, 3.3, 3.8 & 3.9) have revealed
that in spite of significant variation (Liede-Schumann et al., 2005) in morphological
characters, MOG (Rapini et al., 2003) and the recently proposed Orthosiinae are
Chapter 4
91
grouped together with high support. In trnL-F analyses, the embedded position of
Gonolobinae in the Oxypetalinae clade is poorly supported. This uncertain position of
the subtribe was also reported by Rapini et al. (2003). While in combined analyses
Gonolobinae appear as sister to rest of MOG with strong support (Figures 3.8 & 3.9).
The subtribe Oxypetalinae is not monophyletic in all analyses (Figures 3.2, 3.3, 3.8 &
3.9) and these results are incongruent to Rapini et al. (2003, 2006) and Liede-
Schumann et al. (2005). Blepharodon lineare and Funastrumclausum were resolved
taxa in the study of Rapini et al. (2006) and appeared as sister to Metastelmatinae and
Oxypetalinae, respectively and also confirmed in present trnL-F analyses (Figures3.2
& 3.3). According to Liede (1997) F.clausum was previously included in
Metastelmatinae on the basis of morphological characters, but in the most recent
classification (Endress et al., 2007a) and also various molecular studies (Liede-
Schumannet al., 2005; Rapini et al., 2006) it is placed in Oxypetalinae. However, in
the combined analyses the relationship between B. lineare and F.clausum is unclear,
but their sister-group position to the rest of Oxypetalinae is well-supported
(Figures3.8 & 3.9). In the present study, Oxypetalum is sister to Araujia-Philbertia,
similar to the result of Rapini et al. (2006). However, in earlier studies (with less data)
a close relationship between Philbertia and Blepharodon (Liede and Taüber, 2000) or
Philbertia and Funastrum (Rapini et al., 2003) was observed. The genus Philibertia
was previously been included in Metastelmatinae but Goyder (2004) recognizes its
relationship, on the basis of morphological features, to members of the Oxypetalinae.
Metastelmatinae are broadly circumscribed in trnL-F analyses and receive strong
support in Bayesian tree (Figure 3.3). Ditassa is still recovered here polyphyletic as
observed by Rapini et al. (2006). As most of the Ditassa species are transferred in
genus Minaria, which is monophyletic in this study (Figure 3.3). Some genera are
found to be non-monophyletic (like Blepharodon and Ditassa in figures 3.2 and 3.3)
and promoting generic realignment in New World Asclepiadeae.
4.3 Secamonoideae
Subfamily Secamonoideae comprisesof eight genera (Calyptranthera, Genianthus,
Goniostemma, Pervillaea, Secamone, Secamonopsis,Toxocarpus andTrichosandra)
and is placed near Asclepiadoideae and Periplocoideae (Klackenberg, 1992a,
Chapter 4
92
b;Endress and Bruyns, 2000; Venter and Verhoeven, 2001; Ionta and Judd, 2007;
Lahaye et al., 2007).To date, cladistic analyses based on molecular data have all
agreed that Secamonoideae are sister to Asclepiadoideae(Sennblad and Bremer,
1996,2000, 2002;Civeyrel et al., 1998; Civeyrel and Rowe, 2001; Fishbein, 2001;
Potgieter and Albert, 2001; Lahaye et al., 2005, 2007; Livshultz et al., 2007). In our
study, this clade (Secamonoideae-Asclepiadoideae) receives strong support in both
Bayesian and parsimony analyses. Although not broadly sampled here, the included
taxa confirm monophyly of Secamonoideae with high support. Secamone is not
recovered in figures 3.8 & 3.9 as monophyletic, which is congruent with the results of
Lahaye et al. (2007).
4.4 Periplocoideae
In combined trnL-F and PHYA analyses (Bayesian and MP), the position of
Periplocoideae in Apocynoideae differs from recent analyses of Livshultz (2010).
However, nested position of Periplocoideae in Apocynoideae has been observed in
other previous studies (Sennbladand Bremer, 2000; Potgieter and Albert, 2001;
Livshultz et al., 2007; Livshultz, 2010). Periplocoideae were recognized until the last
decades of the 20th century as members of Asclepiadaceae (Schlechter, 1914; Kunze,
1990, 1993; Venter et al., 1990; Dave and Kuriachen, 1991; Liede and Kunze, 1993;
Nilsson et al., 1993; Swarupanandan et al., 1996). On the basis of floral morphology,
the subfamily is regarded as an intermediate stage in a transition series between
characters typical of Apocynoideae and those of milkweeds (Demeter,1922; Safwat,
1962; Cronquist, 1981; Rosatti, 1989;Endress, 1994, 2001, 2004; Endress and Bruyns,
2000;Wyatt et al., 2000). Apocynum has pollen in tetrads with simple translators,
which is frequently considered to be the first stage in this series (Demeter, 1922;
Safwat, 1962; Nilsson et al., 1993 and also cited by Livshultz et al., 2007). This is
followed by pollen in tetrads with spoon-shaped translators in some Periplocoideae
and then further aggregation leading to a pollinial stage in Periplocoideae (Nilsson et
al., 1993; Verhoeven and Venter, 1998; Livshultz et al., 2007). Therefore,
Periplocoideae as sister to the milkweeds is a common concept in the literature, but
results of phylogenetic analyses have shown that Periplocoideae are more closely
related to Apocynaceae sensu stricto; instead, Baisseeae are the sister of the
milkweeds (Kunze, 1996; Judd et al., 1994; Struwe et al., 1994; Sennblad andBremer,
Chapter 4
93
1996; Endress, 1997; Sennblad, 1997; Potgieter and Albert, 2001; Sennblad and
Bremer, 2002; Livshultz et al., 2007).
In present study, Periplocoideae are well-supported as observed in Livshultz et al.
(2007) and Livshultz (2010). The grooved translator clade described by Ionta and
Judd (2007) is also well-supported here (Figures3.8 & 3.9). These data show
Periploca (the type genus of subfamily Periplocoideae) is sister to the rest of the
subfamily, which can be contrasted with the findings of Ionta and Judd (2007), in
which Phyllanthera is sister to the rest of Periplocoideae. Note that Phyllanthera is
sister to Petopentia with this data.
Periplocoideae is one of the unique subfamily among subfamilies of Apocynaceae,
having taxa with or without pollinia. In the present study Finlaysonia, Gymnanthera,
Hemidesmus are Asian pollinial Periplocoids and Schlechterella is African pollinial
genus form clades independent of pollinial origin. So these results are corresponding
to Venter and Verhoeven (1997, 2001) findings that pollinia in Periplocoideae
evolved polyphyletically and independently.
4.5 Apocynoideae
In recent classification by Endress et al. (2007a), eight tribes were recognised in the
subfamily: Apocyneae, Baisseeae, Echiteae, Malouetieae, Mesechiteae, Nerieae,
Odontadenieae and Wrightieae. Subfamily is non-monophyletic as observed in
various molecular based approaches (Potgieter and Albert, 2001; Rapini et al., 2003;
Rapini et al., 2006; Livshultz et al., 2007; Simões et al., 2007; Livshultz, 2010).
Apocynoideae is discussed (Table 4.2) in comparison to Endress and Bruyns (2000)
and Livshultz et al. (2007).
4.5.1 APSA clade
In the present study, APSA clade is highly supportedin phylogenetic trees (Figures
3.2, 3.3, 3.10 & 3.11) based on plastids markers (trnL-F and atpB) in comparison to
PHYA
Chapter 4
94
Table 4.2Phylogenetic position of taxa in Apocynoideae, in comparison with Endress and Bruyns (2000) classification and Livshultz et al. (2007) study.
Genera Distribution Endress and Bruyns (2000) Livshultz et al. (2007) Present study
Adenium Old World Wrightieae Nerium clade Nerieae Aganosma Old World Apocyneae Apocyneae Apocyneae Angadenia New World Echiteae Echiteae Echiteae Anodendron Old World Apocyneae Apocyneae Apocyneae Apocynum Old World Apocyneae Apocyneae Apocyneae Artia New World Echiteae Echiteae Echiteae Baissea Old World Apocyneae Baisseeae Baisseeae Beaumontia Old World Apocyneae Apocyneae Apocyneae Chonemorpha Old World Apocyneae Apocyneae Apocyneae Cleghornia Old World Apocyneae Apocyneae Apocyneae Cycladenia New World Echiteae New World clade Odontadenieae Dewevrella Old World Apocyneae Baisseeae clade Baisseeae clade Echites New World Echiteae Echiteae Echiteae Elytropus New World Apocyneae New World clade Odontadenieae Epigynum Old World Apocyneae Apocyneae Apocyneae Fernaldia New World Echiteae *** Echiteae Forsteronia New World Apocyneae Mesechiteae Mesechiteae Ichnocarpus Old World Apocyneae Apocyneae Apocyneae Kibatalia Old World Malouetiea *** Malouetiea Laubertia New World Echiteae Echiteae Echiteae Mandevilla New World Mesechiteae Mesechiteae Mesechiteae Motandra Old World Apocyneae Baisseeae Baisseeae
Chapter 4
95
Nerium Old World Wrightieae Nerium clade Nerieae Odontadenia New World Apocyneae New World clade Odontadenieae Oncinotis Old World Apocyneae Baisseeae Baisseeae Pachypodium Old World Malouetiea Malouetiea Malouetiea Papuechites Old World Apocyneae Apocyneae Apocyneae Parameria Old World Apocyneae Apocyneae Apocyneae Parsonsia New World Echiteae Echiteae Echiteae Peltastes New World Echiteae Echiteae Echiteae Pentalinon New World Echiteae Echiteae Echiteae Pinochia New World *** Odontadenieae Odontadenieae Pleioceras Old World Wrightieae Wrightieae Wrightieae Prestonia New World Echiteae Echiteae Echiteae Rhabdadenia New World Echiteae Unplaced in APSA Unplaced in APSA Rhodocalyx New World *** Echiteae Echiteae Secondatia New World Mesechiteae New World clade Odontadenieae Sindechites Old World Apocyneae Apocyneae Apocyneae Stipecoma New World Echiteae Odontadenieae Echiteae Temnadenia New World Echiteae Echiteae Echiteae Thyrsanthella New World *** Odontadenieae Odontadenieae Trachelospermum Old World Apocyneae *** Apocyneae Urceola Old World Apocyneae Apocyneae Apocyneae Vallaris Old World Apocyneae Apocyneae Apocyneae *** Taxa not present in the study.
Chapter 4
96
analyses. So, in the combined analyses the well-supported clade (Figures 3.8 & 3.9)
receives signals from trnL-F region. Wrighteae occupies the basal position of the
APSA clade as was the case in other phylogenetic analyses of Apocynaceae
(Sennblad and Bremer, 1996, 2002; Sennblad et al., 1998; Potgieter and Albert, 2001;
Livshultz et al., 2007; Livshultz, 2010). Synapomorphies such as gynostegium,
lignified anthers, porate pollen and comose seed have been identified in previous
studies for this clade (Judd et al., 1994; Sennblad and Bremer, 1996; Potgieter and
Albert, 2001; Livshultz et al., 2007). Monophyly of APSA receives high support in
both Bayesian and MP trees as observed in analyses of Livshultz et al. (2007) and
Livshultz (2010). Wrighteae is different from rest of APSA (Except Parameria and
Toxocarpus) due to presence sinistrorse aestivationof corollas (Livshultz et al., 2007).
Another variable character pointed by Livshultz et al. (2007) is micropylar coma, the
most frequent state in APSA except Wrighteae and Malouetia, Kibatalia and
Funtumia.
4.5.2 Nerieae
The tribe is represented here by two genera, Nerium and Adenium and is resolved
monophyletic with strong support in both trnL-F and combined Bayesian analyses
(Figures 3.3& 3.9). However, this clade receives less support in strict consensus trees
(Figures 3.2& 3.8). In previous phylogenetic studies (Sennblad et al., 1998; Potgieter
and Albert, 2001; Sennblad and Bremer, 2002) with more number of taxa the
monophyly of tribe got weak support. Livshultz et al. (2007) identified diagnostic
characters for Nerieae: dextrorsely contorted corolla, micropylar coma and absence of
nectary around the ovary. The closer relationship of Nerium and Adenium is also
based on similar floral morphology, predominantly their long pubescent anther
connectives (Pagen, 1987).
4.5.3 Malouetieae
A strongly supported clade termed as the ‘crown clade’ (including subfamilies
Asclepiadoideae, Secamonoideae, Periplocoideae and tribes Echiteae, Mesechiteae,
Odontadenieae and Apocyneae of Apocynoideae) by Livshultz et al. (2007) received
less support (Figures 3.8& 3.9) as compared to Livshultz et al. (2007) and Livshultz
(2010). However, the moderately supported sister group relationship of Malouetieae
Chapter 4
97
with the crown clade, as illustrated in recent studies (Livshultz et al. 2007; Livshultz
2010), is also confirmed in our analyses.
The presence of a calcium oxalate pocket in anther stomium and absence of vertical
ridges on the style head are considered synapomorphies for this tribe (Sennblad et al.,
1998). Livshultz et al. (2007) identified characters (such as presence of nectary and
self supporting growth form) in this tribe that are similar to the taxa of the crown
clade. Despite their differing geographic distributions, both genera of Malouetieae,
Kibatalia (New World) and Pachypodium (Old World), form a strongly supported
clade. Pachypodium has traditionally been included in Echiteae (Pichon, 1950b), but
Endress and Bruyns (2000) transferred this genus into Malouetieae, and this change
was supported by Livshultz et al. (2007) and our study.
4.5.4 Odontadenieae
One of the New World tribe of Apocynoideae is not well-supported here (Figures
3.8&3.9) as found in Livshultz et al. (2007) and Livshultz (2010). Genera of the tribe
were previously placed in Apocyneae, Mesechiteae (Pichon 1950b) and Echiteae
(Leeuwenberg, 1994). In the most recent classification (Endress et al., 2007a)
Odontadenieae are given a separate tribal position in Apocynoideae. In our study
Odontadenieae do not form clade with either of New World tribes (Echiteae and
Mesechiteae) of Apocynoideae contradicting Livshultz et al. (2007) where New
World tribes form a separate clade.
4.5.5 Mesechiteae
The tribe is represented by two genera (Forsteronia and Mandevilla) is strongly
supported in Bayesian tree (Figure 3.9). Leeuwenberg (1994) placed Forsteroniain
Apocyneae, which was later supported by elaborate study of Endress and Bruyns
(2000). The genus Forsteronia was examined in detailed by Simões et al. (2004) on
the basis of floral morphological and molecular characters. This study illustrated that
Forsteronia is more closely related to genera of Mesechiteae rather Apocyneae and
this was also confirmed by Livshultz et al. (2007), Livshultz (2010) and in the present
study.
Chapter 4
98
4.5.6 Echiteae
A well-supported basal subclade Angadenia, Laubertia and Pentalinon (Figure 3.9)
shows a weak relationship to Mesechiteae while rest of Echiteae form a well
supported clade. Inter-generic relationship is well-resolved here but monophyly of
Echiteae is suspected due to odd position of Rhabdadenia. Results are much
congruent to recent phylogenetic studies by Livshultz et al. (2007) and Livshultz
(2010).
New World Apocynoideae is not resolved in a clade, result here congruent to previous
findings(Sennblad et al., 1998; Potgieter and Albert, 2001; Sennblad and Bremer,
2002). But in the studies of Simões et al. (2004) and Livshultzet al. (2007) New
World Apocynoideae form a weakly supported clade.
4.5.7 Apocyneae
Old World Apocyneae form a well-supported clade with the New World tribes
(Odontadenieae, Echiteae and Mesechiteae) of Apocynoideae in both Bayesian and
parsimony analyses of combined trnL-F and PHYA sequences. In a recent
phylogenetic analysis (Livshultz, 2010), this clade received less support: BP 68
compared to BP 100/ PP 1.0 here (Figures 3.8& 3.9). The monophyly of Apocyneae is
not supported by the MP analysis as compared to 100 BP in Livshultz (2010), but in
the Bayesian tree it receives low support (Figures 3.8&3.9).
The topology in Apocyneae is somewhat inconsistent with that in Livshultz (2010),
only by adding Trachelospermum; a basal clade (PP 0.72) emerges comprising of
Beaumontia, Trachelospermum, Vallaris, Sindechites,Papuechites and Anodendron.
In previous phylogenetic studies (Potgieter and Albert, 2001; Sennblad and Bremer,
2002; Simõeset al., 2004) Beaumontia andTrachelospermum form a clade with
Chonemorpha, but here Chonemorpha is sister to Urceola (Figures. 3.8 & 3.9).
4.5.8 Baisseeae
Livshultz (2010) defined a new tribe Baisseeae comprising three African genera:
Baissea, Oncinotis and Motandra and stated that the tribe is sister to the milkweeds
rather than subfamily Periplocoideae. This relationship was originally suggested by
Chapter 4
99
Macfarlane (1933) on the basis of their geography. In previous phylogenetic analyses,
this relationship has frequently been noted, but with weak support (Sennblad et al.,
1998; Potgieter and Albert, 2001; Sennblad and Bremer, 2002) and more recently
with stronger support (Lahaye et al., 2007; Livshultz et al., 2007; Simões et al.,
2007). In our analysis this sister relationship of Baisseeae receives strong support in
the Bayesian analysis (Figure 3.9) and comparatively weak bootstrap support in MP
analysis (Figure 3.8).
Formerly, Pichon (1950b) placed these three genera in subtribe Baisseinae of
Mesechiteae sensu Pichon based on having glabrous facets retinacles and presences of
colleters on the leaves. Later, Nilsson et al. (1993) concluded that the retinacle in
Baissea is formed by agglutination of trichomes and this is also confirmed by
Livshultz et al. (2007). Baisseeae’s morphological characters such as short stamen-
corolla tube, half inferior ovaries and collarless style-head have frequently been
observed in traditional Asclepiadaceae and Asian taxa of Apocyneae (Leeuwenberg,
1994; Endress and Bruyns, 2000; Livshultz et al., 2007).
In the classification of Endress and Bruyns (2000), Baissea and Motandra are
grouped with Prestonia and Cycladenia on the basis of corona characters (particularly
finger-like projections above the stamens). In molecular phylogenetic analyses
Prestonia forms a group with the ‘core Echiteae’, and Baissea and Motandra form a
separate clade (Baisseeae; Livshultz, 2010). Recently, Livshultz et al. (2007)
identified these genera as having colleters on the adaxial surface of their petiole
(rarely extending onto the base). However, this character is shared by Farquharia
(Malouetieae), Isonema and Nerium (Nerieae). Therefore, morphologically, the
African clade still needs additional characters to justify its separate tribal identity as
the sister group of the milkweeds.
Monotypic genus Dewevrella formerly included in Apocyneae (Endress and Bruyns,
2000; Endress et al., 2007a). While in the study of Livshultz et al. (2007) the genus
appears with member of Baisseeae and receives same position in the present analyses.
4.6 Rauvolfioideae
Chapter 4
100
The structure of phylogenetic trees based on combined molecular data (Figures 3.8,
3.9, 3.10&3.11) is broadly congruent with previously published data of Apocynaceae
(e.g., Civeyrel et al., 1998; Potgieter and Albert, 2001; Sennblad and Bremer, 2002;
Simões et al., 2004). The basal subfamily is forming a grade that is paraphyletic to the
rest of Apocynaceae. Rauvolfioideae is not widely studied for phylogenetic studies,
however recently Simõeset al. (2004, 2007) paid attention toward phylogeny of
subfamily by using sequences from regions of plastid genome. In addition to trnL-F
alone and combined analyses (trnL-F and PHYA), relationships in Rauvolfioideae are
also discussed on the basis of trees constructed by using sequences of trnL-F, PHYA
and atpB gene promoter in combined dataset (Table 4.3).
4.6.1 Alstonieae and Aspidospermeae
In trnL-F study, two clades form the earliest diverging lineages and represent the
separation of the New World tribe Aspidospermeae and Old World tribe Alstonieae,
which corresponds with the findings of Potgieter and Albert (2001) and Simões et al.
(2007). Aspidospermeae (comprising just Aspidosperma and Vallesia) and Alstonieae
(Alstonia alone in our survey) form successive sister groups of the rest of the family.
Similar results were found in the studies of Endress and Bruyns (2000), Sennblad and
Bremer (2002), and recent studies based on molecular and morphological data by
Simões et al. (2007), which were incorporated into the revised classification of
Endress et al. (2007a) (Figures 3.2& 3.3).
4.6.2 Alyxieae
The positions of tribe Alyxieaeis unresolved in both our MP and Bayesian trees of
trnL-F analyses (Figures 3.2& 3.3). Chilocarpus and Condylocarpon of Alyxieae
appeared in the Amsonia clade of Simõeset al. (2007) with weak support. The genus
Pteralyxia appeared in the Alyxieae clade, which differs from the results of Potgieter
and Albert (2001), in which these taxa appeared in the Plumerieae clade, but is
consistent with the results of Livshultz et al. (2007), Endress et al. (2007b) and the
revised classification of Endress et al. (2007a).
4.6.3 Vinceae
Chapter 4
101
Table 4.3 Comparative overview of phylogenetic positionsof Rauvolfioideae’s taxa within present phylogenetic analyses and previousclassifications (Endress and Bruyns, 2000; Endress et al., 2007a).
Genera Distribution Endress and Bruyns (2000) Endress et al. (2007a) This Study
Acokanthera Old World Carisseae Carisseae Carisseae Allamanda New World Plumerieae Plumerieae Plumerieae Alstonia Old World Alstonieae Alstonieae Alstonieae Alyxia Old World Alyxieae Alyxieae Alyxieae clade Amsonia Old World Vinceae Amsonia clade Amsonia clade Anechites New World Plumerieae Plumerieae Plumerieae Aspidosperma New World Alstonieae Aspidospermeae Aspidospermeae Carissa Old World Carisseae Carisseae Carisseae Catharanthus Old World Vinceae Vinceae Vinceae Chilocarpus Old World Alyxieae Alyxieae Unresolved Alyxieae Condylocarpon Old World Alyxieae Alyxieae Unresolved Alyxieae Craspidospermum Old World Melodineae Melodineae Melodineae Gonioma Old World Melodineae Hunterieae Hunterieae Kopsia Old World Vinceae Vinceae Vinceae Lepiniopsis Old World Alyxieae Alyxieae Alyxieae clade Molongum New World Tabernaemontaneae Tabernaemontaneae Tabernaemontaneae Ochrosia Old World Vinceae Vinceae Vinceae Petchia Old World Vinceae Vinceae Vinceae Plectaneia Old World Alyxieae Alyxieae Alyxieae clade Plumeria New World Plumerieae Plumerieae Plumerieae Pteralyxia Old World Alyxieae Alyxieae Alyxieae clad Rauvolfia Old World Vinceae Vinceae Vinceae Rhazya Old World *** *** Unplaced Vinceae
Chapter 4
102
Skytanthus New World Plumerieae Plumerieae Plumerieae Tabernaemontana New World Tabernaemontaneae Tabernaemontaneae Tabernaemontaneae Thevetia New World Plumerieae Plumerieae Plumerieae Vallesia New World Alstonieae Aspidospermeae Aspidospermeae Vinca Old World Vinceae Vinceae Vinceae
***Taxa not present in the study
Chapter 4
103
Vinceae is not resolved as monophyletic group incongruent to Simõeset al. (2007).
The separate position of Amsonia and Rhazya from the rest of Vinceae is in agreement
with earlier DNA based studies (Potgieter and Albert, 2001; Endress et al., 2007b;
Simões et al., 2007). A floral study conducted by Endress et al. (2007b) on Amsonia
and Rhazya suggested that these two genera are more similar to Catharanthus and
Vinca, but results place the former pair with Hunterieae. Endress and Bruyns (2000)
treated Rhazya as a synonym of Amsonia on the basis of similar fruits, seeds and
floral morphology (Pichon, 1949; Nilsson, 1986), and this relationship is also strongly
supported in the present study. However, Endress et al. (2007a) segregated both
genera from the Vinceae and placed them as incertaesedis within Rauvolfioideae. The
Vinceae clade comprises Rauvolfia, Catharanthus, Vinca, Ochrosia (including the
species formerly in Neisosperma), Petchia and Kopsia. Position of Asian genus
Kopsia in Vinceae (Simões et al., 2007) is not well-supported here. The genus shared
a number of morphological characters to Vinceae such as a pair of well-developed
nectary lobes and style-head has a short membranous basal collar, otherwise these
characters are relatively absent in the rest of Rauvolfioideae (Middleton, 2004a, b).
Chemotaxonomic (Kisakürek et al., 1983; Homberger and Hesse, 1984) and
morphological studies prompted Endress and Bruyns (2000) to include the genus in
Vinceae, however this inclusion was later supported by Simõeset al. (2007) and
present study.
4.6.4 Plumerieae
As in Simões et al., (2007), monophyly of Plumerieae did not receive strong support
in our analyses. In trnL-F analysis (Figure 3.3) Thevetia is paraphyletic while in
combined analyses it appears with Skytanthus corresponding to results of Simõeset al.
(2007).
4.6.5 Tabernaemontaneae
Tabernaemontaneae are not strongly supported in previous studies (Endress and
Bruyns, 2000; Sennblad and Bremer, 2002; Potgieter and Albert, 2001) however
received strong support in recent studies by Simões et al. (2007, 2010). However the
inclusion of Molongum in Tabernaemontaneae (Sennblad and Bremer, 2002) receives
strong support in both MP (Figure 3.2) and Baysian analyses (Figure 3.3). The
Chapter 4
104
detailed molecular and morphological study of Tabernaemontaneae by Simões et al.
(2010) using three plastid loci (but not trnL-F) confirmed this. In all analyses (Figures
3.2, 3.3, 3.8, 3.9, 3.10 & 3.11), Tabernaemontaneae shows relationship with members
of Vinceae.
4.6.6 Melodineae
The presence of Craspidospermum in tribe Melodineae (Endress and Bruyns, 2000) is
well-supported in previous analyses (Sennblad and Bremer, 2002; Potgieter and
Albert, 2001). Here the genus receives low support (Figure 3.3) as sister to the major
clade including that of Amsonia, Tabernaemontana and Vinceae. In
Craspidospermum, porate pollen is shed as pantoporate tetrads (Lienau et al., 1986).
This syndrome is unknown in Rauvolfioideae but resembles pollen of some
Periplocoideae (Nilsson et al., 1993).
4.6.7 Carisseae
Tribe Carisseae, comprising Carissaand Acokanthera, emerge as a sister clade
(Figures 3.2, 3.3, 3.8 &3.9) of Apocynoideae, Periplocoideae, Secamonoideae and
Asclepiadoideae (the APSA clade), in agreement with the results of Civeyrel et al.
(1998), Potgieter and Albert (2001), Livshultz et al. (2007) and Simões et al. (2007).
4.7 Phytochrome A
In plants low-copy number nuclear genes are a rich source of evolutionary
information. These genes have great potential to increase the strength of phylogenetic
reconstruction at all taxonomic levels (Sang, 2002). In a broad survey it is estimated
that substitution rate of nuclear genes is five times more than those of chloroplast
genes and twenty times greater than mitochondrial genes (Wolfe et al., 1987; Gaut,
1998). After Livshultz (2010) study, first exon of PHYA gene is sequenced here from
different taxa of Apocynaceae and phylogenetic trees have been constructed. Values
such as BP and PP in parsimony and Bayesian trees respectively, to support the
relationship are much higher than plastid markers (Figures 3.2, 3.3, 3.10 & 3.11). But
to amplify low copy number genes such as PHYA by using DNA extracted from
herbarium material is relatively difficult, also illustrated by Small et al. (2004).
Chapter 4
105
4.8 Conclusion
In the present study, representative of all major groups in Apocynaceae sensulato
were included.Tribal delimitation of subfamily Rauvolfioideae in both trnL-F separate
and combined (trnL-F, PHYA and atpB) analyses is not well-supported. The present
analyses concluded that Rauvolfioideae, Apocynoideae and the traditional
Asclepiadaceae are all non-monophyletic groups and that, in contrast, the APSA clade
is well-supported. The subfamily Periplocoideae is nested within Apocynoideae. So,
Periplocoideae should be placed in Apocynoideae rather than thought of as the sister
group of the milkweeds. The sister group relationship between Baisseeae and the
milkweeds is also confirmed by present analyses. The ACT clade is not monophyletic,
whereas the monophyly of MOG clade receives high support. Old World
Cynanchineae forms a well-supported group within the New World MOG clade in
combined analyses. In separate trnL-F analyses, Cynanchineae in ACT group are not
monophyletic only the Malagasy Cynanchum group appear as a monophyletic clade
with good support, whereas American generaform a separate clade, and the type
species (C. acutum) appears as incertae sedis. Thissuggests that the Cynanchum
requires further phylogenetic and taxonomic studies acrossits range.
Presently confidence values for clades obtained in combined analyses are
comparatively better than in studies where plastid regions alone were sequenced.
Clade structure within the Apocynaceae is now generally well understood. The
principal challenges now lie in identifying characters that can reflect and articulate
these clades in a formal classification. There is need to sequence greater numbers, of
taxa of Apocynaceae to further refine the relationships in the family. To have high-
quality DNA from herbarium material, new optimised DNA extraction protocols are
also needed. It is more technically difficult to use DNA from herbarium material to
amplify low-copy nuclear genes such as PHYA.
106
Conclusion
The present study aims to investigate the phylogenetic relationships among different
groups (such as subfamilies, tribes and subtribes) of family Apocynaceae. To achieve
the purpose of study, different regions of plastid (trnL-F intron-spacer region and
atpB promoter) and nuclear (PHYA) genomes were sequenced from different taxa
representing major groups in Apocynaceae. For DNA isolation some of the species
were collected from tropical and subtropical regions of Pakistan, while rest of the taxa
were obtained by utilizing different resources (herbarium and living collection) of The
Royal Botanic Gardens Kew, London. The inclusion of specimens from different
geographic areas was also a high priority. To elaborate the number of taxa in
phylogenetic analysis, sequences of various taxa of the family were also retrieved
from the GenBank. Phylogenetic trees were constructed by using two different
programs: PAUP was used for maximum parsimony (MP) analysis and Mr. Bayes
was preferred for Bayesian analysis.
In trnL-F analyses, 177 taxa of Apocynaceae were included as an ingroup. Major
lineages of the family in Bayesian trees receive strong supports as compared to
parsimony analysis with exception of subfamily Rauvolfioideae and Apocynoideae.
Overall resolution within Rauvolfioideae is low in both MP and Bayesian analyses.
While the clade comprised of Apocynoideae, Periplocoideae, Secamonoideae and
Asclepiadoideae (APSA clade) is strongly supported in both parsimony and Bayesian
trees. Apocynoideae is paraphyletic with respect to nested position of Periplocoideae.
In Asclepiadoideae, a clade comprising taxa from Ceropegieae and Marsdenieae
receives good support in Bayesian analysis and confirming the sister relationship of
these two tribes. The monophyly of Asclepiadeae and subtribal relationships are well-
supported in the Bayesian tree. New Wold’s Metastelmatinae, Oxypetalinae and
Gonolobinae (MOG) and Old World’s Asclepiadineae, Cynanchineae and
Tylophorinae (ACT) clades also appear with high posterior probability (PP) value in
Bayesian analysis. The Malagasy succulent group of Cynanchineae forms a separate
clade from rest of the Cynanchineae. Cynanchineae is not recovered monophyletic
since other ‘non Malagasy’ species appear in different tribes in the ACT clade with
weak support. Within MOG clade, Metastelmatinae is monophyletic and Gonolobinae
are embedded in Oxypetalinae.
107
The phylogenetic analyses based on PHYA region, the dataset was comprised of only
112 taxa relatively less number as compared to trnL-F analyses. The plastid marker
trnL-F has widely been used for phylogeny of Apocynaceae, so large number of trnL-
F sequences of Apocynaceae’s taxa is present in the GenBank. The utility of nuclear
regions for phylogeny of Apocynaceae is comparatively low, Livshultz (2010) first
time used PHYA for estimating relationships in Apocynoideae. In the present study
the PHYA marker was employed on taxa of whole family. In both parsimony and
Bayesian analyses based on PHYA, support is weak at some places like APSA clade is
not strongly supported here. Overall resolution produced by PHYA in both Bayesian
and parsimony trees is comparatively higher than trnL-F analyses. For better
resolution of groups, combined (trnL-F and PHYA datasets) phylogenetic trees were
constructed.
In combined analyses, number of taxa was same as in PHYA analyses but resolution
was increased than previous analyses, while the situation in Rauvolfioideae was not
improved. Basal tribes of Apocynoideae such as Nerieae, Malouetieae and subfamily
Periplocoideae are making Apocynoideae paraphyletic. New World (Odontadineae,
Mesechiteae and Echiteae) and Old World Apocyneae form a well-supported clade in
both analyses. Instead Periplocoideae, the Old World tribe Baisseeae of
Apocynoideae appears as sister group of milkweeds. Sister group relationship of
Ceropegieae and Marsdenieae also receive good support in Bayesian analysis. In
Asclepiadeae, ACT is not recovered Monophyletic due to the position of
Cynanchineae (comprised of Old World Cynanchum) with subtribes of MOG clade.
In order to improve resolution in Rauvolfioideae, additionally atpB promoter region
was sequenced from the members of the subfamily. The phylogenetic trees (Bayesian
and parsimony) were constructed using trnL-F, PHYA and atpB sequences. But
overall support in both analyses to resolve groups in Rauvolfioideae was recovered
poor.
From the present study, it is concluded that there are still some gaps which need more
attention by adding more number of taxa and exploiting more loci of plastid and
nuclear genomes. It is also confirmed that resolution power can be increased by
simultaneous analyses of combined datasets.
108
Major achievements so far from the study were a paper entitled ‘‘The taxonomy and
systematics of Apocynaceae: where we stand in 2012” which is accepted with minor
revision (Botanical Journal of Linnean Society). While three research papers have
been submitted in different international journals: ‘‘Phylogenetic relationships in
Apocynaceae based on plastid trnL-F intron/spacer region sequences” (Turkish
Journal of Botany), “Identification of putative cis-acting regulatory elements in atpB
gene promoter and phylogenetic relationship in Rauvolfioideae” (Caryologia) and
“Utilization of low-copy nuclear gene in phylogeny of Apocynaceae sensu lato”
(Taxon).
Chapter 5
106
References
Alan CA, Wilkes B. 1964. Studies on the suppression of immune responses by the
periwinkle alkaloids Vincristine and Vinblastine. Journal of Clinical
Investigation 43: 2394–2403.
Alvarez I, Wendel JF. 2003. Ribosomal ITS sequences and plant phylogenetic
inference. Molecular Phylogenetics and Evolution 29: 417–434.
APG I. 1998. An ordinal classification of the families of flowering plants. Annals of
the Missouri Botanical Garden 85: 531–553.
APG II. 2003. An update of the Angiosperm Phylogeny Group classification for the
orders and families of flowering plants: APG II. Botanical Journal of the
Linnean Society 141: 399–436.
APG III. 2009. An update of the Angiosperm Phylogeny Group classification for the
orders and families of flowering plants: APG III. Botanical Journal of the
Linnean Society 161: 105–121.
Bennett JR, Mathews S. 2006. Phylogeny of the parasitic plant family
Orobanchaceae inferred from phytochrome A. American Journal of Botany 93:
1039–1051.
Bentham G. 1876. Apocynaceae and Asclepiadaceae. In: Bentham G, Hooker JD,
eds. Genera plantarum. London: Lovell Reeve, 681–785.
Brown R. 1810. Prodromus Florae Novae Hollandiae et Insulae van Diemen.
London: Richard Taylor & Son.
Brown R. 1811. On the Asclepiadeae, a natural order of plants separated from the
Apocineae of Jussieu. Memoirs of the Wernerian Natural History Society 1:
12–78.
Brown R. 1833. On the organs and mode of fecundation in Orchideae and
Asclepiadeae. Transactions of the Linnean Society of London 16: 685–746.
Chapter 5
107
Bruyns PV, Forster PI. 1991. Recircumscription of the Stapelieae (Asclepiadaceae).
Taxon 40: 381–391.
Bruyns PV. 1999. The systematic position of Eustegia. Botanische Jahrbücher für
Systematik, Pflanzengeshichte und Pflanzengeographie 121: 19–44.
Bruyns PV. 2004. New species in Echidnopsis and Secamone and new records of
Ceropegia (Apocynaceae) from Socotra. Edinburgh Journal of Botany 61: 7–
19.
Candonelle AP De. 1844. Prodromus systematis naturalis regni vegetabilis; Tomo
VIII. Paris, 26–32.
Chase MW, Hillis HG. 1991. Silica gel: an ideal material for field preservation of
leaf samples for DNA studies. Taxon 40: 215–220.
Chin Y-W, Jones WP, Waybright TJ, McCloud TG, Rasoanaivo P, Cragg
GM, Cassady JM, Kinghorn AD. 2006. Tropane aromatic ester alkaloids
obtained from a large-scale recollection of Erythroxylum pervillei stem bark
collected in Madagascar. Journal of Natural Products 69: 414–417.
Civeyrel L, Klackenberg J. 1996. A second species of the Malagasy genus
Secamonopsis (Asclepiadaceae). Novon 6: 144–146.
Civeyrel L, Rowe N. 2001. Phylogenetic relationships of Secamonoideae based on
the plastid gene matK, morphology, and biomechanics. Annals of the Missouri
Botanical Garden 88: 583–602.
Civeyrel L, Thomas Le A, Ferguson K, Chase MW. 1998. Critical reexamination
of palynological characters used to delimit Asclepiadaceae in comparison to
the molecular phylogeny obtained from plastid matK sequences. Molecular
Phylogenetics and Evolution 9: 517–527.
Civeyrel L. 1994. Variation et evolution des types polliniques du genre Secamone
(Secamonoideae, Asclepiadaceae). Comptes Rendus de l Academie des
Sciences Paris 317: 1159–1165.
Chapter 5
108
Civeyrel L. 1995. Pollen morphology and ultrastructure of the genus Secamone in
Africa. In: Le Thomas A, Roche E, eds. 2d Symposium on African Palynology,
Tervuren (Belgium). Orléans: CIFEG, 207–215.
Civeyrel L. 1996. Phylogenie des Asclepiadaceae: Approche palynologique et
moleculaire. Thesis, University of Montpellier.
Coppen J-J W, Cobb AL. 1983. The occurrence of iridoids in Plumeria and
Allamanda. Phytochemistry 22: 125–128.
Court GD. 1987. Fockea Endl. – an African genus. Asklepios 40: 69–74.
Cronquist A. 1981. An Integrated System of Classification of Flowering Plants. New
York: Columbia University Press.
Dan Dicko-Zafimahova L. 1978. Ultrastructure of Pollinia Walls in Calotropis
procera Asclepiadaceae. Adansonia 17: 455–464.
Dannenbaum C, Schill R. 1991. Die Entwicklung der Pollentetraden und Pollinien
bei den Asclepiadaceae. Bibliotheca Botanica 141: 1–138.
Dave Y, Kuriachen PM. 1991. Comparative anatomical characters of Periplocaceae
of follicles and their taxonomic significance. Feddes Repertorium 102: 63–68.
Decaisne, MJ. 1844. Asclepiadaceae. In: De Candolle AP, ed. Prodromus Systematis
Naturalis Regni Vegetabilis. Paris: Treuttel and Würtz, 490–684.
Deepak D, Srivastav S, Khare A. 1997. Pregnane glycosides. Progress in the
chemistry of organic natural products 71: 169–325.
Demeter K. 1922. Vergleichende Asclepiadeenstudien. Flora 115: 130–176.
Dey A, De JN. 2011. Ethnobotanical aspects of Rauvolfia serpentine (L.) Benth. Ex
Kurz. in India, Nepal and Bangladesh. Journal of Medicinal Plants and
Research 5: 144–150.
Chapter 5
109
Don G. 1838. A general history of the Dichlamydeous plants. London: JG Rivington
and F Rivington et al.
Doyle JJ, Doyle JL, Brown AHD, Pfeil BE. 2000. Confirmation of shared and
divergent genomes in the Glycine tabacina polyploid complex (Leguminosae)
using histone H3-D sequences. Systematic Botany 25: 437–448.
Doyle JJ, Doyle JL. 1987. A rapid DNA isolation procedure for small quantities of
fresh leaf tissue. Phytochemical Bulletin 19: 11–15.
Endlicher SL. 1838. Genera P1antarum (Apocynaceae & Asclepiadaceae). Vienna:
F. Beck.
Endlicher SL. 1841. Enchiridion botanicum. Leipzig: Engelmann.
Endress M, Albert VA. 1995. A morphological cladistic study of Apocynaceae:
Trends in character evolution within a broadened familial circumscription.
American Journal of Botany 82: 127 (6, Abstracts).
Endress ME, Bruyns P. 2000. A revised classification of the Apocynaceae s.l.
Botanical Review (Lancaster) 66: 1–56.
Endress ME, Hesse M, Nilsson S, Guggisberg A, Zhu J-P. 1990. The systematic
position of the Holarrheninae (Apocynaceae). Plant Systematics and Evolution
171: 157–185.
Endress ME, Liede-Schumann S, Meve U. 2007a. Advances in Apocynaceae: the
enlightenment, an introduction. Annals of the Missouri Botanical Garden 94:
259–267.
Endress ME, Sennblad B, Nilsson S, Civeyrel L, Chase M, Huysmans S,
Grafstrom E, Bremer B. 1996. A phylogenetic analysis of Apocynaceae s.s.
and some related taxa in Gentianales: A multi-disciplinary approach. Opera
Botanica Belgica 7: 59–102.
Chapter 5
110
Endress ME, Stevens WD. 2001. The renaissance of the Apocynaceae sensu lato:
recent advances in systematics, phylogeny, and evolution: Introduction.
Annals of the Missouri Botanical Garden 88: 517–522.
Endress ME, Van der Ham RWJM, Nilsson S, Civeyrel L, Chase MW, Sennblad
B, Potgieter K, Joseph J, Powell M, Lorence D, Zimmerman Y-M, Albert
VA. 2007b. A phylogenetic analysis of Alyxieae (Apocynaceae) based on
rbcL, matK, trnL intron, trnL-F spacer sequences, and morphological
characters. Annals of the Missouri Botanical Garden 94: 1–35.
Endress ME. 1997. Key characters at the interface of the apocynacs and the
asclepiads. American Journal of Botany 84: 189–190 (6, Abstracts).
Endress ME. 2001. Apocynaceae and Asclepiadaceae: United they stand. Haseltonia
8: 2–9.
Endress ME. 2003. Apocynaceae and Asclepiadaceae: United they stand. Haseltonia
8: 1–9.
Endress ME. 2004. Apocynaceae: Brown and now. Telopea 10: 525–541.
Endress PK. 1994. Floral structure and evolution of primitive angiosperms: recent
advances. Plant Systematics and Evolution 192: 79–97.
Fallen ME. 1986. Floral structure in the Apocynaceae: Morphological, functional,
and evolutionary aspects. Botanische Jahrbücher für Systematik 106: 245–
286.
Fishbein M, Chuba D, Ellison C, Mason-Gamer RJ, Lynch SP. 2011.
Phylogenetic relationships of Asclepias (Apocynaceae) inferred from non-
coding chloroplast DNA sequences. Systematic Botany 36: 1008–1023.
Fishbein M. 2001. Evolutionary innovation and diversification in the flowers of
Asclepiadaceae. Annals of the Missouri Botanical Garden 88: 603–623.
Chapter 5
111
Forster PI, Harold K. 1989. Secamone R. Br. (Asclepiadaceae: Secamonoideae) in
Australia. Austrobaileya 3: 69–78.
Friedman F. 1990. Note sur la position systématique du genre Trichosandra Decne.
(Asclepiadaceae). Adansonia 12: 131–138.
Frye TC. 1901. Development of the pollen in some Asclepiadaceae. Botanical
Gazette 32: 325–330.
Galloway GL, Malmberg RL, Price RA. 1998. Phylogenetic utility of the nuclear
gene arginine decarboxylase: an example from Brassicaceae. Molecular
Biology and Evolution 15: 1312–1320.
Gaut BS. 1998. Molecular clocks and nucleotide substitution rates in higher plants.
Evolutionary Biology 30: 93–120.
Gentry AH. 1983. Alstonia (Apocynaceae): Another palaeotropical genus in Central
America. Annals of the Missouri Botanical Garden 70: 206–207.
Good R. 1947. The geography of the flowering plants. London: Longmans, Green
and Co.
Good R. 1952. An atlas of the Asclepiadaceae. New Phytologist 51: 198–209.
Goyder D. 2001. Asclepiadaceae or Apocynaceae? Asklepios 83: 13–16.
Goyder DJ, Nicholas A, Liede-Schumann S. 2007. Phylogenetic relationships in
subtribe Asclepiadinae (Apocynaceae: Asclepiadoideae). Annals of the
Missouri Botanical Garden 94: 423–434.
Goyder DJ. 1992. Secamone (Asclepiadaceae subfam. Secamonoideae) in Africa.
Kew Bulletin 47: 437–474.
Goyder DJ. 1999. The Asclepiadaceae – a figment of our imagination? In:
Timberlake J, Kativu S, eds. African Plants: Biodiversity, Taxonomy and
Uses. Kew: Royal Botanic Gardens, 309–317.
Chapter 5
112
Goyder DJ. 2004. An amplified concept of Philibertia Kunth (Apocynaceae:
Asclepiadoideae), with a synopsis of the genus. Kew Bulletin 59: 415–451.
Goyder DJ. 2006. An overview of asclepiad biogeography. In: Ghazanfar SA,
Beentje H, eds. Taxonomy and Ecology of African Plants and their
Conservation and Sustainable Use. London: Royal Botanic Gardens, Kew,
205–214.
Habibuddin M, Daghriri HA, Humaira T, Al-Qahtani MS, Fafzi AA. 2008.
Antidiabetic effect of alcoholic extract of Caralluma sinaica L. on
streptozotocin-induced diabetic rabbits. Journal of Ethnopharmacology 117:
215–220.
Hallier H. 1905. Provisional scheme of the natural (phylogenetic) system of
flowering plants. New Phytologist 4: 151–162.
Hechem V, Calviño CI, Ezcurra C. 2011. Molecular phylogeny of Diplolepis
(Apocynaceae-Asclepiadoideae) and allied genera, and taxonomic
implications. Taxon 60: 638–648.
Hennig W. 1950. Grundzuge einer Theorie der Phylogenetischen Systematik. Berlin:
Deutsche Zentralverlag.
Hennig W. 1966. Phylogenetic systematics. Urbana: University of Illinois Press.
Homberger K, Hesse M. 1984. Kopsirachin, ein ungewöhnliches alkaloid aus der
Apocynaceae Kopsia dasyrachis Ridl. Helvetica Chimica Acta 67: 237–248.
Huelsenbeck JP, Ronquist F, Nielsen R, Bollback JP, 2001. Bayesian inference of
phylogeny and its impact on evolutionary boilogy. Science 294: 2310–2314.
Huelsenbeck JP, Ronquist F. 2001. Mr. Bayes: Bayesian inference of phylogenetic
trees. Bioinformatics 17: 754–755.
Hutchinson J. 1973. The families of flowering plants. Oxford: Clarendon Press.
Chapter 5
113
Ionta GM, Judd WS. 2007. Phylogenetic relationships in Periplocoideae
(Apocynaceae s.l.) and insights into the origin of pollinia. Annals of the
Missouri Botanical Garden 94: 360–375.
Johnson LA, Soltis DE. 1998. Assessing congruence: Empirical examples from
molecular data. In: Soltis DE, Soltis PS, Doyle JJ, eds. Molecular systematics
of plants II: DNA sequencing. Boston: Kluwer Academic Publishers, 297–348.
Judd WS, Sanders RW, Donoghue MJ. 1994. Angiosperm family pairs:
Preliminary phylogenetic analyses. Harvard Paper of Botany 5: 1–51.
Jussieu ALde. 1789. Genera Plantarum. Paris: Herissant.
Kelchner SA. 2000. The evolution of noncoding chloroplast DNA its application in
plant systematics. Annals of the Missouri Botanical Garden 87: 482–498.
Khan SW, Khatoon S. 2008. Ethnobotanical studies on some useful herbs of
Haramosh and Bugrote valleys in Gilgit, northern areas of Pakistan. Pakistan
Journal of Botany 40: 43–58.
Kirtikar KR, Basu BD. 1999. Indian medicinal plants. Dehrandun: International
book distributor, 191-192, 420-422, 993-994, 2045-2047.
Kisakürek MV, Leeuwenberg AJM, Hesse M. 1983. A chemotaxonomic
investigation of the plant families of Apocynaceae, Loganiaceae, and
Rubiaceae by their indole alkaloid content. In: Pelletier SW, ed. Alkaloids:
Chemical and Biological Perspectives. New York: Wiley, 211–376.
Klackenberg J. 1992a. Taxonomy of Secamone s.l. (Asclepiadaceae) in the
Madagascar Region. Opera Botanica 112: 11–27.
Klackenberg J. 1992b. Taxonomy of Secamone (Asclepiadaceae) in Asia and
Australia. Kew Bulletin 47: 595–612.
Klackenberg J. 1995a. Malagasy Asclepiadaceae: reinstatement of the genus
Pervillea and two new combinations. Phytologia 78: 189–191.
Chapter 5
114
Klackenberg J. 1995b. Taxonomy and phylogeny of the SE Asian genus Genianthus
(Asclepiadaceae). Botanische Jahrbücher für Systematik 117: 401–467.
Klackenberg J. 1996a. The new genus Calyptranthera (Asclepiadaceae) from
Madagascar. Novon 6: 25–27.
Klackenberg J. 1996b. Revision of the Malagasy genus Pervillea (Asclepiadaceae)
and its phylogenetic relationship to Calyptranthera. Nordic Journal of Botany
16: 165–184.
Klackenberg J. 1997. Revision of the genus Baroniella Costantin & Gallaud
(Asclepiadaceae, Periplocoideae). Candollea 52: 383–407.
Klackenberg J. 2001. Notes on Secamonoideae (Apocynaceae) in Africa. Adansonia
23: 317–335.
Klackenberg J. 2005. Secamone trichostemon Klack. (Apocynaceae,
Secamonoideae) a new species from Madagascar. Candollea 60: 119–122.
Kolukisaoglu HU, Marx S, Wiegmann C, Hanelt S, Schneider-Poetsch HA. 1995.
Divergence of the phytochrome gene family predates angiosperm evolution
and suggests that Selaginella and Equisetum arose prior to Psilotum. Journal
of Molecular Evolution 41: 329–337.
Kunze H, Meve U, Liede S. 1994. Cibirhiza albersiana, a new species of
Asclepiadaceae, and establishment of the tribe Fockeeae. Taxon 43: 367–376.
Kunze H. 1995. Floral morphology of some Gonolobeae (Asclepiadaceae).
Botanische Jahrbücher für Systematik 117: 211–238.
Kunze H. 1990. Morphology and evolution of the corona in Asclepiadaceae and
related families. Tropische und subtropische Pflanzenwelt 76: 1–51.
Kunze H. 1993. Evolution of the translator in Periplocaceae and Asclepiadaceae.
Plant Systematics and Evolution 185: 99–122.
Chapter 5
115
Kunze H. 1996. Morphology of the stamen in the Asclepiadaceae and its systematic.
Botanische Jahrbücher für Systematik 118: 547–579.
Lahaye R, Civeyrel L, Speck T, Rowe N. 2005. Evolution of shrub-like growth
forms in the lianoid subfamily Secamonoideae (Apocynaceae s.l.) of
Madagascar: Phylogeny, biomechanics, and development. American Journal
of Botany 92: 1381–1396.
Lahaye R, Klackenberg J, Källersjö M, Van Campo E, Civeyrel L. 2007.
Phylogenetic relationships between derived Apocynaceae s.l. and within
Secamonoideae based on chloroplast sequences. Annals of the Missouri
Botanical Garden 94: 376–391.
Leeuwenberg AJM. 1994. Taxa of the Apocynaceae above the genus level. Series of
revisions of Apocynaceae, XXXVIII. Wageningen Agriculture University
Papers 94: 45–60.
Leeuwenberg AJM. 2003. Series of revisions of Apocynaceae. LIII. Melodinus.
Systematics and Geography of Plants 73: 3–62.
Liede S, Taüber A. 2000. Sarcostemma R. Br. (Apocynaceae–Asclepiadoideae). A
controversial generic circumscription reconsidered: evidence from trnL-trnF
spacers. Plant Systematics and Evolution 225: 133–140.
Liede S, Albert F. 1994. Tribal disposition of genera in the Asclepiadaceae. Taxon
43: 201–231.
Liede S, Kunze H. 1993. A descriptive system for corona analysis in the
Asclepiadaceae. Plant Systematics and Evolution 185: 99–284.
Liede S, Kunze H. 2002. Cynanchum and the Cynanchinae (Apocynaceae –
Asclepiadoideae): a molecular, anatomical and latex triterpenoid study.
Organisms Diversity and Evolution 2: 239–269.
Liede S, Meve U. 2002. Dissolution of Cynanchum sect. Macbridea (Apocynaceae-
Asclepiadoideae). Nordic Journal of Botany 22: 579–591.
Chapter 5
116
Liede S, Taüber A, Schneidt J. 2002. Molecular considerations in the Tylophorinae
K. Schum (Apocynaceae-Asclepiadoideae). Edinburgh Journal of Botany 59:
377–403.
Liede S, Taüber A. 2002. Circumscription of the genus Cynanchum (Apocynaceae-
Asclepiadoideae). Systematic Botany 27: 789–801.
Liede S. 1994. Myth and reality in the subtribe Astephaninae (Decne.) Schumann
(Asclepiadaceae). Botanical Journal of the Linnean Society 114: 81–98.
Liede S. 1997. Subtribes and genera of the tribe Asclepiadeae (Apocynaceae,
Asclepiadoideae) – A synopsis. Taxon 46: 233–247.
Liede S. 2001. Molecular considerations on the subtribe Astephaninae Endl. ex
Meisn. (Apocynaceae -Asclepiadoideae). Annals of the Missouri Botanical
Garden 88: 657–668.
Liede-Schumann S, Rapini A, Goyder DJ, Chase MW. 2005. Phylogenetics of the
New World subtribes of Asclepiadeae (Apocynaceae -Asclepiadoideae):
Metastelmatinae, Oxypetalinae, and Gonolobinae. Systematic Botany 30: 184–
195.
Lienau K, Straka H, Friedrich B. 1986. Palynologia madagassica et mascarenica,
Fam. 167–181. Tropische und subtropische Pflanzenwelt 55: 1–158.
Livshultz T, Middleton DJ, Endress ME, Williams J. 2007. Phylogeny of
Apocynoideae and the APSA clade. Annals of the Missouri Botanical Garden
94: 323–361.
Livshultz T. 2002. Comparative morphology and development of staminal coronas in
Dischidia. (Asclepiadoideae, Apocynaceae). Botanical Society of America
meeting (Oral presentation).
Livshultz T. 2003. Lectotypification of Dolichostegia Schlechter (Asclepiadoideae,
Apocynaceae) and a new combination, Dischidia boholensis. Taxon 52: 595–
600.
Chapter 5
117
Livshultz T. 2010. The phylogenetic position of milkweeds (Apocynaceae
subfamilies Secamonoideae and Asclepiadoideae): Evidence from the nucleus
and chloroplast. Taxon 59: 1016–1030.
Lý TD. 1986. Die Familie Apocynaceae Juss. in Vietnam. Teil 1. Allgemeiner Teil.
Feddes Repertorium 97: 235–273.
Macfarlane JM. 1933. The Evolution and Distribution of Flowering Plants.
Philadelphia: Noel.
Malme GOAN. 1927. Asclepiadaceae dusenianae in Paraná collectae. Arkiv för
Botanik 21A: 1–48.
Mathews S, Donoghue MS. 1999. The root of angiosperm phylogeny inferred from
duplicate phytochrome genes. Science 286: 947–950.
Mathews S, Lavin M, Sharrock RA. 1995. Evolution of the phytochrome gene
family and its utility for phylogenetic analysis of angiosperms. Annals of the
Missouri Botanical Garden 82: 296–321.
Mathews S, Sharrock RA. 1996. The phytochrome gene family in grasses (Poaceae):
a phylogeny and evidence that grasses have a subset of the loci found in dicot
angiosperms. Molecular Biology and Evolution 13: 1141–1150.
Mathews S, Tsai RC, Kellogg EA. 2000. Phylogenetic structure in the grass family
(Poaceae): Evidence from the nuclear gene phytochrome B. American Journal
of Botany 87: 96–107.
Meve U, Liede S. 1999. The Asclepiadoideae and Periplocoideae (Apocynaceae s.l.)
of the Thunberg herbarium. Nordic Journal of Botany 19: 129–138.
Meve U, Liede S. 2001a. Inclusion of Tenaris and Macropetalum in Brachystelma
(Apocynaceae-Asclepiadoideae-Ceropegieae) inferred from non-coding
nuclear and chloroplast DNA sequences. Plant Systematics and Evolution 228:
89–105.
Chapter 5
118
Meve U, Liede S. 2001b. Reconsideration of the status of Lavrania, Larryleachia and
Notechidnopsis (Asclepiadoideae-Ceropegieae). South African Journal of
Botany 67: 161–168.
Meve U, Liede S. 2002. A molecular phylogeny and generic rearrangement of the
stapeloid Ceropegieae (Apocynaceae-Asclepiadoideae). Plant Systematics and
Evolution 234: 171–209.
Meve U, Liede S. 2004. Subtribal division of Ceropegieae (Apocynaceae-
Asclepiadoideae). Taxon 53: 61–72.
Meve U, Liede-Schumann S. 2007. Ceropegia (Apocynaceae, Ceropegieae,
Stapeliinae): paraphyletic but still taxonomically sound. Annals of the
Missouri Botanical Garden 94: 392–406.
Meve U. 1995. Neoschumannia (including Swynnertonia), a primitive genus of the
Asclepiadaceae-Stapelieae. Plant Systematics and Evolution 197: 233–242.
Meve U. 2002. Species numbers and progress in asclepiad taxonomy. Kew Bulletin
57: 459–464.
Middleton DJ. 2004a. A revision of Kopsia (Apocynaceae: Rauvolfioideae).
Harvard Paper of Botany 9: 89–142.
Middleton DJ. 2004b. Apocynaceae. In: Soepadmo E, Saw LG, Chung RCK, eds.
Tree Flora of Sabah and Sarawak. Kuala Lumpur: Forest Research Institute,
Ampang Press, 1–61.
Middleton DJ. 2007. Apocynaceae, subfamilies Rauvolfioideae and Apocynoideae.
Flora Malesiana 18: 1–471.
Morales JF. 1995. Evaluación del Género Alstonia (Apocynaceae) en Centro
América. Phytologia 78: 192–194.
Morales JF. 1997. A synopsis of the genus Allomarkgrafia (Apocynaceae). Brittonia
49: 337–345.
Chapter 5
119
Muellner AN, Samuel R, Johnson SA, Cheek M, Pennington TD, Chase MW,
2003. Molecular phylogenetics of Meliaceae (Sapindales) based on nuclear
and plastid DNA sequences. American Journal of Botany 90: 471–480.
Nazar N, Mahmood T. 2010. Morphological and molecular characterization of
selected Artemisia species from Rawalakot, Azad Jammu and Kashmir. Acta
Physiologiae Plantarum 33: 625–633.
Nicholas A, Baijnath H. 1994. A consensus classification for the order Gentianales
with additional details on the suborder Apocynineae. The Botanical Review
(Lancaster) 60: 440–482.
Nilsson S, Endress ME, Grafstrom E. 1993. On the relationships of the
Apocynaceae and Periplocaceae. Grana 32: 3–20.
Nilsson S. 1986. The significance of pollen morphology in the Apocynaceae. In:
Blackmore S, Ferguson K, eds. Pollen and Spores: Form and Function.
London: Academic Press, 359–374.
Nilsson S. 1990. Taxonomic and evolutionary significance of pollen in Apocynaceae.
P1ant Systematics Evolution 5: 91–102.
Nixon KC, Carpenter JM. 1996. On simultaneous analysis. Cladistics 12: 221–241.
Olmstead RG, Reeves PA. 1995. Evidence for the polyphyly of the Scrophulariaceae
based on chloroplast rbcL and ndhF sequences. Annals of the Missouri
Botanical Garden 82: 176–193.
Omlor R. 1998. Generische revision der Marsdenieae (Asclepiadaceae). Thesis,
Universitat Kais-erslautern.
Orbigny A. (ed.) 1843. Dictionnaire Universel d’Histoire Naturelle. Paris: Renard.
Oudhia P, Tripathi RS, Puri S, Chandel DS. 1999. Traditional knowledge about
medicinal weeds in Chhattisgarh. Vasundhara the Earth 1: 12–15.
Chapter 5
120
Pagel M, 1999. Inferring historical patterns of biological evolution. Nature 401: 877–
884.
Pagen FJJ. 1987. Series of revisions of Apocynaceae XX. Oleander: Nerium L. and
the Oleander cultivars. Wageningen Agriculture University Papers 87: 1–113.
Persoon JGM, van Dilst FJH, Kuijpers RP, Leeuwenberg AJM, Vonk GJA.
1992. The African species of Landolphia P. Beauv. Series of revisions of
Apocynaceae. XXXIV. Wageningen Agriculture University Paper 92: 1–232.
Pichon M. 1949. Classification des Apocynacées. IX. Rauvolfiées, Alstoniées,
Allamandées et Tabernaémontanoidées. Mémoires du Muséum National
d’Histoire Naturelle 27: 153–251.
Pichon M. 1948a. Classification des Apocynacées. V. Cérbéroidées. Notulae
systematicae, herbier d'muséum de Paris, Phanérogamie 13: 212–229.
Pichon M. 1948b. Classification des Apocynacées. I. Carissées et Ambelaniees.
Mémoires du Muséum National d'Histoire Naturelle 24: 111–181.
Pichon M. 1950a. Classification des Apocynacées: XXVIII, Supplement aux
Plumérioidées. Mémoires du Muséum National d'Histoire Naturelle serie B,
botanique 1: 145–166.
Pichon M. 1950b. Classification des Apocynacées. XXV. Échitoidés. Mémoires du
Muséum National d'Histoire Naturelle serie B, botanique 1: 1–143.
Pichon, M. 1947. Classification des Apocynacées: IV. Genre ‘‘Alstonia’’ et genres
voisins. Bulletin du Museum National d'Histoire Naturelle (Paris) 19: 294–
301.
Potgieter K, Albert VA. 2001. Phylogenetic relationships within Apocynaceae s.l.
based on trnL intron and trnL-F spacer sequences and propagule characters.
Annals of the Missouri Botanical Gardens 88: 523–549.
Chapter 5
121
Potgieter K. 1999. Phylogenetic study of Apocynaceae Juss. and Aspidosperma Mart.
& Zucc. Thesis, University of Illinois at Urbana-Champaign.
Rapini A, Chase MW, Goyder DJ, Griffiths J. 2003. Asclepiadoideae
classification: Evaluating the phylogenetic relationships of New World
Asclepiadoideae (Apocynaceae). Taxon 52: 33–50.
Rapini A, Chase MW, Konno TUP. 2006. Phylogenetics of South American
Asclepiadeae (Apocynaceae). Taxon 55: 119–124.
Rapini A, Fontella-Pereira J, Goyder DJ. 2011. Towards a stable generic
circumscription in Oxypetalinae (Apocynaceae). Phytotaxa 26: 9–16.
Rapini A, Mello-Silva R, Kawasaki ML. 2002. Richness and endemism in
Asclepiadoideae (Apocynaceae) from the Espinhaço range of Minas Gerais,
Brazil - a conservationist view. Biodiversity and Conservation 11: 1733–1746.
Rapini A, Van den Berg C, Liede-Schumann S. 2007. Diversification of
Asclepiadoideae (Apocynaceae) in the New World. Annals of the Missouri
Botanical Gardens 94: 407–422.
Rapini A. 2002. Six new species of Ditassa R. Br. from the Espinhaço Range, Brazil,
with notes on generic delimitation in Metastelmatinae (Apocynaceae-
Asclepiadoideae). Kew Bulletin 57: 533–546.
Rapini A. 2012. Taxonomy “under construction”: advances in the systematics of
Apocynaceae, with emphasis on the Brazilian Asclepiadoideae. Rodriguésia
63: 75–88.
Richard EJ. 1997. Preparation of plant DNA using CTAB. In: Ausubel F, Brent R,
Kingston RE, Moore DD, Siedman JG, Smith JA, Struhl K, eds. Short
Protocols in Molecular Biology. New York: Wiley, 2.10–2.11.
Rosatti TJ. 1989. The genera of suborder Apocynineae (Apocynaceae and
Asclepiadaceae) in the southeastern United States. Journal of the Arnold
Arboretum 70: 307–401.
Chapter 5
122
Safwat FM. 1962. The floral morphology of Secamone and the evolution of the
pollinating apparatus in Asclepiadaceae. Annals of the Missouri Botanical
Garden 49: 95–129.
Samuel R, Kathriarachchi H, Hoffmann P, Barfuss MHJ, Wurdack KJ, Davis
CC, Chase MW. 2005. Molecular phylogenetics of Phyllanthaceae: Evidence
from plastid matK and nuclear PHYC sequences. American Journal of Botany
92: 132–141.
Sang T, Crawford DJ, Stuessy TF. 1997a. Chloroplast phylogeny, reticulate
evolution, and biogeography of Paeonia (Paeoniaceae). American Journal of
Botany 84: 1120–1136.
Sang T, Donoghue MJ, Zhang D. 1997b. Evolution of alcohol dehydrogenase genes
in peonies (Paeonia): phylogenetic relationships of putative nonhybrid
species. Molecular Biology and Evolution 14: 994–1007.
Sang T, Zhang D. 1999. Reconstructing hybrid speciation using sequences of low-
copy nuclear genes: hybrid origins of five Paeonia species based on Adh gene
phylogenies. Systematic Botany 24: 148–163.
Sang T. 2002. Utility of low-copy nuclear gene sequences in plant phylogenetics.
Critical Reviews in Biochemistry and Molecular Biology 37: 121–147.
Schill, R, Jäckel U. 1978. Beitrag zur Kenntnis der Asclepiadaceen-Pollinarien.
Tropische und subtropische Pflanzenwelt 22: 1–122.
Schlechter R. 1914. Periplocaceae. In: Mildbraed J, ed. Wissenschaftliche Ergebnisse
der deutschen Zentral-Afrika-Expedition. Leipzig: Klinkhardt and Biermann,
541–542.
Schlechter R. 1924. Periplocaceae and Asclepiadaceae. In: Fries RE, Fries TCE, eds.
Beitrage zur Kenntnis der Flora des Mt. Kenia, Mt. Aberdove und Mt. Elgon.
Notizblatt des Botanischen Gartens und Museums zu Berlin-Dahlem 9: 1–32.
Chapter 5
123
Schumann K. 1895. Apocynaceae and Asclepiadaceae. In: Engler A, Prantl K, eds.
Die Natürlichen Pflanzenfamilien. Germany: Engelmann, Leipzig, 109–305.
Sennblad B, Bremer B. 1996. The familial and subfamilial relationships of
Apocynaceae and Asclepiadaceae evaluated with rbcL data. Plant Systematics
and Evolution 202: 153–175.
Sennblad B, Bremer B. 2000. Is there a justification for differential a priori
weighting in coding sequences? A case study from rbcL and Apocynaceae.
Systematic Biology 49: 101–113.
Sennblad B, Bremer B. 2002. Classification of Apocynaceae s.l. according to a new
approach combining Linnaean and phylogenetic taxonomy. Systematic
Biology 51: 389–409.
Sennblad B, Endress ME, Bremer B. 1998. Morphology and molecular data in
phylogenetic fraternity the tribe Wrightieae (Apocynaceae) revisited.
American Journal of Botany 85: 1143–1158.
Sennblad B. 1997. Phylogeny of the Apocynaceae s.l. Thesis, Acta Universitas
Uppsaliensis.
Sheelaa B, Hussain SM, Kumar PS, Kalaichelvam VK, Venkatachalam VK.
2010. Vasodialation effect of latex from Calotropis gigantea in green frog
Rana hexadactyla. Asian Journal of Medicinal Science 2: 22–24.
Sidiyasa K. 1998. Taxonomy, phylogeny, and wood anatomy of Alstonia
(Apocynaceae). Blumea Supplement 11: 1–230.
Simmons MP, Clevinger CC, Savolainen V, Archer RH, Mathews S, Doyle JJ.
2001. Phylogeny of the Celastraceae inferred from phytochrome B gene
sequence and morphology. American Journal of Botany 88: 313–325.
Simões AO, Endress ME, Conti E. 2010. Systematics and character evolution of
Tabernaemontaneae (Apocynaceae, Rauvolfioideae) based on molecular and
morphological evidence. Taxon 59: 772–790.
Chapter 5
124
Simões AO, Endress ME, Van der Niet T, Conti E, Kinoshita LS. 2004. Tribal and
intergeneric relationships of Mesechiteae (Apocynaceae, Apocynoideae):
Evidence from three noncoding plastid DNA regions and morphology.
American Journal of Botany 91: 1409–1418.
Simões AO, Livshultz T, Conti E, Endress ME. 2007. Phylogeny and systematics
of the Rauvolfioideae (Apocynaceae) based on molecular and morphological
evidence. Annals of the Missouri Botanical Garden 94: 268–297.
Small RL, Cronn RC, Wendel JF. 2004. Use of nuclear genes for phylogeny
reconstruction in plants. Australian Systematic Botany 17: 145–170.
Small RL, Ryburn JA, Cronn RC, Seelanan T, Wendel JF. 1998. The tortoise and
the hare: choosing between noncoding plastome and nuclear Adh sequences
for phylogeny reconstruction in a recently diverged plant group. American
Journal of Botany 85: 1301–1315.
Small RL, Wendel JF. 2000. Phylogeny, duplication, and intraspecific variation of
Adh sequences in New World diploid cottons (Gossypium, Malvaceae).
Molecular Phylogenetics and Evolution 16: 73-84.
Soerianegara I, Lemmens RHMJ. 1994. Plant resources of South-East Asia
timber trees: major commercial timbers. Wageningen: Pudoc Scientific
Publishers.
Stapf O. 1902. Apocynaceae. In: Thiselton-Dyer WT, ed. Flora of Tropical Africa.
London: Lovell Reeve, 24–231.
Stebbins GL. 1974. Flowering plants: Evolution above the species level. Cambridge:
Belknap Press of Harvard University Press.
Stevens WD. 1976. A revision of Matelea subg. Dictyanthus (Apocynaceae, sensu
lato). Thesis, Michigan State University.
Struwe L, Albert VA, Bremer B. 1994. Cladistics and family level classification of
the Gentianales. Cladistics 10: 175–206.
Chapter 5
125
Surveswaran S, Kamble MY Yadav SR, Sun M. 2009. Molecular phylogeny of
Ceropegia (Asclepiadoideae, Apocynaceae) from Indian Western Ghats. Plant
Systematics and Evolution 281: 51–63.
Swarupanandan K, Mangaly JK, Sonny TK, Kishorekumar K, Chand-Basha S.
1996. The subfamilial and tribal classification of the family Asclepiadaceae.
Botanical Journal of the Linnean Society 120: 327–369.
Swofford DL. 2001. PAUP* 4.0: Phylogenetic analysis using parsimony (*and other
methods). Sunderland, Massachusetts: Sinauer Associates.
Swofford DL. 2002. PAUP* 4.10b: Phylogenetic Analysis Using Parsimony (*and
other methods). Sunderland, MA: Sinauer Associates.
Taberlet P, Gielly L, Pautou G, Bouvet J. 1991. Universal primers for amplification
of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17:
1105–1109.
Takhtajan A. 1997. Diversity and classification of flowering plants. New York:
Columbia University Press.
Thankamma L. 2003. Hevea latex as wound healer and pain killer. Current Science
84: 971–972.
Thorne RF. 1976. A phylogenetic classification of the Angiospermae. Evolutionary
Biology, 9: 35–106.
Thorne RF. 1992. An updated phylogenetic classification of the flowering plants.
Aliso 13: 365–389.
Tsiang Y. 1934. Notes on Asiatic Apocynales. II. Sunyatsenia 2: 90–202.
Venter HJT, Verhoeven RL. 1997. A tribal classification of the Periplocoideae
(Apocynaceae). Taxon 46: 705–720.
Chapter 5
126
Venter HJT, Verhoeven RL. 2001. Diversity and relationships within the
Periplocoideae (Apocynaceae). Annals of the Missouri Botanical Garden 88:
550–568.
Venter HJT, Verhoeven R, Kotze JDS. 1990. The genus Petopentia
(Periplocaceae). South African Journal of Botany 56: 393–398.
Verhoeven RL, Liede S, Endress ME. 2003. The tribal position of Fockea and
Cibirhiza (Apocynaceae-Asclepiadoideae): evidence from pollinium structure
and cpDNA sequence data. Grana 42: 70–81.
Verhoeven RL, Venter HJT. 1998. Pollinium structure in Periplocoideae
(Apocynaceae). Grana 37: 1–14.
Verhoeven RL, Venter HJT. 2001. Pollen morphology of the Periplocoideae,
Secamonoideae, and Asclepiadoideae (Apocynaceae). Annals of the Missouri
Botanical Garden 88: 569–582.
Wanntorp L, Kocyan A, Renner SS. 2006b. Wax plants disentangled: A phylogeny
of Hoya (Apocynaceae) using molecular markers. Molecular Phylogenetics
and Evolution 39: 722–733.
Wanntorp L, Kocyan A, van Donkelaar R, Renner SS. 2006a. Towards a
monophyletic Hoya (Marsdenieae, Apocynaceae): Inferences from the
chloroplast trnL region and the rbcL-atpB spacer. Systematic Botany 31: 586–
596.
Williams JK. 1996. The Mexican genera of Apocynaceae (sensu A. DC.), with key
and additional taxonomic notes. Sida 17: 197–213.
Wolfe KH, Li W-H, Sharp PM. 1987. Rates of nucleotide substitution vary greatly
among plant mitochondrial, chloroplast and nuclear DNAs. Proceedings of the
National Academy of Sciences of the United States of America 84: 9054–9058.
Chapter 5
127
Woodson Jr RE. 1930. Studies in the Apocynaceae. I. A critical study of the
Apocynoideae (with special reference to the genus Apocynum). Annals of the
Missouri Botanical Garden 17: 1–213.
Woodson Jr RE. 1941. The North American Asclepiadaceae. 1. Perspective of the
genera. Annals of the Missouri Botanical Garden 28: 193–244.
Woodson Jr RE. 1951. Studies in the Apocynaceae. VIII. An interim revision of the
genus Aspidosperma Mart. & Zucc. Annals of the Missouri Botanical Garden
38: 119–207.
Wyatt R, Broyles SB, Lipow SR. 2000. Pollen-ovule ratios in milkweeds
(Asclepiadaceae): An exception that probes the rule. Systematic Botany 25:
171–180.
Zarucchi JL, Morillo GN, Endress ME, Hansen BF, Leeuwenberg AJM. 1995.
Apocynaceae. In: Steyermark JA, Berry PA, Holst BK, eds. Flora of the
Venezuelan Guayana. St. Louis: Missouri Botanical Garden/Timber Press,
471–571.
Zhu JP, Guggisberg A, Kalt-Hadamowsky M, Hesse M. 1990. Chemotaxonomic
study of the genus Tabernaemontana (Apocynaceae) based on their indole
alkaloid content. Plant Systematics and Evolution 172: 13–34.
128
Appendix I
QIAquick PCR Purification Kit Protocol
Procedure
1. Five volumes of PB Buffer was added to 1 volume of the PCR sample and mixed.
2. Then a QIAquick spin column was placed in a provided 2 ml collection tube.
3. Sample was poured into the QIAquick column for DNA binding and then
centrifuged for 30-60 seconds and discarded flow-through.
4. QIAquick column was placed back into the same tube.
5. For washing, 0.75 ml Buffer PE was added to the QIAquick column followed by
centrifugation for 30-60 seconds.
6. Flow-through was discarded and QIAquick column was placed back in the same
tube, followed by centrifugation of an additional 1 minute.
7. After centrifugation, the QIAquick column was transferred to a clean 1.5 ml
microcentrifuge tube.
8. DNA was eluted by adding 50 μl elution buffer (10 mM Tris·Cl, pH 8.5) to the
center of the QIAquick membrane and the column was centrifuged for 1 minute,
at the end purified DNA was collected in the tube.
129
Appendix II
Cycle Sequencing
Reaction Mixture
Reagent Quantity
2.5X Terminator Ready Reaction Mix* 0.5 μl
5X Sequencing buffer 2 μl
Primer 0.75 μl (3.2 pmol)
Deionized water 6.25 μl
Template 1 μl (10-40 ng)
Total volume 10 μl
Following temperature conditions were used;
Purification of cycle sequencing product
1. Reaction plate with sequencing product was short spined and then 2 μl of 125 mM EDTA
was added to each well.
2. 3 M sodium acetate was also added to each well and spin shortly.
3. After spinning, 100 % ethanol was added to each well.
4. Reaction plate was sealed and for proper mixing the plate was inverted 4 times.
5. For incubation, the plate was left at room temperature for 15 minutes.
6. Centrifugation was carried out at 1650 × g for 45 minutes and temperature was set at
4 °C.
96 °C 1 minute 1 Cycle
96 °C 10 seconds
25 Cycles 50 °C 5 seconds
60 °C 4 minutes
4 °C Hold
130
7. Reaction plate was removed from centrifuge and spin again at 185 × g for 1 minute in
inverted position. At the end the samples were resuspended in buffer.
8. After centrifugation, 70 % ethanol was added to each well.
9. Step 6 and 7 was repeated.
10. At the end the samples were resuspended in buffer.
Recommended