View
6
Download
0
Category
Preview:
Citation preview
UNIVERSITY OF OULU P .O. Box 8000 F I -90014 UNIVERSITY OF OULU FINLAND
A C T A U N I V E R S I T A T I S O U L U E N S I S
University Lecturer Tuomo Glumoff
University Lecturer Santeri Palviainen
Postdoctoral researcher Jani Peräntie
University Lecturer Anne Tuomisto
University Lecturer Veli-Matti Ulvinen
Planning Director Pertti Tikkanen
Professor Jari Juga
University Lecturer Anu Soikkeli
University Lecturer Santeri Palviainen
Publications Editor Kirsti Nurkkala
ISBN 978-952-62-2805-1 (Paperback)ISBN 978-952-62-2806-8 (PDF)ISSN 0355-3221 (Print)ISSN 1796-2234 (Online)
U N I V E R S I TAT I S O U L U E N S I S
MEDICA
ACTAD
D 1594
AC
TAR
avindra Daddali
OULU 2020
D 1594
Ravindra Daddali
MOLECULAR MECHANISMS REGULATING THE ONSETOF LABORCOMPARATIVE PROTEOMICS AND miRNAOMICS OF HUMAN SPONTANEOUS AND ELECTIVE LABORS
UNIVERSITY OF OULU GRADUATE SCHOOL;UNIVERSITY OF OULU,FACULTY OF MEDICINE;MEDICAL RESEARCH CENTER OULU;OULU UNIVERSITY HOSPITAL
ACTA UNIVERS ITAT I S OULUENS I SD M e d i c a 1 5 9 4
RAVINDRA DADDALI
MOLECULAR MECHANISMS REGULATING THE ONSET OF LABORComparative proteomics and miRNAomics of human spontaneous and elective labors
Academic dissertation to be presented with the assent ofthe Doctoral Training Committee of Health andBiosciences of the University of Oulu for public defence inAuditorium F202 of the Faculty of Medicine (Aapistie 5 B),on 11 December 2020, at 12 noon
UNIVERSITY OF OULU, OULU 2020
Copyright © 2020Acta Univ. Oul. D 1594, 2020
Supervised byProfessor Mika RämetProfessor Mikko HallmanDocent Antti Haapalainen
Reviewed byProfessor Markku VarjosaloDocent Tomi Airenne
ISBN 978-952-62-2805-1 (Paperback)ISBN 978-952-62-2806-8 (PDF)
ISSN 0355-3221 (Printed)ISSN 1796-2234 (Online)
Cover DesignRaimo Ahonen
PUNAMUSTATAMPERE 2020
OpponentProfessor Jaana Rysä
Daddali, Ravindra, Molecular mechanisms regulating the onset of labor.Comparative proteomics and miRNAomics of human spontaneous and electivelaborsUniversity of Oulu Graduate School; University of Oulu, Faculty of Medicine; MedicalResearch Center Oulu; Oulu University HospitalActa Univ. Oul. D 1594, 2020University of Oulu, P.O. Box 8000, FI-90014 University of Oulu, Finland
Abstract
Human parturition is a complicated biological process and the molecular mechanisms regulating the onset oflabor are not well understood. Several studies propose that gene variants, proteins and miRNAs play a majorrole in maintaining pregnancy and aberrations in protein and miRNA levels may lead to pregnancycomplications. The levels of proteins and miRNAs could prove to be useful biomarkers for monitoring theonset of labor.
In this study, using proteomics and a genome analysis, we identified Calcineurin-like phosphoesterasedomain-containing protein (CPPED1), as a potential biomarker of labor. CPPED1 was found to bedownregulated in spontaneous term placentas compared with placentas from elective deliveries. The siRNAknockdown of CPPED1 in trophoblasts derived cells mostly affects pathways related to inflammation andangiogenesis, and these functions may be involved in the induction of labor or in maintaining pregnancy. Inbladder cancer cells, CPPED1 has been shown to dephosphorylate AKT1 on the Ser-473 residue and topromote apoptosis via the AKT/PI3K pathway. In our studies using cells of placental origin AKT1phosphorylation levels were unaffected by CPPED1 expression, whereas its silencing led to the upregulationof negative regulators of the PI3K pathway.
In a comparative miRNAomics screen of spontaneous term vs. elective term placentas, we identified 54differentially expressed miRNAs, out of which 23 miRNAs were upregulated and 31 were downregulated byat least 1.5-fold. Among the upregulated miRNAs, miRNA-371a-5p targets CPPED1 and post-transcriptionally regulates its expression by binding to its 3’UTR region. In addition, we found that CPPED1and miR-371a-5p levels inversely correlate with each other in spontaneous and elective term placentas.Measuring the levels of CPPED1 and miR-371a-5p levels in maternal blood could be a potential diagnosticbiomarker for labor.
In order to elucidate the functions of CPPED1 we used a protein microarray to identify proteins thatinteract with CPPED1 in vitro and obtained a list of 36 proteins that potentially bind CPPED1. The interactionof CPPED1 with PAK4 and PIK3R2 was confirmed by co-immunoprecipitation and investigation of thecellular localization by BiFC studies showed that CPPED1 and PAK4 are colocalized in the cytoplasm,whereas CPPED1-PIK3R2 complex on the cell membrane. Further, by a mass spectrometry analysis, we foundthat CPPED1 dephosphorylates PAK4 on five different serine residues. The functional importance of thesephosphorylation sites is still unknown. PIK3R2 phosphorylation was unaffected by CPPED1.
Based on our studies we propose that the levels of CPPED1 and miRNA-371a-5p in the maternalcirculation could serve as biomarkers for the prediction of labor. The functional role of CPPED1 on PIK3R2and PAK4 remains to be studied.
Keywords: AKT1, CPPED1, mass spectrometry, miR-371a-5p, miRNA, PAK4,PIK3R2
Daddali, Ravindra, Synnytykseen liittyvät molekyylimekanismit. Ihmisenspontaanin ja elektiivisen synnytyksen vertaileva proteomiikka ja miRNAomiikkaOulun yliopiston tutkijakoulu; Oulun yliopisto, Lääketieteellinen tiedekunta; Medical ResearchCenter Oulu; Oulun yliopistollinen sairaalaActa Univ. Oul. D 1594, 2020Oulun yliopisto, PL 8000, 90014 Oulun yliopisto
Tiivistelmä
Ihmisen synnytyksen käynnistyminen ja synnytys ovat monimutkaisia biologisia prosesseja, joiden kaikkiataustalla olevia molekyylimekanismeja ei vielä tunneta. Useat tutkimukset osoittavat, että tietyillä proteii-neilla ja mikroRNA-molekyyleillä on tärkeä rooli raskauden ylläpitämisessä. Näiden proteiini- ja mikroR-NA-määrien poikkeamat voivat johtaa raskauskomplikaatioihin. Proteiinien ja mikroRNA:n määrien mittaa-mista voitaisiin siten käyttää mahdollisina raskauskomplikaatioiden ja synnytyksen biomarkkereina.
Tässä tutkimuksessa löysimme proteomiikan ja genomin laajuisen assosiaatiotutkimuksen (GWAS) avul-la entsyymin nimeltä Calcineurin-like phosphoesterase domain-containing protein 1 (CPPED1), joka mah-dollisesti voi toimia spontaanin synnytyksen biomarkkerina. CPPED1-tasot laskivat spontaaneissa synnytyk-sissä, kun niistä saatuja istukoita verrattiin keisarinleikkauksen kautta saatuihin istukkoihin. Kun CPPED1-geenin ilmeneminen hiljennettiin istukan trofoblastisoluissa, tulehduksiin ja verisuonten uudismuodostuk-seen liittyvät signalointireitit muuttuivat eniten. Näillä muutoksilla saattaa olla merkitystä raskauden kes-toon. Aikaisemmassa tutkimuksessa on osoitettu, että virtsarakon syöpäsoluissa CPPED1 poistaa fosfaatti-ryhmän AKT1-entsyymin seriini-473 aminohapolta. Tämän fosfaatin poistaminen johti ohjelmoituun solu-kuolemaan AKT/PI3K-signalointireitin kautta. Meidän omissa tutkimuksissamme AKT1-entsyymin fosfory-lointi ei muuttunut istukan soluissa vaikkakin CPPED1:n määrä muuttui. Sen sijaan, CPPED1-määrän laski-essa PI3K-signalointireittiä negatiivisesti säätelevien proteiinien määrät lisääntyivät istukasta peräisin ole-vassa solulinjassa.
Vertailevassa mikroRNAomiikassa, jossa vertailtiin alatiesynnytyksistä ja keisarinleikkauksista peräisinolevien istukoiden mikroRNA-molekyylejä, havaitsimme merkittäviä muutoksia 54 mikroRNA-molekyyli-en määrissä. Näistä 54 mikroRNA:stä 23 mikroRNA:n määrät nousivat ja 31 mikroRNA:n määrät laskivatspontaaneiden täysiaikaisten synnytysten istukoissa. Eräs mikroRNA, jonka määrä nousi spontaanin synny-tyksen istukassa, oli miR-371a-5p. Osoitimme, että miR-371a-5p sitoutuu CPPED1:n lähetti-RNA:n 3’UTR-alueelle, minkä seurauksena lähetti-RNA:n määrä laski. CPPED1- ja miR-371a-5p-tasot siis korreloivatkäänteisesti toisiinsa istukoissa, jotka ovat peräisin spontaaneista synnytyksistä. Näin ollen äitien verestämitatut CPPED1 ja miR-371a-5p määrät voisivat olla potentiaalinen diagnostinen biomarkkeri spontaaninsynnytyksen ennustamisessa.
CPPED1:n toimintojen selvittämiseksi käytimme proteiinimikrosirutekniikkaa tunnistaaksemme proteii-neja, jotka voisivat mahdollisesti olla vuorovaikutuksessa CPPED1:n kanssa. Kyseinen proteiinimikrosirusisälsi noin 75% ihmisen solun kaikista proteiineista. Proteiinimikrosirumenetelmällä CPPED1:n osoitettiinsitoutuvan 36 erilaiseen proteiiniin. Näistä kahden proteiinin, PAK4:n ja PIK3R2:n, vuorovaikutuksetCPPED1:n kanssa varmistettiin kahdella muulla menetelmällä. Immuunisaostuksen avulla osoitettiin, ettäCPPED1 muodosti tiiviin kompleksin sekä PAK4:n että PIK3R2:n kanssa. Kaksoisfluoresenssikomplement-timenetelmän avulla havaitsimme, että CPPED1 sijaitsi solun sisällä samoissa paikoissa kuin PAK4 jaPIK3R2. Lisäksi massaspektrometrianalyysillä osoitimme, että CPPED1 poisti fosfaattiryhmiä PAK4:n tie-tyistä seriiniaminohapoista; näiden fosforylointikohtien toiminnallinen merkitys PAK4:lle on vielä tuntema-ton. Siten CPPED1 merkitys PAK4:n ja PIK3R2:n toiminnoille vaatii vielä lisätutkimuksia.
Asiasanat: AKT1, CPPED1, massaspektrometria, miR-371a-5p, miRNA, PAK4,PIK3R2
Dedicated to my family
8
9
Acknowledgements
This work was carried out at the PEDEGO Research Unit and the Medical Research
Center Oulu, University of Oulu and Oulu University Hospital, during the years
2016-2020. I wish to acknowledge all people who have contributed to this work
and supported me during these years.
I would like to sincerely thank the trio of my supervisors including Professor
Mika Ramet, Professor Mikko Hallman and Docent Antti Haapalainen. My
principal supervisor Mika Ramet is especially acknowledged for his insightful
comments and advice in different situations as well as for his positive and
encouraging support. I am grateful to Mikko Hallman for giving me the opportunity
to work in his group and I value his curiosity and open-mindedness towards
research. I would like to thank my third supervisor Antti Haapalainen for his
support throughout this project.
I would also like to extend my sincere gratitude to the pre-examiners of this
thesis, Professor Markku Varjosalo and Docent Tomi Airenne for their constructive
comments to improve the contents of the thesis. I am grateful to Professor Jaana
Rysä for agreeing to be my opponent and I look forward to our discussion.
I warmly thank all former and present members of our research group. I wish
to thank Anu Pasanen, Maarit Haarala, Minna Karjalainen, Heli Tiensuu, Marja
Ojaniemi, Johanna Huusko and others for their assistance, peer support and
intriguing conversations in the laboratory, during coffee breaks and in many other
situations. Special thanks to Marjatta Paloheimo for the help whenever I needed it.
I also wish to thank the people of CRC for such a friendly atmosphere and indulging
in interesting conversations. I wish to thank the members of my follow-up group,
Professor Lauri Eklund and Dr. Tiila-Rikka Kiema for their time and encouraging
comments. Likewise, I also want to thank the members of the neighbouring labs of
Docent Reetta Hintala and Professor Johanna Uusimaa and Antti Nätynki, Jussi
Tuusa, Masuma Aman. I also sincerely thank the faculty members of the Clinical
Research Center.
I thank to my best friends Dr. Venkateswarlu Raavi, Dr. Gaurav Soman, Dr.
Mastan babu, Dr. Vangipurapu Rajanikanth, Dr. Madhavi Padala, Anil, Sanjeeva,
Obul reddy, Vijay, Dr. Kanuru Madhavi, Dr. Saikrishna, Dr. Kedar and all my other
friends during graduation and postgraduation.
I extend my thanks to previous workplace at the CCMB Research group to Dr.
Yogendra Sharma and the YS Group (Rajanikanth, Shashi, Amita, Rajeev Raman,
Shantiswaroop, Vijeta, Balkrishn and Raji).
10
I thank my latter workplace at the NCCS research lab of Dr. Debashis Mitra
and his group (Priyanka, Surya, Tracy, Kailash, Jay) along with my batchmates of
NCCS 2012 for their immense support for making me learn the struggles for
existence and survival of the fittest throughout my thick and thins.
I also thank Dr. Karuna Rupula, Prof. Beedu Sashidhar Rao, Dr. Raju, Suresh
and Dr. Shyam at Osmania University, Biochemistry department.
My special thanks and grateful to my friends in Oulu, Dr. Abhishek Sharma,
Dr. Dhirendra Singh, Shruthi Sridhar, Surbhi Mishra, Pooja, Dr. Bishal Singh, Dr.
Srinivas kumar, Vamsikrishna and other Indian friends in Oulu for all the good
times and educational moments we have shared during these years.
I thank my family members, my uncle Srinu Mamayya and son in laws Harsha
and Rakesh, for their love and support. I express my deep gratitude to my brothers
Hari babu and Kiran Kumar and brother in-law Akshay Rai for their enormous love
and support all throughout. I thank my sister in-law Jyothsna, Shristi Rai and my
nephews Aravind and Karthik for their charming smile and love towards me. I
thank my sister Umarani and younger brother Srikanth for their love.
My special thanks to my spouse and life partner Supriya Rai for her
unconditional love and support in every phase of my struggle and sufferings. I rely
on your support for which I feel very lucky and grateful. I hope I can bring even a
fraction of the love, happiness, and joy into your life that I have received from you.
Finally, I thank my parents for their wholehearted love and never-ending
support throughout my life till now. Nothing would have been possible without you
and your support.
The work was conducted with the support of grants from the Jane and Aatos
Erkko Foundation (MH, MR), the Sigrid Jusélius Foundation (MH), and from the
Academy of Finland, Foundation for Pediatric Research and the University of Oulu
Scholarship Foundation.
Date Ravindra.Daddali
16.11.2020
11
Abbreviations
3’UTR 3’ untranslated region
ADAM12 A disintegrin and metalloprotease 12
AF Amniotic fluid
β-hCG Beta Human Chorionic Gonadotropin
BiFC Bimolecular fluorescence complementation
CNA Calcineurin A
CPPED1 Calcineurin Like Phosphoesterase Domain Containing 1
CVF Cervico-vaginal fluid
C14MC Chromosome 14 miRNA cluster
C19MC Chromosome 19 miRNA cluster
CD Circular dichroism
co-IP co-immunoprecipitation
C1qTNF5 Complement C1q Tumor Necrosis Factor-Related Protein 5
CSTP1 Complete S transactivated protein
CRH Corticotropin-releasing hormone
CYC1 Cytochrome c1
DNA-PK DNA-dependent protein kinase
ETB Elective term birth
fFN Fetal fibronectin
GRB2 Growth Factor Receptor Bound Protein 2
HD Hydrophobic Domain
IAI Intra-amniotic infection
IGFBP-1 Insulin-like growth factor-binding protein 1
ILK Integrin-linked kinase
LC-MS/MS Liquid chromatography–tandem mass spectrometry
MPEs Metallophosphoesterases
MPPs Metalloproteinphosphatases
miRNA Micro-RNA
mTORC Mechanistic target of rapamycin complex
PAK4 p21 Activated Kinase 4
PIP3 Phosphatidyl Inositol 3, 4, 5 triphosphate
PDK1 Phosphoinositide-dependent kinase 1
PI3K Phosphoinositide-3-Kinase
PIK3R2 Phosphoinositide-3-Kinase Regulatory Subunit 2
PAMG-1 Placental alpha macroglobulin-1
12
PlGF Placental growth factor
PTEN Phosphatase and tensin homolog
PP13 Plasma protein 13
PH Pleckstrin homology
PCR Polymerase chain reaction
PE Preeclampsia
PAPP-A Pregnancy associated plasma protein A
PSG Pregnancy specific glycoproteins
PROM Premature rupture of fetal membranes
PTB Preterm Birth
PP2A Protein phosphatase 2 A
PAP Purple Acid phosphatase
q-RTPCR Quantitative Real time PCR
sEng Soluble endoglobin
sFIt-1 Soluble fms-like tyrosine kinase-1
STB Spontaneous term birth
SLS Static light scattering
SELDI Surface-enhanced laser desorption ionization
TNF Tumor necrosis factor
uNK uterine Natural killer cells
VEGF Vascular endothelial growth factor
13
Original publications
This thesis is based on the following publications, which are referred to throughout
the text by their Roman numerals:
I Haapalainen AM, Karjalainen MK, Daddali R, Ohlmeier S, Anttonen J, Määttä TA, Salminen A, Mahlman M, Bergmann U, Mäkikallio K, Ojaniemi M, #Hallman M, #Rämet M. (2017). Expression of CPPED1 in human trophoblasts is associated with timing of term birth. J Cell Mol Med. 2018 Feb;22(2):968-981
II Daddali R, Ojaniemi M, Hallman M, Rämet M& Haapalainen AM. (2020). MicroRNA-371a-5p targets CPPED1, and its expression in human placenta is associated with spontaneous delivery. Plos One. 2020 PLoS One. 2020 Jun 10;15(6):e0234403
III #Haapalainen AM, #Daddali R, Hallman M, Rämet M. Human CPPED1 belongs to calcineurin-like metallophosphoesterase superfamily and dephosphorylates PI3K-AKT pathway component PAK4 (Submitted)
# Equal contribution
The contributions of the author, R. Daddali, to the work focused on molecular
biology, proteomics and miRNAomics. He did all cell culture experiments (I, II,
III), the siRNA knockdown of CPPED1 (I), confocal imaging of p-FOXO1and p-
FOXO3, miRNA isolation, miRNA transfections, luciferase assay and data analysis
(II). He carried out the experiments including cloning, protein purification, BiFC
assays, co-IP, in vitro activity assays, CD and data analysis (III).
14
15
Contents
Abstract
Tiivistelmä
Acknowledgements 9
Abbreviations 11
Original publications 13
Contents 15
1 Introduction 19
2 Review of the literature 21
2.1 Labor/delivery and the length of pregnancy ........................................... 21
2.1.1 Major complications during pregnancy and delivery ................... 23
2.1.2 Biomarkers for labor and pregnancy complications ..................... 24
2.2 Human Placenta ...................................................................................... 26
2.2.1 Placental development and functions ........................................... 27
2.2.2 Placental genes, proteins and miRNAs ......................................... 29
2.2.3 Placental abnormalities and pregnancy complications ................. 30
2.3 Proteomics and pregnancy ...................................................................... 30
2.3.1 Proteomic changes in the placenta during pregnancy ................... 31
2.3.2 Human placental proteomics of preterm birth .............................. 32
2.3.3 Proteins as biomarkers of preterm birth from various body
fluids ............................................................................................. 33
2.4 Immune cells and inflammatory biomarkers in term and preterm
labor ........................................................................................................ 38
2.5 miRNAs in labor and pregnancy ............................................................. 40
2.5.1 Biogenesis of miRNAs ................................................................. 41
2.5.2 miRNA functions: ......................................................................... 43
2.5.3 Placental specific /Pregnancy associated miRNA-clusters ........... 46
2.5.4 miRNAs as biomarkers of pregnancy complications ................... 50
2.5.5 Circulating placenta-derived microRNA as biomarkers ............... 52
3 Aims of the study 55
4 Materials and Methods 57
4.1 Molecular Cloning (III) ........................................................................... 57
4.1.1 Generation of plasmid constructs for a BiFC analysis (III) .......... 57
4.2 Protein purification (III) .......................................................................... 57
4.3 In vitro phosphatase activity assay (III) .................................................. 58
4.4 Protein microarray (III) ........................................................................... 58
16
4.5 Immunoprecipitation of CPPED1 interacting partners and
western blotting (III) ............................................................................... 59
4.6 Bimolecular fluorescence complementation assay (III) .......................... 59
4.7 Phosphatase assay detection by mass spectrometry (III) ........................ 60
4.8 Placental miRNA isolation (II) ................................................................ 60
4.9 Quantitative analysis of CPPED1 mRNA by qPCR (II) ......................... 60
4.10 Quantitative PCR of hsa-miR-371a-5p (II) ............................................. 61
4.11 Luciferase assay (II) ................................................................................ 61
4.12 siRNA knockdown of CPPED1 and transcriptomics of siRNA
samples (I) ............................................................................................... 62
5 Results 63
5.1 Proteomic changes associated with spontaneous term deliveries
(I) ............................................................................................................. 63
5.1.1 Placental differential protein expression between
chorionic and basal plates ............................................................. 63
5.1.2 CPPED1 expression levels and its polymorphism
associated with gestational age ..................................................... 64
5.1.3 AKT1 phosphorylation levels are unaffected by variations
in CPPED1 expression levels ....................................................... 64
5.1.4 CPPED1 silencing in HTR-8 trophoblasts and mRNA
transcriptomics (I) ........................................................................ 64
5.2 miRNA transcriptomics of spontaneous term birth (II) ........................... 65
5.2.1 miRNA transcriptomics identifies differential miRNA
expression in spontaneous and elective term placentas (II) .......... 65
5.2.2 Comparison of human placental proteomics and
miRNAomics identifies a miR-371a-5 -CPPED1 pair (I,
II) .................................................................................................. 65
5.2.3 CPPED1 mRNA levels are decreased and miR371a-5p
levels increased during spontaneous delivery (II) ........................ 66
5.2.4 miR-371a-5p and miR-520d-5p bind to the 3′UTR of
CPPED1........................................................................................ 66
5.3 CPPED1 classification and its functional role ........................................ 67
5.3.1 CPPED1 sequence alignment suggests a
metallophosphotase family protein (III) ....................................... 67
5.3.2 CPPED1 dephosphorylates AKT1 in vitro ................................... 67
5.3.3 CPPED1 interacts with multiple proteins in an in vitro
protein microarray ........................................................................ 68
17
5.3.4 CPPED1 and binding protein interactions confirmed by
co-IP and a BiFC assay ................................................................. 68
5.3.5 CPPED1 dephosphorylation activity on the PAK4 and
PIK3R2 proteins ........................................................................... 69
6 Discussion 71
6.1 Proteomic changes in spontaneous term and elective term
placentas (I) ............................................................................................. 71
6.1.1 Placenta has a unique set of proteins at the fetal and
maternal sides ............................................................................... 71
6.1.2 CPPED1 expression levels and polymorphisms associated
with the length of gestation and spontaneous term birth .............. 72
6.2 The expression levels of miRNAs associate with the outcome of
labor (II) .................................................................................................. 73
6.2.1 miR-371a-5p ................................................................................. 73
6.2.2 CPPED1 is targeted by miR-371a-5p and their expression
levels inversely associate with each other .................................... 73
6.3 Homo sapiens CPPED1 belongs to the calcineurin-like
metallophosphoesterase superfamily (III) ............................................... 74
6.3.1 CPPED1 mediates the dephosphorylation of AKT1 ..................... 74
6.3.2 Interaction between CPPED1 and selected target proteins
were confirmed using co-immunoprecipitation and BiFC
experiments .................................................................................. 76
6.4 Prospects for future studies ..................................................................... 79
7 Conclusions 81
References 83
Original publications 99
18
19
1 Introduction
The molecular mechanisms associated with the onset and timing of human
parturition are still poorly understood (Norwitz et al., 2015). Depending on the
length of the pregnancy, the deliveries are categorized into term, postterm and
preterm births. Births before 37 weeks of gestation are premature and those taking
place at 42 weeks of pregnancy or later are defined as post term (Muglia & Katz,
2010; Schierding, O'Sullivan, Derraik, & Cutfield, 2014). At least ten percent of all
births are premature and about fifteen million premature infants are born each year.
Prematurity is the major determinant of neonatal mortality and morbidity, as these
children have multiple, mostly acquired disorders and they are at high risk of
having long term morbidities. Nearly 70% of preterm births start spontaneously,
and the rest are elective as a result of a medical condition of the mother, fetus or
the placenta. Hereditary factors, environmental exposures, infertility treatments,
behavioral and socioeconomic factors influence the risk of premature birth.
However, spontaneous onset is the most common cause of premature birth (Esplin,
2014).
Molecular mechanisms underlying the onset and progression of labor, preterm
labor and postterm delivery, are not known in detail. The genomes of the mother
and the fetus influences the length of the pregnancy and the risk of premature birth.
Understanding the pathology and biochemistry of the maternal- fetal interface of
the placenta using a genomics, transcriptomics (including miRNA) and proteomics
approach helps to elucidate the function of candidate genes, gene variants, mRNA
and proteins (Aghaeepour et al., 2018; M. Cai, Kolluru, & Ahmed, 2017).
Comparative studies on term placentas with different gestational weeks may reveal
genes and proteins in placental tissues underlying pregnancy complications.
The aim of this research was to study the biochemical mechanisms of labor and
delivery, using hypothesis free approaches of proteomics, genomics and
transcriptomics combined with microRNA (miRNA) analyses. We discovered that
CPPED1, a protein phosphatase, was downregulated in placentas from spontaneous
births. We identified a microRNA, miRNA-371a-5p, which targets CPPED1.
Further, we found that CPPED1 interacts with the PAK4 and PIK3R2 proteins,
dephosphorylating five different serines on PAK4. In conclusion, CPPED1 or
miRNA-371a-5p could be a biomarker for labor. The biological significance of
PAK4 dephosphorylation by CPPED1 remains to be studied.
20
21
2 Review of the literature
2.1 Labor/delivery and the length of pregnancy
Labor or delivery is a physiological process that results in the expulsion of the fetus,
placenta and fetal membranes from the uterus. It occurs in various time dependent
processes including uterine contractions and cervical dilations, which cause the
rupture of the fetal membrane leading to delivery. Labor in animals involves
changes in the hormonal levels of both the maternal and fetal circulations
(endocrine events). While, in humans labor involves complex biochemical
crosstalk between the fetoplacenta and the mother (autocrine, paracrine and
endocrine events) and immune endocrine events (Kota et al., 2013). Hormones
produced by both mother and fetus (placenta) are important in maintaining the
favorable environment and sufficient nutrition for the fetus. Modulation of the
maternal immune system is crucial for the immune survival of the semi allogeneic
fetus in the mother and this is supported by steroid (progesterone, estradiol,
corticosteroids) and peptide hormones (prolactin, oxytocin, human chorionic
gonadotropin and relaxin). All of them play a major role in maternal
immunomodulation (Nair, Verma, & Singh, 2017). The heterogeneous mechanisms
of parturition are due to the genetic conflict between maternal and paternal genes
and placental hormone synthesis regulated by genomic imprints (John, 2013). Early
studies suggested that the timing of birth depends on both the development of the
placenta, and the level of corticotropin-releasing hormone (CRH) produced by
placenta (McLean et al., 1995).
Length of pregnancy and types of birth/ labor
The mean duration of human pregnancy is between 39 to 40 weeks and varies
slightly between populations. Depending on the length of the pregnancy, births are
mainly classified into term, preterm and postterm term births (Morgan & Cooper,
2020) (Fig. 1).
Preterm birth: Babies born before 37 weeks of gestation are called premature
birth or preterm birth, which is further divided into moderately preterm (32-36 wk),
very preterm (28-31 wk) and extremely preterm (< 28 wk). Children who were born
as premature are at a higher risk of health complications such as cerebral palsy and
developmental disorders than are children delivered at term and the risk increases
22
according to the degree of prematurity and the intrauterine growth retardation
(IUGR) (Lee et al., 2017). Infections are commonly associated with premature birth.
Chorioamnionitis, a common phenotype associated with spontaneous premature
birth, may often be a manifestation of an infection.
Term birth: Babies that are born in between 39+0 to 41 weeks of gestation are
termed as full term or spontaneous term births, while babies that are born between
37-39 weeks are called as early term and between 41 to 42 weeks are late term.
Elective preterm deliveries before 37 weeks of gestation take place mostly by
cesarean section (ACOG committee opinion no 579: Definition of term
pregnancy.2013). Particularly in complications such as preeclampsia or IUGR
labor may precipitate acute asphyxia. In addition, bleeding from the placenta
around the cervix (Placenta previa) is an indication for cesarean section. In
multiple pregnancies and particularly in pregnancies with severe maternal or fetal
disease, elective deliveries may be indicated. In postterm pregnancies, the infants
are born after 42 weeks of gestation (Morgan & Cooper, 2020). In many cases labor
is induced before 42 weeks of gestation and postmature mothers often undergo
elective cesarean section. Infants born post term are prone to conditions such as
IUGR, birth asphyxia and to obstructed labor.
Labor and delivery as well as elective births by cesarean section are associated with
several complications that can cause adverse effects to the newborn or the
mother.
Hence, there is a need to understand the molecular mechanisms associated with
preterm, term and postterm births
Fig. 1. The timeline of human pregnancy: A normal human pregnancy or average
childbirth lasts for 39 to 41 weeks of gestation (Full term). Preterm birth occurs before
37 weeks, while 37 to 39 are early term, 41 to 42 are late term and post mature birth
takes place after 42 weeks of gestation. (Modified from Häggström, Mikael 2014
https://en.wikipedia.org/wiki/Gestational_age).
23
2.1.1 Major complications during pregnancy and delivery
As per reports in 2017, there has been a decline in the maternal death rate by 44
percent due to pregnancy associated complications. Conversely, 830 women die
every day due to causes related to pregnancy, childbirth, injuries and infections or
disabilities (https://www.who.int/news room/fact-sheets/detail/maternal-mortality).
The center for disease control and prevention (CDC) has initiated an effort to
improve the health of both neonates and mothers and to reduce the number of
maternal mortalities.
The regulation of the pregnancy duration is still poorly understood. In most
cases the pregnancy ends at the onset of labor and subsequent delivery. Many
pregnancy complications take place during labor. Most complications are evident
when the labor is either premature or postmature. Problems can be caused either by
the mother, fetus or the placenta. A common complication is premature rupture of
the membranes before the onset of labor. Another typical complication of
pregnancy is preeclampsia, which is seen as symptoms in the mother (high blood
pressure, proteinuria). In most severe cases the mother develops convulsions due
to eclampsia.
Detachment of the placenta (abruptio) with or without labor is a serious
although rare complications causing severe fetal asphyxia. Further complications
include the abnormal position or abnormal presentation of the fetus. Multiple
pregnancies are also associated with excessive complications; one of them is
premature birth. Complications during labor include shoulder dystocia, nuchal cord
and a prolapsed umbilical cord. Amniotic fluid embolism and placenta accreta are
complications manifesting during labor and delivery. Representative complications
are listed in Table 1.
24
Table 1. Common complications arising during labor
Complication name Features/Causes Reference
Obstructed labor
Preeclampsia
Postpartum bleeding
Postpartum infections
Gestational diabetes
Neonatal infections
Perinatal asphyxia
Too small or deformed pelvis. Prolonged labor, failure of vaginal delivery High blood pressure, proteinuria and risk of seizures in pregnant women. Restriction of fetal growth
Uterine atony, uterine constriction,
retention of parts of placenta
Consequences of heavy blood loss
Puerperal fever
Common in miscarriages
High blood sugar, preeclampsia,
polycystic ovary syndrome (PCOS)
Infection obtained intranatally: Str.
agalactiae. E. coli, Listeria infections
Insufficient O2 supply during birth
Multiple organ damage, persistent brain
damage
(Neilson, Lavender, Quenby, &
Wray, 2003)
(Lambert, Brichant, Hartstein,
Bonhomme, & Dewandre, 2014
(Weeks, 2015)
(Loudon, 1998)
(McIntyre et al., 2019)
(Chan, Lee, Baqui, Tan, & Black,
2013)
(Aslam et al., 2014)
2.1.2 Biomarkers for labor and pregnancy complications
There has been a long quest to understand the outcome of pregnancy and the
associated complications. It would be helpful to develop accurate biomarkers for
the prediction of a specific disorder and eventually to provide effective treatment
and prevention of severe consequences. Screening for fetal aneuploidy in the first
trimester is a commonly used test for the prediction of chromosomal incongruity.
The development of multiparametric tests for aneuploidy using multiple
biomarkers in early pregnancy helps in the prognosis of also other pregnancy
complications such as preeclampsia, fetal growth restriction, gestational diabetes
and preterm births.
25
In fetal growth restriction (FGR), the fetus fails to grow according to the
duration of the pregnancy. FGR is detected by fetal ultrasound and confirmed at
birth. Growth restricted fetuses have a higher risk of metabolic and cardiovascular
diseases in postnatal life than do children born at term (Malhotra et al., 2019). FGR
can arise from placental maternal or fetal factors.
For instance, FGR in severe preeclapsia is associated with the poor
development of placental villae. Many biomarker tests are available for the
prediction of FGR due to placental insufficiency, which includes fetal nuchal
translucency (NT) thickness, serum pregnancy associated plasma protein-A (PAPP-
A), free beta-human chorionic gonadotropin (beta-hCG), placental growth factor
(PlGF), placental protein 13 (PP13), and A disintegrin and metalloprotease
(ADAM12) (Kane, Costa Fda, & Brennecke, 2014) . PP13, which is majorly
expressed by the syncytiotrophoblast of the placenta and released into the
circulation and its low concentrations in the first trimester turned out to be a good
biomarker for pregnancy complications. Similarly, PIGF in the third trimester was
suggested to be potential biomarker of FGR and preeclampsia. Other studies
reported beta human beta-hCG and ADAM12 as diagnostic markers of FGR (Gullai
et al., 2013; Rausch et al., 2011; Than et al., 2004).
A wide range of maternal serum analytes have been used as biomarkers for
predicting preterm birth including PAPP-A and PP13 as markers of placental
function, and Inhibin A and Activin A as proteins of placental origin, angiogenesis
agents such as PIGF and vascular endothelial growth factor (VEGF), soluble fms-
like tyrosine kinase-1 (sFIt-1) and soluble endoglobin (sEng)(Oskovi Kaplan &
Ozgu-Erdinc, 2018). None of these is satisfactory in predictive accuracy. Fetal
fibronectin (fFN) is the most extensively investigated biomarker for the prediction
of preterm labor and delivery. Usually fFN is absent in cervicovaginal fluids from
week 24 of gestation. However, the presence of fFN implies the disruption of the
choriodecidual barrier and eventually leads to an increased risk of preterm labor.
Based on several reports on the biomarkers for the prediction of labor, the outcome
is inconclusive and extensive research is needed to identify accurate analytes from
the maternal circulation, such as is serum matrix metalloproteinase-12 for the
detection of an ectopic pregnancy (Rausch et al., 2011). Currently, there are no
reported biomarkers for the onset of term labor so far.
26
2.2 Human Placenta
The human placenta is structurally very different from most mammalian placentas,
although it resembles that of other great apes (Carter & Mess, 2007; Enders &
Carter, 2012). It is discoidal in shape and at term its mean weight is 500 g, length
22 cm and thickness 2.5 cm. It connects to the fetus by the umbilical cord, which
is 55-60 cm in length, inserted into the placenta and contains two umbilical arteries
and one vein (Fig. 2). These blood vessels emanate from the placenta and are further
divided into more branches resulting in formation of villous tree structures, grouped
into lobules called cotyledons (Turco & Moffett, 2019). The human placenta is
hemo-monochorial as the maternal blood flows from the uterine spiral arteries into
the intervillous space, where the maternal blood is in direct contact with fetal
syncytiotrophoblasts that line with the intervillous fetal capillaries.
In early human pregnancy, proliferation of invading trophoblasts from the outer
layer of the blastocyst triggers specific reactions in the uterine wall that lead to the
development of the placenta. The trophoblasts lining the extraembryonic
membranes of the placenta have essential roles throughout pregnancy. Human fetal
membranes composed of an amnion and a chorion also known as the
chorioamniotic membranes are derived from the outer trophoblast layer. The
amnion is the innermost layer in contact with the amniotic fluid, fetus and umbilical
cord, connected with the chorion. The chorion separates the amnion from the
maternal decidua and uterus (Menon, Richardson, & Lappas, 2019). The decidua
is a modified mucosal endometrium layer of the uterus, formed from the maternal
part of the placenta in a process called decidualization, which is influenced by
progesterone.
27
Fig. 2. The structure of the human placenta: The human placenta has two sides. The
fetal side is also called the chorionic side and the maternal side is known as the Basal
plate. The chorion contains the umbilical arteries, the umbilical vein and the amnion.
The maternal side contains the basal plate, decidual basalis, and myometrium (Modified
from https://mybiblioteka.su/tom2/3-98667.html).
2.2.1 Placental development and functions
After 6-7 days of fertilization, the blastocyst attaches to the uterine decidual wall
and the formation of the placenta begins. The outermost layer of blastocyst cells
consists of trophoblasts. The placenta is composed of trophoblasts, decidual cells,
endothelial cells and vascular smooth muscle cells, as well as multiple
mesenchymal, interstitial and immune cells. Morphologically the placenta has three
different trophoblasts named cytotrophoblasts, syncytiotrophoblasts and
extravillous trophoblasts. The overlying layer outer to the cytotrophoblast is the
syncytiotrophoblast, formed from the fusion of undifferentiated and highly
proliferative cytotrophoblasts. Chorionic villi are the main functional units of the
placenta within which the fetal blood and the maternal blood are separated by the
trophoblast layer and the villous capillary endothelium. Extravillous trophoblasts
formed from cytotrophoblasts detach from the placenta and migrate into the
maternal decidua (Castellucci, Scheper, Scheffen, Celona, & Kaufmann, 1990;
Huppertz, 2008).
28
The decidua is the modified mucosal lining of the endometrium, formed in
pregnancy due to decidualization. The decidua contains a large population of
endometrial granular leukocytes made up of specialized uterine natural killer cells
(uNK) and dendritic cells, whereas polynuclear leukocytes and B cells are scarce.
The decidua enabled gas and nutrient exchange by allowing the invasion of
trophoblasts into the maternal sides. It also protects the fetus from the invasion of
the maternal immune system throughout the pregnancy. Abnormalities in
decidualization associate with endometriosis, which could lead to miscarriage and
premature birth (Edmondson et al., 2009).
Placental functions:
Major functions of the placenta include nutrient and oxygen uptake and the
exchange of several constituents between the developing fetus and the maternal
circulation. In addition, the placenta is also involved in the secretion of hormones
and growth factors, thermogenesis, and the excretion of metabolic products such as
CO2 and urea. It is involved in protecting the fetus from infections, xenobiotics and
maternal diseases. Along with the maternal control of uterine functions that are vital
to the pregnancy outcome. The placenta maintains interdependent signaling
between the maternal and fetal compartments. Functional changes occur in the
placenta during pregnancy to accommodate the increasing metabolic demands of
the developing fetus (Costa, 2016; Gude, Roberts, Kalionis, & King, 2004).
Metabolic and endocrine functions:
The placenta grows throughout the pregnancy and the development of blood supply
to the placenta is completed by 14th week of pregnancy. The placenta functions as
a barrier between the chorionic (Fetal side) and the basal plate/Decidua (Maternal
side) formed from both fetal and maternal tissues. Syncytiotrophoblasts are the
major cells secreting different hormones such as human chorionic gonadotropin,
progesterone, estrogens and metabolites such as placental lactogen, placental
growth hormone, leptins, adiponectin, resistin, adipokines, PAPP-A, PP-13,
inhibins and activins. All these placental hormones and metabolites are important
and play a major role in maintaining the pregnancy, fetal development and labor
(Costa, 2016)
29
Placental exosomes:
As the gestational age progresses, the turnover of villous trophoblasts increases and
generates a variable size of micro particles or extracellular vesicles called exosomes
(typically 30-150 nm in diameter). These exosomes that are released into the
circulation and are taken up by maternal immune and endothelial cells induce
changes in maternal compartments (Redman & Sargent, 2008). Placental exosomes
can be found in maternal plasma from 6 weeks of gestation and their magnitude
increases as the gestation advances as well as in pregnancy complications like
diabetes and preeclampsia (M. D. Mitchell et al., 2015). Placental exosomes
contain a variety of miRNAs encoded by chromosome 19 (C19MC), chromosome
14 (C14MC) and other placenta specific miRNAs which attenuate various cellular
processes and confer viral resistance by inducing autophagy in engulfed cells
(Delorme-Axford et al., 2013).
2.2.2 Placental genes, proteins and miRNAs
70% of the human protein coding genes are expressed in the placenta. The human
protein atlas shows that the placenta expresses 1104 placenta specific genes which
are not detected in any other tissue (www. proteinatlas. org/humanproteome/ tissue/
placenta-function) and most of them are secreted proteins, expressed in
trophoblasts and likely have pregnancy specific functions. Examples of proteins
whose expression is elevated in the placenta compared to other organs and tissues
are Paternally Expressed 10 (PEG10) and the cancer testis antigen Prostate-
Associated Gene Protein 4 (PAGE4) (Placenta has higher expression levels than
any other tissue followed by epididymis, prostate, seminal vesicles and testis)
expressed in cytotrophoblasts, Chorionic Somatomammotropin Hormone 1 (CSH1)
and the metastasis-suppressor KiSS-1 (KISS-1) expressed in syncytiotrophoblasts,
while Pregnancy-Associated Plasma proteinA2 (PAPPA2) and Proteoglycan 2
(PRG2) are expressed in extravillous trophoblasts (Uhlen et al., 2015).
Transcriptome analyses have identified that in addition to placenta specific genes
and proteins, the placenta has its own specific miRNA clusters such as the C19
miRNA cluster (C19MC) located on chromosome 19, the chromosome 14 miRNA
cluster (C14MC) and the miRNA 371-373 clusters which are exclusively expressed
in the placenta (M. Cai et al., 2017).
30
2.2.3 Placental abnormalities and pregnancy complications
Normal structural functions of the placenta are essential for the growth of the fetus
throughout the pregnancy. Severe preeclampsia, placental abruption and abnormal
cord insertion are associated with more than 50% of stillbirths (Vergani et al., 2008).
Abnormalities in the placenta results in a decrease in the levels of PAPP-A protein
and an increase in the levels of alpha-fetoprotein (AFP) aggravates the risk of
stillbirth by 50% (G. C. Smith et al., 2006). A genetic analysis demonstrated that
genes imprinting in the placenta is altered in pregnancy loss and epigenetics studies
support the observation that stillbirths and pregnancy loss can be a consequence of
confined placental mosaicism (Goodfellow, Batra, Hall, McHale, & Heazell, 2011).
Common pathological conditions of the placenta include fetal thrombotic
vasculopathy, chronic intervillositis, chorioamnionitis, funisitis, massive
perivillous fibrin deposition, villous dysmaturity, and cord lesions. Further research
is needed to obtain a better understanding of placental pathology in stillbirths and
other pregnancy complications (Rathbun & Hildebrand, 2020; Warrander &
Heazell, 2011). Furthermore, studies have identified various placental
abnormalities such as chorioangioma, circumvallate placentation, placenta
membranacea, vasa previa, placenta accreta spectrum and abnormal
cytotrophoblastic invasions as well as gestational trophoblastic disease or neoplasia.
2.3 Proteomics and pregnancy
Proteomics broadly refers to the identification and quantification of overall proteins
derived from the genome or the entire set of proteins produced by an organism or
system. The term proteomics was coined by Marc Wilkins as an analogy to the term
genomics (Wilkins et al., 1996). After genomics and transcriptomics, proteomics
has gained a lot of importance in understanding and addressing biological questions.
Cells or tissues make different sets of proteins under different cellular processes
during the cell cycle, differentiation, proliferation, development and further
complexity of the proteome arises due to a wide range of posttranslational
modifications. Proteomic strategies mainly based on protein expression, structure
and functional aspects can link dynamic changes to various physiological stimuli
or diseased conditions.
Identifying the biomarkers for the diagnosis of the onset of parturition
contributes to understanding the mechanisms of labor and other complications such
as preterm birth, preeclampsia and fetal growth restriction. These complications
31
can have adverse effects on the health of the woman and child (Law, Han, Tong, &
Baker, 2015). Currently there are no accurate predictive tests available for the
diagnosis of the onset of term labor nor for pregnancy related complications.
Advancements in mass spectrometry (MS) based proteomics such as electrospray
ionization (ESI), matrix-assisted laser desorption/ionization (MALDI)-based MS,
top-down proteomic and peptidomic profiling by laser mass spectrometry, liquid
chromatography or capillary electrophoresis coupled to MS, bottom-up
quantitative proteomics and targeted proteomics by liquid chromatography MS
have been explored to elucidate protein biomarkers and biological mechanism
underlying pregnancy-related complications and various cancers. These
methods have emerged as a powerful tools to provide breakthroughs in
understanding the pathophysiology of complex pregnancy diseases (Kolialexi,
Mavrou, Spyrou, & Tsangaris, 2008; Law et al., 2015; Shankar et al., 2005).
2.3.1 Proteomic changes in the placenta during pregnancy
The biological process of human parturition is not yet completely understood. The
human placenta secretes several hormones and peptides to maintain the intricate
balance throughout pregnancy and this balance is disturbed in gestational diseases.
Identification of these changes may eventually be used to predict the onset of labor
and placental disorders leading to FGR. For example, measuring the levels of
human chorionic gonadotropin (hCG) levels allows the detection of early
pregnancy problems and gestational trophoblastic disease (GTD) (Kharfi, Giguere,
De Grandpre, Moutquin, & Forest, 2005). Similarly, other protein biomarkers
related to PE including, VEGF, sFlt1, PlGF, sENG, PAPP-A, PP13, HSP70 and
other proteins have been shown to be used in the prediction or diagnosis of PE,
which helps in understanding the pathogenesis of PE (He, Zhou, Wei, & Li, 2020).
Lowered oxygen tension is known to affect trophoblast differentiation through
transcription factors such as hypoxia-inducible factor-1(HIF-1) and transforming
growth factor β3 (TGFβ) (Caniggia et al., 2000; Genbacev, Zhou, Ludlow, & Fisher,
1997). A reduction in oxygen tension, like in preeclampsia, leads to changes in less
than 3% of expressed proteins, mainly resulting in the downregulation of
antioxidants and the upregulation of glycolytic enzymes. A significant increase in
the level of annexin II, a protein associated with proliferation and fibrinolysis under
hypoxic conditions, was reported (Menaa et al., 1999; Rao, Denslow, & Block,
1994). Functional proteomics studies have identified annexin II, which binds to
32
placental protein 13 (PP13)/galectin 13, whose dimerization affects oxygen
changes in the placenta (Than et al., 2004).
Despite the importance of the placenta in pregnancy, very little is known about
the proteomic changes in the human placenta. Mushahary et al., investigated the
protein expression profile of the full term human placenta using a two-dimensional
gel electrophoresis Mass spectroscopy (2-D gel-MS/MS) approach and identified
117 novel proteins from 2D-gel based analysis of the placenta, which belongs to
different functional classes such as cell stress, metabolism, cytoskeletal proteins,
transport proteins and signal transduction pathways (Mushahary, Gautam,
Sundaram, & Sirdeshmukh, 2013)
There has been only a limited number of proteomic studies comparing different
gestational ages during pregnancy. Fard et al., performed comparative studies of
normal human placental proteomes between the first and third trimester, identified
the variations in the expression of 11 proteins in the first trimester when compared
with the third trimester. Among the identified proteins, four proteins including
protein disulfide isomerase, tropomyosin 4 isoform 2, enolase 1, and 78-kDa
glucose-regulated protein were upregulated, while seven proteins including actin
g1 pro-peptide, heat shock protein gp96, 1-antitrypsin, EF-hand domain family
member D1, tubulin a1, glutathione S-transferase, and vitamin D binding protein
were downregulated in the first trimester vs the third trimester (Gharesi-Fard,
Zolghadri, & Kamali-Sarvestani, 2015).
2.3.2 Human placental proteomics of preterm birth
Characterization of the proteome of ex-vivo perfused placental effluents can
provide insights into the repertoire of proteins secreted by the placenta in in vivo.
Advancement in applications of these high throughput methodologies enable the
characterization of placental and cellular proteomes, unravel functional networks
along with the identification of disease markers, and can therefore significantly
improve maternal health during pregnancy (Hanash, 2003; Marko-Varga &
Fehniger, 2004; Robinson, Ackerman, Kniss, Takizawa, & Vandre, 2008).
Protein expression levels of the fetal side are different from those of the
maternal sides of the placenta and this can be a preliminary source for the discovery
of biomarkers associated with preterm births. Niu et al., collected the samples from
placentas of both the fetal and maternal sides of spontaneous preterm labors with
intact membranes (sPTL-IM) and analyzed with two-dimensional gel-
electrophoresis (2D-GE) coupled with matrix-assisted laser desorption/ionization-
33
time of flight/time of flight (MALDI TOF/TOF) mass spectrometry. Twelve
proteins with significant differential expression levels were identified in sPTL-IM
and these changes were more prominent on the fetal sides as compared to the
maternal sides. The identified proteins are involved in the regulation of the
cytoskeleton, immune response, fetal as well as placental development and the
anticoagulation cascade. Among the identified proteins S100-A9 and Ig chain C
region were upregulated, whereas Vimentin, Calpain small subunit-1, protein PP4-
X, Ferritin light chain subunit, Septin2, Peroxire-doxin 3, Cytokeratin 8,
Cytokeratin 1, Tropomo-dulin 3, Annexin A1 were downregulated in sPTL-IM
placentas (Niu et al., 2018).
In another study by Butt et al., proteomic analysis, of human preterm labor
placental membranes vs term placental membranes identified that 11 proteins,
which varied between the two phenotypes. Among the identified proteins Keratin
type I cytoskeletal 19, Annexin A4, Endoplasmin precursor, beta and Gamma actins
ERp29 are more expressed in term placentas, whereas Vimentin, 78kDa glucose
regulated protein grp78, Lactoylglutathione lyase, Transgelin were over-expressed
in preterm cases. These differentially expressed proteins belong to
structural/cytoskeletal components, ER lumenal proteins with enzymatic or
chaperone functions, and proteins with anticoagulant properties (Butt et al., 2006).
In a recent study the placenta was found to secrete thirty-four proteins into the
maternal circulation, including placental growth factor, growth/differentiation
factor 15, and matrix metalloproteinase 12, while 341 proteins were secreted into
the fetal circulation. Only 7 proteins were found to be common for both the fetal
and maternal circulations. This study signifies a distinct directionality in placental
proteins released into the fetal and maternal compartments. Among the 34 proteins
secreted into the maternal circulation, 8 were changed significantly throughout
gestational ages. Protein profiles of these placental proteins help to identify novel
minimally invasive biomarkers for human placental function across gestation and
shed light on maternal physiology and fetal development (Michelsen, Henriksen,
Reinhold, Powell, & Jansson, 2019).
2.3.3 Proteins as biomarkers of preterm birth from various body
fluids
Proteomics hase made a great impact on modern obstetrics and aided in the
identification of biomarkers for various obstetric diseases and fetal conditions such
as oocyte maturation, spermatogenesis, fertilization, endometriosis, down's
34
syndrome, preterm birth, amniotic infections, preeclampsia, intrauterine growth
restriction and obstructive uropathies (C. S. Buhimschi, Weiner, & Buhimschi,
2006; Lekhwani, Shankar, & Vaswani, 2011). The clinical proteomics provides
multiple sources for studies including maternal blood, maternal urine, placental
tissue, amniotic fluid, cervical mucus, vaginal secretions, and saliva. Proteomics
may help in the prediction, diagnosis, management, and treatment of several
obstetric conditions, which are associated with an increased risk of
maternal/perinatal mortality and morbidity (Klein et al., 2014).
The development of new technologies and methodological approaches during the
past decade has provided a motive to search for predictive and diagnostic PTB
biomarkers and many of them have been identified in several biological fluids.
Saliva biomarkers
Saliva contains progesterone and its low concentrations during 24 – 34 weeks of
gestation in women have been linked to early preterm labor, in a study following
women with a singleton pregnancy with at least one risk factor for PTB (Lachelin
et al., 2009). Fetal fibronectin (fFN) was measured at 24 and 27 weeks of gestation
in the same cohort and no correlation was observed between fFN and salivary
progesterone. In another study Priya et al., showed the utility of salivary
progesterone in the prediction of preterm birth singletons. In this study, salivary
progesterone was measured at 24 and 28 weeks of gestation and the measurement
was repeated after 3-4 weeks. Authors found that a progesterone level below
2575 pg/mL was indicative of preterm birth with a sensitivity of 83% and 86%
specificity. Thus, estimating the salivary progesterone in high risk pregnant women
may identify those who might benefit from progesterone therapy (Priya et al., 2013).
Cervical fluid
A systematic review form the early 2000’s reported that the accuracy of fetal
fibronectin in predicting spontaneous PTB varied in different studies and it is most
accurate in predicting preterm birth in women without advanced cervical dilatation
within 7-10 days after testing (Honest, Bachmann, Gupta, Kleijnen, & Khan, 2002).
In a more recent meta-analysis, it was reported that fFN levels in singleton
gestations were not predictive for PTB (Berghella & Saccone, 2016).
IL-6 and IL-8 are chemokine family members of C-X-C chemokines acting as
chemoattractants for inflammatory cells whose levels in CVF were associated with
35
PTB within 7 days. The test is more reliable when combined with a cervical length
measurement test showing 92.8% specificity in predicting PTB. However, its low
sensitivity limits its clinical utility (Jung et al., 2016). Placental alpha
microglobulin-1 (PAMG-1), reported to be a potential biomarker, assessed by
PartoSure, was compared with fetal fibronectin, cervical length measurement and
it was reported that measuring PAMG-1 protein in vaginal secretions by the
PartoSure® test have good positive prediction values (PPV) for spontaneous
preterm delivery within 7 days and it is more accurate in predicting PTB with 80%
sensitivity and 95% specificiy. PartoSure has the greatest utility in patients with a
cervical length of 15-35 mm (Nikolova, Bayev, Nikolova, & Di Renzo, 2015).
Insulin-like growth factor binding protein-1 (IGFBP-1) was suggested to be a
potential biomarker for predicting PTB in CVF of women. Premaquick developed
a triple biomarker for native and total IGFBP-1 and IL-6 was reported as a
successful test with 87.1% sensitivity, 92.4 specificity, and 95% accuracy in
predicting PTB within 7 days. IGFBP1 when combined with cervical length is an
alternative for fFN in the PTB test (Eleje et al., 2017; Tripathi et al., 2016).
Amniotic fluid
An intra-amniotic infection is one of the major complications associated with PTB.
Gravett et al., studied the protein peptide profiles of women who delivered
prematurely with or without an intra-amniotic infection and woman who delivered
at term. Calgranulin B and an insulin-like growth factor binding protein 1 (IGFBP-
1) peptide fragment were identified as useful biomarkers for the early detection of
an intra-amniotic infection associated with preterm birth (Gravett et al., 2004).
Two heparan sulphate proteoglycans, agrin and perlecan, identified by 2D-GE
were suggested as potential biomarkers for the premature rupture of fetal
membranes (PROM), a condition that often precedes spontaneous preterm labor
and is responsible for a quarter of preterm deliveries (Fortunato & Menon, 2001;
Vuadens et al., 2003). These two proteins have been identified solely in the
amniotic fluid of women with PROM.
Investigation of the amniotic fluid biomarkers during second trimester showed
that low amniotic fluid glucose was associated with subsequent preterm delivery,
while the levels of IL-6, amniotic fluid ferritin tend to be higher in the preterm
mothers (Ozgu-Erdinc et al., 2014). In contrast to this, Kesrouani et al., did not find
any significant differences in terms of IL-6, matrix metalloproteinase-9 (MMP-9),
36
glucose, and C-reactive protein (CRP) in mid-trimester amniotic fluid (Kesrouani
et al., 2016). This discrepancy remains unexplained.
According to the studies conducted by Buhimschi et al., there are four
biomarkers, defensins 1 and 2 and calgranulins A and C, in the amniotic fluid which
can predict perinatal infections (I. A. Buhimschi, Christner, & Buhimschi, 2005).
The proteomic biomarkers of intra amniotic inflammation appear sequentially,
starting with human neutrophil defensin 2, followed by human neutrophil defensin
1, calgranulin C, and ending with calgranulin A. The presence of these four
biomarkers confirm fetal and neonatal infections and may be reliable in the
prediction of infections and preterm birth (C. S. Buhimschi et al., 2009).
Maternal serum markers
There are few reported potential biomarkers for identifying PTB and other
pregnancy related complications from maternal serum: maternal serum calponin
1 for PTB and the ratio of maternal serum alpha fetoprotein (AFP) and amniotic
fluid AFP, which was suggested as a potential predictor for intrauterine growth
restriction and preterm delivery. Maternal serum progesterone-induced blocking
factor (PIBF) and maternal salivary estriol are other reported biomarkers of PTB
(Hudic et al., 2015).
Gunko et al., performed the mass spectrometric profiling of serum in women
at 16-17 weeks of gestation to detect protein biomarkers of preterm delivery and
identified 25 proteins (13 proteins downregulated and 12 upregulated) in the sera
of mothers who delivered prematurely. The listed proteins were Transgelin-2,
SOD1, β2-Glycoprotein-1, Peroxiredoxin-2, Peroxiredoxin-3, Gelsolin, VEGF-A,
Prolactin-inducible protein, JNK2 (fragment), Placental folate transporter, E-
cadherin, Heat shock 70 kDa protein 8, HspA8, Endoplasmin, Apolipoprotein A-
IV, Insulin-like growth factor-binding protein 1, Bikunin, MMP-8, IL-6, IL-7,
Fibrinopeptide B, Transcription elongation factor S-II, Retinol-binding protein-2,
Ribosomal protein S6 kinase alpha-3, Pigment epithelium-derived factor and
Lipocalin-1. These proteins are linked to antioxidant enzymes, chaperons, the
cytoskeleton, cell adhesion, angiogenesis, proteolysis, transcription, inflammation
processes, binding and/or transportation of various ligands, and such a proteomic
imbalance as early as during the 2nd trimester eventually leads to premature delivery
(Gunko, Pogorelova, & Linde, 2016).
A number of studies have identified multiple putative biomarkers for predicting
the risk of preterm birth. However, these studies have been unable to identify
37
repeatedly a common biomarker so far due to differences in the analytical
techniques for proteins as well as in the results. This warrants for further studies
using carefully selected cohorts. The Preterm Birth International Collaborative
(PREBIC; www.prebic.org) performed a systematic review of all of the literature
published over the past four decades, on single maternal biomarker for PTB and
reported 116 different biomarkers in 217 studies (Table 2) (Menon et al., 2011).
Table 2. List of proteins identified as PTB biomarkers. Listed proteins identified from
various biological fluids were reported in two different studies (Bastek & Elovitz, 2013;
Menon et al., 2011)
Immune function and
inflammation
Activin A, CRP, Defensin, ENA-78, Ferritin, G-CSF, GM-CSF, GRO-a, I-309/
CCL1, IFN-γ, IGF-1, IGFBP-1, IL-1A, IL-1B, IL-1 RA, IL-2, IL-2R, IL4-6, IL-8, IL-
10, IL-13 IL-15-18, InhA, ILGF-BP-1, ICAM-1, IP1-/CXCL10, ITAC/CXCL11,
Leukemia inhibitory factor, Lysozyme, Macrophage inflammatory protein-1,
MCP-1, MDC/CCL22, MIP-1a/CCL3, MIP-1b/CCL4, MIP-3α/CCL20, MIP-
3β/CCL19, Neopterin, nplGFBP-1, phlGFBP-1, Placental isoferritin, Prolidase,
sCD163, Selectin, Sialidase, sICAM-1, sIL-6R-α, Soluble CD8, Soluble IL-2R,
Soluble TNFR2, sTNFR-1, sVcam-1, TARC/CCL17, TGF-β, TNF-R1, TNF-R2,
TNF-α, TREM-1
Stress ACTH, Activan, Cortisol, CRH, CRHBP, DHEA, Dopamine, Noradrenaline,
Urocortin
Extracellular matrix
degradation
SLPI, TIMP I, Elastase, Active MMP2, Collagenase, fFN, HA, MMP-1, MMP-2,
MMP-7-9, MSAFP, SHAP-HA
Fetal anomalies AFP, beta-HCG, PAPP-A
Estrogen metabolism Androstenedione, estradiol, estriol, estrogen
Uterotonin Oxytocinase, PGE2, PGF2, relaxin
Cellular metabolism Lactoferrin, retinol-binding protein, transferrin, transferrin receptor
Progesterone
metabolism
Progesterone
Apoptosis Nucleosome, soluble Fas
Growth/immune
function
Prolactin
Placental dysfunction Placental lactogen, P-LAP
Hematologic disorders Complement C3
Hemostasis/uterotonin Angiogenin
Hemostasis Procalcitonin
Some other reviews on PTB biomarkers presented similar findings, endorsing the
notion that there is no single biomarker that is able to reliably predict PTB (Conde-
Agudelo, Papageorghiou, Kennedy, & Villar, 2011; Honest, Hyde, & Khan, 2012).
38
PTB involves multiple and intricate pathways and a single biomarker may not
accurately define the risk of PTB. These findings led PREBIC to perform another
systematic review to examine the biomarkers identified by proteomic technologies
specifically through 2D electrophoresis and MALDI or surface-enhanced laser
desorption/ionization (SELDI) protein profiling. They identified 64 dysregulated
proteins and none of them was reproducible or accurately able to predict PTB either
(Kacerovsky et al., 2014).
2.4 Immune cells and inflammatory biomarkers in term and
preterm labor
The maintenance of the structural integrity of the decidual–fetal membrane–
placental unit and its gradual decline towards the end of pregnancy is crucial for
parturition. Various cytokines, growth factors and proteases are involved in the
decidual–placental interactions and decidual lymphocytes are majorly involved in
separation during parturition by rupturing the fetal membranes (Abadia-Molina,
Ruiz, King, Loke, & Olivares, 1997; Lash, 2015; Menon, 2016).
The fetus resembles a semi allogeneic graft that grows and develops within the
mother without being rejected by the maternal immune system, which depends on
the establishment of a feto-maternal tolerance (Finn, St Hill, Davis, Hipkin, &
Harvey, 1977; Guleria & Sayegh, 2007). Immune tolerance is initiated by the
presentation of paternal-fetal antigens from the seminal fluid facilitated by seminal
plasma proteins (Bromfield, 2018; Robertson & Sharkey, 2001). Fetal antigens are
processed by maternal dendritic cells and present to T cells in uterine draining
lymph-nodes. This results in the proliferation of regulatory T cells (Tregs), which
maintain peripheral tolerance to the fetus throughout the pregnancy creating
tolerance, an anti-inflammatory state or hyporesponsiveness towards paternal
antigens until late gestation (Ander, Diamond, & Coyne, 2019; Rowe, Ertelt, Xin,
& Way, 2012). Parturition is linked to feto-maternal endocrine and immune changes
in the intrauterine cavity and initiation is triggered from senescent fetal tissues via
extracellular vesicles functions in paracrine mechanism (Menon, 2019; R. Smith,
1998). Dysregulation of the homeostatic balance derived from both endocrine and
paracrine actions produces an inflammatory burden which results in the transition
of the quiescent endometrium into an active status, eventually leading to the
disruption of pregnancy. During late pregnancy, circulating maternal leukocytes
(innate and adaptive) are recruited to reproductive tissues (the cervix and
myometrium) and to the feto-maternal interface (decidual tissues) by a chemotactic
39
process, which leads to the development of a proinflammatory state, resulting in
the delivery of the fetus (Fig. 3)(Gomez-Lopez, StLouis, Lehr, Sanchez-Rodriguez,
& Arenas-Hernandez, 2014).
Fig. 3. Involvement of maternal immune cells in human term/preterm labor. 1) A stimulus
from maternal/fetal origin activates innate and adaptive immune cells. 2) At the fetal
maternal interface CXCL10, CXCL8, CCL2 and CCL5 molecules attract and recruit
immune cells. 3) Infiltrating leukocytes amplify the proinflammatory microenvironment
in labor. Infection or inflammation activates the anti-inflammatory microenvironment in
preterm birth (Modified from Gomez-Lopez et al., 2014).
Tomblom et al., have quantified the concentrations of IL-8, IL-6, monocyte
chemotactic protein-1 (MCP-1), regulated upon activation normal T cells expressed
and secreted (RANTES) and tumor necrosis factor (TNF) in four groups of
40
pregnant women including preterm labor, term labor, preterm not in labor and term
not in labor. It was found that IL-8, IL-6 and MCP-1 levels were higher in the labor
compared to the nonlabor groups, whereas there were no changes in RANTES and
TNF levels between the groups. IL-8, IL-6, MCP-1 levels in turn were even more
increased in non-infected preterm parturition from the human cervix (Tornblom et
al., 2005). Complement activation plays a role in cervical remodeling and PTB and
it was found that increased C3a and C5a deposition leads to an increase in collagen
degradation and the MMP-9 activity of macrophages, which in turn leads to PTB.
A systematic review was conducted on the pro and anti-inflammatory
biomarkers reported in intrauterine tissues (amnion, chorion, decidua, placenta and
myometrium) at term labor. Each of these tissues expresses a unique set of
biomarkers at the time of term labor, but there is a significant overlap between these
tissues. All tissues express IL-6, IL-8, IL-1β, COX-2, PGE-2, TNF, and hCAP18 at
term labor and the secretion of anti-inflammatory markers has hardly been reported
in term labor (Hadley, Richardson, Torloni, & Menon, 2018).
There is no single or combinational screening method for preterm birth with
high sensitivity and specificity. So far, measuring the length of the cervix is the
most effective method for clinical practice. In addition to this, tests for detecting
biomarkers like fFN, IGFBP-1, IL-6, and placental alpha-microglobulin-1 are in
clinical use. Ultrasound markers, in addition to the common cervical length
measurements, such as the uterocervical angle and the placental strain ratio have
been proposed. Studies on metabolomics, proteomics and microRNA profiling
have brought a new facet to this subject that will likely help in identifying women
who possess a high risk for preterm birth and developing more effective and
preventive strategies in the future.
2.5 miRNAs in labor and pregnancy
miRNAs are small noncoding RNA molecules that play an important role in the
regulation of gene expression. miRNAs are transcribed from DNA sequences into
pri-miRNA which is further processed to form mature miRNAs. The placenta has
its own specific miRNAs, which play a role in the maintenance of pregnancy and
parturition, and changes in their expression are associated with pregnancy
complications.
41
2.5.1 Biogenesis of miRNAs
The biogenesis of miRNAs occurs in canonical and noncanonical pathways.
The canonical pathway is the most predominant pathway by which the majority of
miRNAs are processed. The pri-miRNA has a cap at its 5’ end and is
polyadenylated at its 3’ end. The pri-miRNA binds to and is processed by the
microprocessor complex, which consists of a ribonuclease III called Drosha and a
RNA binding protein DiGeorge syndrome critical region 8/Pasha (DGCR-8)(Denli,
Tops, Plasterk, Ketting, & Hannon, 2004). DGCR 8 recognizes an N-6 methylated
adenine residue in the GGAC sequence and other motifs in the pri-miRNA, whereas
Drosha cleaves the RNA duplex at the base of a hairpin structure which leads to
the generation of a pre-miRNA with 2 nucleotide 3’ overhangs (Alarcon, Lee,
Goodarzi, Halberg, & Tavazoie, 2015; J. Han et al., 2004).
In non-canonical pathway, miRNA processing and maturation take place in
Drosha/DGCR8 as well as in Dicer independent pathways. Pre-miRNAs produced
in this pathway resemble dicer substrates. For example, miRNAs are produced
from the introns of mRNA during splicing and such pre-miRNAs are called
mirtrons. Another example is 7-methylguanosine (m7G) capped pre-miRNAs that
are directly transported to the cytoplasm without Drosha cleavage via exportin-1
(Fig. 4). In this process, the 3p strand is loaded into Argonaute instead of the 5p
strand, because the m7G cap prevents the 5p from loading into the RISC complex
(Xie et al., 2013).
42
Fig. 4. MicroRNA biogenesis and mechanism of action. Canonical miRNA biogenesis
generates the pri-miRNA transcript, cleaved by the microprocessor complex (Drosha
and DiGeorge Syndrome Critical Region 8 (DGCR8)) to produce the precursor-miRNA
(pre-miRNA). The pre-miRNA is exported to the cytoplasm via Exportin5/RanGTP and
processed to produce the mature miRNA duplex. Finally, either the 5p or 3p strand of
the mature miRNA duplex is loaded into the Argonaute (AGO) complex to form a miRNA-
induced silencing complex (miRISC). In the non-canonical pathways, small hairpin RNA
(shRNA) are processed and transported like in the canonical pathway and further
processed via AGO2-dependent, but Dicer-independent, cleavage. Mirtrons and 7-
methylguanine capped (m7G)-pre-miRNA are dependent on Dicer to complete their
cytoplasmic maturation. Mirtrons are exported via Exportin5/RanGTP while m7G-pre-
miRNA are exported via Exportin1. All pathways ultimately lead to a functional miRISC
complex, which acts via degrading the target mRNA or inhibiting translation initiation
(Modified from O'Brien, Hayder, Zayed, & Peng, 2018).
The directionality of the miRNA determines the name of the mature miRNA. The
5p arises from the 5’ of the pre-miRNA, whereas the 3p arises from the 3’ of the
43
pre-miRNA. Both strands of the mature miRNA are loaded into the Argonaute
(AGO) family proteins in an ATP dependent manner (Yoda et al., 2010). Generally,
the strand with 5’lower stability or with uracil preferentially loaded onto AGO is
considered the guide strand. The unloaded strand, called the passenger strand, is
unwound from the guide strand through various mechanisms and degraded (M. Ha
& Kim, 2014).
2.5.2 miRNA functions:
Significant conservation of individual miRNAs across different species suggests
their functional importance. It has been shown in several animal models that
miRNAs participate in determining cell fate, in pattern formation during embryonic
development, and in controlling cell proliferation, cell differentiation, and cell
death. Several groups of miRNAs have been found to regulate the expression of
tumor-associated genes, while others seem to hold prognostic value in predicting
the survival of cancer patients. The major functions of miRNAs are the regulation
of gene expression by binding to specific sequences at the 3’ UTR of target mRNAs
to induce translational repression by mRNA deadenylation and decapping
(Huntzinger & Izaurralde, 2011; Ipsaro & Joshua-Tor, 2015).
MicroRNA-mediated gene silencing via miRISC
The miRNA induced RISC complex (miRISC) contains a guide strand and AGO
(Kawamata & Tomari, 2010). The target specificity of miRISC depends on the
interaction of miRNA with complementary sequences on its target mRNA called
miRNA response elements (MRE). The magnitude of the complementary
sequences determines whether the silencing is achieved through AGO2 dependent
silencing of target mRNA or miRISC based mRNA decay or translational inhibition
(Jo et al., 2015). Several studies showed that the fully complementary sequences
between the miRNA and the target miRNA induces AGO2 endonuclease activity
that leads to mRNA decay, whereas the partial complementary sequences lead to
weak binding that further results in the repression of translation initiation
(Krutzfeldt et al., 2005). In animal cells, miRNA-MRE interactions are partially
complementary and central mismatches prevent AGO2 endonuclease activity. In a
majority of cases the miRNA interaction occurs at the 5’ seed region (nucleotide 2-
8) and additional pairing at the 3’ end promotes the stability and specificity of
44
miRNA and target interactions (Broughton, Lovci, Huang, Yeo, & Pasquinelli,
2016).
The formation of miRISC is a multistep process that starts with the recruitment
of GW182 proteins which provide the platform for recruitment of other proteins
such as poly(A)-deadenylase complexes PAN2-PAN3 and chemokine receptor 4-
negative on TATA (CCR4-NOT) (Jonas & Izaurralde, 2015). PAN2/3 proteins
initiate the poly-(A)-deadenylation of mRNA and CCR4-NOT completes
continuation of the process.
Translational repression
The mechanism by which miRNA represses the translation of its target mRNA is
still unclear. Petersen et al., proposed that miRNA exerts its action by inhibiting the
elongation process by promoting ribosome dissociation from mRNA. Three
different theories have been proposed to explain the mechanism of miRNA
mediated translation repression (Fig. 5) (Petersen, Bordeleau, Pelletier, & Sharp,
2006).
In the first mechanism, miRNA competes with eucaryotic initiation factor 4E
(eIF4E) to bind to the 5’ cap structure of the mRNA that leads to failure of
translation initiation. However, other studies deny this model and suggest that
GW182 or any downstream factor could compete with eIF4E (Eulalio, Huntzinger,
& Izaurralde, 2008; Mathonnet et al., 2007; Thermann & Hentze, 2007). A second
model proposed that miRISC prevents mRNA circularization that prevents
initiation. The CCR4-NOT is a multiprotein complex containing chromatin
assembly factor 1 subunit (CAF-1), CCR4 and NOT 1-5, that are involved in
translation inhibition (Parker & Song, 2004). A third mechanism is that miRNA
prevents the association of the 60S ribosomal subunit with the 40S preinitiation
complex and prevents translation (Jackson, Hellen, & Pestova, 2010). Another
proposed mechanism is that miRISC inhibits translation by promoting the
accumulation of target mRNAs in processing bodies (P bodies). As P bodies do not
contain a translation machinery, it suggests that these mRNAs are not translated
into proteins (Parker & Sheth, 2007).
45
Fig. 5. Mechanisms of miRNA-Mediated Gene Silencing. (A) MicroRNA-mediated mRNA
decay. Proteins required for this process are shown including components of the major
deadenylase complex (CAF1, CCR4, and the NOT complex). Post initiation mechanisms:
(B) Argonaute proteins recruit eIF6, which prevents the large ribosomal subunit from
assembling with the small subunit. (C) MicroRNAs trigger deadenylation and
subsequent decapping of the mRNA target. (D) Argonaute proteins prevent the
formation of the closed loop mRNA that includes deadenylation. (E) Cotranslational
protein degradation. This involves the degradation of the nascent polypeptide chain
cotranslationally. The putative protease is unknown. (F) MicroRNAs repress the
translation of target mRNAs by blocking translation elongation or by promoting the
premature dissociation of ribosomes (ribosome drop-off) (Modified from Eulalio et al.,
2008).
Methylation regulates miRNA expression:
The expression of miRNA genes is regulated by epigenetic inactivation due to
aberrant hypermethylation and characterized in many cancers (Brueckner et al.,
2007; Lujambio et al., 2007). Expression of many of the miRNA genes located at
CpG islands, are affected by methylation as shown in the case of miR-34b and miR-
34c, which are the two components of the p53 pathway that are silenced due to
46
hypermethylation of nearby CpG islands in colorectal cancer (Lodygin et al., 2008;
Toyota et al., 2008). Another possible indirect mechanism of miRNA regulation is
that methylation can affect the expression of transcription factors that control
miRNA expression (Fig. 6) (L. Han, Witmer, Casey, Valle, & Sukumar, 2007). Still,
the methylation dependent regulation of miRNA expression is unclear and a further
understanding of these mechanisms at the molecular level is needed to determine
its significance in biological processes.
Fig. 6. miRNA gene expression affected by methylation. The degree of methylation in
the up-stream sequence of miRNAs regulates miRNA gene expression;
hypermethylation represses and hypomethylation activates miRNA genes (Modified
from Y. Cai, Yu, Hu, & Yu, 2009).
2.5.3 Placental specific /Pregnancy associated miRNA-clusters
The quest of identifying the placental miRNAs started in 2005 by Bentwich et.al.,
who determined the expression of computationally predicted miRNAs by high-
throughput miRNA microarray which in turn defined placental specific clusters.
There are three distinct miRNA clusters reported in the placenta, which are the
chromosome 19 miRNA cluster (C19MC), the chromosome 14 miRNA cluster
(C14MC) and the miR371-3 miRNA cluster. It is not clear whether the miRNAs of
all three clusters are coregulated by the same cis elements (Tsai, Kao, Chen, Chen,
& Lin, 2009).
47
The chromosome 14 microRNA cluster (C14MC)
Recent studies on miRNA expression analyses have shown that many miRNAs are
specifically expressed in a group of organisms or in some single species only.
Glazov et al., stated that the origin of the C14MC precursor sequences appeared
around 100 million years ago in early mammalian ancestors, post the evolution of
Metatheria (marsupial) or Prototheria (monotreme). A detailed analysis of this
miRNA cluster described that the miRNA cluster is (also known as mir-379/mir-
656 cluster) located within the imprinted DLK-DIO3 (delta-like homolog 1 gene
and the type III iodothyronine deiodinase) region on human chromosome 14q32
(Fig.7), but on distal chromosome 12 in the mouse (Glazov, McWilliam, Barris, &
Dalrymple, 2008).
Fig. 7. Schematic representation and genomic organization of the chromosome 14
miRNA cluster (C14MC). B) C14MC in the imprinted DLK-DIO3 domain on the human
14q32 chromosomal interval. C) Highlighted miRNAs are relevant in pregnancy (Red)
reported by Morales Prieto et al. (Blue) reported by Fallen et al. (Green) Reported in both
studies. D) The expression of C14MC gradually decreases from 1st to 3rd trimester
(Modified from Morales-Prieto, Ospina-Prieto, Chaiwangyen, Schoenleben, & Markert,
2013).
48
This gene cluster domain contains three protein coding genes, Dlk1, Rtl 1 and Dio3,
inherited from the paternal chromosome and several large and small noncoding
RNA genes, inherited from the maternal chromosome (da Rocha, Edwards, Ito,
Ogata, & Ferguson-Smith, 2008).
Evaluation of gene targets for this miRNA cluster has revealed that they associate
with biological processes such as neurogenesis, embryonic development,
transcriptional regulation and RNA metabolism. C14MC is also referred to as the
Mirg cluster, the miR-379/miR-410 cluster or the miR-379/miR-656 cluster
(Bortolin-Cavaille, Dance, Weber, & Cavaille, 2009; Noguer-Dance et al., 2010).
It is one of the largest miRNA clusters and comprises 52 miRNA genes, of which
40 are organized as large clusters located within two close neighboring segments
spanning about 40 kb (Gardiner et al., 2012; Morales-Prieto et al., 2012; Seitz et
al., 2004). This cluster is mainly regulated by methylation of a distal Intergenic
Germline-derived Differentially Methylated Region (IG-DMR). Expression
analysis of healthy human tissues revealed that some members of C14MC are
predominantly expressed in the placenta and to some extent in epithelial tissues.
The expression of C14MC decreases from the first trimester to the third trimester
and their altered expression levels have been shown to be associated with various
pregnancy complications (Liang, Ridzon, Wong, & Chen, 2007).
The chromosome 19 microRNA cluster (C19MC)
C19MC is one of the largest miRNA gene clusters in humans, identified so far. It
is located in the 19q13.41 region (Fig. 8) and spans around 100 kb in length.
C19MC miRNAs are primate-specific and comprised of 46 miRNA genes
(Bentwich et al., 2005; Bortolin-Cavaille et al., 2009; Lin et al., 2010). The miRNA
members of this cluster share common seed sequences and originate from a
common ancestor of the miR-371-3 cluster which is juxtaposed with C19MC on
chromosome 19 (Zhang, Wang, & Su, 2008). Similar to C14MC, C19MC is also
localized within imprinted genes except that it is imprinted from the paternally
inherited chromosome and regulated by methylation of the promoter CpG rich
region, which is 17.6 kb upstream of C19MC (Noguer-Dance et al., 2010).
Remarkably, C19MC miRNA genes are enriched in dispersed Alu elements,
approximately 10 times more than in any other regions, denoting the co-evolution
of Alu sequences and miRNAs (Lehnert et al., 2009; Zhang et al., 2008). However,
the functions of these Alu repeat elements and their connection with miRNAs
remain unclear.
49
Fig. 8. Genomic organization of the chromosome 19 miRNA cluster. A) Chromosome 19
containing miRNA clusters C19MC (Hg19: 54 169 933–54 265 683). B) Location of C19MC
miRNAs and miR-371-3 cluster mapping at chromosome 19q13.42 located in between
the protein coding regions of ZNF761 and MYDAM and their directionality. C) List of all
C19MC miRNAs. Altered expression of different C19MC miRNAs in pregnancy
complications are highlighted in red reported by (Fallen et al., 2018). D) The expression
of C19MC increases exponentially from the 1st trimester to the 3rd trimester (Modified
from Morales-Prieto et al., 2013).
Moreover, the expression of miRNAs seems to be partly regulated by Alu elements.
The expression of C19MC is found to be mainly restricted to the reproductive
system and placenta. Its homologues are absent in mouse, rat and dogs which
strongly emphasizes that it is specific to primates only (Bentwich et al., 2005; Liang
et al., 2007; Zhang et al., 2008). Comparative genomic studies showed that 99%
conservation of chromosome 19 miRNA genes between chimpanzees and humans
and this cluster may be related to human-primate evolution and maybe important
for embryo development as well (Cao, Yang, & Rana, 2008; Tsai et al., 2009).
The expression of the paternal imprinted placenta specific C19MC is regulated by
the epigenetic modification of DNA methylation. Surprisingly, this methylated
region originates from maternal imprinting in oocytes and a large noncoding RNA
population compartmentalizes near to the C19MC transcription site but not in the
Alu-rich domain region. Interestingly, C19MC is located adjacent to another
50
maternally imprinted protein coding region, the ZNF331 gene that defines a novel
large primate specific paternal imprinted chromosomal domain (Noguer-Dance et
al., 2010). The C19MC accounts for about ∼8% of all known human miRNAs (59
out of 695) and their primate specificity emphasizes its role in phenotype plasticity.
C19MC miRNAs are intron encoded and processed by DGCR8-Drosha and the
non-protein coding RNA Pol II (Bortolin-Cavaille et al., 2009).
The miR-371-3 cluster
The miR-371-3 cluster mainly comprises 3 miRNAs hsa-miR-371a-3p, hsa-miR-
372 and hsa-miR-373-3p which share the same seeding sequence “AAG UGC”. In
humans, this cluster is a homologue of miR-290-295 sharing the same seed
sequence with the mouse. Two miRNAs are synthesized from the opposite site of
the pre-microRNA (hsa-miR-371-5p and hsa-miR-373-5p), as well as hsa-miR-
371b-3p of the cluster (Houbaviy, Murray, & Sharp, 2003; Persson et al., 2011).
Surprisingly, several members of C19MC miRNAs (miR-520s), CM2C (miR-467s)
and miR-17/92 cluster(oncomiR1) have the same seed sequence AAGUGC, which
is found in the ES cell specific miR-371-3 cluster.
The miR-371-3 cluster is located on chromosome 19 within a 1050 bp region
adjacent to the C19MC cluster and is conserved in mammals like C14MC and
C19MC, and is predominantly found to be expressed in the placenta (Fig.9)
(Bentwich et al., 2005; Houbaviy et al., 2003). Interestingly, members of the miR-
371-3 cluster are highly expressed in human ESCs and their levels decrease during
development, possibly to enhance the reprogramming of fibroblasts to induced
pluripotent stem cells (Laurent et al., 2008; Subramanyam et al., 2011; Wilson et
al., 2009). This murine miR-290 cluster or the mammalian miR-371-3 cluster, also
known as embryonic stem cell-specific cell cycle regulating (ESCC-) miRNAs,
plays an essential role in cell cycle maintenance and is also involved in the
regulation of cell proliferation and apoptosis (Voorhoeve et al., 2006; Y. Wang et
al., 2008).
2.5.4 miRNAs as biomarkers of pregnancy complications
Several studies have suggested that miRNA expression changes with physiological
conditions during pregnancy and facilitates a successful pregnancy outcome,
whereas dysregulation of miRNAs contribute to disorders of pregnancy such as
preterm birth, preeclampsia and intrauterine growth restriction etc (Fig. 10).
51
Measuring alterations in placenta and uterus specific miRNAs can be used as
potential biomarkers of pregnancy complications.
miRNAs in preterm birth
Placenta-associated miRNAs have been reported to be implicated in preterm birth
and abortion. Mayor-Lynn et al., analyzed the miRNA expression profiles between
preterm and normal term placentas and identified twenty differentially expressed
miRNAs, including some well-known preeclamptic or small for gestational ages
(SGA)-associated miRNAs. The expression of miR-15b, miR-181a, miR-200C,
miR-210, miR-296-3p, miR-377, miR-483-5p, and miR-493 varied significantly
and these miRNAs target matrix metalloproteinases (MMP-1, MMP-9), a
disintegrin and metalloproteinase domains (ADAM-17, ADAM-30), tissue
inhibitor of metalloproteinase 3 (TIMP-3), suppressor of cytokine signaling 1
(SOCS1), Stanniocalcin 2 (STC2), corticotropin-releasing hormone (CRH), CRH-
binding protein (CRHBP) and endothelin-2 (EDN2). Some of these proteins have
been reported as potential protein biomarkers in pregnancy complications (Mayor-
Lynn, Toloubeydokhti, Cruz, & Chegini, 2011). The expression levels of miR-17
and 19b were downregulated in placentas of early pregnancy loss compared to
normal term placentas and these miRNAs are known to target PTEN, CREB-1,
TGFβ-1 and TGFβ-RII. Surprisingly, the PTEN mRNA was significantly up-
regulated in early pregnancy loss, while TGF-β1, CREB-1 and TGFβ-RII were not
significantly different (Ventura et al., 2013). In case of women with recurrent
spontaneous abortion (RSA) miR-133a was found to be overexpressed in placental
villi which led to the down regulation of Human leukocyte antigen G (HLA-G) at
protein levels that might be involved in fetal rejection by maternal immune cells
leading to RSA (X. Wang et al., 2012). In placenta accreta patients, miR-34a
expression was found to be reduced in trophoblast cells and this led to an increase
in the trophoblast invasion potential (Umemura et al., 2013). Recently in an miRNA
omics screen of plasma from pregnant women with preterm birth and/or cervical
shortening, nine miRNAs including hsa-let-7a-5p, hsa-miR-374a-5p, hsa-miR-
15b-5p, hsa-miR-19b-3p, hsa-miR-23a-3p, hsa-miR-93-5p, hsa-miR-150-5p, hsa-
miR-185-5p and hsa-miR-191-5p were found to be differentially expressed in PTB
(Cook et al., 2019). In another miRNA comparative study between the placentas of
term in labor, PTB and PROM pregnancies, the expression profile of microRNAs
was found to be different between PPROM and PTB, term in labor pregnancies,
and between gestational age-matched PPROM and PTB groups. When compared
52
with term in labor pregnancies, C19MC microRNAs were downregulated in
PPROM pregnancies (miR-525-5p), whereas in PTB pregnancies C19MC
microRNAs were upregulated (miR-515-5p, miR-516-5p, miR-518b, miR-518f-5p,
miR-519a, miR-519e-5p, miR-520a-5p, miR-520h, and miR-526b-5p) or showed
a trend towards upregulation (miR-519d and miR-526a). In comparison with PTB,
the PROM group showed a significant downregulation in C19MC microRNAs
(miR-516-5p, miR-517-5p, miR-518b, miR-518f-5p, miR-519a, miR-519d,
miR-519e-5p, miR-520a-5p, miR-520h, miR-525-5p, miR-526a and miR-526b-5p).
The PROM group showed a negative correlation between gestational ages while
the PTB group showed a positive correlation between gestational age and the
miRNA of placental tissues (Hromadnikova, Kotlabova, Ivankova, & Krofta, 2017).
2.5.5 Circulating placenta-derived microRNA as biomarkers
MicroRNA profiling of the human placenta has led to the identification of certain
placenta specific miRNA clusters such as C19MC, C14MC and miR-371-3 that are
highly expressed in placentas. miRNA omics data demonstrated that the expression
of C14MC is higher in the first trimester and gradually decreases towards the end
of the third trimester. Conversely, C19MC expression levels are low in the first
trimester and exponentially increase upto 100-fold towards the end of the
pregnancy based on data both from continuous trophoblast cell lines as well as from
corresponding placental tissues (Liang et al., 2007; Luo et al., 2009; Morales Prieto
& Markert, 2011). Recent studies have shown that trophoblast and stromal cells of
the villi release some of the C19MC miRNA members into the maternal circulation
in the form of exosomes. These circulating miRNAs have interesting features like
high stability, resistance towards enzymatic cleavage, pH alterations and freeze
thaw cycles (Luo et al., 2009; P. S. Mitchell et al., 2008; Z. Zhao et al., 2012). Due
to these characteristics, miRNAs have been proposed as potential blood-based
biomarkers for the detection of tumors and pregnancy-associated diseases (Cortez
& Calin, 2009; Donker et al., 2012; Fallen et al., 2018; Hromadnikova, Kotlabova,
Doucha, Dlouha, & Krofta, 2012).
Although no individual miRNA has yet been confirmed as a biomarker, as no
significant changes in miRNA expressions have been detected in the maternal
circulation between the 12th and 16th week in pregnant women who later developed
preeclampsia and pregnancies complicated with FGR (Hromadnikova et al., 2012;
Mouillet et al., 2010). Next generation sequencing technologies for miRNA
expression profiling have revealed that the expression profiles of 29 miRNAs were
53
dysregulated in the serum of PE women (Yang et al., 2011). Despite these
conflicting results, miRNAs are implicated in the pathogenesis of PE and PTB and
can serve as potential candidate biomarkers in the future.
Fig. 9. Role of placental and uterus miRNAs in pregnancy. The pregnancy process is
regulated by genetic, environmental, and physiological factors. miRNAs in the placenta
and uterus respond to changes in these factors during pregnancy. Altered expression
of miRNAs leads to pregnancy disorders (Modified from M. Cai et al., 2017) .
54
55
3 Aims of the study
The aim of this study was to determine the differential protein and miRNA
expression levels in the human placenta associated with spontaneous and elective
term labors. The specific aims were as follows:
1. To carry out a comparative proteomics study of term and elective term
pregnancies (article #1)
2. To identify miRNAs associated with the onset of labor followed by the
functional characterization of selected miRNAs (article #2)
3. To study the functional role of CPPED1 in the cellular milieu of the placenta
(article#3)
The goal of this study was to detect variations in the expression levels of proteins
and miRNAs in spontaneous and elective delivery phenotypes. A further study on
the functional roles of proteins and miRNAs and measurements of protein and
miRNA levels in pregnancy may provide biomarkers for predicting the onset of
labor.
56
57
4 Materials and Methods
4.1 Molecular Cloning (III)
The protein coding region of CPPED1 was amplified by PCR using placental
cDNA as a template. The amplified product was gel excised using Gel Extraction
Kit (Invitrogen) and subjected to restriction enzyme double digestion of both vector
and insert. The ligation product was transformed into E. coli DH5α competent cells.
Positive clones were confirmed by restriction enzyme double digestion and further
by DNA sequencing. For mammalian cell expression, CPPED1 was subcloned into
BamH1, HindIII sites in the pCMV Flag 2B plasmid. Similarly, the PAK4 and
PIK3R2 genes were cloned into the pCDNA 3-Myc expression plasmid using gene
specific primers (listed in Table-3) and these constructs were used in protein-
protein interaction studies.
4.1.1 Generation of plasmid constructs for a BiFC analysis (III)
The coding regions of the CPPED1, C1qTNF5, GRB2, PAK4 and PIK3R2 genes
were subcloned and amplified as explained previously. To generate the BiFC
constructs for a fluorescence complementation analysis, we cloned CPPED1 into
the VN plasmid and its putative binding partners such as C1qTNF5, GRB2, PAK4
and PIK3R2 were cloned into VC plasmids. The cloning primers with restriction
sites for each gene are given below (Table 3).
4.2 Protein purification (III)
CPPED1 cloned into pSFOXB20, which is a constitutive expression plasmid, was
expressed in the E. coli Bl21 (DE3) strain. The culture was grown at 37oC for 7-8
hours, cells were harvested and lysed by sonication on ice for 20 mins followed by
centrifugation at 18,000 g for 15 mins and most of the protein was found to be in
soluble form after expression checking on SDS-PAGE. Initially, the protein was
purified by Ni-NTA affinity chromatography followed by ammonium sulphate
buffer exchange for hydrophobic interaction chromatography and further by gel
flltration (Detailed description in study III). The purity of the protein was analyzed
on SDS PAGE and further confirmed by western blotting using both CPPED1 and
V5 tag antibodies.
58
Table 3. List of primers used in this study for cloning
Gene Name and Plasmid Sequence
CPPED1- PSF-OXB20 sense 5'- GCAT GAATTC GATG TCG GCT GCA GAG GCG GG -3'
antisense 5'- GC GGATCCTCATTT TTT CTT GAT CAA ATC CAT GAG -3'
CPPED1-pCMV-Flag 2B sense 5'- GCAT GAATTCGATG TCG GCT GCA GAG GCG GG -3'
antisense 5'- GC GGATCCTCATTTTTT CTT GAT CAA ATC CAT GAG ATC -3'
CPPED1-pBiFC-VN173 sense 5'- GAGC AAGCTTATG TCG GCT GCA GAG GCG GGG -3'
antisense 5'- GACC GTCGACTTT TTT CTT GAT CAA ATC CAT GAG ATC-3'
PAK4-pcDNA3-myc sense 5'- GGCC AAGCTTATGTTTGGGAAGAGGAAGAAGCGG -3'
antisense 5'- GGCC CTCGAGTCTGGTGCGGTTCTGGCGCATG -3'
PAK4-pBIFC-VC155
sense 5'- GAGCGAATTCTTATGTTTGGGAAGAGGAAGAAGCGG -3'
antisense 5'- GACG GGTACCTCTGGTGCGGTTCTGGCGCATG -3'
PIK3R2- pcDNA3-myc
sense 5'- GGCC GAATTCATGGCGGGCCCTGAGGGCTTCC -3'
antisense 5'- GGCC CTCGAGGCGGGCGGCAGGCGGCGGGCC-3'
PIK3R2-pBIFC-VC155
5'- GAGC GAATTCTTATGGCGGGCCCTGAGGGCTTCC -3'
5'- GGACCTCGAGCGCGGGCGGCAGGCGGCGGGCC -3'
4.3 In vitro phosphatase activity assay (III)
To check the activity of purified CPPED1 we performed a phosphatase or
dephosphorylation assay using AKT1 as a substrate. Previously, it was reported that
CPPED1 dephosphorylates AKT1 on the Ser 473 residue (D. X. Zhuo et al., 2013).
The dephosphorylation reactions were carried out as previously reported (T. Gao,
Furnari, & Newton, 2005). Briefly, 25 ng of purified CPPED1 and 30 ng of
commercially purchased His tagged AKT1 (009-001-P21; Rockland) were
incubated in reaction buffer and the phosphorylation levels of Ser-473 were
measured using a phosphoserine specific antibody.
4.4 Protein microarray (III)
The HuProtTM v3.1- Human Proteome Microarray contains a vast number of human
proteins, encoding more than 20,000 recombinant proteins that covers ~ 75% of the
annotated protein coding genome. Prior to incubation with the bait protein
59
(CPPED1), HuprotTM arrays were blocked with a buffer containing 2% BSA in
HEPES and incubated at 4o C for overnight. The array slides were then washed with
HEPES buffer and 40 µg of CPPED1 protein prepared in blocking buffer was added
to the array and incubated at room temperature for 2 h with gentle shaking, followed
by incubation with a fluorophore conjugated Anti V5 antibody (1 µg/ml in blocking
buffer). Finally, the arrays were scanned on a Tecan LS400 microarray scanner at
532 nm excitation for the detection of GST staining of all proteins and at 633 nm
for the detection of interactions of the sample with a resolution of 10 µm, and the
fluorescence data was collected.
4.5 Immunoprecipitation of CPPED1 interacting partners and
western blotting (III)
HEK 293T cells were transfected with CPPED1-pCMV Flag 2B and PAK4,
PIK3R2 in pc-DNA 3Myc plasmids and 24 hours of post transfection cells were
lysed in IP lysis buffer supplemented with protease inhibitors (Roche diagnostics)
and 10 mM PMSF on ice for 1 hour with intermittent mixing using a vortex, and
the supernatant was separated after centrifugation at 18,000 g at 4oC. Prior to co-
IP, both anti-c-Myc agarose and control agarose resins were blocked with 1% BSA
at 4°C for 1 h to prevent nonspecific binding. 500 µg of protein samples subjected
to immunoprecipitation using1 µg of an anti c-Myc Ab (sc-40, Santa Cruz) to
immunoprecipitate Myc tagged (PAK4, and PIK3R2) proteins.
After immunoprecipitation, the samples were separated by SDS-PAGE.
Proteins were transferred onto a nitrocellulose membrane (Thermo Scientific). The
membrane was washed with 1x PBS and incubated with blocking buffer (1x PBS,
3% BSA and 0.2% Tween 20) for 1 hour at room temperature followed by
incubation with primary antibodies against CPPED1, PAK4 and PIK3R2 (Detailed
description about dilutions in study III) followed by incubations with secondary
antibodies (Described in study III). Finally, the blots were washed with 1x PBS and
scanned in the visible region to detect the protein bands with an Odyssey Infrared
Imaging System (LI-COR Biosciences).
4.6 Bimolecular fluorescence complementation assay (III)
HEK293T cells (50,000 cells) were seeded per semicircle in a four semicircle 10
mm petri dish coated with a round bottom glass slip (CELL view Cell Culture Dish
(35mm; Greiner Bio-One) and transfected when the cell confluency was 50% with
60
corresponding plasmids in combination or single plasmids and controls (Described
in study III). CPPED1 cloned into pEGFPN1 was used as a control to check the
transfection efficiency, which was found to be 90% in HEK 293T cells. After 18
hours of transfection, cells were fixed with a 4% formaldehyde solution in 1X PBS
for 20 mins at room temperature and washed three times with 1X PBS. After
fixation, cells were observed under an Olympus FluoView FV1000 confocal
microscope and images were acquired using a 20x objective and higher resolution
images for cellular localization studies were acquired using a 60x objective with
oil immersion.
4.7 Phosphatase assay detection by mass spectrometry (III)
The in vitro dephosphorylation reactions of CPPED1 performed with PAK4 and
PIK3R2 were done as described earlier with AKT1 and the detection of changes in
phosphorylation in PAK4 and PIK3R2 was done by mass spectrometry. In the
reaction mixture (50 µl), the final concentration of CPPED1 and PAK4 (TP302302;
Origene) and PIK3R2 (009-001-S95S; Rockland) were 0.13 µM, 0.16µM and 0.15
µM, respectively. The sample processing and preparation are described further in
study III.
4.8 Placental miRNA isolation (II)
For miRNAomics we included the placental tissues from the basal plate collected
after either spontaneous term or elective caesarean term birth (n=6 per each group).
miRNAs were isolated with the NucleoSpin miRNA kit (Macherey-Nagel) and
their quality was analyzed with the Advanced Analytical Fragment Analyzer.
miRNA library preparation and HiSeq 2500 sequencing were done at the Finnish
Functional Genomics Centre, Turku, Finland. While filtering for the differential
expression of miRNAs, a fold change of 1.5 and a p-value of 0.05 were set as
threshold values.
4.9 Quantitative analysis of CPPED1 mRNA by qPCR (II)
For a qRT-PCR analysis, we included samples from both the chorionic plate and
the basal plate of placentas from full term, spontaneous preterm, elective term and
elective preterm pregnancies (further details described in study II). mRNA was
isolated using the RNeasy Micro Kit (Qiagen) and cDNA synthesis was done using
61
the Transcriptor First Strand cDNA Synthesis Kit (Roche). qPCR was done as an
intron-spanning assay with a LightCycler®96 instrument (Roche). Cytochrome C1
(CYC1) mRNA was used as a reference gene. All samples were measured in
triplicate and normalized in accordance with the ΔΔCt method. Statistical analyses
were conducted with SPSS Statistics 20.0 (IBM Corporation). Significant
differences in expression levels were identified by the nonparametric Mann–
Whitney U test.
4.10 Quantitative PCR of hsa-miR-371a-5p (II)
After miRNA isolation and quality assessment, the first strand cDNA synthesis was
done with the miRCURY LNA RT Kit (Qiagen). The qPCR was done using the
miRCURY LNA miRNA PCR Assay kit (Qiagen) with a LightCycler®96
instrument (Roche). The hsa-miR-103a-3p mRNA was used as a reference gene.
All samples were measured in triplicate and normalized in accordance with the
ΔΔCt method. The statistical analysis was done with SPSS Statistics 20.0 (IBM
Corporation). Significant differences in expression levels were identified by the
nonparametric Mann–Whitney U test (Detailed description in study II).
4.11 Luciferase assay (II)
HEK-293T cells were plated into a 96-well plate and allowed to reach
approximately 90% confluence. Cells were co-transfected with 100 ng of plasmid
DNA (WT-pmirGLO or Mut-pmirGLO) with Lipofectamine3000 (Invitrogen Life
Technologies) and 10 nM miRNA (mimic or negative control) was used per well.
Cells were lysed 24 hours post-transfection, and luciferase reporter assays were
performed with the Promega Dual Luciferase Reporter Assay System (Promega)
according to the manufacturer’s instructions. The Firefly and Renilla luciferase
activities were measured, and the background signal was subtracted for each
transfection. Firefly (experimental reporter) and Renilla (control reporter)
luciferase ratios were calculated and compared to negative controls (Described in
study III).
62
4.12 siRNA knockdown of CPPED1 and transcriptomics of siRNA
samples (I)
For the silencing of CPPED1 we used HTR8/SVneo cells (ATCC, CRL‐3271),
which were transfected with 30 nM of a negative control siRNA or 100 nM of
pooled CPPED1 siRNAs (siRNA pairs 1–3) (Ambion) in suspensions using the
Lipofectamine 3000 transfection protocol and incubated. After 24 hours of
incubation, adherent cells were re‐transfected with siRNA pairs 1–3 or siRNA
negative controls with the same concentration as the transfection performed in
suspension. Cells were harvested 48 hours after the second transfection and RNA
was isolated using the Qiagen RNA isolation kit. RNA quality was assessed by an
Agilent 2100 Bioanalyzer system at the Biocentre Oulu Sequencing facility,
Finland. The transcriptomes of the CPPED1 silenced cells and negative control
cells were sequenced using the Illumina HiSeq high‐throughput sequencing system
(Described in study I).
63
5 Results
5.1 Proteomic changes associated with spontaneous term
deliveries (I)
Proteomic studies of placentas from full term and elective term placentas were used
to identify differential protein expression patterns. After a mass spectrometry
analysis, we found 10 proteins, whose expression levels varied in spontaneous term
placentas compared to elective placentas (Figure 1, Table 1 in original article I).
Among the ten proteins, four proteins, actin cytoplasmic 1 (ACTB), β‐2‐
microglobulin, keratin type II cytoskeletal 8, keratin type II cytoskeletal 19 were
upregulated, whereas six proteins, α‐2‐macroglobulin, CPPED1, cytochrome b5,
haemoglobin subunit γ‐2, peroxiredoxin‐2 and plasminogen activator inhibitor 2
were downregulated in spontaneous term placentas compared with elective term
placentas. We confirmed the proteomics results for CPPED1 using western blotting
and observed a corresponding decrease in the protein level (Figure 1 in original
article I).
5.1.1 Placental differential protein expression between chorionic and
basal plates
A proteomics analysis of placentas from either spontaneous term or elective term
deliveries revealed that totally 19 proteins were differentially expressed in the
chorionic plate and basal plate regions of the same placenta. Out of 19 proteins,
eleven proteins, ACTB, annexin A3 (ANXA3), annexin A5 (ANXA5), serum
amyloid P‐component (APCS), clusterin (CLU), fibrinogen β (FGB), fibrinogen γ
(FGG), gelsolin (GSN), lumican (LUM), tropomyosin α‐1 chain (TPM1) and
tropomyosin β chain (TPM2) had higher expression levels in the chorionic plate,
whereas eight proteins, elongation factor 2 (EEF2), ferritin light chain (FTL), 3‐
hydroxyisobutyrate dehydrogenase (HIBADH), heterogeneous nuclear
ribonucleoprotein K (HNRNPK), estradiol 17‐β‐dehydrogenase 1 (HSD17B1),
lamin‐B1 (LMNB1), vacuolar protein sorting‐associated protein 35 (VPS35) and
tryptophan‐tRNA ligase (WARS) were present at lower levels in the chorionic plate
compared to the basal plate (Figure 2, Table 1 in original article I).
64
5.1.2 CPPED1 expression levels and its polymorphism associated
with gestational age
We investigated whether SNPs within 20 kb of the genes encoding for
ACTB, A2M, B2M, CPPED1, CYB5A, HBG2, KRT8, KRT19, PRDX2 and SERPI
NB2 associated with the length of gestation. Of all the analyzed SNPs only two
alleles rs11643593 (A) and major allele of rs8048866 (A) (Table S4 and S5 in
article I) located near the CPPED1 gene associated with the length of gestation,
indicating that CPPED1 may be involved in the initiation of labor.
Next, we analyzed whether changes in CPPED1 protein levels are due to
altered mRNA levels. To this end, mRNAs were isolated from the placentas of
spontaneous term (N=6) and elective term pregnancies (N=6) at both basal plate
and chorionic plate regions and revealed that CPPED1 mRNA levels were
significantly lower in spontaneous term placentas compared with elective term
placentas ((P < 0.05)) (Figure 4 in article I).
5.1.3 AKT1 phosphorylation levels are unaffected by variations in
CPPED1 expression levels
Previously it has been shown that CPPED1 dephosphorylates Ser473 of AKT1 in
bladder cancer and supresses tumor growth (D. X. Zhuo et al., 2013). AKT1 has
been shown to phosphorylate its downstream targets, such as forkhead box protein
1, (FOXO1) also known as forkhead homologue in rhabdomyosarcoma (FKHR),
and together with progesterone receptor B acts as a transcriptional complex that
regulates the transcription of certain decidual genes (Takano et al., 2007; Vasquez
et al., 2015). We investigated whether lower CPPED1 levels lead to an increase in
p-AKT and FOXO1 phosphorylation levels in spontaneous term placentas and
found that the phosphorylation levels of both AKT1 and FOXO1 (Figure 5 in article
I) were unaffected despite the variations in CPPED1 expression levels.
5.1.4 CPPED1 silencing in HTR-8 trophoblasts and mRNA
transcriptomics (I)
To investigate the functional aspect of CPPED1 in the placenta, we silenced
CPPED1 in HTR-8 trophoblasts, a continuous cell line (ATCC) derived from first
trimester placentas with small interfering RNAs (siRNA) (Figure S2 in article I).
When gene expression levels were analyzed using RNA sequencing, 147 genes
65
were either up (n = 77) or down (n = 70) regulated by CPPED1 silencing compared
to control cells (Table S6 & S7 article I). When the differentially expressed genes
were grouped according to their Gene ontology (GO) biological processes and
molecular functions, the inflammation, blood vessel and vasculature development
related pathways were among the most affected ones (Table S8 in article I).
5.2 miRNA transcriptomics of spontaneous term birth (II)
miRNAs are among the most important regulators of gene expression and their
deviant expression levels associate with various diseases and pathological
conditions. Several studies proposed that altered expression of the miRNAome in
maternal circulation or in placental tissue has a role in pregnancy maintenance and
gestational diseases such as preterm birth. To identify the differential miRNA
expression profiles between spontaneous term and elective term placentas, we
performed comparative studies using miRNAomics.
5.2.1 miRNA transcriptomics identifies differential miRNA
expression in spontaneous and elective term placentas (II)
To determine the variations in the levels of miRNA expression between
spontaneous term labor and elective term labor placentas, we used miRNAomics
of human placentas from spontaneous deliveries (n = 6) and elective births (n = 6).
miRNAomics revealed that 23 miRNAs were upregulated, whereas 31 miRNAs
were downregulated in spontaneous term labor compared to elective term placentas
(Table 1 in original article II). Among the identified differentially expressed
miRNAs, some belonged to placental specific clusters, in which miR-323b-3p is a
member of the C14MC cluster, while miR-371a-5p, miR-371b-3p, miR-372-3p,
miR-372-5p and miR-373-3p are the members of the miR-371-3 cluster, located
adjacent to the chromosome 19 miRNA cluster. The miRNA genes of the rest of the
differentially regulated miRNAs are in different chromosomes.
5.2.2 Comparison of human placental proteomics and miRNAomics
identifies a miR-371a-5 -CPPED1 pair (I, II)
In miRNAomics, we found 54 miRNAs which were differentially expressed
between placentas from elective and spontaneous deliveries. Further, we
investigated whether there was any overlap between the proteomics and predicted
66
targets of miRNAs and identified three miRNA–protein target matches in the basal
plate of the placenta: miR-371a-5p–CPPED1, miR-3614-3p–ACTB and miR-
6872-3p–ACTB. We found that in spontaneous term deliveries, miR-371a-5p was
upregulated, whereas its target CPPED1 was downregulated indicating a potential
association between CPPED1 and miR-371a-5p.
5.2.3 CPPED1 mRNA levels are decreased and miR371a-5p levels
increased during spontaneous delivery (II)
In our comparative proteomic analysis and mRNA quantification analysis, we
found a decrease in the expression of the CPPED1 protein and mRNA levels in
both the basal plate and chorionic plates of the placenta from spontaneous term
labor. Further, we continued our study to measure CPPED1 mRNA levels by a
quantitative PCR (qPCR) analysis in spontaneous (n = 20) and elective caesarean
(n = 33) and preterm delivered placentas from both the chorionic and basal plate
regions. We found that CPPED1 mRNA levels decreased (1.5-fold, p< 0.001) in
the chorionic plate of the placenta at spontaneous preterm birth, but we did not
observe the same in the basal plate (Figure 1 in article II). Using miRNAomics we
observed that miR-371a-5p levels increased by 1.5-fold (p =0.04) in the basal plate
of spontaneous term placentas (Figure 2 in article II) compared to those of preterm
deliveries. The inversely correlated expression levels of miR-371a-5p and CPPED1
suggests that miR-371a-5p might regulate the levels of CPPED1 post-
transcriptionally.
5.2.4 miR-371a-5p and miR-520d-5p bind to the 3′UTR of CPPED1
In order to validate the binding of miR-371a-5p to the 3′UTR of the CPPED1
mRNA, we used a dual luciferase reporter gene assay to study the post-
transcriptional regulation of target mRNAs in intact cells. In addition to the miR-
371a-5p of miR-371-3 cluster, we also analyzed two other miRNAs of the C19MC
cluster, miR-520d-5p and miR-524-5p for their binding to the UTR and
posttranslational regulation of CPPED1 (Figure 3 in article II).
Both whole (WT) and truncated (lacking the terminal 33 bps, Mut) 3′UTRs of
CPPED1 mRNAs were cloned into the pmiRGLO vector and transfected into HEK-
293T continuous cell line. The mutant construct lacked the seed regions of both
miR-520d-5p and miR-524-5p, while both constructs contained the seed regions
for miR-371a-5p binding. The luciferase reporter assay revealed a significant
67
decrease (p = 0.004) in the relative luciferase activity of cells co-transfected with
the WT construct and the miR-371a-5p mimic (WT/miR-371a-5p) (n = 6)
compared to those transfected with the WT construct and the miRNA mimic
negative control (WT/miR-neg) (n = 6). We observed a similar decrease when the
cells were co-transfected with the WT construct and the miR-520d-5p mimic
(WT/miR-520d-5p) (n = 6, p = 0.004) when compared to WT/miR-neg (n = 6).
Altogether, these results indicated that miR-371a-5p of the miR-371-3 cluster and
miR-520d-5p of the C19MC cluster negatively regulates CPPED1 expression
(Figure 3 in article II).
5.3 CPPED1 classification and its functional role
5.3.1 CPPED1 sequence alignment suggests a metallophosphotase
family protein (III)
Zhuo et al., reported that based on a sequence analysis, CPPED1 contains a PP2A
catalytic domain from amino acids 50 to 250. According to the classification of the
protein phosphatase superfamily, members of the PP2A protein family do not
require any metal ions for their catalytic functions. CPPED1 phosphatase activity
was abrogated by trifluoroperazine, which is a PP2B specific inhibitor that does not
affect PP2A members (D. X. Zhuo et al., 2013), indicating a possible error in
classification, and prompting us to investigate CPPED1 further. Based on previous
reports, we searched for homology sequences using NPS Blast, and showed that
purple acid phosphatases from plants and phosphoesterases from Mycobacterium
and enterobacterial members are the closest homologues of CPPED1 (Figure 1 and
2 in article III).
5.3.2 CPPED1 dephosphorylates AKT1 in vitro
Previously, Zhang et al. reported that CPPED1 dephosphorylates AKT1 at the Ser-
473 residue and prevents bladder cancer progression in a mouse model (D. X. Zhuo
et al., 2013). In contrast to this finding, in our studies p-AKT of Ser-473 levels
remained unchanged, irrespective of CPPED1 expression levels in different term
placentas (Haapalainen et al., 2018). Using recombinant CPPED1, we performed
an in vitro phosphatase assay essentially as described by Gao et al., to confirm
whether CPPED1 dephosphorylates AKT1 (T. Gao et al., 2005). In this assay, we
68
incubated 30 ng of AKT1 and 25 ng of CPPED1 in Tris-HCl pH 7.5 buffer
containing 5 mM Mn2+ according to the protocol and another set without metal ions.
We observed that CPPED1 dephosphorylates AKT1 in the presence of both Mn2+
(maximum activity) and Ca2+ (moderately active) but no effect was observed in the
presence of Mg2+ (Figure 3 in article III).
5.3.3 CPPED1 interacts with multiple proteins in an in vitro protein
microarray
HuProt protein microarray has vast number of applications which includes
autoantibody-screening, protein-protein interactions, protein posttranslational
modifications and analyzing the modulation of protein expression levels in health
and diseased conditions (Huang et al., 2012). To identify proteins, which might
interact with CPPED1, recombinant purified CPPED1 with both V5 and His tags
were sent to a protein microarray core facility at Cambridge, the UK. After analysis
of protein-protein interaction studies, we obtained a list of 36 proteins (Table 1 in
article III), which interact with CPPED1 in vitro. A further pathway analysis was
done using DAVID functional annotation studies of all proteins to identify the
biological pathways affected by these proteins. Positive signal transduction
pathways and insulin pathways (PI3K/AKT pathways) were enriched in the list
(Table 2 in Article III).
5.3.4 CPPED1 and binding protein interactions confirmed by co-IP
and a BiFC assay
After the pathway analysis, we chose PAK4 and PIK3R2 for further studies. In
order to confirm the interaction between CPPED1 and binding partners, we
performed a co-IP of PAK4 and PIK3R2 with CPPED1. HEK 293T cells were co-
transfected with pCMVFlag Tag-CPPED1 and c-Myc tagged interacting partners.
CPPED1 and PAK4, PIK3R2 co-transfected cell lysates were pulled down with the
c-Myc antibody and probed with the anti-CPPED1 antibody (Figure 4 in article III).
We further used a BiFC assay to confirm the interaction between CPPED1 and
its putative binding partners the PAK4 and PIK3R2 proteins. We observed that cells
transfected with CPPED1 and PIK3R2 showed a fluorescence signal in the cytosol
with high intensity spots at the cell membrane, whereas PAK4 and CPPED1 over-
expressing cells gave the strongest signal in the cytoplasm (Figure 5 in article III).
Previously, it has been reported that phosphorylation of PAK4 is essential for its
69
nuclear translocation and functions (Li et al., 2012). Our studies confirmed the
interaction of CPPED1 with PAK4, however the functional importance of this
interaction remains to be elucidated.
5.3.5 CPPED1 dephosphorylation activity on the PAK4 and PIK3R2
proteins
After corroborating the interactions of CPPED1 with PAK and PIK3R2, we further
investigated the effect of CPPED1 on the phosphorylation status of PAK4 and
PIK3R2 proteins by an in vitro phosphatase activity assay. After the activity assay,
we analyzed the total phosphorylation levels on both the protein peptides identified
after a mass spectrometry analysis (Figure S7 in article III). It was found that
CPPED1 dephosphorylates five different serine residues in PAK4 including Ser 104,
Ser 167, Ser 173, Ser 174, Ser 181 and Ser 195 amino acids (Figure 6 in article III).
Out of the five, three have not been reported so far and the importance of these
phosphorylation sites in the functional regulation of PAK4 is not known. In contrast,
we did not observe any changes in the phosphorylation levels of the PIK3R2 protein,
which is mainly regulated by tyrosine-based phosphorylation/dephosphorylations
mediated by phosphotyrosine kinases/phosphatases.
70
71
6 Discussion
The molecular mechanisms associated with the onset of human parturition are
incompletely understood. We carried out proteomic and miRNAomic analyses of
human placentas, comparing samples from spontaneous term and elective term
labors to identify the proteins and miRNAs involved in the onset of labor.
6.1 Proteomic changes in spontaneous term and elective term
placentas (I)
We compared the human placental proteomes after spontaneous and elective term
delivery and detected statistically significant differences in the levels of ten proteins
between spontaneous and elective term deliveries. The quantitative changes were
significant in either the basal or the chorionic plates or in both. When we performed
a pathway analysis, we found that the majority of the GO terms were linked to
either the immune system or to structural/cytoskeletal organization. Structural
molecule activity (ACTB, KRT8 and KRT19) represented the major molecular
function. In addition, A2M and SERPINB2 were in the same blood coagulation
pathway. CPPED1 was not associated with any of the enriched GO terms. As a
phosphatase, CPPED1 is supposed to be involved in blocking cell cycle progression,
promoting apoptosis and affecting glucose metabolism (Vaittinen et al., 2013; D.
X. Zhuo et al., 2013). In addition, among the genes encoding the ten proteins whose
expression differed in spontaneous and elective births, genetic variants of the
CPPED1 gene associated with the duration of term pregnancies.
6.1.1 Placenta has a unique set of proteins at the fetal and maternal
sides
There is only a limited number of studies on the differential mRNA and protein
expression in fetal (chorionic) and maternal tissues (Decidua basalis). Two
independent studies found oxytocin as well as oxytocin receptor (OTR) levels to
be higher in the decidua and the fetal regions, in proximity of the decidua compared
to distal regions of the fetus (Chibbar, Miller, & Mitchell, 1993; Takemura et al.,
1994). Another study, which involved in identifying the low molecular weight
proteins and peptides between the chorionic and basal plates of the same placenta
reported 16 species with significant differences between the two regions (Kedia,
Nichols, Thulin, & Graves, 2015). When we compared the proteomes of the
72
chorionic and basal plates, we identified 19 proteins differentially expressed
between the foetal (chorionic plate) and the maternal (basal plate) sides of placenta.
When we compared the list of proteins from our studies with the proteins which
were reported in different studies and listed in a systematic review by Kacerovsky
et al., we found several proteins in common such as ACTB, keratin type I,
cytoskeletal 19, SERPINB3, annexin A3, annexin A5, and isoform 4 of
tropomyosin a-1 chain.
6.1.2 CPPED1 expression levels and polymorphisms associated with
the length of gestation and spontaneous term birth
CPPED1 is a phosphoprotein phosphatase encoded on chromosome 16p13.12. This
protein has 3 isoforms. Isoform 1 is a full-length protein comprising 314 amino
acids, while variant 2 is shorter form lacking amino acid residues 97-238 and
variant 3 varies in its sequence from isoform 1 at residues 97-122 and lacks amino
acids 123-314. The importance of these variants is not known yet. A qPCR analysis
of CPPED1 showed lower expression in spontaneous term labor compared to
elective term placentas and two of its SNPs were shown to strongly correlate with
the length of gestation. These notions emphasize its role in the onset of labor.
Previous studies have shown that CPPED1 dephosphorylates AKT1 on Ser473 and
inhibits AKT1 activation. However, in our studies p-AKT levels remain unchanged
despite varying CPPED1 expression levels. It is known that AKT1 phosphorylates
FOXO1 and FOXO3 and inhibits FOXO transcription factor mediated gene
expression by recruiting FOXO from the nucleus to the cytoplasm. FOXO interacts
with the progesterone receptor and this complex binds to DNA and activates
decidual genes, which play a major role in implantation. In addition to p-AKT
levels we did not observe any changes in FOXO1 and FOXO3 and their
phosphorylation levels. Interestingly, siRNA knockdown of CPPED1 in HTR-8
cells leads to the upregulation of the PI3K pathway negative regulatory gene
expression levels such as phosphoinositide-3-kinase interacting protein 1 (PIK3IP1) and phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma (PIK3CG) indicating that CPPED1 might be involved in the
regulation of the PI3K/AKT pathway via other proteins rather than AKT1. Hence,
further studies are needed to understand the cellular functions and mechanism of
CPPED1 action in regulating the PI3K pathways in detail.
73
6.2 The expression levels of miRNAs associate with the outcome
of labor (II)
In this study we compared the miRNA expression levels between term placentas
from spontaneous births and elective births without labor. We were able to identify
a total of 53 different miRNA expression levels when comparing spontaneous and
elective births. Further, we compared our miRNAomics data with proteomics data
to find out whether these miRNAs target any of the reported protein candidates.
Indeed, using qpCR we found that miRNA371a-5p targets CPPED1 and its levels
were upregulated in spontaneous term placentas vs electively delivered placentas.
6.2.1 miR-371a-5p
The regulation of miR-371-5p is an epigenetic process which is dependent on
methylation and histone deacetylation mechanisms. The role of miR371-3 in the
placenta and during pregnancy was not known and further studies were needed to
understand its role in the placenta. Zhao et al., found that miR-371a-5p levels are
upregulated in gestational trophoblastic neoplasia (GTN) as compared to complete
hydatidiform moles and the elevated levels are associated with enhanced
proliferation, differentiation and invasion in choriocarcinoma cells. This dentotes
that miR371-3 may serve as a diagnostic marker for GTN (J. R. Zhao et al., 2018).
Other pregnancy disorders, in which miR-371-5p is involved, are intrahepatic
cholestasis, where patients have elevated levels of miR-371-5p in their serum (Zou
et al., 2018). Recurrent pregnancy loss is a condition in which apoptosis dominates
trophoblast growth which results in an adverse pregnancy outcome. The expression
of miR-371-5p and its target gene X-linked inhibitor of apoptosis protein (XIAP)
are greatly reduced, which is associated with increased apoptosis which further
leads to pregnancy loss (Du et al., 2019). In our studies we discovered that the
levels of miR-371a-5p are higher in term placentas from spontaneous deliveries
compared to elective term placentas.
6.2.2 CPPED1 is targeted by miR-371a-5p and their expression levels
inversely associate with each other
In our previous studies we have shown that the expression level of CPPED1
associates with the timing of birth. In addition, spontaneous term placentas have
decreased levels of CPPED1 compared to elective term placentas. Our
74
miRNAomics data showed that miRNA-371a-5p levels are upregulated in term
placentas. Furthermore, we showed that miRNA-371a-5p targets CPPED1 in vitro
assay. Interestingly, we did not observe any changes in the levels of CPPED1 in
preterm delivered placentas compared to spontaneous term placentas. Quantifying
CPPED1, along with miR-371a-5p may reveal an association, which indicates the
length of pregnancy or the onset of labor.
6.3 Homo sapiens CPPED1 belongs to the calcineurin-like
metallophosphoesterase superfamily (III)
Previously, CPPED1 was categorized as a protein phosphatase 2B family member
(D. X. Zhuo et al., 2013). Our homology search using the NPS Blast tool suggested
that CPPED1 belongs to the metallophosphatase (PPM) superfamily. However,
CPPED1 lacks MPPs signature sequence motifs. Metalloproteinphoshatases
contain two important signature sequence motifs, GDCDN-RTWGD and
DXH(X)nGDXX D(X)nGNHD/E, which are found in several PPM family
members. CPPED1 does not have these motifs except for the presence of GNHD
residues, which may aid in metal ion binding and catalysis. The lack of signature
motifs indicates that CPPED1 does not belong to MPPs despite the metal binding.
In another study, Guasch et al., performed a comparative analysis of amino
acid residues of the catalytic domain containing FSAPNYxxxxxNx from
calcineurin A with other PPP family members, identified that this motif is highly
conserved in all protein phosphatase family members including
metalloproteinphosphatases, while CPPED1 does not have this sequence,
indicating its divergence from other PPPs members (Guasch et al., 2015).
Further we have noticed that CPPED1 has many similar features to that of class
III cyclic nucleotide phosphodiesterases (also called Calcineurin-like
metallophosphoesterases, MPEs) and we conclude that CPPED1 may belong to
metallophosphoesterases (Matange, 2015) .
6.3.1 CPPED1 mediates the dephosphorylation of AKT1
In our studies we found that AKT1 levels were not affected by variations in
CPPED1 expression levels in spontaneous and elective term placentas and AKT1
was the only protein shown to be dephosphorylated by CPPED1. In order to
confirm whether CPPED1 can dephosphorylate and to assure the purified
recombinant CPPED1 was functionally active, we performed an in vitro
75
phosphatase assay with AKT1 as substrate. AKT is a member of the AGC family
of protein kinases and was discovered in 1977 as the oncogene in the transforming
retrovirus AKT8. AKT1 is also known as protein kinase B (PKB), a serine
threonine specific protein kinase which plays a major role in many cellular
processes such as cell proliferation, cell migration, glucose metabolism,
transcription and apoptosis. AKT1 is a pivotal downstream component of the
phosphatidylinositol 3-kinase (PI3K) pathway and it regulates the balance between
cell survival and apoptosis (Scheid & Woodgett, 2001).
AKT Activation
AKT resides in the cytoplasm in its inactive form until the cell is activated by an
extracellular stimulus at which point AKT translocates to the plasma membrane.
The pleckstrin homology (PH) domain of AKT has high affinity for the secondary
messenger PIP3 (PI 3,4,5 triphosphate) and PI3K pulls AKT to the membrane and
this interaction causes conformational changes resulting in the phosphorylation of
Thr-308 in the kinase domain and of Ser-473 in the C-terminal domain. AKT is
partially activated by phosphorylation of Thr-308 by PDK1 and becomes fully
active when phosphorylated on Ser-473, which is catalyzed by many proteins
including phosphoinositide-dependent kinase 2 (PDK2), integrin-linked
kinase (ILK), mechanistic target of rapamycin complex (mTORC) and DNA-
dependent protein kinase (DNA-PK)(Hemmings & Restuccia, 2012;
Vanhaesebroeck & Alessi, 2000).
Regulation of AKT
The PI3K/AKT pathway is a key player in many cellular signaling pathways, it
must be regulated carefully, and its dysregulation leads to various disease
conditions including cancer. One such mechanism of regulation is reducing the
levels of PIP3. PTEN is a tumor suppressor, which antagonizes PI3K by converting
PIP3 to PIP2 and therefore a loss of PTEN leads to hyperactivation of AKT.
Another way of regulation is by Protein Phosphatase 2A (PP2A) which
dephosphorylates AKT on Thr-308, and by the phosphatase PHLPP which
dephosphorylates AKT on Ser-473 (Manning & Toker, 2017).
CPPED1 is a recently identified protein phosphatase, found to dephosphorylate
AKT1 on Ser-473 in vivo, and blocks the cell cycle and promotes apoptosis via its
phosphatase domain. A gene expression analysis on the mRNA level has shown
76
that CPPED1 levels are downregulated in bladder cancer and its overexpression
suppressed the size of tumors in nude mice, indicating a role in cancer regulation
by inhibiting AKT1 activation through a dephosphorylating mechanism (D. X.
Zhuo et al., 2013). In vitro, CPPED1 mediated AKT1 dephosphorylation is metal
ion dependent. We analyzed the effect of three different metal ions Mn2+, Ca2+ and
Mg2+ on AKT dephosphorylation. It was observed that in presence of Mn2+, AKT1
dephosphorylation was most prominent, whereas the activity was moderate in the
presence of Ca2+, and no phosphate activity towards AKT1 was observed with Mg2+
ions.
6.3.2 Interaction between CPPED1 and selected target proteins were
confirmed using co-immunoprecipitation and BiFC
experiments
After carrying out a pathway analysis for proteins found in the protein microarray
interactome study, we found that the PI3K/AKT pathway was enriched in the list.
From the pathway analysis we chose the PAK4 and PIK3R2 proteins for further
studies. It is well known that GRB2, PAK4 and PIK3R2 are involved in the same
pathway as well as in many other cellular signaling pathways (Thillai, Lam, Sarker,
& Wells, 2017; Wagner, Stacey, Liu, & Pawson, 2013)
p21 Activated Kinase 4 (PAK4)
PAK4 is a member of the p21-activated kinase (PAK) family of serine/threonine
kinases that contains six protein members named PAK 1-6, which are further
subdivided into two groups based on domain structure, sequence homology and
regulation. Group I PAKs are PAK 1-3 and group II are PAK 4-6. Structurally PAK4
contains an N-terminal PBD (p21-GTPase -binding domain) and a highly
conserved C-terminal catalytic Ser/Thr kinase domain and a newly identified auto-
inhibitory domain (AID) or AID like pseudosubstrate sequence (B. H. Ha et al.,
2012).
Pak4 is highly expressed throughout the developmental stages ubiquitously and
in adults at low levels. PAK4 activity is mainly regulated by phosphorylation of Ser
474 which is mediated by autophosphorylation as well as protein kinase D 1
(PKD1) and by an autoinhibitory domain that is released upon RhoGTPase binding.
Another important regulation mechanism for PAK4 is cellular translocation. It has
been shown that phosphorylation of Ser 99 by PKD1 and binding of the 14-3-3
77
protein promotes the formation of a PAK4/LIMK/PKD1 complex, which regulates
directed cell migration to the leading edge (Bastea et al., 2013). PRP4 is a kinase,
identified to phosphorylate PAK4 on Ser 104 and the functional importance of this
phosphorylation in PAK4 is not known yet (Q. Gao et al., 2013). Based on previous
studies it is evident that phosphorylation events play an important role in the
cellular translocation of PAK4 and its functional regulation. A mutation in the Ser
99 residue leads to the cytoplasmic retention of PAK4, whereas a mutation in Ser
474 impairs its nuclear translocation. In our studies we identified that CPPED1
interacts with PAK4 and dephosphorylates it on different serine residues.
Elucidating these dephosphorylation events helps to better understand the cellular
translocation of PAK4 and its functional regulation in the cellular milieu.
Phosphoinositide-3-Kinase Regulatory Subunit 2 (PIK3R2)
The most important function of the p85 subunit is the regulation of PI3K activation
by modulating the stability, conformation, and localization of the catalytic subunit.
Structurally p85 contains an N-terminal SH3 domain followed by a RhoGap
homology region located between the two proline rich domains. Upon binding to
activated receptor tyrosine kinases (RTK), the SH2 domain of p85 mediates
translocation of PI3K to the plasma membrane and initiates conformational
changes which lead to the activation of the PI3K pathway (Cariaga-Martinez et al.,
2014). P85β is mainly localized to the cytosol and concentrates at focal adhesions.
In the nucleus, it interacts with PI3Kβ which is required for the nuclear functions
of PI3Kβ (Kumar et al., 2011). An expression level analysis of p85β in colon and
breast cancer samples showed that the elevated expression PI3Kβ is correlated with
elevated AKT activation and a high-grade tumor stage and similar observations
were found in metastatic melanoma (Cortes et al., 2012). Recently it was shown
that the epigenetic regulation of the PIK3R2 promoter contains CpG islands and its
methylation is reduced by IL-6 that affects genes involved in angiogenesis and
insulin signaling (Balakrishnan, Guruprasad, Satyamoorthy, & Joshi, 2018).
Vallejo-Díaz et al., proposed that the oncogenic role of PIK3R2 in different cancers
by the elevated activation of the PI3K pathway indicates its involvement in tumor
progression (Vallejo-Diaz, Chagoyen, Olazabal-Moran, Gonzalez-Garcia, &
Carrera, 2019) . Our HuProt microarray interactome studies showed that CPPED1
interacts with PIK3R2 and the interaction was confirmed with co-
immunoprecipitation and BiFC studies. Further, mass spectrometry analysis of
78
PIK3R2 revealed that its phosphorylation levels are unaffected by CPPED1, but
the effect of CPPED1 on the expression levels of p85β is not known.
Fig. 10. Compex interplay of CPPED1 with different proteins of the PI3K/AKT and PAK4
signaling pathways. Binding of growth factors to tyrosine receptors leads to activation
of GRB2, which further activates PI3K via Ras GDP/GTP proteins. CPPED1 interacts
with GRB2. Activated PI3K converts PIP2 to PIP3 which recruits PDK1 and AKT1 to the
cell membrane. CPPED1 interacts with p85β which is a regulatory subunit of PI3K, but
the significance of this interaction is yet to be elucidated. PDK1, PDK2 and ILK
phosphorylate AKT1, which leads to the full activation of AKT1. Similarly, PP1, PP2A,
PHLPP dephosphorylate AKT1 which leads to AKT1 inactivation. CPPED1 is shown to
dephosphorylate AKT1 on Ser-473 and promote apoptosis. Activated AKT1
phosphorylates FOXO1/3 transcription factors leading to the nuclear exclusion of FOXO
proteins. On the other hand, the PAK4 protein is activated by the KRAS or PI3K protein,
which further activates AKT1 by phosphorylation. Both AKT1 and PAK4 reciprocally
regulate each other. PAK4 functions are regulated by phosphorylation/
dephosphorylation events. Autophosphorylation of PAK4 on Ser-474 leads to nuclear
translocation and activation of the expression of certain genes. CPPED1 interacts and
dephosphorylates several serine residues which might prevent nuclear translocation
and regulation of PAK4 functions are yet to be elucidated. In our studies we have shown
the interaction of CPPED1 with PAK4 and PIK3R2 which might regulate the PI3K
pathway at various stages either by p85β or PAK4 in addition to previously known AKT1
dephosphorylation (Modified based on Crivellaro et al., 2016; Thillai et al., 2017).
In a recent study, Zhuo et al., showed that the mechanism of CPPED1 tumor
suppressor activity in bladder cancer via decreasing IL-6 secretion which
79
inactivates the STAT3 signaling pathway. A gene expression analysis of CPPED1
overexpressing bladder cancer cells by microarray identified that IL-6 was
downregulated (D. Zhuo, Wu, Luo, Deng, & Niu, 2019) , whereas in contrast to
this, in our previous findings the knockdown of CPPED1 in HTR-8 trophoblast
cells led to a three-fold decrease in IL- 6 levels, implying that the function of
CPPED1 might be dependent on cell type and origin. It is interesting to note that
IL-6 reduces PIK3R2 levels by epigenetic modifications, whereas CPPED1
silencing leads to upregulation of IL-6 in bladder cancer. This suggests that
CPPED1 might influence p85β expression levels either directly or via upregulating
the levels of IL-6 in the cellular milieu. Further investigation is needed to
understand the connection between CPPED1, IL-6 and PIK3R2. This information
may help in the elucidation of the cancer progression.
6.4 Prospects for future studies
Using proteomics and miRNA-omic studies, we have identified different proteins
and variations in miRNA expression levels between term and elective term
placentas.
Our comparative proteomics studies have identified 10 proteins which were
differentially expressed in term placentas compared with elective term placentas.
Among the ten proteins, the following four were upregulated: ACTB, b-2-
microglobulin (B2M), keratin type II cytoskeletal 8 (KRT8) and 19 (KRT19),
whereas six proteins, including a-2-macroglobulin (A2M), CPPED1, cytochrome
b5 (CYB5A), haemoglobin subunit c-2 (HBG2), peroxiredoxin- 2 (PRDX2) and
plasminogen activator inhibitor 2 (SERPINB2) were downregulated and all
proteins showed differences in their expression at the chorionic (fetal side) and the
basal plate (maternal sides) of the placenta, suggesting a fetal - maternal gradient.
Further, we confirmed the associations of CPPED1 SNPs in term deliveries and
that its silencing in trophoblasts affects inflammation and angiogenesis. More
studies are needed with larger placental samples to confirm these changes and to
further strengthen the association of CPPED1 with the onset of labor.
Our miRNAomics demonstrated the differential expression levels of 54
miRNAs and we validated the significant differences in miR-371a-5p levels
between term and elective term placentas. Further, we characterized the connection
between miR-371a-5p and CPPED1 protein levels and they were found to be
inversely correlated in term placentas. Measuring the levels of both miR-371a-5p
80
and the CPPED1 protein during different gestational ages using more placentas
would reveal the kinetics in their variation and importance for the onset of labor.
CPPED1 is an unexplored protein of the protein phosphatase family and known
to play an important role in inhibiting bladder cancer progression via affecting the
AKT/PI3K pathway by dephosphorylating the Ser-473 residue on AKT1. We have
studied in vitro protein-protein interactions of CPPED1 and its binding partners
using the HuProt protein array and confirmed the interaction of CPPED1 with
PAK4 and PIK3R2. An in vitro phosphatase activity assay and mass spectroscopy
revealed that CPPED1 dephosphorylates PAK4 on several different serine residues.
Characterizing the importance of these phosphorylation events will help to
understand the functional regulation of PAK4. Furthermore, studying the effect of
CPPED1 on PIK3R2 expression levels will likely elucidate the functional
mechanism of CPPED1 in the cellular milieu.
81
7 Conclusions
Our comparative proteomics study of spontaneous and elective term labors
identified different protein profiles for the maternal and fetal sides of the placenta.
The levels of these proteins are altered in spontaneous labor. Previous studies
showed that the levels of CPPED1 are reduced with the progression of bladder
cancer and lower levels are associated with low survival, indicating its potential as
a biomarker for cancer progression. Similarly, we found lower levels of CPPED1
to be associated with spontaneous term birth.
miRNAomics were used to determine the differential miRNA expression
patterns between term and elective term phenotypes of labor. Measuring these
identified miRNAs between these two groups and identifying their functional and
biological roles in the placenta would contribute to understanding the roles of these
miRNAs in the onset of labor. In this study we have demonstrated that the
expression levels of a protein and miRNA pair, CPPED1-miR-371a-5p, showed a
significant difference between spontaneous term and elective term placentas and
measuring their levels could be used as a biomarker for labor.
We showed that CPPED1, a novel protein phosphatase dephosphorylates
AKT1 on the Ser-473 residue. However, AKT1 phosphorylation levels remain
unaffected despite of the variations in CPPED1 levels in different term placentas.
The siRNA knockdown of CPPED1 in HTR8 trophoblasts led to an increase in the
upregulation of negative regulators of the PI3K pathway, suggesting that CPPED1
might play a central orchestrating role in fine tuning of the AKT pathway via other
mechanisms if not by AKT1.
Finally, we characterized the protein interactome of CPPED1 using a protein
microarray and corroborated the interaction of CPPED1 with PAK4 and PIK3R2,
both involved in the regulation of the AKT/PI3K pathway. Based on proteomics,
genetics and epigenetics CPPED1 associates with spontaneous birth and may turn
out to be a specific biomarker for the onset of labor. CPPED1 might be a
pleotrophic protein which is involved in the regulation of different cellular
processes by altering the functions of the target protein by either posttranslational
modifications such as dephosphorylation, as seen in case of AKT1 and PAK4, or
by inhibiting or decreasing the levels of certain genes, as in the case of IL-6. Further
studies, identifying the significance of CPPED1 interactions with its binding
partners, might reveal the functional role of CPPED1 in the cellular milieu.
82
83
References
Abadia-Molina, A. C., Ruiz, C., King, A., Loke, Y. W., & Olivares, E. G. (1997). Lymphocytes of human term decidua decrease cell adhesion to a plastic substrate. Human Reproduction (Oxford, England), 12(11), 2393-2398. doi:10.1093/ humrep/12.11.2393 [doi]
ACOG committee opinion no 579: Definition of term pregnancy. (2013). Obstetrics and Gynecology, 122(5), 1139-1140. doi:10.1097/01.AOG.0000437385.88715.4a [doi]
Aghaeepour, N., Lehallier, B., Baca, Q., Ganio, E. A., Wong, R. J., Ghaemi, M. S., . . . Angst, M. S. (2018). A proteomic clock of human pregnancy. American Journal of Obstetrics and Gynecology, 218(3), 347.e1-347.e14. doi:S0002-9378(17)32707-2 [pii]
Alarcon, C. R., Lee, H., Goodarzi, H., Halberg, N., & Tavazoie, S. F. (2015). N6-methyladenosine marks primary microRNAs for processing. Nature, 519(7544), 482-485. doi:10.1038/nature14281 [doi]
Ander, S. E., Diamond, M. S., & Coyne, C. B. (2019). Immune responses at the maternal-fetal interface. Science Immunology, 4(31), 10.1126/sciimmunol.aat6114. doi:eaat6114 [pii]
Aslam, H. M., Saleem, S., Afzal, R., Iqbal, U., Saleem, S. M., Shaikh, M. W., & Shahid, N. (2014). "Risk factors of birth asphyxia". Italian Journal of Pediatrics, 40, 94-014-0094-2. doi:10.1186/s13052-014-0094-2 [doi]
Balakrishnan, A., Guruprasad, K. P., Satyamoorthy, K., & Joshi, M. B. (2018). Interleukin-6 determines protein stabilization of DNA methyltransferases and alters DNA promoter methylation of genes associated with insulin signaling and angiogenesis. Laboratory Investigation; a Journal of Technical Methods and Pathology, 98(9), 1143-1158. doi:10.1038/s41374-018-0079-7 [doi]
Bastea, L. I., Doppler, H., Pearce, S. E., Durand, N., Spratley, S. J., & Storz, P. (2013). Protein kinase D-mediated phosphorylation at Ser99 regulates localization of p21-activated kinase 4. The Biochemical Journal, 455(2), 251-260. doi:10.1042/ BJ20130281 [doi]
Bastek, J. A., & Elovitz, M. A. (2013). The role and challenges of biomarkers in spontaneous preterm birth and preeclampsia. Fertility and Sterility, 99(4), 1117-1123. doi:10.1016/j.fertnstert.2013.01.104 [doi]
Bentwich, I., Avniel, A., Karov, Y., Aharonov, R., Gilad, S., Barad, O., . Bentwich, Z. (2005). Identification of hundreds of conserved and nonconserved human microRNAs. Nature Genetics, 37(7), 766-770. doi:ng1590 [pii]
Berghella, V., & Saccone, G. (2016). Fetal fibronectin testing for prevention of preterm birth in singleton pregnancies with threatened preterm labor: A systematic review and metaanalysis of randomized controlled trials. American Journal of Obstetrics and Gynecology, 215(4), 431-438. doi:10.1016/j.ajog.2016.04.038 [doi]
Bortolin-Cavaille, M. L., Dance, M., Weber, M., & Cavaille, J. (2009). C19MC microRNAs are processed from introns of large pol-II, non-protein-coding transcripts. Nucleic Acids Research, 37(10), 3464-3473. doi:10.1093/nar/gkp205 [doi]
84
Bromfield, J. J. (2018). Review: The potential of seminal fluid mediated paternal-maternal communication to optimise pregnancy success. Animal : An International Journal of Animal Bioscience, 12(s1), s104-s109. doi:10.1017/S1751731118000083 [doi]
Broughton, J. P., Lovci, M. T., Huang, J. L., Yeo, G. W., & Pasquinelli, A. E. (2016). Pairing beyond the seed supports MicroRNA targeting specificity. Molecular Cell, 64(2), 320-333. doi:S1097-2765(16)30521-4 [pii]
Brueckner, B., Stresemann, C., Kuner, R., Mund, C., Musch, T., Meister, M., . . . Lyko, F. (2007). The human let-7a-3 locus contains an epigenetically regulated microRNA gene with oncogenic function. Cancer Research, 67(4), 1419-1423. doi:67/4/1419 [pii]
Buhimschi, C. S., Dulay, A. T., Abdel-Razeq, S., Zhao, G., Lee, S., Hodgson, E. J., . . . Buhimschi, I. A. (2009). Fetal inflammatory response in women with proteomic biomarkers characteristic of intra-amniotic inflammation and preterm birth. BJOG : An International Journal of Obstetrics and Gynaecology, 116(2), 257-267. doi:10.1111/ j.1471-0528.2008.01925.x [doi]
Buhimschi, C. S., Weiner, C. P., & Buhimschi, I. A. (2006). Clinical proteomics: A novel diagnostic tool for the new biology of preterm labor, part I: Proteomics tools. Obstetrical & Gynecological Survey, 61(7), 481-486. doi:0006254-200607000-00025 [pii]
Buhimschi, I. A., Christner, R., & Buhimschi, C. S. (2005). Proteomic biomarker analysis of amniotic fluid for identification of intra-amniotic inflammation. BJOG : An International Journal of Obstetrics and Gynaecology, 112(2), 173-181. doi:BJO00340 [pii]
Butt, R. H., Lee, M. W., Pirshahid, S. A., Backlund, P. S., Wood, S., & Coorssen, J. R. (2006). An initial proteomic analysis of human preterm labor: Placental membranes. Journal of Proteome Research, 5(11), 3161-3172. doi:10.1021/pr060282n [doi]
Cai, M., Kolluru, G. K., & Ahmed, A. (2017). Small molecule, big prospects: MicroRNA in pregnancy and its complications. Journal of Pregnancy, 2017, 6972732. doi:10.1155/2017/6972732 [doi]
Cai, Y., Yu, X., Hu, S., & Yu, J. (2009). A brief review on the mechanisms of miRNA regulation. Genomics, Proteomics & Bioinformatics, 7(4), 147-154. doi:10.1016/ S1672-0229(08)60044-3 [doi]
Caniggia, I., Mostachfi, H., Winter, J., Gassmann, M., Lye, S. J., Kuliszewski, M., & Post, M. (2000). Hypoxia-inducible factor-1 mediates the biological effects of oxygen on human trophoblast differentiation through TGFbeta(3). The Journal of Clinical Investigation, 105(5), 577-587. doi:10.1172/JCI8316 [doi]
Cao, H., Yang, C. S., & Rana, T. M. (2008). Evolutionary emergence of microRNAs in human embryonic stem cells. PloS One, 3(7), e2820. doi:10.1371/ journal.pone.0002820 [doi]
Cariaga-Martinez, A. E., Cortes, I., Garcia, E., Perez-Garcia, V., Pajares, M. J., Idoate, M. A., . Carrera, A. C. (2014). Phosphoinositide 3-kinase p85beta regulates invadopodium formation. Biology Open, 3(10), 924-936. doi:10.1242/ bio.20148185 [doi]
Carter, A. M., & Mess, A. (2007). Evolution of the placenta in eutherian mammals. Placenta, 28(4), 259-262. doi:S0143-4004(06)00121-4 [pii]
85
Castellucci, M., Scheper, M., Scheffen, I., Celona, A., & Kaufmann, P. (1990). The development of the human placental villous tree. Anatomy and Embryology, 181(2), 117-128. doi:10.1007/bf00198951 [doi]
Chan, G. J., Lee, A. C., Baqui, A. H., Tan, J., & Black, R. E. (2013). Risk of early-onset neonatal infection with maternal infection or colonization: A global systematic review and meta-analysis. PLoS Medicine, 10(8), e1001502. doi:10.1371/ journal.pmed.1001502 [doi]
Chibbar, R., Miller, F. D., & Mitchell, B. F. (1993). Synthesis of oxytocin in amnion, chorion, and decidua may influence the timing of human parturition. The Journal of Clinical Investigation, 91(1), 185-192. doi:10.1172/JCI116169 [doi]
Conde-Agudelo, A., Papageorghiou, A. T., Kennedy, S. H., & Villar, J. (2011). Novel biomarkers for the prediction of the spontaneous preterm birth phenotype: A systematic review and meta-analysis. BJOG : An International Journal of Obstetrics and Gynaecology, 118(9), 1042-1054. doi:10.1111/j.1471-0528.2011.02923.x [doi]
Cook, J., Bennett, P. R., Kim, S. H., Teoh, T. G., Sykes, L., Kindinger, L. M., . . . Terzidou, V. (2019). First trimester circulating MicroRNA biomarkers predictive of subsequent preterm delivery and cervical shortening. Scientific Reports, 9(1), 5861-019-42166-1. doi:10.1038/s41598-019-42166-1 [doi]
Cortes, I., Sanchez-Ruiz, J., Zuluaga, S., Calvanese, V., Marques, M., Hernandez, C., . . . Carrera, A. C. (2012). P85beta phosphoinositide 3-kinase subunit regulates tumor progression. Proceedings of the National Academy of Sciences of the United States of America, 109(28), 11318-11323. doi:10.1073/pnas.1118138109 [doi]
Cortez, M. A., & Calin, G. A. (2009). MicroRNA identification in plasma and serum: A new tool to diagnose and monitor diseases. Expert Opinion on Biological Therapy, 9(6), 703-711. doi:10.1517/14712590902932889 [doi]
Costa, M. A. (2016). The endocrine function of human placenta: An overview. Reproductive Biomedicine Online, 32(1), 14-43. doi:10.1016/j.rbmo.2015.10.005 [doi]
Crivellaro, S., Carra, G., Panuzzo, C., Taulli, R., Guerrasio, A., Saglio, G., & Morotti, A. (2016). The non-genomic loss of function of tumor suppressors: An essential role in the pathogenesis of chronic myeloid leukemia chronic phase. BMC Cancer, 16, 314-016-2346-6. doi:10.1186/s12885-016-2346-6 [doi]
da Rocha, S. T., Edwards, C. A., Ito, M., Ogata, T., & Ferguson-Smith, A. C. (2008). Genomic imprinting at the mammalian Dlk1-Dio3 domain. Trends in Genetics : TIG, 24(6), 306-316. doi:10.1016/j.tig.2008.03.011 [doi]
Delorme-Axford, E., Donker, R. B., Mouillet, J. F., Chu, T., Bayer, A., Ouyang, Y., . Coyne, C. B. (2013). Human placental trophoblasts confer viral resistance to recipient cells. Proceedings of the National Academy of Sciences of the United States of America, 110(29), 12048-12053. doi:10.1073/pnas.1304718110 [doi]
Denli, A. M., Tops, B. B., Plasterk, R. H., Ketting, R. F., & Hannon, G. J. (2004). Processing of primary microRNAs by the microprocessor complex. Nature, 432(7014), 231-235. doi:nature03049 [pii]
86
Donker, R. B., Mouillet, J. F., Chu, T., Hubel, C. A., Stolz, D. B., Morelli, A. E., & Sadovsky, Y. (2012). The expression profile of C19MC microRNAs in primary human trophoblast cells and exosomes. Molecular Human Reproduction, 18(8), 417-424. doi:10.1093/ molehr/gas013 [doi]
Du, E., Cao, Y., Feng, C., Lu, J., Yang, H., & Zhang, Y. (2019). The possible involvement of miR-371a-5p regulating XIAP in the pathogenesis of recurrent pregnancy loss. Reproductive Sciences (Thousand Oaks, Calif.), 26(11), 1468-1475. doi:10.1177/ 1933719119828051 [doi]
Edmondson, N., Bocking, A., Machin, G., Rizek, R., Watson, C., & Keating, S. (2009). The prevalence of chronic deciduitis in cases of preterm labor without clinical chorioamnionitis. Pediatric and Developmental Pathology : The Official Journal of the Society for Pediatric Pathology and the Paediatric Pathology Society, 12(1), 16-21. doi:10.2350/07-04-0270.1 [doi]
Eleje, G. U., Ezugwu, E. C., Eke, A. C., Eleje, L. I., Ikechebelu, J. I., Ezebialu, I. U., . Ezugwu, F. O. (2017). Accuracy of a combined insulin-like growth factor-binding protein-1/interleukin-6 test (premaquick) in predicting delivery in women with threatened preterm labor. Journal of Perinatal Medicine, 45(8), 915-924. doi:10.1515/ jpm-2016-0339 [doi]
Enders, A. C., & Carter, A. M. (2012). Review: The evolving placenta: Different developmental paths to a hemochorial relationship. Placenta, 33 Suppl, S92-8. doi:10.1016/j.placenta.2011.10.009 [doi]
Esplin, M. S. (2014). Overview of spontaneous preterm birth: A complex and multifactorial phenotype. Clinical Obstetrics and Gynecology, 57(3), 518-530. doi:10.1097/ GRF.0000000000000037 [doi]
Eulalio, A., Huntzinger, E., & Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell, 132(1), 9-14. doi:10.1016/j.cell.2007.12.024 [doi]
Fallen, S., Baxter, D., Wu, X., Kim, T. K., Shynlova, O., Lee, M. Y., . . . Wang, K. (2018). Extracellular vesicle RNAs reflect placenta dysfunction and are a biomarker source for preterm labour. Journal of Cellular and Molecular Medicine, 22(5), 2760-2773. doi:10.1111/jcmm.13570 [doi]
Finn, R., St Hill, C. A., Davis, J. C., Hipkin, L. J., & Harvey, M. (1977). Feto-maternal bidirectional mixed lymphocyte reaction and survival of fetal allograft. Lancet (London, England), 2(8050), 1200-1202. doi:S0140-6736(77)90439-1 [pii]
Fortunato, S. J., & Menon, R. (2001). Distinct molecular events suggest different pathways for preterm labor and premature rupture of membranes. American Journal of Obstetrics and Gynecology, 184(7), 1399-405; discussion 1405-6. doi:S000293780141074X [pii]
Gao, Q., Mechin, I., Kothari, N., Guo, Z., Deng, G., Haas, K., . Huang, S. M. (2013). Evaluation of cancer dependence and druggability of PRP4 kinase using cellular, biochemical, and structural approaches. The Journal of Biological Chemistry, 288(42), 30125-30138. doi:10.1074/jbc.M113.473348 [doi]
Gao, T., Furnari, F., & Newton, A. C. (2005). PHLPP: A phosphatase that directly dephosphorylates akt, promotes apoptosis, and suppresses tumor growth. Molecular Cell, 18(1), 13-24. doi:S1097-2765(05)01178-0 [pii]
87
Gardiner, E., Beveridge, N. J., Wu, J. Q., Carr, V., Scott, R. J., Tooney, P. A., & Cairns, M. J. (2012). Imprinted DLK1-DIO3 region of 14q32 defines a schizophrenia-associated miRNA signature in peripheral blood mononuclear cells. Molecular Psychiatry, 17(8), 827-840. doi:10.1038/mp.2011.78 [doi]
Genbacev, O., Zhou, Y., Ludlow, J. W., & Fisher, S. J. (1997). Regulation of human placental development by oxygen tension. Science (New York, N.Y.), 277(5332), 1669-1672. doi:10.1126/science.277.5332.1669 [doi]
Gharesi-Fard, B., Zolghadri, J., & Kamali-Sarvestani, E. (2015). Proteome differences in the first- and third-trimester human placentas. Reproductive Sciences (Thousand Oaks, Calif.), 22(4), 462-468. doi:10.1177/1933719114549857 [doi]
Glazov, E. A., McWilliam, S., Barris, W. C., & Dalrymple, B. P. (2008). Origin, evolution, and biological role of miRNA cluster in DLK-DIO3 genomic region in placental mammals. Molecular Biology and Evolution, 25(5), 939-948. doi:10.1093/ molbev/ msn045 [doi]
Gomez-Lopez, N., StLouis, D., Lehr, M. A., Sanchez-Rodriguez, E. N., & Arenas-Hernandez, M. (2014). Immune cells in term and preterm labor. Cellular & Molecular Immunology, 11(6), 571-581. doi:10.1038/cmi.2014.46 [doi]
Goodfellow, L. R., Batra, G., Hall, V., McHale, E., & Heazell, A. E. P. (2011). A case of confined placental mosaicism with double trisomy associated with stillbirth. Placenta, 32(9), 699-703. doi:S0143-4004(11)00216-5 [pii]
Gravett, M. G., Novy, M. J., Rosenfeld, R. G., Reddy, A. P., Jacob, T., Turner, M., . . . Nagalla, S. R. (2004). Diagnosis of intra-amniotic infection by proteomic profiling and identification of novel biomarkers. Jama, 292(4), 462-469. doi:10.1001/jama.292.4.462 [doi]
Guasch, A., Aranguren-Ibanez, A., Perez-Luque, R., Aparicio, D., Martinez-Hoyer, S., Mulero, M. C., . Fita, I. (2015). Calcineurin undergoes a conformational switch evoked via peptidyl-prolyl isomerization. PloS One, 10(8), e0134569. doi:10.1371/ journal.pone.0134569 [doi]
Gude, N. M., Roberts, C. T., Kalionis, B., & King, R. G. (2004). Growth and function of the normal human placenta. Thrombosis Research, 114(5-6), 397-407. doi:S0049-3848(04)00342-1 [pii]
Guleria, I., & Sayegh, M. H. (2007). Maternal acceptance of the fetus: True human tolerance. Journal of Immunology (Baltimore, Md.: 1950), 178(6), 3345-3351. doi:178/6/3345 [pii]
Gullai, N., Stenczer, B., Molvarec, A., Fugedi, G., Veresh, Z., Nagy, B., & Rigo, J.,Jr. (2013). Evaluation of a rapid and simple placental growth factor test in hypertensive disorders of pregnancy. Hypertension Research : Official Journal of the Japanese Society of Hypertension, 36(5), 457-462. doi:10.1038/hr.2012.206 [doi]
Gunko, V. O., Pogorelova, T. N., & Linde, V. A. (2016). Proteomic profiling of the blood serum for prediction of premature delivery. Bulletin of Experimental Biology and Medicine, 161(6), 829-832. doi:10.1007/s10517-016-3522-z [doi]
88
Ha, B. H., Davis, M. J., Chen, C., Lou, H. J., Gao, J., Zhang, R., . . . Boggon, T. J. (2012). Type II p21-activated kinases (PAKs) are regulated by an autoinhibitory pseudosubstrate. Proceedings of the National Academy of Sciences of the United States of America, 109(40), 16107-16112. doi:10.1073/pnas.1214447109 [doi]
Ha, M., & Kim, V. N. (2014). Regulation of microRNA biogenesis. Nature Reviews.Molecular Cell Biology, 15(8), 509-524. doi:10.1038/nrm3838 [doi]
Haapalainen, A. M., Karjalainen, M. K., Daddali, R., Ohlmeier, S., Anttonen, J., Maatta, T. A., . Ramet, M. (2018). Expression of CPPED1 in human trophoblasts is associated with timing of term birth. Journal of Cellular and Molecular Medicine, 22(2), 968-981. doi:10.1111/jcmm.13402 [doi]
Hadley, E. E., Richardson, L. S., Torloni, M. R., & Menon, R. (2018). Gestational tissue inflammatory biomarkers at term labor: A systematic review of literature. American Journal of Reproductive Immunology (New York, N.Y.: 1989), 79(2), 10.1111/ aji.12776. Epub 2017 Oct 27. doi:10.1111/aji.12776 [doi]
Han, J., Lee, Y., Yeom, K. H., Kim, Y. K., Jin, H., & Kim, V. N. (2004). The drosha-DGCR8 complex in primary microRNA processing. Genes & Development, 18(24), 3016-3027. doi:gad.1262504 [pii]
Han, L., Witmer, P. D., Casey, E., Valle, D., & Sukumar, S. (2007). DNA methylation regulates MicroRNA expression. Cancer Biology & Therapy, 6(8), 1284-1288. doi:4486 [pii]
Hanash, S. (2003). Disease proteomics. Nature, 422(6928), 226-232. doi:10.1038/ nature01514 [doi]
He, A., Zhou, Y., Wei, Y., & Li, R. (2020). Potential protein biomarkers for preeclampsia. Cureus, 12(6), e8925. doi:10.7759/cureus.8925 [doi]
Hemmings, B. A., & Restuccia, D. F. (2012). PI3K-PKB/akt pathway. Cold Spring Harbor Perspectives in Biology, 4(9), a011189. doi:10.1101/cshperspect.a011189 [doi]
Honest, H., Bachmann, L. M., Gupta, J. K., Kleijnen, J., & Khan, K. S. (2002). Accuracy of cervicovaginal fetal fibronectin test in predicting risk of spontaneous preterm birth: Systematic review. BMJ (Clinical Research Ed.), 325(7359), 301. doi:10.1136/ bmj.325.7359.301 [doi]
Honest, H., Hyde, C. J., & Khan, K. S. (2012). Prediction of spontaneous preterm birth: No good test for predicting a spontaneous preterm birth. Current Opinion in Obstetrics & Gynecology, 24(6), 422-433. doi:10.1097/GCO.0b013e328359823a [doi]
Houbaviy, H. B., Murray, M. F., & Sharp, P. A. (2003). Embryonic stem cell specific MicroRNAs. Developmental Cell, 5(2), 351-358. doi:S1534-5807(03)00227-2 [pii]
Hromadnikova, I., Kotlabova, K., Doucha, J., Dlouha, K., & Krofta, L. (2012). Absolute and relative quantification of placenta-specific micrornas in maternal circulation with placental insufficiency-related complications. The Journal of Molecular Diagnostics : JMD, 14(2), 160-167. doi:10.1016/j.jmoldx.2011.11.003 [doi]
Hromadnikova, I., Kotlabova, K., Ivankova, K., & Krofta, L. (2017). Expression profile of C19MC microRNAs in placental tissue of patients with preterm prelabor rupture of membranes and spontaneous preterm birth. Molecular Medicine Reports, 16(4), 3849-3862. doi:10.3892/mmr.2017.7067 [doi]
89
Huang, Y., Jeong, J. S., Okamura, J., Sook-Kim, M., Zhu, H., Guerrero-Preston, R., & Ratovitski, E. A. (2012). Global tumor protein p53/p63 interactome: Making a case for cisplatin chemoresistance. Cell Cycle (Georgetown, Tex.), 11(12), 2367-2379. doi:10.4161/cc.20863 [doi]
Hudic, I., Stray-Pedersen, B., Szekeres-Bartho, J., Fatusic, Z., Dizdarevic-Hudic, L., Tomic, V., . . . Fatusic, J. (2015). Maternal serum progesterone-induced blocking factor (PIBF) in the prediction of preterm birth. Journal of Reproductive Immunology, 109, 36-40. doi:10.1016/j.jri.2015.02.006 [doi]
Huntzinger, E., & Izaurralde, E. (2011). Gene silencing by microRNAs: Contributions of translational repression and mRNA decay. Nature Reviews.Genetics, 12(2), 99-110. doi:10.1038/nrg2936 [doi]
Huppertz, B. (2008). The anatomy of the normal placenta. Journal of Clinical Pathology, 61(12), 1296-1302. doi:10.1136/jcp.2008.055277 [doi]
Ipsaro, J. J., & Joshua-Tor, L. (2015). From guide to target: Molecular insights into eukaryotic RNA-interference machinery. Nature Structural & Molecular Biology, 22(1), 20-28. doi:10.1038/nsmb.2931 [doi]
Jackson, R. J., Hellen, C. U., & Pestova, T. V. (2010). The mechanism of eukaryotic translation initiation and principles of its regulation. Nature Reviews.Molecular Cell Biology, 11(2), 113-127. doi:10.1038/nrm2838 [doi]
Jo, M. H., Shin, S., Jung, S. R., Kim, E., Song, J. J., & Hohng, S. (2015). Human argonaute 2 has diverse reaction pathways on target RNAs. Molecular Cell, 59(1), 117-124. doi:10.1016/ j.molcel.2015.04.027 [doi]
John, R. M. (2013). Epigenetic regulation of placental endocrine lineages and complications of pregnancy. Biochemical Society Transactions, 41(3), 701-709. doi:10.1042/ BST20130002 [doi]
Jonas, S., & Izaurralde, E. (2015). Towards a molecular understanding of microRNA-mediated gene silencing. Nature Reviews.Genetics, 16(7), 421-433. doi:10.1038/ nrg3965 [doi]
Jung, E. Y., Park, J. W., Ryu, A., Lee, S. Y., Cho, S. H., & Park, K. H. (2016). Prediction of impending preterm delivery based on sonographic cervical length and different cytokine levels in cervicovaginal fluid in preterm labor. The Journal of Obstetrics and Gynaecology Research, 42(2), 158-165. doi:10.1111/jog.12882 [doi]
Kacerovsky, M., Lenco, J., Musilova, I., Tambor, V., Lamont, R., Torloni, M. R., . . . PREBIC Biomarker Working Group 2012-2013. (2014). Proteomic biomarkers for spontaneous preterm birth: A systematic review of the literature. Reproductive Sciences (Thousand Oaks, Calif.), 21(3), 283-295. doi:10.1177/1933719113503415 [doi]
Kane, S. C., Costa Fda, S., & Brennecke, S. (2014). First trimester biomarkers in the prediction of later pregnancy complications. BioMed Research International, 2014, 807196. doi:10.1155/2014/807196 [doi]
Kawamata, T., & Tomari, Y. (2010). Making RISC. Trends in Biochemical Sciences, 35(7), 368-376. doi:10.1016/j.tibs.2010.03.009 [doi]
90
Kedia, K., Nichols, C. A., Thulin, C. D., & Graves, S. W. (2015). Novel "omics" approach for study of low-abundance, low-molecular-weight components of a complex biological tissue: Regional differences between chorionic and basal plates of the human placenta. Analytical and Bioanalytical Chemistry, 407(28), 8543-8556. doi:10.1007/s00216-015-9009-3 [doi]
Kesrouani, A., Chalhoub, E., El Rassy, E., Germanos, M., Khazzaka, A., Rizkallah, J., . . . Aouad, N. (2016). Prediction of preterm delivery by second trimester inflammatory biomarkers in the amniotic fluid. Cytokine, 85, 67-70. doi:10.1016/j.cyto.2016.06.008 [doi]
Kharfi, A., Giguere, Y., De Grandpre, P., Moutquin, J. M., & Forest, J. C. (2005). Human chorionic gonadotropin (hCG) may be a marker of systemic oxidative stress in normotensive and preeclamptic term pregnancies. Clinical Biochemistry, 38(8), 717-721. doi:S0009-9120(05)00123-2 [pii]
Klein, J., Buffin-Meyer, B., Mullen, W., Carty, D. M., Delles, C., Vlahou, A., . . . Schanstra, J. P. (2014). Clinical proteomics in obstetrics and neonatology. Expert Review of Proteomics, 11(1), 75-89. doi:10.1586/14789450.2014.872564 [doi]
Kolialexi, A., Mavrou, A., Spyrou, G., & Tsangaris, G. T. (2008). Mass spectrometry-based proteomics in reproductive medicine. Mass Spectrometry Reviews, 27(6), 624-634. doi:10.1002/mas.20181 [doi]
Kota, S. K., Gayatri, K., Jammula, S., Kota, S. K., Krishna, S. V., Meher, L. K., & Modi, K. D. (2013). Endocrinology of parturition. Indian Journal of Endocrinology and Metabolism, 17(1), 50-59. doi:10.4103/2230-8210.107841 [doi]
Krutzfeldt, J., Rajewsky, N., Braich, R., Rajeev, K. G., Tuschl, T., Manoharan, M., & Stoffel, M. (2005). Silencing of microRNAs in vivo with 'antagomirs'. Nature, 438(7068), 685-689. doi:nature04303 [pii]
Kumar, A., Redondo-Munoz, J., Perez-Garcia, V., Cortes, I., Chagoyen, M., & Carrera, A. C. (2011). Nuclear but not cytosolic phosphoinositide 3-kinase beta has an essential function in cell survival. Molecular and Cellular Biology, 31(10), 2122-2133. doi:10.1128/MCB.01313-10 [doi]
Lachelin, G. C., McGarrigle, H. H., Seed, P. T., Briley, A., Shennan, A. H., & Poston, L. (2009). Low saliva progesterone concentrations are associated with spontaneous early preterm labour (before 34 weeks of gestation) in women at increased risk of preterm delivery. BJOG : An International Journal of Obstetrics and Gynaecology, 116(11), 1515-1519. doi:10.1111/j.1471-0528.2009.02293.x [doi]
Lambert, G., Brichant, J. F., Hartstein, G., Bonhomme, V., & Dewandre, P. Y. (2014). Preeclampsia: An update. Acta Anaesthesiologica Belgica, 65(4), 137-149.
Lash, G. E. (2015). Molecular crosstalk at the feto-maternal interface. Cold Spring Harbor Perspectives in Medicine, 5(12), 10.1101cshperspect.a023010. doi:10.1101/ cshperspect.a023010 [doi]
Laurent, L. C., Chen, J., Ulitsky, I., Mueller, F. J., Lu, C., Shamir, R., . . . Loring, J. F. (2008). Comprehensive microRNA profiling reveals a unique human embryonic stem cell signature dominated by a single seed sequence. Stem Cells (Dayton, Ohio), 26(6), 1506-1516. doi:10.1634/stemcells.2007-1081 [doi]
91
Law, K. P., Han, T. L., Tong, C., & Baker, P. N. (2015). Mass spectrometry-based proteomics for pre-eclampsia and preterm birth. International Journal of Molecular Sciences, 16(5), 10952-10985. doi:10.3390/ijms160510952 [doi]
Lee, A. C., Panchal, P., Folger, L., Whelan, H., Whelan, R., Rosner, B., . . . Lawn, J. E. (2017). Diagnostic accuracy of neonatal assessment for gestational age determination: A systematic review. Pediatrics, 140(6), 10.1542/peds.2017-1423. Epub 2017 Nov 17. doi:e20171423 [pii]
Lehnert, S., Van Loo, P., Thilakarathne, P. J., Marynen, P., Verbeke, G., & Schuit, F. C. (2009). Evidence for co-evolution between human microRNAs and alu-repeats. PloS One, 4(2), e4456. doi:10.1371/journal.pone.0004456 [doi]
Lekhwani, S., Shankar, V., & Vaswani, N. D. (2011). Proteomics in obstetrics and gynecology. Indian Journal of Human Genetics, 17(1), 3-6. doi:10.4103/0971-6866.82185 [doi]
Li, Y., Shao, Y., Tong, Y., Shen, T., Zhang, J., Li, Y., . . . Li, F. (2012). Nucleo-cytoplasmic shuttling of PAK4 modulates beta-catenin intracellular translocation and signaling. Biochimica Et Biophysica Acta, 1823(2), 465-475. doi:10.1016/j.bbamcr.2011.11.013 [doi]
Liang, Y., Ridzon, D., Wong, L., & Chen, C. (2007). Characterization of microRNA expression profiles in normal human tissues. BMC Genomics, 8, 166-2164-8-166. doi:1471-2164-8-166 [pii]
Lin, S., Cheung, W. K., Chen, S., Lu, G., Wang, Z., Xie, D., . . . Kung, H. F. (2010). Computational identification and characterization of primate-specific microRNAs in human genome. Computational Biology and Chemistry, 34(4), 232-241. doi:10.1016/ j.compbiolchem.2010.08.001 [doi]
Lodygin, D., Tarasov, V., Epanchintsev, A., Berking, C., Knyazeva, T., Korner, H.,. Hermeking, H. (2008). Inactivation of miR-34a by aberrant CpG methylation in multiple types of cancer. Cell Cycle (Georgetown, Tex.), 7(16), 2591-2600. doi:6533 [pii]
Loudon, I. (1998). The tragedy of puerperal fever. Health Libraries Review, 15(3), 151-156. doi:10.1046/j.1365-2532.1998.1530151.x [doi]
Lujambio, A., Ropero, S., Ballestar, E., Fraga, M. F., Cerrato, C., Setien, F., . . . Esteller, M. (2007). Genetic unmasking of an epigenetically silenced microRNA in human cancer cells. Cancer Research, 67(4), 1424-1429. doi:67/4/1424 [pii]
Luo, S. S., Ishibashi, O., Ishikawa, G., Ishikawa, T., Katayama, A., Mishima, T., . Takizawa, T. (2009). Human villous trophoblasts express and secrete placenta-specific microRNAs into maternal circulation via exosomes. Biology of Reproduction, 81(4), 717-729. doi:10.1095/biolreprod.108.075481 [doi]
Malhotra, A., Allison, B. J., Castillo-Melendez, M., Jenkin, G., Polglase, G. R., & Miller, S. L. (2019). Neonatal morbidities of fetal growth restriction: Pathophysiology and impact. Frontiers in Endocrinology, 10, 55. doi:10.3389/fendo.2019.00055 [doi]
Manning, B. D., & Toker, A. (2017). AKT/PKB signaling: Navigating the network. Cell, 169(3), 381-405. doi:S0092-8674(17)30413-0 [pii]
92
Marko-Varga, G., & Fehniger, T. E. (2004). Proteomics and disease--the challenges for technology and discovery. Journal of Proteome Research, 3(2), 167-178. doi:10.1021/ pr049958+ [doi]
Matange, N. (2015). Revisiting bacterial cyclic nucleotide phosphodiesterases: Cyclic AMP hydrolysis and beyond. FEMS Microbiology Letters, 362(22), 10.1093/femsle/fnv183. Epub 2015 Sep 30. doi:10.1093/femsle/fnv183 [doi]
Mathonnet, G., Fabian, M. R., Svitkin, Y. V., Parsyan, A., Huck, L., Murata, T., . Sonenberg, N. (2007). MicroRNA inhibition of translation initiation in vitro by targeting the cap-binding complex eIF4F. Science (New York, N.Y.), 317(5845), 1764-1767. doi:1146067 [pii]
Mayor-Lynn, K., Toloubeydokhti, T., Cruz, A. C., & Chegini, N. (2011). Expression profile of microRNAs and mRNAs in human placentas from pregnancies complicated by preeclampsia and preterm labor. Reproductive Sciences (Thousand Oaks, Calif.), 18(1), 46-56. doi:10.1177/1933719110374115 [doi]
McIntyre, H. D., Catalano, P., Zhang, C., Desoye, G., Mathiesen, E. R., & Damm, P. (2019). Gestational diabetes mellitus. Nature Reviews.Disease Primers, 5(1), 47-019-0098-8. doi:10.1038/s41572-019-0098-8 [doi]
McLean, M., Bisits, A., Davies, J., Woods, R., Lowry, P., & Smith, R. (1995). A placental clock controlling the length of human pregnancy. Nature Medicine, 1(5), 460-463.
Menaa, C., Devlin, R. D., Reddy, S. V., Gazitt, Y., Choi, S. J., & Roodman, G. D. (1999). Annexin II increases osteoclast formation by stimulating the proliferation of osteoclast precursors in human marrow cultures. The Journal of Clinical Investigation, 103(11), 1605-1613. doi:10.1172/JCI6374 [doi]
Menon, R. (2016). Human fetal membranes at term: Dead tissue or signalers of parturition? Placenta, 44, 1-5. doi:10.1016/j.placenta.2016.05.013 [doi]
Menon, R. (2019). Initiation of human parturition: Signaling from senescent fetal tissues via extracellular vesicle mediated paracrine mechanism. Obstetrics & Gynecology Science, 62(4), 199-211. doi:10.5468/ogs.2019.62.4.199 [doi]
Menon, R., Richardson, L. S., & Lappas, M. (2019). Fetal membrane architecture, aging and inflammation in pregnancy and parturition. Placenta, 79, 40-45. doi:S0143-4004(18)31060-9 [pii]
Menon, R., Torloni, M. R., Voltolini, C., Torricelli, M., Merialdi, M., Betran, A. P., . . . Arora, C. (2011). Biomarkers of spontaneous preterm birth: An overview of the literature in the last four decades. Reproductive Sciences (Thousand Oaks, Calif.), 18(11), 1046-1070. doi:10.1177/1933719111415548 [doi]
Michelsen, T. M., Henriksen, T., Reinhold, D., Powell, T. L., & Jansson, T. (2019). The human placental proteome secreted into the maternal and fetal circulations in normal pregnancy based on 4-vessel sampling. FASEB Journal : Official Publication of the Federation of American Societies for Experimental Biology, 33(2), 2944-2956. doi:10.1096/fj.201801193R [doi]
93
Mitchell, M. D., Peiris, H. N., Kobayashi, M., Koh, Y. Q., Duncombe, G., Illanes, S. E., . . . Salomon, C. (2015). Placental exosomes in normal and complicated pregnancy. American Journal of Obstetrics and Gynecology, 213(4 Suppl), S173-81. doi:10.1016/j.ajog.2015.07.001 [doi]
Mitchell, P. S., Parkin, R. K., Kroh, E. M., Fritz, B. R., Wyman, S. K., Pogosova-Agadjanyan, E. L., . Tewari, M. (2008). Circulating microRNAs as stable blood-based markers for cancer detection. Proceedings of the National Academy of Sciences of the United States of America, 105(30), 10513-10518. doi:10.1073/pnas.0804549105 [doi]
Morales Prieto, D. M., & Markert, U. R. (2011). MicroRNAs in pregnancy. Journal of Reproductive Immunology, 88(2), 106-111. doi:10.1016/j.jri.2011.01.004 [doi]
Morales-Prieto, D. M., Chaiwangyen, W., Ospina-Prieto, S., Schneider, U., Herrmann, J., Gruhn, B., & Markert, U. R. (2012). MicroRNA expression profiles of trophoblastic cells. Placenta, 33(9), 725-734. doi:10.1016/j.placenta.2012.05.009 [doi]
Morales-Prieto, D. M., Ospina-Prieto, S., Chaiwangyen, W., Schoenleben, M., & Markert, U. R. (2013). Pregnancy-associated miRNA-clusters. Journal of Reproductive Immunology, 97(1), 51-61. doi:10.1016/j.jri.2012.11.001 [doi]
Morgan, J. A., & Cooper, D. B. (2020). Pregnancy dating. StatPearls (). Treasure Island (FL): StatPearls Publishing LLC. doi:NBK442018 [bookaccession]
Mouillet, J. F., Chu, T., Hubel, C. A., Nelson, D. M., Parks, W. T., & Sadovsky, Y. (2010). The levels of hypoxia-regulated microRNAs in plasma of pregnant women with fetal growth restriction. Placenta, 31(9), 781-784. doi:10.1016/j.placenta.2010.07.001 [doi]
Muglia, L. J., & Katz, M. (2010). The enigma of spontaneous preterm birth. The New England Journal of Medicine, 362(6), 529-535. doi:10.1056/NEJMra0904308 [doi]
Mushahary, D., Gautam, P., Sundaram, C. S., & Sirdeshmukh, R. (2013). Expanded protein expression profile of human placenta using two-dimensional gel electrophoresis. Placenta, 34(2), 193-196. doi:10.1016/j.placenta.2012.11.015 [doi]
Nair, R. R., Verma, P., & Singh, K. (2017). Immune-endocrine crosstalk during pregnancy. General and Comparative Endocrinology, 242, 18-23. doi:S0016-6480(16)30047-8 [pii]
Neilson, J. P., Lavender, T., Quenby, S., & Wray, S. (2003). Obstructed labour. British Medical Bulletin, 67, 191-204. doi:10.1093/bmb/ldg018 [doi]
Nikolova, T., Bayev, O., Nikolova, N., & Di Renzo, G. C. (2015). Comparison of a novel test for placental alpha microglobulin-1 with fetal fibronectin and cervical length measurement for the prediction of imminent spontaneous preterm delivery in patients with threatened preterm labor. Journal of Perinatal Medicine, 43(4), 395-402. doi:10.1515/jpm-2014-0300 [doi]
Noguer-Dance, M., Abu-Amero, S., Al-Khtib, M., Lefevre, A., Coullin, P., Moore, G. E., & Cavaille, J. (2010). The primate-specific microRNA gene cluster (C19MC) is imprinted in the placenta. Human Molecular Genetics, 19(18), 3566-3582. doi:10.1093/ hmg/ddq272 [doi]
Norwitz, E. R., Bonney, E. A., Snegovskikh, V. V., Williams, M. A., Phillippe, M., Park, J. S., & Abrahams, V. M. (2015). Molecular regulation of parturition: The role of the decidual clock. Cold Spring Harbor Perspectives in Medicine, 5(11), 10.1101/ cshperspect.a023143. doi:10.1101/cshperspect.a023143 [doi]
94
O'Brien, J., Hayder, H., Zayed, Y., & Peng, C. (2018). Overview of MicroRNA biogenesis, mechanisms of actions, and circulation. Frontiers in Endocrinology, 9, 402. doi:10.3389/fendo.2018.00402 [doi]
Oskovi Kaplan, Z. A., & Ozgu-Erdinc, A. S. (2018). Prediction of preterm birth: Maternal characteristics, ultrasound markers, and biomarkers: An updated overview. Journal of Pregnancy, 2018, 8367571. doi:10.1155/2018/8367571 [doi]
Ozgu-Erdinc, A. S., Cavkaytar, S., Aktulay, A., Buyukkagnici, U., Erkaya, S., & Danisman, N. (2014). Mid-trimester maternal serum and amniotic fluid biomarkers for the prediction of preterm delivery and intrauterine growth retardation. The Journal of Obstetrics and Gynaecology Research, 40(6), 1540-1546. doi:10.1111/jog.12371 [doi]
Parker, R., & Sheth, U. (2007). P bodies and the control of mRNA translation and degradation. Molecular Cell, 25(5), 635-646. doi:S1097-2765(07)00111-6 [pii]
Parker, R., & Song, H. (2004). The enzymes and control of eukaryotic mRNA turnover. Nature Structural & Molecular Biology, 11(2), 121-127. doi:10.1038/nsmb724 [doi]
Persson, H., Kvist, A., Rego, N., Staaf, J., Vallon-Christersson, J., Luts, L., . Rovira, C. (2011). Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. Cancer Research, 71(1), 78-86. doi:10.1158/0008-5472.CAN-10-1869 [doi]
Petersen, C. P., Bordeleau, M. E., Pelletier, J., & Sharp, P. A. (2006). Short RNAs repress translation after initiation in mammalian cells. Molecular Cell, 21(4), 533-542. doi:S1097-2765(06)00077-3 [pii]
Priya, B., Mustafa, M. D., Guleria, K., Vaid, N. B., Banerjee, B. D., & Ahmed, R. S. (2013). Salivary progesterone as a biochemical marker to predict early preterm birth in asymptomatic high-risk women. BJOG : An International Journal of Obstetrics and Gynaecology, 120(8), 1003-1011. doi:10.1111/1471-0528.12217 [doi]
Rao, U. J., Denslow, N. D., & Block, E. R. (1994). Hypoxia induces the synthesis of tropomyosin in cultured porcine pulmonary artery endothelial cells. The American Journal of Physiology, 267(3 Pt 1), L271-81. doi:10.1152/ajplung.1994.267.3.L271 [doi]
Rathbun, K. M., & Hildebrand, J. P. (2020). Placenta abnormalities. StatPearls (). Treasure Island (FL): StatPearls Publishing LLC. doi:NBK459355 [bookaccession]
Rausch, M. E., Beer, L., Sammel, M. D., Takacs, P., Chung, K., Shaunik, A., . Barnhart, K. T. (2011). A disintegrin and metalloprotease protein-12 as a novel marker for the diagnosis of ectopic pregnancy. Fertility and Sterility, 95(4), 1373-1378. doi:10.1016/ j.fertnstert.2010.12.040 [doi]
Redman, C. W., & Sargent, I. L. (2008). Circulating microparticles in normal pregnancy and pre-eclampsia. Placenta, 29 Suppl A, S73-7. doi:10.1016/j.placenta.2007.11.016 [doi]
Robertson, S. A., & Sharkey, D. J. (2001). The role of semen in induction of maternal immune tolerance to pregnancy. Seminars in Immunology, 13(4), 243-254. doi:10.1006/smim.2000.0320 [doi]
Robinson, J. M., Ackerman, W. E.,4th, Kniss, D. A., Takizawa, T., & Vandre, D. D. (2008). Proteomics of the human placenta: Promises and realities. Placenta, 29(2), 135-143. doi:10.1016/j.placenta.2007.12.005 [doi]
95
Rowe, J. H., Ertelt, J. M., Xin, L., & Way, S. S. (2012). Pregnancy imprints regulatory memory that sustains anergy to fetal antigen. Nature, 490(7418), 102-106. doi:10.1038/nature11462 [doi]
Scheid, M. P., & Woodgett, J. R. (2001). PKB/AKT: Functional insights from genetic models. Nature Reviews.Molecular Cell Biology, 2(10), 760-768. doi:10.1038/ 35096067 [doi]
Schierding, W., O'Sullivan, J. M., Derraik, J. G., & Cutfield, W. S. (2014). Genes and post-term birth: Late for delivery. BMC Research Notes, 7, 720-0500-7-720. doi:10.1186/ 1756-0500-7-720 [doi]
Seitz, H., Royo, H., Bortolin, M. L., Lin, S. P., Ferguson-Smith, A. C., & Cavaille, J. (2004). A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain. Genome Research, 14(9), 1741-1748. doi:10.1101/gr.2743304 [doi]
Shankar, R., Gude, N., Cullinane, F., Brennecke, S., Purcell, A. W., & Moses, E. K. (2005). An emerging role for comprehensive proteome analysis in human pregnancy research. Reproduction (Cambridge, England), 129(6), 685-696. doi:129/6/685 [pii]
Smith, G. C., Shah, I., Crossley, J. A., Aitken, D. A., Pell, J. P., Nelson, S. M., . Dobbie, R. (2006). Pregnancy-associated plasma protein A and alpha-fetoprotein and prediction of adverse perinatal outcome. Obstetrics and Gynecology, 107(1), 161-166. doi:107/1/161 [pii]
Smith, R. (1998). Alterations in the hypothalamic pituitary adrenal axis during pregnancy and the placental clock that determines the length of parturition. Journal of Reproductive Immunology, 39(1-2), 215-220. doi:S0165-0378(98)00023-0 [pii]
Subramanyam, D., Lamouille, S., Judson, R. L., Liu, J. Y., Bucay, N., Derynck, R., & Blelloch, R. (2011). Multiple targets of miR-302 and miR-372 promote reprogramming of human fibroblasts to induced pluripotent stem cells. Nature Biotechnology, 29(5), 443-448. doi:10.1038/nbt.1862 [doi]
Takano, M., Lu, Z., Goto, T., Fusi, L., Higham, J., Francis, J., . Kim, J. J. (2007). Transcriptional cross talk between the forkhead transcription factor forkhead box O1A and the progesterone receptor coordinates cell cycle regulation and differentiation in human endometrial stromal cells. Molecular Endocrinology (Baltimore, Md.), 21(10), 2334-2349. doi:me.2007-0058 [pii]
Takemura, M., Kimura, T., Nomura, S., Makino, Y., Inoue, T., Kikuchi, T., . . . Kamiura, S. (1994). Expression and localization of human oxytocin receptor mRNA and its protein in chorion and decidua during parturition. The Journal of Clinical Investigation, 93(6), 2319-2323. doi:10.1172/JCI117236 [doi]
Than, N. G., Bohn, H., Toth, P., Bersinger, N., Grudzinskas, J. G., & Bischof, P. (2004). From basic research to clinical application of placental proteins--a workshop report. Placenta, 25 Suppl A, S109-11. doi:10.1016/j.placenta.2004.01.021 [doi]
Thermann, R., & Hentze, M. W. (2007). Drosophila miR2 induces pseudo-polysomes and inhibits translation initiation. Nature, 447(7146), 875-878. doi:nature05878 [pii]
Thillai, K., Lam, H., Sarker, D., & Wells, C. M. (2017). Deciphering the link between PI3K and PAK: An opportunity to target key pathways in pancreatic cancer? Oncotarget, 8(8), 14173-14191. doi:10.18632/oncotarget.13309 [doi]
96
Tornblom, S. A., Klimaviciute, A., Bystrom, B., Chromek, M., Brauner, A., & Ekman-Ordeberg, G. (2005). Non-infected preterm parturition is related to increased concentrations of IL-6, IL-8 and MCP-1 in human cervix. Reproductive Biology and Endocrinology : RB&E, 3, 39-7827-3-39. doi:1477-7827-3-39 [pii]
Toyota, M., Suzuki, H., Sasaki, Y., Maruyama, R., Imai, K., Shinomura, Y., & Tokino, T. (2008). Epigenetic silencing of microRNA-34b/c and B-cell translocation gene 4 is associated with CpG island methylation in colorectal cancer. Cancer Research, 68(11), 4123-4132. doi:10.1158/0008-5472.CAN-08-0325 [doi]
Tripathi, R., Tyagi, S., Mala, Y. M., Singh, N., Pandey, N. B., & Yadav, P. (2016). Comparison of rapid bedside tests for phosphorylated insulin-like growth factor-binding protein 1 and fetal fibronectin to predict preterm birth. International Journal of Gynaecology and Obstetrics: The Official Organ of the International Federation of Gynaecology and Obstetrics, 135(1), 47-50. doi:10.1016/j.ijgo.2016.03.030 [doi]
Tsai, K. W., Kao, H. W., Chen, H. C., Chen, S. J., & Lin, W. C. (2009). Epigenetic control of the expression of a primate-specific microRNA cluster in human cancer cells. Epigenetics, 4(8), 587-592. doi:10230 [pii]
Turco, M. Y., & Moffett, A. (2019). Development of the human placenta. Development (Cambridge, England), 146(22), 10.1242/dev.163428. doi:dev163428 [pii]
Uhlen, M., Fagerberg, L., Hallstrom, B. M., Lindskog, C., Oksvold, P., Mardinoglu, A., . . . Ponten, F. (2015). Proteomics. tissue-based map of the human proteome. Science (New York, N.Y.), 347(6220), 1260419. doi:10.1126/science.1260419 [doi]
Umemura, K., Ishioka, S., Endo, T., Ezaka, Y., Takahashi, M., & Saito, T. (2013). Roles of microRNA-34a in the pathogenesis of placenta accreta. The Journal of Obstetrics and Gynaecology Research, 39(1), 67-74. doi:10.1111/j.1447-0756.2012.01898.x [doi]
Vaittinen, M., Kaminska, D., Kakela, P., Eskelinen, M., Kolehmainen, M., Pihlajamaki, J., . Pulkkinen, L. (2013). Downregulation of CPPED1 expression improves glucose metabolism in vitro in adipocytes. Diabetes, 62(11), 3747-3750. doi:10.2337/db13-0830 [doi]
Vallejo-Diaz, J., Chagoyen, M., Olazabal-Moran, M., Gonzalez-Garcia, A., & Carrera, A. C. (2019). The opposing roles of PIK3R1/p85alpha and PIK3R2/p85beta in cancer. Trends in Cancer, 5(4), 233-244. doi:S2405-8033(19)30027-5 [pii]
Vanhaesebroeck, B., & Alessi, D. R. (2000). The PI3K-PDK1 connection: More than just a road to PKB. The Biochemical Journal, 346 Pt 3, 561-576.
Vasquez, Y. M., Mazur, E. C., Li, X., Kommagani, R., Jiang, L., Chen, R., . . . DeMayo, F. J. (2015). FOXO1 is required for binding of PR on IRF4, novel transcriptional regulator of endometrial stromal decidualization. Molecular Endocrinology (Baltimore, Md.), 29(3), 421-433. doi:10.1210/me.2014-1292 [doi]
Ventura, W., Koide, K., Hori, K., Yotsumoto, J., Sekizawa, A., Saito, H., & Okai, T. (2013). Placental expression of microRNA-17 and -19b is down-regulated in early pregnancy loss. European Journal of Obstetrics, Gynecology, and Reproductive Biology, 169(1), 28-32. doi:10.1016/j.ejogrb.2013.01.025 [doi]
97
Vergani, P., Cozzolino, S., Pozzi, E., Cuttin, M. S., Greco, M., Ornaghi, S., & Lucchini, V. (2008). Identifying the causes of stillbirth: A comparison of four classification systems. American Journal of Obstetrics and Gynecology, 199(3), 319.e1-319.e4. doi:10.1016/j.ajog.2008.06.098 [doi]
Voorhoeve, P. M., le Sage, C., Schrier, M., Gillis, A. J., Stoop, H., Nagel, R., . . . Agami, R. (2006). A genetic screen implicates miRNA-372 and miRNA-373 as oncogenes in testicular germ cell tumors. Cell, 124(6), 1169-1181. doi:S0092-8674(06)00291-1 [pii]
Vuadens, F., Benay, C., Crettaz, D., Gallot, D., Sapin, V., Schneider, P., . Tissot, J. D. (2003). Identification of biologic markers of the premature rupture of fetal membranes: Proteomic approach. Proteomics, 3(8), 1521-1525. doi:10.1002/pmic.200300455 [doi]
Wagner, M. J., Stacey, M. M., Liu, B. A., & Pawson, T. (2013). Molecular mechanisms of SH2- and PTB-domain-containing proteins in receptor tyrosine kinase signaling. Cold Spring Harbor Perspectives in Biology, 5(12), a008987. doi:10.1101/ cshperspect.a008987 [doi]
Wang, X., Li, B., Wang, J., Lei, J., Liu, C., Ma, Y., & Zhao, H. (2012). Evidence that miR-133a causes recurrent spontaneous abortion by reducing HLA-G expression. Reproductive Biomedicine Online, 25(4), 415-424. doi:10.1016/j.rbmo.2012.06.022 [doi]
Wang, Y., Baskerville, S., Shenoy, A., Babiarz, J. E., Baehner, L., & Blelloch, R. (2008). Embryonic stem cell-specific microRNAs regulate the G1-S transition and promote rapid proliferation. Nature Genetics, 40(12), 1478-1483. doi:10.1038/ng.250 [doi]
Warrander, L. K., & Heazell, A. E. (2011). Identifying placental dysfunction in women with reduced fetal movements can be used to predict patients at increased risk of pregnancy complications. Medical Hypotheses, 76(1), 17-20. doi:10.1016/j.mehy.2010.08.020 [doi]
Weeks, A. (2015). The prevention and treatment of postpartum haemorrhage: What do we know, and where do we go to next? BJOG : An International Journal of Obstetrics and Gynaecology, 122(2), 202-210. doi:10.1111/1471-0528.13098 [doi]
Wilkins, M. R., Pasquali, C., Appel, R. D., Ou, K., Golaz, O., Sanchez, J. C., . Hochstrasser, D. F. (1996). From proteins to proteomes: Large scale protein identification by two-dimensional electrophoresis and amino acid analysis. Bio/Technology (Nature Publishing Company), 14(1), 61-65. doi:10.1038/nbt0196-61 [doi]
Wilson, K. D., Venkatasubrahmanyam, S., Jia, F., Sun, N., Butte, A. J., & Wu, J. C. (2009). MicroRNA profiling of human-induced pluripotent stem cells. Stem Cells and Development, 18(5), 749-758. doi:10.1089/scd.2008.0247 [doi]
Xie, M., Li, M., Vilborg, A., Lee, N., Shu, M. D., Yartseva, V., . Steitz, J. A. (2013). Mammalian 5'-capped microRNA precursors that generate a single microRNA. Cell, 155(7), 1568-1580. doi:10.1016/j.cell.2013.11.027 [doi]
Yang, Q., Lu, J., Wang, S., Li, H., Ge, Q., & Lu, Z. (2011). Application of next-generation sequencing technology to profile the circulating microRNAs in the serum of preeclampsia versus normal pregnant women. Clinica Chimica Acta; International Journal of Clinical Chemistry, 412(23-24), 2167-2173. doi:10.1016/j.cca.2011.07.029 [doi]
98
Yoda, M., Kawamata, T., Paroo, Z., Ye, X., Iwasaki, S., Liu, Q., & Tomari, Y. (2010). ATP-dependent human RISC assembly pathways. Nature Structural & Molecular Biology, 17(1), 17-23. doi:10.1038/nsmb.1733 [doi]
Zhang, R., Wang, Y. Q., & Su, B. (2008). Molecular evolution of a primate-specific microRNA family. Molecular Biology and Evolution, 25(7), 1493-1502. doi:10.1093/molbev/msn094 [doi]
Zhao, J. R., Cheng, W. W., Wang, Y. X., Cai, M., Wu, W. B., & Zhang, H. J. (2018). Identification of microRNA signature in the progression of gestational trophoblastic disease. Cell Death & Disease, 9(2), 94-017-0108-2. doi:10.1038/s41419-017-0108-2 [doi]
Zhao, Z., Zhao, Q., Warrick, J., Lockwood, C. M., Woodworth, A., Moley, K. H., & Gronowski, A. M. (2012). Circulating microRNA miR-323-3p as a biomarker of ectopic pregnancy. Clinical Chemistry, 58(5), 896-905. doi:10.1373/ clinchem.2011.179283 [doi]
Zhuo, D., Wu, Y., Luo, J., Deng, L., & Niu, X. (2019). CSTP1 inhibits IL-6 expression through targeting akt/FoxO3a signaling pathway in bladder cancer cells. Experimental Cell Research, 380(1), 80-89. doi:S0014-4827(19)30193-4 [pii]
Zhuo, D. X., Zhang, X. W., Jin, B., Zhang, Z., Xie, B. S., Wu, C. L., . . . Mao, Z. B. (2013). CSTP1, a novel protein phosphatase, blocks cell cycle, promotes cell apoptosis, and suppresses tumor growth of bladder cancer by directly dephosphorylating akt at Ser473 site. PloS One, 8(6), e65679. doi:10.1371/journal.pone.0065679 [doi]
Zou, P., Luo, L., Zhao, C., Chen, Z., Dong, R., Li, N., . . . Chen, D. (2018). The serum microRNA profile of intrahepatic cholestasis of pregnancy: Identification of novel noninvasive biomarkers. Cellular Physiology and Biochemistry : International Journal of Experimental Cellular Physiology, Biochemistry, and Pharmacology, 51(3), 1480-1488. doi:10.1159/000495595 [doi]
99
Original publications
I Haapalainen AM, Karjalainen MK, Daddali R, Ohlmeier S, Anttonen J, Määttä TA, Salminen A, Mahlman M, Bergmann U, Mäkikallio K, Ojaniemi M, #Hallman M, #Rämet M. (2017). Expression of CPPED1 in human trophoblasts is associated with timing of term birth. J Cell Mol Med. 2018 Feb;22(2):968-981
II Daddali R, Ojaniemi M, Hallman M, Rämet M& Haapalainen AM. (2020). MicroRNA-371a-5p targets CPPED1, and its expression in human placenta is associated with spontaneous delivery. Plos One. 2020 PLoS One. 2020 Jun 10;15(6):e0234403
III #Haapalainen AM, #Daddali R, Hallman M, Rämet M. Human CPPED1 belongs to calcineurin-like metallophosphoesterase superfamily and dephosphorylates PI3K-AKT pathway component PAK4 (Submitted)
Reprinted (I and II) articles with the permission from corresponding journals.
Original publications are not included in the electronic version of the dissertation.
100
A C T A U N I V E R S I T A T I S O U L U E N S I S
Book orders:Virtual book store
http://verkkokauppa.juvenesprint.fi
S E R I E S D M E D I C A
1579. Khashana, Abdelmoneim (2020) Cortisol and other adrenal steroids in criticalneonatal disease associated with shock
1580. Kajabi, Abdul Wahed (2020) Quantitative magnetic resonance imaging of articularcartilage and meniscus during osteoarthritis progression : experimental andclinical feasibility of novel MRI methods
1581. Stenman, Päivi (2020) Iäkkäiden hoitotyössä toimivan henkilöstön kokemuksiatyötyytyväisyydestä ja toimintaympäristöstä kinestetiikan käyttöönoton aikana
1582. Koota, Elina (2020) The development of an evidence-based practice educationalintervention and its effectiveness on emergency nurses’ attitudes, knowledge,skills, self-efficacy and behavior
1583. Pohjola, Mari (2020) Thromboelastography for coagulation monitoring in obesityand cytoreductive surgery
1584. Järvinen, Jyri (2020) Lumbar degenerative Modic changes : association betweenbone turnover and low back symptoms, and the effect of a zoledronic acidtreatment intervention
1585. Siddika, Nazeeba (2020) Prenatal exposure to ambient air pollution and the riskof preterm birth and stillbirth : synergy among air pollutants in causing pretermbirth
1586. Karkkola, Sini (2020) Management of ankle fractures : long-term results andintramedullary nailing of high risk patients
1587. Kemi, Niko (2020) Novel histological prognostic factors in gastric cancer
1588. Länkimäki, Sami (2020) Prehospital airway management in Finnish emergencymedical service by non-physicians
1589. Santala, Simi (2020) Prognostic role of cyclins A, B, and E and p27 in endometrialendometrioid adenocarcinoma
1590. Konttila, Jenni (2020) Hypoteettinen malli työssä kohdatun väkivallan jatyöhyvinvoinnin välisestä yhteydestä aikuispsykiatrisessa avohoidossa
1591. Parviainen, Roope (2020) The intrauterine and genetic factors associated with thechildhood fracture risk
1592. Juntunen, Mikael (2020) Technical and algorithmic approaches for medical photoncounting computed tomography in the example of coronary artery calciumquantification
UNIVERSITY OF OULU P .O. Box 8000 F I -90014 UNIVERSITY OF OULU FINLAND
A C T A U N I V E R S I T A T I S O U L U E N S I S
University Lecturer Tuomo Glumoff
University Lecturer Santeri Palviainen
Postdoctoral researcher Jani Peräntie
University Lecturer Anne Tuomisto
University Lecturer Veli-Matti Ulvinen
Planning Director Pertti Tikkanen
Professor Jari Juga
University Lecturer Anu Soikkeli
University Lecturer Santeri Palviainen
Publications Editor Kirsti Nurkkala
ISBN 978-952-62-2805-1 (Paperback)ISBN 978-952-62-2806-8 (PDF)ISSN 0355-3221 (Print)ISSN 1796-2234 (Online)
U N I V E R S I TAT I S O U L U E N S I S
MEDICA
ACTAD
D 1594
AC
TAR
avindra Daddali
OULU 2020
D 1594
Ravindra Daddali
MOLECULAR MECHANISMS REGULATING THE ONSETOF LABORCOMPARATIVE PROTEOMICS AND miRNAOMICS OF HUMAN SPONTANEOUS AND ELECTIVE LABORS
UNIVERSITY OF OULU GRADUATE SCHOOL;UNIVERSITY OF OULU,FACULTY OF MEDICINE;MEDICAL RESEARCH CENTER OULU;OULU UNIVERSITY HOSPITAL
Recommended