OEB 192 – 08.11.17 Physiological basis of adaptation

OEB 192 – 08.11.17

Physiological basis of adaptation

Wednesday (11/19): Epistasis

Modular epistasis in yeast metabolismDaniel Segrè, Alexander DeLuna, George M. Church, Roy Kishony

Upcoming talksTuesday, 11/18

“Experimental Group Selection of Sociology of Plasmids”Juan PedrazaHMS Systems Biology (Paulsson lab)12:30 pm, 563 Warren Alpert (HMS)Systems Biology Tuesday Pizza Talk

Tuesday, 12/9

“Mutation as a Stress Response and the Regulation of Evolvability” Susan M. RosenburgBaylor College of Medicine12:30 pm, 341 Warren Alpert

Tuesday, 12/16Rich LenskiMichigan State University12:30 pm, 341 Warren Alpert

OEB 192 – 08.11.17 Physiological basis of adaptation

Documents

OEB 2009 - Large Scale Moodle Networks

Holmes oeb 2011

Catalogo oeb

OEB 192 – 09.10.28 Mobile genetic elements and adaptive mutation

EASA OEB report

BY COU - OEB

Evolution before Darwin Lamarck: Philosophie Zoologique (1809) OEB 192 – 10.09.08 Prior theme music: //

b747 Fcl Ops Draft Oeb Report 22082011

OEB 192 – 10.11.08 Epistasis. (Segrè et al., 2005. Nat. Genet.)

More on neutral theory OEB 192 – 10.09.15. Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA

OEB ETC III 2_15

Enwin OEB Application

Regulated Price Plan Manual - OEB

oeb Design Thinking Taster Workshop 2017

OEB 192 – 11.11.28 Evolution of pathogens (Grenfell et al., 2004. Science) 20and%20Hare%20Populations.htm

BIOS E-127 – 08.11.17 Pleiotropy & specialization

I Reubzaet Cinop Oeb 2009v1

Evolution in Action (OEB 100)

OEB Staff Submission - rds.oeb.ca

OEB 192 – 10.11.01 Genetic & physiological basis of adaptation (Goddard et al., 2005. Nature) (Cooper, 2007. PLoS Biol.)