View
8
Download
0
Category
Preview:
Citation preview
1
nature | methods
eSGA: E. coli synthetic genetic array analysis
Gareth Butland, Mohan Babu, J Javier Díaz-Mejía, Fedyshyn Bohdana, Sadhna Phanse, Barbara Gold, Wenhong Yang,
Joyce Li, Alla G Gagarinova, Oxana Pogoutse, Hirotada Mori, Barry L Wanner, Henry Lo, Jas Wasniewski, Constantine
Christopolous, Mehrab Ali, Pascal Venn, Anahita Safavi-Naini, Natalie Sourour, Simone Caron, Ja-Yeon Choi, Ludovic
Laigle, Anaies Nazarians-Armavil, Avnish Deshpande, Sarah Joe, Kirill A Datsenko, Natsuko Yamamoto, Brenda J
Andrews, Charles Boone, Huiming Ding, Bilal Sheikh, Gabriel Moreno-Hagelseib, Jack F Greenblatt & Andrew Emili
Supplementary figures and text:
Supplementary Figure 1 Construction of query mutation in a Hfr Cavalli donor strain.
Supplementary Figure 2 Selective outgrowth steps at 1,536-colony density to produce consistent colony sizes.
Supplementary Figure 3 An eSGA plate image shows occasional cases where the Isolate-1 and Isolate-2 versions of a
deletion strain behave differently.
Supplementary Figure 4 Effect of linkage suppression on recombination efficiency.
Supplementary Figure 5 Reverse confirmation of synthetic genetic interactions using custom mini-arrays.
Supplementary Methods
Supplementary Results
Supplementary Discussion
Note: Supplementary Tables 1–4 are available on the Nature Methods website.
Homologous
recombination
Gene
replacement
Transformation
Into Hfr strain
Chromosomal ORF
Homologous recombination
45-nt homologous to target gene
20-nt homologous to CmR cassette
PCR
amplification
ΔabcA-CmR
SUPPLEMENTARY FIGURE 1
Supplementary Figure 1. Construction of query mutation in a Hfr Cavalli donor strain.
The query mutation in chromosome of an E. coli Hfr strain is constructed by transformation and replacement
of a desired locus with a chloramphenicol drug resistance (CmR) cassette using an in vivo recombination
approach based on PCR amplification2. The CmR cassette is generated by PCR using 20-nt forward and
reverse primers homologous to the 3’ end of the CmR marker (shown in white arrow heads), and 45-nt at 5’
end that are homologous to the sequences flanking the target gene intended for deletion (shown in colored
boxes).
a
SUPPLEMENTARY FIGURE 2
aidB
Donor
only
ybcJ
yacL
yhhP
rusA
Selection of double
mutants on LB with Kan and Cm
(excluding selective outgrowth step)
aidB
Donor
only
ybcJ
yacL
yhhP
rusA
Selection of double
mutants on LB with Kan and Cm
(including selective outgrowth step)
b
aidB
Donor
only
ybcJ
yacL
yhhP
rusA aidB
Donor
only
ybcJ
yacL
yhhP
rusA
Selection of double
mutants on LB with Kan and Cm
(excluding selective outgrowth step)
Selection of double
mutants on LB with Kan and Cm
(including selective outgrowth step)
Supplementary Figure 2. Selective outgrowth steps at 1,536-colony density produce consistent colony sizes.
The results of the selective outgrowth steps of ybcJ (a) and rusA (b) query deletion (marked with CmR) strains
conjugated into a custom designed array containing selected recipient deletion (marked with KanR) strains are shown
as plate images. The ybcJ (a) and rusA (b) query deletion strains is conjugated with recipient deletion strains containing
the following mutants (columns left to right: aidB, ybcJ, yacL, yhhP, and rusA). The conjugants are pinned onto the
LB plate with kanamycin and chloramphenicol for a first selection of 24 hr at 32 °C (left side image of the panels
‘a’ and ‘b’). A second selection (right side image of the panels ‘a’ and ‘b’) is performed by pinning the double mutants
from the first selection onto a second LB plate with kanamycin and chloramphenicol for 24 hr incubation at 32 °C.
More enhanced and uniform growth of colonies on the assay plates is clearly visible when an additional outgrowth step
is included. Donor only represents an internal negative control used in the assay. Each recipient deletion mutant strains
on the array are pinned in 8 columns.
SUPPLEMENTARY FIGURE 3
ΔiscS-CmR and
ΔnuoN-KanR
“Isolate-1”
ΔiscS-CmR and
ΔnuoN-KanR
“Isolate-2”
Supplementary Figure 3. An eSGA plate image shows occasional cases where the Isolate-1 and Isolate-2
versions of a deletion strain behave differently.
Each plate contains 384 different recipient single gene deletion mutants marked with KanR from the
KEIO collection that were used to screen against an ΔiscS-CmR query deletion mutant marked with CmR.
Each conjugant is pinned 4 times to a density of 1,536 and double mutants were selected on LB media
containing chloramphenicol and kanamycin antibiotics. The recipient deletion mutants marked with KanR
showing synthetic lethal or sick interactions against the ΔiscS-CmR query mutant are highlighted in black
line. Two independent versions of each strain were created in the KEIO collection; the four spots in a line on
a plate for a given mutant include two “Isolate-1” versions and two “Isolate-2” versions (shown in black
arrows). Occasionally, the “Isolate-1” and “Isolate-2” versions of a gene mutant do not behave identically in
an eSGA assay, indicating one of the strains must be defective. Based on our 39 genome-wide eSGA screens,
it appears that 195 “Isolate-1” and 224 “Isolate-2” strains behave abnormally, suggesting that they contain
genetic duplications or unknown compensatory lesions.
isc operon
fdx hscAhscB iscS iscRiscU
iscA
SUPPLEMENTARY FIGURE 4
Supplementary Figure 4. Effect of linkage suppression on recombination efficiency.
Illustrative example showing spurious results obtained when ∆iscU-CmR donor strain was conjugated with strains
bearing null mutations in and around the isc operon. We identified genes that fail to generate vigorously growing
viable recombinants. Essential no recombination (that is, few viable double mutants) was observed with the mutations
∆iscR-KanR, ∆iscS-KanR, ∆iscA-KanR, and ∆hscB-KanR, reduced recombination with ∆hscA-KanR, and slightly
impaired recombination with ∆fdx-KanR, which flank the iscU locus. Donor only represents an internal negative
control used in the assay.
SUPPLEMENTARY FIGURE 5
Supplementary Figure 5. Reverse confirmation of synthetic genetic interactions using custom mini-arrays.
The results of eSGA mini-array confirmation using ydhD query deletion strain are shown as plate images. The results
of double mutant growth of ydhD and pdxB query deletion strains in combination with recipient mutations present in the
ISC array (a) contains the following mutants (columns left to right: hcaC, yfhR, trmJ, iscR, iscS, iscU, iscA, hscB, hscA,
fdx, pbpC and a no recipient control), while the results of double mutant growth of ydhD and pdxB query deletion strains
in combination with recipient mutations present in the SUF array (b) contains the following mutants (columns left to
right: ydiN, ydiI, ydiH, sufA, sufB, sufC, sufD, sufS, sufE, ynhG, ydhW and a no recipient control (represented as ‘C’)).
The control images show the results of double mutant growth of a ybaS donor mutant in combination with recipient
mutations present within ISC or SUF arrays respectively. The apparent false positive interactions observed sporadically
in the ydhD-Suf array were possibly due to residual linkage, given the close proximity of the two loci (<30 kbp).
a
b
Supplementary Methods
Arraying recipient F- Kan
R E. coli mutant strains for genome-wide screens
The recipient F- Kan
R (resistance to kanamycin) KEIO
1 E. coli mutant strains arrayed in
ninety 96-well plates were transferred to twenty-four 384-well plates containing 100µl of
the Luria-Bertani (LB) medium supplemented with 50 µg/ml kanamycin grown overnight
at 32 ºC to an optical density (OD) of ~0.4 to 0.6 at 600nm by gently shaking the cultures
at 190 rpm. The overnight culture of each deletion mutant is supplemented with 15%
glycerol and stored at -80 ºC in 384-well plates prior to pinning. List of KEIO E. coli
deletion mutants used in the genome-wide screens are shown in Supplementary Table 1.
In each plate, we included “donor specific control or DSC” and “recipient specific control
or RSC” as an internal quality controls.
Construction of query deletion mutation in an Hfr Cavalli donor strain
For each genome-wide screen, a query gene deletion mutation is first constructed by
homologous recombination in an E. coli Hfr Cavalli donor strain bearing an integrated
temperature-inducible -Red high efficiency recombination system2. A temperature-
inducible λ Red cassette in strain DY3302 marked with Amp
R (resistance to ampicillin)
was moved by P1 transduction into Hfr Cavalli prior to the construction of query deletion
mutation. Transformants were selected on LB agar supplemented, where required, with
ampicillin (100 µg/ml) and chloramphenicol (12.5 µg/ml). Following were the four
critical steps used in the construction of query gene deletion mutation in Hfr Cavalli:
1. Preparation and generation of linear DNA cassette
Standard PCR conditions were used to amplify linear DNA fragments with Expand long
template PCR system (Roche). The CmR cassette (resistance to chloramphenicol) was
amplified from the plasmid pKD33 with forward (5’-
AGATTGCAGCATTACACGTCTT-3’) and reverse (5’-
GGCTGACATGGGAATTAGC-3’) primers. The PCR products were purified using
Qiaquick PCR purification kit (Qiagen). The amplified linear DNA is suspended in sterile
water, quantified by spectrophotometer and stored at -20 ºC. The linear DNA cassette is
designed to replace the target gene for deletion with CmR
marker. The cassette is
generated by PCR using 20-nt forward (5’- GCGTGTTACGGTGAAAACCT - 3’) and
reverse (5’-TCGTCGTGGTATTCACTCCA- 3’) primers homologous to the 3’ end of
the CmR
cassette, and 45-nt at 5’ end that are homologous to the sequences flanking the
target gene intended for deletion. Thus, the inner 20-nt sequence is common for all
forward and reverse knock out primers, while the 45-nt outermost primer sequence is
specific to the targeted gene. The PCR using these primers and a DNA template
containing the marker cassette generates a linear DNA product with the cassette flanked
by target homology. The generated linear cassette is stored in -20 ºC and used as template
for all subsequent PCRs. The PCR amplifications were carried out in 50µl reactions
containing 1x reaction buffer I, 200µM dNTPs, 2µM of forward and reverse knock out
primers, 3.75 U Taq DNA polymerase (Roche) and 0.5µl chloramphenicol template
(5ng/µl). Reactions were run for 30 cycles: 94 °C for 3 min; 30 cycles of 94 °C for 1 min,
56 °C for 1 min, 72 °C for 2 min; followed by 72 °C for 10 min. The amplified PCR
products were analyzed by running 1% agarose gel electrophoresis.
2. Electroporation and mutant selection
The Hfr Cavalli strain carrying the λ Red cassette is grown in 50 ml LB medium with
ampicillin respectively, at 32 ºC to an OD of ~0.4 to 0.6 at 600 nm. The electroporation
competent cells were prepared as described elsewhere2. Two microliter of the amplified
PCR product of CmR cassette was mixed with 50 µl of the competent cells and
electroporated in an ice-cold 0.2 cm cuvette at 2.5KV with 25µF and 200 , followed by
the addition of 1 ml SOC medium, to allow entry of the linear CmR
cassette. After
incubating the cells at 32 ºC for at least 1 hr with shaking at 220 rpm, ~100 µl of the
electroporated cell mixture was spread onto an agar LB plate containing 12.5 µg/ml of
chloramphenicol to select transformants at 32 ºC.
3. PCR confirmation of recombinants
In order to confirm the knock out mutants by PCR, genomic DNA was purified from two
random recombinant clones. The DNA is amplified with two sets of knock out
confirmation primers, and the size of the fragments confirmed using 1% agarose gel
electrophoresis. The first set consists of 20-nt flanking primer located 200 base pairs
upstream of the deleted region and one internal primer complementary to the CmR
cassette. This method ensures the position and location of the CmR
cassette and target
gene, respectively. The second set involves the same upstream probe, paired with another
20-nt flanking primer located 200 base pairs downstream of the deletion to verify the
correct mutation and to rule out the possibility that the selected strain is a rare diploid,
with one gene copy replaced by the cassette and the other copy adjacent to it. The list of
knockout and confirmation primer pair sequences used in the construction of the query
mutations in strains selected for the genome-wide screens are shown in Supplementary
Table 2.
PCR reactions were carried out in 50 µl reactions containing 1x reaction buffer I,
200µM dNTPs, 2µM of forward and reverse knock out confirmation primers, 3.75U Taq
DNA polymerase (Roche) and 1µl genomic DNA. Reactions were run for 30 cycles:
94 °C for 3 min; 30 cycles of 94 °C for 1 min, 56 °C for 1 min, 72 °C for 2min; followed
by 72 °C for 10 min. The amplified PCR products were confirmed using 1% agarose gel
electrophoresis.
4. Storage of confirmed query deletion mutants
Two randomly selected and successfully confirmed recombinant clones for each query
deletion mutants were stored in cryovials containing 1.5 ml LB medium supplemented
with 12.5 µg/ml chloramphenicol and 15% glycerol.
Construction of double mutants in E. coli using an automated strain handling
arraying procedure
Briefly, the process can be broken down into 4 separate sections, mutant array
preparation, conjugation, selection of double mutants on double antibiotics and
quantifying the colony sizes. A six-day replica plating method was used to construct
double mutants in a high throughput manner.
(A) First day, the frozen glycerol stock cultures of query deletion mutant created in an
Hfr strain with the target gene replacement with CmR were grown overnight at 32 ºC in
rich LB liquid media supplemented with 34 µg/ml of chloramphenicol prior to pinning
the cultures at 384 density.
(B) Second day, the overnight culture of the query deletion mutant, and the frozen
glycerol stock culture from an ordered array of recipient deletion mutant, marked with
KanR, were pinned onto a LB medium containing 34 µg/ml chloramphenicol and 50
µg/ml kanamycin, respectively at 384 density (24 column x 16 row)
(C) Third day, conjugation was carried out onto a LB plate by pinning the overnight
query and recipient deletion mutants at a 384 density.
(D) Fourth day, conjugants were subjected to first round of selection onto a LB medium
containing chloramphenicol and kanamycin antibiotics. On this day, two 384 colony
density conjugation plates are combined in duplicate onto a LB medium containing
chloramphenicol and kanamycin antibiotics to create 1,536 colony density plate. During
the development process, we did perform several experiments on a genome-wide scale in
which we selected the conjugant first in the presence of one drug (kanamycin or
chloramphenicol) and then in the presence of both antibiotics. We observed that the
selection of conjugants in one antibiotic (kanamycin or chloramphenicol), followed by
selection using both antibiotics, resulted in highly variable numbers of conjugants after
the first selection step. In the current eSGA screening process, the donor and recipient
cells are conjugated at a ratio of ~1:1. In these conditions, the variability observed in
pinning the conjugants first onto plates with a single drug was much greater than with our
standard selection process, to the extent that it was not possible to complete these screens
and obtain quantifiable genetic interaction data. For this reason, we decided to select
conjugants immediately with both drugs rather than first selecting the conjugants in the
presence of only one drug.
(E) Fifth day, the colonies from the first double drug selection plate is pinned onto a
second double drug selection plate. This additional selective outgrowth step deemed to be
advantageous for two reasons. First, it has been previously reported that having > 1 spot
to assay greatly increases the accuracy of growth measurements4 allowing the natural
measure of variation in the standard deviation. Second, it has been noted during the
development process that direct assay of the conjugation plate via double antibiotic
selection led to highly variable colony size distribution on the assay plates which would
be highly problematic for assaying via colony size. This is illustrated in Supplementary
Figure 2.
(F) Sixth day, the colonies from each double drug plate is photographed using a Kaiser
RS1 camera stand (product code no. 5510) and a digital camera (Canon Powershot A640,
10 Megapixels) with illumination from two Testrite 16 x 24 light boxes (Freestyle
Photographic supplies product #1624). The captured images were saved as jpeg files and
growth phenotype of the double mutants was quantitatively assayed using an in-house
automated image processing system originally devised for yeast4. In each step of the
above process, the plates were incubated for 24 hrs at 32 ºC.
Custom mini-array eSGA screening
A. Query mutant construction
Query mutants were constructed by replacing the target gene in Hfr Cavalli with a
chloramphenicol resistance marker, using the λ-Red system on pKD465, with the
following modifications. Transformation of electro-competent cells with PCR product
was performed using a BTX ECM630 (Harvard Apparatus, MA) and 2 mm gap cuvettes
with the following electroporation parameters: 2.5 kV, 200 ohms, 25 uF followed by 2-hr
recovery in 800 ul SOC without antibiotic at 32 °C, 200 rpm. Cells were pelleted and
plated on LB-Cm plates which were incubated overnight at 42 °C. Cultures of positive
clones were streaked on LB-Amp agar plates to check curing of plasmid (cultures re-
cured at 42 °C, if necessary). To confirm mutations, 2 to 4 colonies were selected and
grown overnight in 3 ml LB-Cm and genomic DNA purified (Wizard Genomic DNA
Purification kit, Promega, WI). Mutations are then verified by PCR amplification of
isolated genomic DNA with locus-specific primers 200 bp up- and downstream of target
gene and the resulting product checked for size and compared to the product of wild-type
genomic DNA amplification as a control. Antibiotics were used at the following
concentrations throughout, Ampicillin (Amp): 100 µg/ml; Chloramphenicol (Cm): 34
µg/ml and Kanamycin (Kan): 25 µg/ml.
B. Custom made recipient mutant mini-arrays
Recipient mutant arrays were made for 4 operon regions with mutants of the KEIO
collection1 in a 96-well format, 11 strains per plate, with a column of 8 wells for each
strain:
Suf array:
1 2 3 4 5 6 7 8 9 10 11 12
ydiN ydiI ydiH sufA sufB sufC sufD sufS sufE ynhG ydhW C
Isc array:
hcaC yfhR trmJ iscR iscS iscU iscA hscB hscA fdx pbpC C
Gnt array:
yhgF feoA feoB yhgA bioH gntX gntY gntT malQ malP yrbA C
Tru array:
purF ubiX argT dedD dedA truA usg pdxB yfcJ yfcL hemF C
These mini-arrays represent the viable deletion mutants present in the KEIO
collection around the isc, suf, gntY and truA loci, with the exception of yrbA and hemF,
which were added to the Gnt and Tru arrays, respectively to facilitate their screening.
After inoculation into 100 ul LB-Kan in a 200 ul 96-well plate and overnight growth (at
32 °C, 200 rpm) a replica on LB-Kan agar (Nunc Omnitray, NY) was made by pinning
with a 96-pin replicator (V&P Scientific, San Diego, CA), and Nunc Microwell and
Omnitray Copier frames, and incubated at 32 °C overnight.
Query deletion arrays were made with 2 donor strains of interest (rows A-C and
E-G) with row D empty and a control strain in row H, as illustrated in the following 96-
well format:
1 2 3 4 5 6 7 8 9 10 11 12
A iscS iscS iscS iscS iscS iscS iscS iscS iscS iscS iscS iscS
B iscS iscS iscS iscS iscS iscS iscS iscS iscS iscS iscS iscS
C iscS iscS iscS iscS iscS iscS iscS iscS iscS iscS iscS iscS
D
E iscU iscU iscU iscU iscU iscU iscU iscU iscU iscU iscU iscU
F iscU iscU iscU iscU iscU iscU iscU iscU iscU iscU iscU iscU
G iscU iscU iscU iscU iscU iscU iscU iscU iscU iscU iscU iscU
H ybaS ybaS ybaS ybaS ybaS ybaS ybaS ybaS ybaS ybaS ybaS ybaS
A replica was pinned on LB-Cm agar for the conjugation.
C. Conjugation and Selection
The solid donor and recipient plates are pinned onto a LB-agar conjugation plate which is
incubated for 24 hrs at 32 °C. This conjugation plate is pinned onto a LB-Kan-Cm agar
plate for a first selection of 48 hrs at 32 °C. A second selection is achieved by pinning the
first selection onto a second LB-Kan-Cm agar plate for 24-hr incubation. Plates were then
inspected manually and colonies compared to other donor/recipient combinations, the
control donor/recipient combinations and row D and column 12 as negative controls.
Supplementary Results
Determination of adequate conjugation time
To determine an adequate conjugation time, we conjugated Hfr Cavalli ∆rusA-CmR with
various recipients for 2, 4, 12 and 24 hr periods. The rusA gene is located at 12.3 min, just
beyond oriT, and so is one of the very last genes to be transferred. As shown in Figure A,
only a few viable conjugants were obtained for short mating periods (<12 hr), while 24 hr
conjugation supported efficient transgenesis. Consequently, we have used 24 hr of
conjugation for all subsequent screens.
Since E. coli is haploid, only one resistance cassette can occupy a given locus.
Indeed, as expected, very few self-conjugants were observed in the ∆rusA-CmR
and
∆rusA-KanR donor-recipient deletion combination (Fig. A). The residual self-double-
mutants sometimes observed presumably represent rare partial chromosomal duplication
events.
To further confirm the reliability of our conjugation and selection procedures, we
examined the genomic status of double mutants produced after 24 hr conjugative transfer
of two unrelated loci (∆aidB-CmR into a ∆yacL-Kan
R recipient). Genomic analyses of
single viable colonies confirmed appropriate replacement of both relevant loci in the
selected conjugants (Fig. B).
Quantitative Image analysis and generation of genetic interaction (S) score
Thirty-nine E. coli genome-wide screens are processed in batch scoring mode using
colony scorer program4. The calibrated software algorithm is executed in Java program
that identifies colonies arrayed in grid format and determines the fitness as a function of
growth rate. The raw colony sizes of the double mutants were normalized to each plate as
a whole and corrected for systematic biases such as plate edge effects, inter-plate
variation effects, column and row competition growth among neighboring colonies and
pinning defects were then analyzed statistically to take into account for replicate
reproducibility and deviations from the median colony sizes4. During the normalization
process the plates containing bad colony sizes were also filtered. There may however, be
cases in which we are unable to detect or quantify SSL interactions because one of the
mutations causes the E. coli colony to have an unusual morphological (e.g. spreading)
phenotype that masks or exaggerates the interaction.
The unbiased variance of relative errors (VARRE) between the replicate colony
sizes on each plate and a plate middle mean (PMM) value refereed as the mean colony
sizes on each plate4 were then computed to correct for unusual larger colony sizes
observed in the outermost rows and columns than the small or normal sized colonies in
the centre of the plate. Such kind of regression analysis is deemed to be necessary in
determining the minimum bound of the relative error in calculating the S score (Fig. C).
To reduce systematic errors, the effects of mutations in recipient strains were
normalized across the results of many unrelated screens, and the effect of each mutation
in a donor strain was taken into account by using the normalized median colony sizes of
all double mutants arising from the same donor strain as control or termed as a reference
set. The relationship between the unbiased variance of relative errors and the normalized
colony sizes from the reference set is shown in Figure D. The data suggests that larger or
smaller colony sizes tend to have larger relative variance, for which an adjustment of the
variances of double mutants was used in calculating the interaction score (S).
The normalized median colony growth sizes were then used to generate the
interaction score (S) for each pair of genes. These values reflected both our confidence in
the presence of genetic interactions as well as on the strengths of interactions. The raw
and normalized colony sizes, |Z scores|, and interaction (S) scores generated from 39
genome-wide screens are shown in Supplementary Table 4.
The interaction scores from 39 screens were then plotted to determine for a
normal distribution trend. Indeed, the S scores generated from the 39 query mutant strains
followed a normal distribution. However, we were very keen in knowing whether the
observed tail distribution in the experimental or actual dataset is due to significant
fraction of observed S scores or due to random chance. So, a randomized dataset was
created for each query mutant screen where the row and column coordinates and the raw
colony sizes of each recipient mutant were shuffled. The randomized dataset for each
query mutant screen is permuted 1,000 times. The genetic interaction (S) scores were
then calculated for each query mutant screen from the permuted randomized dataset. This
permutation testing revealed a large number of interactions in the experimental dataset
than in the randomized set in the tail of the distribution that represents aggravating
genetic interactions (Fig. 3c).
We also performed a second randomization to evaluate whether the observed
genetic interaction between pairs of gene from 39 genome-wide screens are due to true
genetic interaction or due to position effect of the genes on each plate. In order to
demonstrate this hypothesis, we randomized the actual datasets by scrambling the row
and column coordinates of each gene in a plate. During this randomization process, the
original raw colony sizes of each gene extracted from the colony software were retained.
The genetic interaction (S) scores were then calculated for both the actual and
randomized datasets (Fig. E). We clustered the actual and random datasets independently
by arranging the query mutants on the x-axis and recipient array mutants on the y-axis. As
expected, majority of the genetic interaction pattern, including the Suf and Isc genes
(Fig. E) between the actual and random data set showed similar patterns of genetic
interactions suggesting that the observed genetic interactions in the actual data set is true
and not due to position effect of the genes on each plate. As an example, a sub-matrix of
the actual and randomized data for the pairs of gene independently clustered by crossing
the 39 query deletion mutants with their respective recipient KEIO null mutant
collections (both “Isolate-1” and “Isolate-2” strain versions) is shown in Figure E.
Genetic interactions of the Isc genes outside of the Suf system
Our screens also revealed several Isc relationships outside of Suf (Supplementary
Discussion). The SSL interactions of members of the Isc system with hemF, which is
involved in heme biosynthesis, represent one such example. The genes hemF and hemN
encode enzymes catalyzing oxygen-dependent and -independent conversion of
coproporphyrinogen III to protoporphyrinogen IX, respectively. While HemN contains an
Fe-S cluster necessary for catalytic activity6, HemF is manganese-dependent
7. In this
case, the observed SSL interactions likely occur because reduced levels of holo-HemN
resulting from inactivation of the Isc machinery create a dependency on hemF for heme
production.
Validating the reliability of the novel genetic interactions
The authenticity and specificity of many of the high confidence novel genetic interactions
with |Z score| cutoff ≥ 4 (P < 0.0001) were confirmed by reanalyzing the donor-recipient
combinations using custom mini-array screens. We conjugated Isc donor mutations to
genes covering the truA genomic region (“tru array”), on which we also included hemF,
and the gntY locus (“gnt array”), on which we included yrbA. While all Isc pathway
components displayed varying levels of aggravating interactions with hemF, gntY and
yrbA, only iscS displayed a SSL interaction with truA (Fig. F), consistent with our full-
genome screens.
We additionally validated interactions which had |Z score| cutoff ≤ 4, slightly
below the very high confidence cut-off, indicating that there are likely numerous bona-
fide SSL interactions outside of the high-confidence dataset. Interactions to certain isc
genes, such as iscS with pdxB (dehydrogenase involved in pyridoxal 5-phosphate
biosynthesis) and its neighboring gene usg (predicted semi-aldehyde dehydrogenase) are
one such example (Fig. G). Clear functional links exist between iscS and pdxB, given that
pyridoxal 5-phosphate is the cofactor present in both IscS and SufS. The reliability of the
functional interactions was confirmed by conjugating Isc pathway mutations to genes
covering the usg-pdxB genomic region (“tru array”). As shown in Figure F, only iscS
displayed SSL interactions with usg and pdxB, consistent with the full genome eSGA
screens. The specificity of the iscS-pdxB was further validated by measuring reciprocal
genetic interactions by conjugating pdxB donor mutant against the deletion mutants
present in and around the isc, (“ISC array”) and suf (“SUF array”) loci (Supplementary
Fig. 5). The pdxB donor mutant strain displayed a specific SSL interaction with iscS and
not to other Isc pathway components or members of the Suf pathway, suggesting that iscS
and pdxB are functionally linked.
Supplementary Discussion
Factors led to the decision to use Hfr Cavalli strain
There were two major factors that led to the decision to use the Hfr Cavalli strain. First,
BW25113, the base strain for the KEIO recipient collection, is a 13-step descendent of
BD792, which is an F- strain derived from W1485 (F
+), which is a direct descendent of
K-12 EMG2 wild-type1. Looking at the lineage of BW25113 and its predecessors, we
were unable to find a known Hfr derivative. Second, during the initial development
process, we focused on determining the feasibility of Hfr mediated conjugative transfer
as a method for combining deletion mutations between strains. Several well-defined Hfr
strains (Hfr Cavalli, Hfr Hayes and Hfr 3000) were assessed for the ability to make donor
strain mutations using the method of Yu et al2, and their relative efficiencies in
conjugative DNA transfer of chromosomal markers and effects of position and relative
orientation of oriT. We were able to isolate substitution mutants with Hfr Cavalli with
much higher efficiency than with Hfr Hayes, and in trail conjugation experiments the
overall efficiency of transfer and the number of ex-conjugants observed was considerably
greater with Hfr Cavalli (data not shown). These observations highlighted the variability
of different Hfr backgrounds as efficient donor strains. Use of an isogenic strain would
have therefore required not only the isolation of a stable recombinant BW25113 (Hfr),
but the determination if it was a suitably efficient donor background. Given these factors,
the Hfr Cavalli strain was chosen as the donor background for the development process.
Potential problems associated with using non-isogenic strains
Although there are potential problems associated with using non-isogenic strains, we
believe that, in practice, these problems occur quite rarely for the following reasons.
First, potential problems associated with using the Hfr Cavalli donor should arise mainly
due to sequence differences between the Hfr Cavalli and the BW25113 recipient strains.
Hfr Cavalli is also a derivative of K-12 EMG2, but via a different lineage (W6). It has 6
known “mutations” (E. coli Genetic Stock Center CSGC# 4410;
http://cgsc.biology.yale.edu/Strain.php?ID=8448), but no complete genome sequence of
this strain is available, raising the possibility that other unrecorded mutations might exist
in this strain. None of these 6 known mutations exist in BW25113, hence it is possible
that, during mating, BW25113 will inherit one or more of these mutant loci via
homologous recombination. Second, the reverse situation is also possible. Several mutant
loci have been incorporated into BW25113 throughout its history, and indeed it is lac-,
ara- and rha
- amongst others. All of these loci are thought to be wild-type in Hfr Cavalli
and so there is the possibility that the recipient strain could revert to, for example, lac+
due to linked or independent recombination events. We are currently conducting lac
screening of ex-conjugants to determine the extent to which this phenomenon occurs.
While the above conversions or reversions are possible, we believe that it is
highly unlikely that they would notably affect the genetic interaction data obtained in this
study. Linkage data reported here suggests that a secondary mutation would have to be
within 30 kbp of the donor mutant locus to be considered linked (i.e. frequency of
inheritance greater than expected by independent inheritance). If not within ~30 kbp of
the donor mutant locus, secondary mutations leading to these conversions or reversions
should be inherited independently and not be affected by the selection process. For
example, if lac+ is not linked to a donor mutant, then its rate of inheritance in the
recipient would most likely be dependent on other factors (i.e. distance from oriT, nature
of recombination events occurring during mating). The variable here is the
recombination, which would most likely be different for every conjugation. Therefore,
even within one experiment, if we have multiple conjugation spots for the same donor-
recipient pair (as in mini-array experiments), we would expect some conjugants to go
lac+ while others remain lac-. However, we have good reason to think that such events
are rare. If these mutant alleles were often having an effect on the genetic interaction
results then we would expect to see rampant variability (i.e. every conjugation could be
different, and so we would have intra-and inter-experiment variation). This is something
which we haven’t observed in our genome-wide screens, where the reproducibility
between the replicate experiments on average was between 0.5 and 0.7. We therefore
strongly believe that use of a non-isogenic donor does not affect the genetic interactions
obtained in this study.
Factors considered for optimal mating conditions
While it may be true that the increased growth rate in rich LB medium might increase the
rate of spontaneous gene duplication, we considered several factors when deciding on
optimal mating conditions. First, the use of rich LB medium for the conjugation step
resulted in more consistent growth of all the recipient KEIO collection mutants in a
reasonable time frame. Cells grown in minimal medium not only required much longer
incubation times (approximately 2 weeks to complete a full genome screen in minimal
medium versus 6 days using rich medium), but also displayed more growth rate
variability among the different mutants present in the collection. Second, we reasoned
that this variability may lead to inconsistent conjugation when a consistent number of
donor cells are mated with varying numbers of recipient cells (depending on the viability
of each KEIO mutant in minimal medium). Third, while gene duplication can be a factor
in that we observed small numbers of self double mutants, we found that this was not a
vital issue with the two-round selection protocol we used in our current eSGA screening
procedure. Indeed, in order to observe more uniform growth and minimize stress
conditions, we incubated all cells at 32 ºC during the conjugation and selection steps. For
any specific eSGA experiments that require the use of minimal medium to study genetic
interactions for genes and pathways that are essential under specific growth conditions,
mating could be initially performed in rich medium and then the phenotype of the double
mutants could be scored on minimal medium supplemented with various additives such
as amino acids (methionine, cysteine), vitamins, and cofactors.
Iron-sulfur cluster biosynthesis systems
The major iron-sulfur cluster biosynthesis systems are encoded by the iscRSUA-hscBA-
fdx operon (known as the Isc system8) and the sufABCDSE operon (known as the Suf
system9). We chose these systems for our proof-of-principle experiments because these
systems were well supported with reports of synthetic lethality in the literature, and the
multiple components of each system would allow many double mutant combinations to
be tested for synthetic genetic interactions.
In the Isc system, a transcriptional repressor, IscR, binds DNA and represses
transcription of the operon in response to the presence of an Fe-S cluster in the protein10
.
The cysteine desulfurase, IscS, catalyses the conversion of cysteine to alanine along with
the removal of sulfide, which is trapped as a cysteine persulfide (-S-SH) on the active site
cysteine residue8. This sulfide is then transferred to the Fe-S scaffold protein IscU where,
in combination with ferrous (Fe2+
) iron, Fe-S clusters are formed transiently, prior to their
insertion into target apo-proteins11
. IscA has been proposed to play a role as an Fe-S
scaffold capable of binding Fe-S clusters, as well as a source of iron for cluster formation
due to its high affinity for ferrous iron12
. The remaining components of the Isc system are
the Hsp70 and Hsp40 protein folding chaperone homologs, HscA and HscB, and the
ferredoxin, Fdx. The HscA protein has been shown to bind the IscU-type scaffold
protein13
and may together with HscB, act to destabilize the IscU-[Fe-S] complex and
enable delivery of the cluster into its target apo-protein8.
An alternative Suf system for Fe-S biosynthesis contains many components
paralogous to those of the Isc system. SufSE is a cysteine desulfurase9, SufA is an IscA-
like protein14
and SufBCD, a predicted ATPase, has been proposed to stimulate SufS and
accept sulfur from SufE, suggesting it may act as a molecular chaperone akin to HscAB
(with IscU)15
. Importantly, it has been shown that, mutants in the Isc system are of
varying fitness, they are viable and, likewise, mutants in the Suf system display little
growth defect (SSL) 8, 9
. However, combinations of deletions of genes in the isc and suf
operons were previously shown to result in synthetic lethality8, 9
. This was directly
confirmed using iscU and sufC as donor mutations in crosses against custom mini-arrays
(Fig. 2b-c). Our observation that any suf gene deletion, with the exception of sufA, was
indeed non-viable in combination with an iscU deletion, along with our observation of
synthetic sickness of an iscU and sufA double mutant, is in agreement with recently
reported work14
. In these examples, the lack of synthetic lethality for iscU and sufA can
be explained by the ability of iscA to at least partially substitute for sufA.
More thorough analysis of Isc and Suf SSL interactions in genome-wide screens
revealed that most combinations do display aggravating interactions, iscA and sufA are
exceptions and display more subtle interactions with other components of the Suf and Isc
pathways respectively (i.e. the synthetic sick combination of iscU and sufA), but appear
synthetic lethal with each other (Fig. 4b-c ). These data broadly support the idea of sufA
and iscA partial complementation; however several SSL interactions including sufA and
fdx and iscA and sufB require further investigation in order to understand their functional
basis.
Interactions with essential genes
Although aggravating genetic interactions among non-essential genes are usually
orthogonal to protein-protein interactions16, 17
, we detected some strong SSL interactions
involving essential protein complexes which overlap with protein-protein interactions.
For example, greA and greB, which interact physically with RNAP, were synthetic lethal
with rpoA-SPA, which encodes the essential subunit of RNAP. GreA and GreB
reactivate arrested, backtracked RNAP by stimulating endonucleolytic cleavage of
nascent RNA by the RNAP active centre to generate a new 3’-end18
. Recently, an in vitro
study has shown that Gre factors aid progression from abortive initiation to elongation19
.
Therefore, the observed SSL interactions of greA and greB with rpoA-SPA suggest that
active greA and greB may be important in vivo for progression from initiation to
elongation.
Another example is the SSL interaction between rpoS, which encodes the
stationary phase sigma factor, S, and cysB, a regulator that binds to RNAP
20. Since cysB
and rpoS both influence arginine decarboxylase (aidA) expression via the arginine acid
resistance system21
, we speculate there might be insufficient activation in the absence of
these two factors, resulting in a fitness defect.
Analogous approach could be used to look at genetic interactions in other bacterial
species
Indeed, E. coli has been used extensively to transmit non-replicating “suicide” plasmids
by conjugal mating to a variety of bacterial species, including Paracoccus denitrificans22
.
Using the current approach, a similar high-throughput conjugative system could therefore
be used to transfer suicide plasmids (which contain fragments of the DNA of the recipient
strain as a genomic library, individually interrupted at a desired locus with a selectable
marker, with enough flanking DNA on each side for RecA-mediated recombination) from
E. coli into an ordered array of deletion mutants of the desired host species for which a
complete deletion collection is available (e.g., Bacillus subtilis23
, Acinetobacter baylyi
ADP124
). Such a system may even be more efficient than the current system, as one
would be transferring only a plasmid containing a relatively small insert (< 10 kbp) of
homologous DNA, and not a potentially large section of chromosomal DNA. Transfer
efficiency should therefore be high and there should be less chance of unselected
recombination effects. Thus, the availability of recipient gene deletion mutant
collections23, 24
and E. coli shuttle vectors25
should allow for efficient double mutant
construction and characterization for other prokaryotes.
Supplementary References
1. Baba, T. et al. Construction of Escherichia coli K-12 in-frame, single-gene
knockout mutants: the KEIO collection. Mol. Syst. Biol. 2, 2006.0008 (2006).
2. Yu, D. et al. An efficient recombination system for chromosome engineering in
Escherichia coli. PNAS 97, 5978-83 (2000).
3. Zeghouf, M. et al. Sequential Peptide Affinity (SPA) system for the identification
of mammalian and bacterial protein complexes. J. Proteome Res. 3, 463-468
(2004).
4. Collins, S. R., Schuldiner, M., Krogan, N. J. & Weissman, J. S. A strategy for
extracting and analyzing large-scale quantitative epistatic interaction data.
Genome Biol. 7, R63 (2006).
5. Datsenko, K.A. & Wanner, B.L. One-step inactivation of chromosomal genes in
Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U S A 97, 6640-
6645 (2000).
6. Layer, G. et al. Radical S-adenosylmethionine enzyme coproporphyrinogen III
oxidase HemN. J. Biol. Chem. 280, 29038-29046 (2005).
7. Breckau, D., Mahlitz., E., Sauerwald, A., Layer, G. & Jahn, D. Oxygen-dependent
coproporphyrinogen III oxidase (HemF) from Escherichia coli is stimulated by
Manganese. J. Biol. Chem. 278, 46625-46631 (2003).
8. Tokumoto, U. & Takahashi, Y. Genetic analysis of the isc operon in Escherichia
coli involved in the biogenesis of cellular iron-sulfur proteins. J. Biochem. 130,
63-71 (2001).
9. Outten, F.W., Djaman, O. & Storz, G. A suf operon requirement for Fe-S cluster
assembly during iron starvation in Escherichia coli. Mol. Microbiol. 52, 861–872
(2004).
10. Schwartz, C.J. et al. IscR, an Fe-S cluster -containing transcription factor,
represses expression of Escherichia coli genes encoding Fe-S cluster assembly
proteins. Proc. Natl. Acad. Sci. U S A 98, 14895-14900 (2001).
11. Hoff, K.G., Silberg, J.J. & Vickery, L.E. Interaction of the iron-sulfur cluster
assembly protein IscU with the Hsc66/Hsc20 molecular chaperone system of
Escherichia coli. Proc. Natl. Acad. Sci. U S A 97, 7790-7795 (2000).
12. Takahashi, Y. & Nakamura, M. Functional assignment of the ORF2-iscS-iscU-
iscA-hscB-hscA-fdx-ORF3 gene cluster involved in the assembly of Fe-S clusters
in Escherichia coli. J. Biochem. 126, 917-926 (1999).
13. Hoff, K.G., Ta, D.T., Tapley, T.L., Silberg, J.J. & Vickery, L.E. Hsc66 substrate
specificity is directed toward a discrete region of the iron-sulfur cluster template
protein IscU. J. Biol. Chem. 277, 27353-27359 (2002).
14. Lu, J., Yang, J., Tan, G. & Ding, H. Complementary roles of SufA and IscA in the
biogenesis of iron-sulfur clusters in Escherichia coli. J. Biochem. 409, 535-543
(2008).
15. Vickery, L.E. & Cupp-Vickery, J.R. Molecular chaperones HscA/Ssq1 and
HscB/Jac1 and their roles in iron-sulfur protein maturation. Cri. Rev. Biochem.
Mol. Biol. 42, 95-111 (2007).
16. Boone, C., Bussey, H. & Andrews, B.J. Exploring genetic interactions and
networks with yeast. Nat. Rev. Genet. 8, 437-449 (2007).
17. Beyer, A., Bandyopadhyay, S. & Ideker, T. Integrating physical and genetic
maps: from genomes to interaction networks. Nat. Rev. Genet. 8, 699-710 (2007).
18. Komissarova, N. & Kashlev, M. Arrest of transcription: E.coli RNA polymerase
translocates backward leaving the 3' end of the RNA intact and extruded. Proc.
Natl. Acad. Sci.U.S.A. 94, 1755-1760 (1997).
19. Stepanova, E. et al. Analysis of promoter targets for Escherichia coli transcription
elongation factor GreA in vivo and in vitro. J. Bacteriol. 189, 8772-8785 (2007).
20. Lochowska, A., Nowicka, R.I., Plochocka, D. & Hryniewicz, M.M. Functional
dissection of the LysR-type CysB transcriptional regulator: regions important for
DNA binding, inducer response, oligomerization and positive control. J. Biol.
Chem. 276, 2098-2107 (2001).
21. Dong, T., Joyce, C. & Schellhorn, H.E. The role of RpoS in bacterial adaptation.
Bacterial Physiology: A Molecular Approach (ed.W.El-Sharoud) 313-337
(Springer-Verlag, Berlin, Heidelberg, 2008).
22. Baker, S.C. et al. Molecular genetics of the genus Paracoccus: Metabolically
versatile bacteria with bioenergetic flexibility. Micorbiol Mol Biol Rev. 62, 1046-
1078 (1998).
23. Kobayashi, K., Kondo, M., Fukuda, H., Nishimura, M. & Ohta, H. Essential
Bacillus subtilis genes. Proc. Natl. Acad. Sci.U.S.A 100, 4678-4683 (2003).
24. de Berardinis, V. et al. A complete collection of single-gene deletion mutants of
Acinetobacter baylyi ADP1. Mol. Syst. Biol. 4, 174 (2008).
25. Metzgar, D. et al. Acinetobacter sp. ADP1: an ideal model organism for genetic
analysis and genome engineering. Nucleic Acids Res. 32, 5780-5790 (2004).
a
aidB
Donor
only
ybcJ
yacL
yhhP
rusAaidB
Donor
only
ybcJ
yacL
yhhP
rusA
aidB
Donor
only
ybcJ
yacL
yhhP
rusA aidB
Donor
only
ybcJ
yacL
yhhP
rusA
Figure A. Determination of adequate time frame for conjugation.
The results of the time course interval experiment performed independently by allowing the donor deletion mutant rusA
(one of the very last gene to be transferred) to conjugate with custom designed array containing various selected recipient
deletion strains (columns left to right: aidB, ybcJ, yacL, yhhP, and rusA) for 2 (a), 4 (b), 12 (c) and 24 (d) hr periods are
shown as plate images. After a specified time course interval of conjugation, the conjugants are pinned onto the LB plate
with double antibiotics (kanamycin and chloramphenicol) for a first selection of 24 hr at 32 C. A second selection is
performed by pinning the double mutants from the first selection plate onto a second LB plate containing the double
antibiotics (kanamycin and chloramphenicol) for 24 hr incubation at 32 C. “Donor only” represents a negative control
with no recipient strain. Each recipient deletion mutant strains on the array are pinned in 8 columns.
FIGURE A
b
c d
FIGURE B
Figure B. Genomic analysis to confirm the knock outs in viable conjugants of two unrelated loci.
The genomic analysis of double mutants produced after 24 hr conjugative transfer tested using two unrelated
loci namely ∆aidB-CmR as a donor deletion strain and ∆yacL-KanR as a recipient deletion strain. The CmR or KanR
cassette is generated by PCR using 20-nt forward and reverse primers homologous to the 3’ end of the CmR or KanR
marker, and 45-nt at 5’ end that are homologous to the sequences flanking the target gene intended for deletion.
The sizes of the CmR and KanR cassettes , and aidB and yacL loci in base pairs are shown in parentheses.
Strains in which the target gene has been replaced by CmR or KanR cassette resulted in a product of 1,400 bp and
1,900 bp respectively, whereas false positive isolates containing the wild-type copy of the target gene resulted in a
product equal to the size of the gene plus 400 bp.
Lanes from left to right: M. DNA marker; Lane 1. ∆aidB-CmR query deletion strain amplified with yacL knock out
confirmation primers; Lane 2. ∆yacL-KanR recipient deletion strain amplified with yacL knock out confirmation
primers; Lane 3. ∆aidB-CmR query deletion strain amplified with aidB knock out confirmation primers;
Lane 4. ∆yacL-KanR recipient deletion strain amplified with aidB knock out confirmation primers;
Lanes 5 and 7 ; and 6 and 8 represent double mutants (∆aidB-CmR * ∆yacL-KanR) amplified with aidB and yacL
knock out confirmation primers, respectively. The molecular weights in bp are shown with an arrow head.
The lanes 1 to 4 serve as controls and show that donor and recipient is mutant for aidB and yacL, respectively
but wild type at the second locus. Lanes 5 to 8 show the same PCR amplifications using conjugant genomic
DNA and confirm that PCR products corresponding to both mutant loci are present in both isolates.
FIGURE C
Figure C. Regression analysis to determine the minimum bound of relative error in calculating the interaction
(S) score.
(a) Relationship between the unbiased variance of relative error and the plate-middle-mean of the eSGA plate. Blue
data points represent raw colony sizes and red data points represent the regression line of the raw colony sizes.
(b) Frequency distribution of the plate-middle-mean calculated for all double mutant colony sizes generated from
39 genome-wide screens.
(c) Regression (red line) between the unbiased variance of relative errors and the plate-middle-mean for all double mutant
colonies in each plate calculated from the weighted variance of the relative errors (blue dots).
a
b
c
0
0.02
0.04
0.06
0.08
0.1
0.12
0.14
0.16
0 0.5 1 1.5 2 2.5
Un
bia
sed
va
ria
nce
of r
an
do
m
err
or
( V
AR
RE
)
Normalized colony Sizes
FIGURE D
Figure D. Relationship between the unbiased variance of relative random errors and the normalized colony sizes
from the reference set. The reference set is indicated as a control data set where the effect of each mutation in a query
deletion strain is taken into account by using the normalized median colony sizes of all double mutants arising from the
same donor strain.
a
b
Actual data
Randomized data
FIGURE E
Figure E. Evaluation of the genetic interaction between gene pairs from 39 genome-wide screens to determine
whether the observed genetic interaction is true or due to position effect of the genes on each plate.
Sub-matrix of S scores calculated for the actual (a) and randomized (b) dataset by conjugating 39 query deletion
mutants shown on the vertical axis with their respective recipient KEIO null mutants (both “Isolate-1” and “Isolate -2”
strain versions) on the horizontal axis. Closely linked gene pair can be clearly identified along the diagonal line. The
label “RAND” after the gene name represents randomization. The red color represents an aggravating (significantly
(P < 0.0001) negative S score) interaction, green color represents an alleviating (significantly (P < 0.0001) positive
S score) interaction and black color indicates absence of interaction.
FIGURE F
Figure F. Confirmation of synthetic genetic interactions using custom mini-arrays.
The eSGA mini-array confirmation results on using query deletion strains are shown as plate images. The results of
double mutant growth of iscS and iscU (a); iscA and hscA (c); and hscB and fdx (e) query deletion strains in combination
with recipient mutations present in the TRU array contains the following mutants (columns left to right: purF, ubiX,
argT, dedD, dedA, truA, usg, pdxB, yfcJ, yfcL, hemF and a no recipient control (represented as ‘C’)). The double mutant
growth of iscS and iscU (b); iscA and hscA (d); and hscB and fdx (f) query deletion strains in combination with recipient
mutations present in the GNT array contains the following mutants (columns left to right: yhgF, feoA, feoB, yhgA, bioH,
gntX, gntY, gntT, malQ, malP, yrbA and a no recipient control). The control images show the results of double mutant
growth of a sufC donor mutant in combination with recipient mutations present within TRU or GNT arrays respectively.
c
a e
d
bf
pdxB-usg-truA locus
IscS
ISC
System
gntY
yrbA
Protoporphyrinogen IX
Heme Biosynthesis
HemN
[FeS]HemF
Mn2+
Coproporphyrinogen III
ygfZ
FIGURE G
Figure G. Novel genetic interactions of iscS and the Isc system.
Novel genetic interactions uncovered in the eSGA screens associated with the Isc system are shown. Interactions
between hemF, gntY, ygfZ, yrbA and the components of the Isc system are indicated by double black lines. The
interaction between pdxB and truA, members of the pdxB-usg-truA locus, and iscS alone are indicated by a single
black line.
Recommended