Lecture 5

Lecture 5

• The history of comparative embryology and the 20th century dissociation between development and evolution

• Modern evolutionary developmental biology (EvoDevo)

Pre-Darwinian concept of evolution

‘Transformationism’

Human

Fish

Worm

Protozoan

Ont

ogen

y, P

hylo

geny

Karl Ernst von Baer (1792-1876): Embryologist, anti-transformationist

(and creationist)

Von Baer’s Four Principles

1) The general features of a large group of animals appear earlier than do the specialized features of a smaller group

2) Less general characters develop from the more general, until finally the most specialized appear

3) The embryo of a given species, instead of passing through the adult stages of lower animals, departs more and more from them

4) Therefore, the early embryo of a higher animal is never like a lower animal, but only like its early embryo

Trochophore type embryos

Polychaete worm Bivalve mollusc (clam) Vestimentiferan

Dipleurula type embryos

Sea urchin Brittle star Sea cucumber Sea star

Sea urchin Brittle star Sea star Acorn worm Echinoderms Hemichordate

Charles Darwin co-opted von Baer’s comparative embryology as evidence for evolution

Ernst Haeckel (1834-1919): Naturalist, Philosopher, Transformationist

Biogenetic law: “Ontogeny recapitulates phylogeny”

The 20th century divorce and reconciliation between embryology and evolutionary biology

• Divorce:– The late-19th century rise of Entwicklungsmechanik

arose in part in reaction to Haeckel– The nucleus-cytoplasm controversy in embryology gave

birth to genetics as a distinct field removed from embryology

– Embryologists remained fixated on cell signaling and cytoplasm

– The Modern Synthesis (of genetics and Darwinian evolutionary biology) considered embryology to be irrelevant

Figure 4.1 E. B. Wilson (1856–1939) (A) and Thomas Hunt Morgan (1866–1945) (B)

Figure 4.2 Theodor Boveri (1862–1915) (A) and Nettie M. Stevens (1861–1912) (B)

Figure 4.3 Frank Lillie (A), Hans Spemann (left) and Ross Harrison (right) (B), Ernest E. Just (C).

The 20th century divorce and reconciliation between embryology and evolutionary biology

• Reconciliation– The developmental genetics pioneered by C.H.

Waddington and others– The writings of Stephen J. Gould and others in

the 1970s– The discovery of Hox genes in the 1980s– Revival of EvoDevo in the late 20th century

Figure 4.4 Salome Gluecksohn-Schoenheimer (Now S. Gluecksohn-Waelsch) (A),and Conrad Hal Waddington (B).

Developmental reaction normCanalizationGenetic assimilation of environmentally-induced characters(see also: Richard Goldschmidt, I. Schmalhausen)

Brachyury mutant

Developmental reaction norm

Figure 3   Temperature shocking Aglais urticae produces phenocopies of geographic variants. (A) Usual central European variant; (B) heat-shock phenocopy resembling Sardinian form; (C) a Sardinian form of the species. (After Goldschmidt 1938.)

Canalization

Phenotype (reaction norm)

Genetic or environmental change

Genetic assimilation

Stephen J. Gould

Developmental heterochronies and the importance of gene regulation

Ed Lewis, Christianne Nusslein-Volhard, and Eric Wieschaus

Discoveries of developmental regulatory genes

..

Bithorax mutant

Scenario of insect evolution proposed by Ed Lewis based on homeotic mutations like bithorax

Discovery of the Homeobox (Hox) in1984

Modern evolutionary developmental biology (EvoDevo)

• What is the structure of the tree of life?

Figure 23.1(1) Relationships among Phyla

Modern evolutionary developmental biology (EvoDevo)

• What is the structure of the tree of life?• How do differences and similarities among

organisms correlate with developmental genetics?

…ACGTGATAACCGTCGATGTGGTCTGAGCATCAATGCATATTACTGAC……TGCACTATTGGCAGCTACACCAGACTCGTAGTTACGTATAATGACTG…

GAGCAUCAAUGCAUAUUACUGAC…

DNA:

RNA:

M H I T D… Protein:

Structural InformationRegulatory Information

Amino Acid Codons

Transcription

Translation

…ACGTGATAACCGTCGATGTGGTCTGAGCATCAATGCATATTACTGAC……TGCACTATTGGCAGCTACACCAGACTCGTAGTTACGTATAATGACTG…DNA:

Structural InformationRegulatory Information

* * *

*Potential targets of evolutionary mutation

Modern evolutionary developmental biology (EvoDevo)

• What is the structure of the tree of life?– Phylogeny reconstruction

• Molecular distances• Character matrices (anatomy, gene expression, etc.)

Bioinformatics and Genomics

Multiple Sequence Alignments

Phylogenetic trees

Rennert et al., BMC Evol. Biol. 3: 4, 2003

-1

SpRunt-2

Runx Gene Evolution

!

Runx Gene Evolution

Runx Gene Evolution

Modern evolutionary developmental biology (EvoDevo)

• What is the structure of the tree of life?– Phylogeny reconstruction

• Molecular distances• Character matrices (anatomy, gene expression, etc.)

• How do differences and similarities among organisms correlate with developmental genetics?– Gene expression (esp. regulatory genes)– Gene function (changes in protein structure or gene

regulation/expression)– GRN architecture

Example: Homeobox (HOX) gene evolution

• ‘Downstream’ cis-regulatory changes in Hox target genes

• ‘Upstream’ changes in the regulation/pattern of Hox gene expression

• Changes in Hox protein structure/function• Changes in Hox gene number

Figure 23.2 Expression of Regulatory Transcription Factors in Drosophila and in Vertebrates Along the Anterior-Posterior Axis

Example: Homeobox (HOX) gene evolution

• ‘Downstream’ cis-regulatory changes in Hox target genes

• ‘Upstream’ changes in the regulation/pattern of Hox gene expression

• Changes in Hox protein structure/function• Changes in Hox gene number

Figure 23.3 Differences in Larval and Adult Morphology Due to Hox Gene Differences

Upstream changes in Hox regulation (Ubx, AbdA) Downstream changes in Hox target genes

Figure 23.4 Distal-Less Gene Expression in the Larva of the Buckeye Butterfly, Precis

Sean Carroll

Upstream changes in Hox regulation (Ubx, AbdA)

Figure 23.5(1) “Holes” in the Expression of abdA and Ubx in the Abdomenof the Larval Butterfly Precis

Sean Carroll

Upstream changes in Hox regulation (Ubx, AbdA)

Figure 23.5(2) “Holes” in the Expression of abdA and Ubx in the Abdomenof the Larval Butterfly Precis

Example: Homeobox (HOX) gene evolution

• ‘Downstream’ cis-regulatory changes in Hox target genes

• ‘Upstream’ changes in the regulation/pattern of Hox gene expression

• Changes in Hox protein structure/function• Changes in Hox gene number

Figure 23.6(1) Changes in the Ultrabithorax Protein Associated with the Insect Clade (Polyalanine repression domain: Ubx Dll)

S. Carroll; W. McGinnis

Figure 23.6(2) Changes in the Ultrabithorax Protein Associated with the Insect Clade (Polyalanine repression domain: Ubx Dll)

Example: Homeobox (HOX) gene evolution

• ‘Downstream’ cis-regulatory changes in Hox target genes

• ‘Upstream’ changes in the regulation/pattern of Hox gene expression

• Changes in Hox protein structure/function• Changes in Hox gene number

Figure 23.7(1) Hox Gene Expression and Morphological Change in Crustaceans

Figure 23.7(2) Hox Gene Expression and Morphological Change in Crustaceans

Figure 23.8 Schematic Representation of the Expression of Ubx and abdA (Green) in the Thoracic Segments of Different Types of Crustaceans

Figure 23.9 Loss of Limbs in Snakes

Example: Homeobox (HOX) gene evolution

• ‘Downstream’ cis-regulatory changes in Hox target genes

• ‘Upstream’ changes in the regulation/pattern of Hox gene expression

• Changes in Hox protein structure/function• Changes in Hox gene number

Figure 23.11 Postulated Ancestry of the Hox Genes From a Hypothetical Ancestor

“Deep Homology”

Figure 23.14 Homologous Pathways Specifying Neural Ectoderm in Protostomes (Drosophila) and Deuterostomes (Xenopus)

Figure 23.15 Homology of Signaling Pathways in the Formation of the Anterior-Posterior Axes in Drosophila and Chick Appendages

Figure 23.16 Deep Homology of the Limbs

Deep Homology from the GRN perspective

An endomesoderm GRN subcircuit conserved between sea urchins and sea stars

V. Hinman

Mechanisms for recent phenotypic divergenceFigure 23.22 Regulation of Chick Limb Apoptosis by BMPs

Mechanisms for recent phenotypic divergence

3 SEPTEMBER 2004 VOL 1462 305 SCIENCE

Evolutionary Questions

• How do organisms evolve? – Bottom up processes (changes in genes and

gene regulatory networks)

• Why do organisms evolve?– Top down processes (changes in ecology,

natural selection)