Laboratory Techniques

Preview:

Citation preview

Laboratory Techniques September 2014

Information from Increasing Dietary a-Linolenic Acid Enhances Tissue Levels of Long-Chain n-3 PUFA when Linoleic Acid Intake is Low in Hamsters:

Measuring FA Composition of Diets and Tissues:o Lipids from the diets and tissues were transmethylated w 0.5 N

methanolic HCl.o FA methyl esters were analysed by gas chromatography w a flame

ionization detector and autosampler using a Supercowax 10 flexible fused-silica capillary column.

Information from Need for Accurate and Standardized Determination of Amino Acids and Bioactive Peptides for Evaluating Protein Quality and Potential Health Effects of Foods and Dietary Supplements:

Determination of a.a.’s in food:o The safety, allergenic potential and adequacy, including bioavailability

of the new bioactive peptides, should be thoroughly assessed before they are made widely available to consumers.

o Protein digestibility assessment – PDCAASo Determination of the total amino acid content of foods and

supplements requires protein hydrolysis by various means that must take into account variations in stability of individual a.a’s and resistence of diff peptide bonds to the hydrolysis procedure.

o Consider: HPLC – quantifying a.a’s; reversed C8/C18 silica-based

columns Gas chromatography Capillary electrophoresis

Determination of bioactive peptides in foods and dietary supplements:o Food-derived bioactive peptides commonly contain 2-9 a.a’s, (Lunasin

– food-derived bioactive peptide w anticancer bioactivity in skin cancer mouse model w 43 a.a.’s) larger peptides digest in intestinal tract

o ACE-inhibitory peptides have to reach the cardiovascular system in an active form.

o Enzymatic and acid hydrolyses generate peptides from proteins.o Proteinases are most commonly used for the production of peptides

from food proteins.o Fermentation is also used to produce some bioactive peptides.o LC to isolate and purify.o SDS-PAGE can determine M.W. and purity. o Size-exclusion LC can give an indication of particle size.

In Canada, bioactive substances intended to have health benefits could be considered as a functional food or nutraceutical.

KIRS:

2

People with autoimmune disease susceptibility have activating KIRs, which slow the disease progression.

In cancer, there is a correlation to the expression of inhibitory KIRs related to susceptibility.

Whenever you want to recognize a non-self (viruses and cancer), you want an activator, but that leads to increased autoimmune disease.

Want to recognize self, you want an inhibitory, but that leads to increased viral/cancer disease.

All procedures are examples from BCH3356 or the internet and not set in stone.

PCR Amplification

Theory:1. Denaturation: During this step, a high temperature is necessary to convert

double stranded DNA (dsDNA) into single stranded DNA (ssDNA). This step is essential so that each primer can access and anneal to its complementary single-stranded DNA template (2nd step). If the denaturation step is too short, or if the temperature is too low, dsDNA will be partially denaturated and can renature rapidly. On the other hand, if the temperature is too high, or if the denaturation step is too long, excessive loss of enzyme activity will occur with each cycle.

2. Primer annealing: The melting temperature (Tm) of primers is of critical importance in designing the parameters of a successful PCR amplification. A simple formula for estimating the Tm of short DNA oligonucleotides is: Tm =  64.9°C + 41°C x (# of G’s and C’s – 16.4)/N where N is the total number of nucleotides.

The annealing temperature (Ta), which is sometimes confused with the Tm, corresponds to the temperature of the thermocycler during the annealing step. The Ta is adjusted according to the length and the relative GC content composition of the primers. A rule of thumb is to use a Ta value that is about 5°C below the lowest Tm of the two primers. One consequence for using a Ta value that is too low is that one or both primers might anneal to sequences other than their true targets, as internal single-base mismatches or partial annealing may be tolerated. This incorrect annealing can lead to "non-specific" amplification (extra amplification products that can be seen on an agarose gel) and reduced yield of the desired product. A consequence of a Ta that is too high is lower amplification, as the likelihood of primer annealing is reduced.Annealing does not take long: most primers will anneal efficiently within 30 sec or less.

3. Primer extension: This is the DNA synthesis step mediated by a DNA-

3

dependent DNA polymerase. A heat-stable DNA polymerase is required to withstand the denaturing steps carried out at 95-98°C. Many commercial DNA polymerases were originally purified from a thermophilic bacterium such as Thermus aquaticus, which lives in hot springs. Optimal extension activity occurs at about 72°C.DNA extension can be initiated only at a free 3’ end. It is the annealing of primers onto their complementary target sequences that generates the necessary free 3’ ends for priming DNA extension.

Materials: Phusion High-Fidelity DNA polymerase Reverse primer Forward primer

Procedure:

1. Prepare two PCR reactions as indicated in the table below.

2. PCR reactions should be setup in labeled PCR tubes (0.2 mL). (positive and negative controls)

3. Load in thermocycler.

4. The thermocycler will run the following PCR program for this experiment:

I. Initial denaturation: 95°C 1 minII. Denaturation: 95°C 30 sec

III. Annealing: 55°C 30 secIV. Extension: 72°C 30 secV. Repeat step II to IV 24 times

VI. Final extension: 72°C 10 minVII. Hold temperature: 4°C

4

PCRComponents

Concentration of the stock

sample

Targetconcentration

in reaction tube

Volume per reaction:Positive control

Volume per reaction: Negative control

H2O (Brown tube) 29.5 L 39.5LPCR Buffer (Blue tube) 10X 1X 5.0 L 5.0LMgCl2 (Purple tube) 50 mM 1.5 mM 1.5 L 1.5LdNTPs (Green tube) 10 mM 0.2 mM 1.0L 1.0LForward primer (Pink tube) 10 M 0.2 M 1.0L 1.0LReverse primer (Yellow tube) 10 M 0.2 M 1.0 L 1.0LDNA template (Orange tube) 0.01 ng/L 0.1 ng/50L 10.0L -Taq DNA polymerase See TA

5 U/50 L 1.0L 1.0 L

Total volume 50L 50L

Agrose Gel Electrophoresis

Theory:1. Gel electrophoresis is a technique used to separate macromolecules –

especially proteins and nucleic acids - that differ in size, charge or conformation (3). When charged molecules are placed in an electric field, they migrate toward either the positive (anode) or negative (cathode) electrode according to their charge. In contrast to proteins, which can have either a net positive or net negative charge, nucleic acids have a negative charge at neutral pH, due to their backbone of phosphate groups. The relative migration distance of each molecule is determined by the charge density of the molecule and the resistance of the matrix (or gel) media to the passage of the molecule.

2. The higher the agarose concentration, the "stiffer" the gel will be and the smaller the size of the DNA or RNA fragments that can be separated. Following separation, DNA fragments will be visualized by staining with SYBR safe®. This fluorescent dye intercalates between bases of DNA and RNA. It is often incorporated into the gel so that staining occurs during electrophoresis, but the gel can also be stained after electrophoresis by soaking in a dilute solution of SYBR safe®. DNA or RNA fragments appear as green bands when the gel is exposed to UV light. Fragments of linear DNA migrate through agarose gels with a mobility that is inversely proportional to the log of their molecular weight. Circular forms of DNA migrate in agarose differently from linear DNAs of the same mass. Several factors have important effects on the mobility of DNA fragments in agarose gels, and can be used in order to optimize the separation of DNA fragments. These factors include: % agarose concentration, voltage (as the voltage applied to a gel is increased, larger fragments migrate proportionally faster than small fragments), the choice of electrophoresis buffer and SYBR safe®. The molecular weight of a linear DNA sample can be estimated by running a mixture of linear DNA fragments of known size under the same conditions (Figure 2).

Materials: Plasmid DNA at an unknown concentration. Spectrophtometer (+ cuvette) MassRuler Express Forward DNA Ruler bromophenol blue

Procedure: Using a spectrophotometer, you will be required to calculate the

concentration of plasmid DNA and then determine the 260/280 ratio. Once you know the concentration, you will load 50 ng of the plasmid DNA on an agarose gel to validate your calculation.

5

1. Prepare a 1:50 dilution of the unknown DNA solution in a final volume of 1.0mL. Water should be used for the dilution.

2. Transfer this dilution into a 1.5 mL spectrophotometer cuvette. Prepare a second cuvette with 1mL of water for the blank.

3. Read the absorbance of your DNA dilution at 260nm (Remember that 1 OD260

= 50 g/mL of dsDNA).

4. Once the concentration of the DNA solution has been determined, prepare an aliquot that contains 50 ng of plasmid DNA in a final volume of 10 L.

5. Add 3.5 L of water and 1.5 L of 10X DNA loading buffer.

6. Load your aliquot and MassRuler Express Forward DNA ladder on a 1% agarose gel.

7. Transfer 10 L from each PCR reaction to two 1.5 mL micro centrifuge tubes containing 3.5 L of water and 1.5 L of 10X DNA loading buffer. Make sure that your tubes are labelled properly.

8. Close your tubes and mix the solution by gently flicking the tube. Collect the solution from the wall of the tube by using a centrifuge.

9. Load your samples onto the agarose gel and 10 L of the MassRuler Express Forward DNA ladder marker in two pre-assigned wells.

10. Run the gel at 100 volts until the bromophenol blue, which is used as a tracking dye, gets halfway through the gel (It should correspond roughly to the distance travelled by a 150 bp DNA fragment).

11. A picture of your gel will be taken using a gel documentation system (AphaImager mini).

PCR Primer Design

Theory:1. The sense strand is the DNA strand that corresponds to the mRNA sequence,

except for U’s that are substituted with T’s. By convention, the sequence of a gene is represented as its sense strand and is displayed 5’ to 3’. The sense strand is also referred as the coding strand. The antisense strand is the strand that is complementary to the sense strand. Because the two DNA strands are antiparallel (they are side-by-side but in opposite directions), the sequence of the antisense corresponds to the reverse complement of the sense strand.

6

2. Conversion of an mRNA into cDNA. The first step in the production of a cDNA is the conversion of the messenger RNA (mRNA) into a complementary DNA strand. This is done by using a DNA polymerase called Reverse transcriptase forming the antisense strand (First strand cDNA synthesis). Then, RNaseH is used to remove the mRNA and the second strand of the cDNA is subsequently synthesized by the DNA polymerase I (in combination with specific primers). The newly synthesized strand corresponds to the sense strand. In this representation, ATG corresponds to the start codon (AUG in the mRNA) and the TGA (UGA in the mRNA) represents the stop codon (for simplicity, only one of the three stop codons is shown). The polyadenine tail of the transcript is designated by five adenines.

3. To delineate the two ends of the PCR amplicon, two primers are necessary, a forward and a reverse primer. The forward primer sequence reads identical to the coding sequence of the mRNA molecule or the sense strand of your cDNA. It anneals to the antisense (non-coding) strand to initiate elongation of the sense strand from its 5’ to 3’ ends. The reverse primer sequence reads as the reverse complement of the mRNA molecule or the antisense

7

strand of your cDNA and it anneals to the sense (coding) strand to prime elongation of the antisense strand.

4. Primer rules:a. Primers usually have a length of 17-28 nucleotides; b. The primer’s base composition should be 50-60% (G+C); c. Primers 3’-end should have one or two terminal C or G’s. This allows a

firm adhesion of primer’s 3’ terminal nucleotides onto the template;d. Runs of three or more consecutive C’s or G’s within primers may

promote mispriming at GC-rich sequences (because of the stability of annealing); this problem is more common when genomic DNA is used as a template;

e. The 3'-ends of the forward and reverse primers should not be complementary (i.e. they should not be able to anneal to each other) to prevent the formation of primer dimers;

5. Subcloning:a. The reading frame of

your T7 RNA polymerase needs to be adjusted to the reading frame provided by the destination vector.

B)

A)

8

FWD:1 : Six extra nucleotides to ensure optimal Hind III activity2 : Hind III recognition site3 : Coding sequence (open reading frame) of the T7 RNA polymerase.

ATG of the T7 RNA polymerase is shown in bold.

REV

Purification of the T7 RNA polymerase PCR amplicon.

Theory:1. Purification of your amplicon is necessary because the conditions (pH, salt

concentrations, etc.) used for PCR amplification are not necessarily compatible with the conditions to be used for the restriction digest to be performed next week. The process works via binding of DNA to silica at high ionic strength, and release at low ionic strength. Addition of chaotropic salts, such as guanidine, create a salt bridge between the negatively charged phosphate groups of the DNA and the silica column (1).

Materials: Clontech NucleoSpin® Gel and PCR Clean-Up .

Procedure:1. After thermocycling, transfer 2 L of each PCR reaction (T7 RNA and -

control) into two labeled 1.5 mLmicrocentrifuge tubes. Make sure to write a U on the lid of your T7 RNA polymerase aliquot (U for Unpurified). The - controls will not be purified as it will not be used for ligation next week.

5' - GTGTATAAGCTTATGAACACGATTAACATCGCTAAGAACGACTTCT - 3'

GTGTAT AAGCTT ATGAACACGATTAACATCGCTAAGAACGACTTCT

5' - ATTTATGAATTCTTACGCGAACGCGAAGTCCGACTCTAAGATG - 3'

ATTTAT GAATTC TTACGCGAACGCGAAGTCCGACTCTAAGATG

9

Proceed to the next step with your remaining T7 RNA polymerase PCR reaction.

2. Combine the remaining fraction of your T7 RNA polymerase PCR amplicon (about 98 L) with 2 volume of the NTI buffer (196 L) and mix thoroughly.

3. Place a Nucleospin PCR Clean-up column into a 2 mL collection tube.

4. Apply your sample to the Nucleospin PCR Clean-up column.

5. Centrifuge for 30 sec at 11,000 x g. Discard the flow-through and return the column to the collection tube. Your PCR amplicon is now attached to the silica column. However there are also contaminants present that need to be removed.

6. To remove these contaminants from your PCR amplicon, add 700 L of the NT3 buffer to the column and centrifuge for 30 sec at 11,000 x g.

7. Discard the flow-through and place the column back in the same tube. Add again 700 L of the NT3 buffer and centrifuge for 30 sec at 11,000 x g.

8. Discard the flow-through and return the column to the collection tube, being careful not to wet the bottom of the column with the flow-through. Centrifuge again for 1 min at 11,000 x g to evaporate any ethanol residue on the column. It is crucial to eliminate residual ethanol left inside the column since it will prevent or lower the solubilization of DNA in water and, therefore, lower the amount of DNA that can be eluted.

9. Place the column in a clean 1.5 mL micro centrifuge tube (with a cap attached to it) and add 30 L of NE buffer directly onto the center of the membrane. (Be careful not to touch the membrane with the tip of the pipette.) Incubate your Nucleospin PCR Clean-up column at RT for 1 min (this step is really important to permit the complete desorption and

10

resolubilization of your DNA), and then centrifuge for 1 min at 11,000 x g to elute your purified T7 amplicon.

10. Discard the column and keep the 1.5 mL microcentrifuge tube containing your purified T7 RNA polymerase amplicon.

11. Transfer 2 L of your purified amplicon into a new 1.5 mL microcentrifuge tube. This aliquot will be analyzed in parallel with your unpurified T7 amplicon (refer to Step 5) by agarose gel electrophoresis (Experiment #3). The remaining of your purified T7 RNA polymerase amplicon will be stored at -20°C until next week.

Ligation

Theory:There are two basic strategies for ligating DNA fragments into plasmid vectors

depending on the kind of termini in the insert and vector:a) Directional ligation: Double-stranded DNA fragments with compatible

cohesive termini can be covalently joined (ligated) in an ATP-dependent reaction that involves the formation of phosphodiester bonds between 5'-phosphate residues and 3'-hydroxyl residues.

b) Non-directional ligation: Same as directional, but with blunt ends and, therefore, non-specific binding

The following controls are usually recommended for ligation: Positive control: usually a plasmid vector that has been digested with only

ONE enzyme. In the presence of T4 ligase, the open plasmid should be recircularized.

Negative control: a doubly digested plasmid with non-compatible termini. In this lab, you will pre-digest pTAC-MAT-Tag-1 with both Hind III and EcoRI to generate incompatible overhangs so that self-ligation cannot occur. Notice that a partial digest for which the plasmid is cut with only one of the two restriction enzymes would result in compatible termini that might be ligated.

DON’T FORGET TO ADJUST THE READING FRAME OF YOUR AMPLICON TO THE MAT TAG READING FRAME.

Procedure:Part A: Digestion of the T7 amplicon and the pTAC-MAT-Tag-1 vector by Hind III and EcoRI.

1. Prepare the restriction digest of your PCR amplicon and pTAC-MAT-Tag-1 as described in the table below. Use the remaining fraction of the undigested

11

pTAC-MAT-Tag-1 for preparing a positive control for your transformation (step 3).

Sample Sample volume

(L)

H2O

(L)

10X BufferNEB4

(L)

Hind III[20units/L]

(50 units)

EcoRI[20units/L]

(50 units)

Final volume

(L)

T7 Amplicon 27.5 L 2.5 L 2.5 L 100 L

pTAC-MAT-Tag-1 (1 g)

10 L 2.5 L 2.5 L 100 L

2. Digest your two samples for 2 hour at 37°C.

3. While waiting for your digests, prepare an aliquot containing 40 ng in a final volume of 40 L. This latter aliquot (40 ng/40 L) of the undigested pTAC-MAT-Tag-1 can be put for storage at -70°C. This undigested aliquot will serve as a positive control for the transformation protocol.

4. At the end of the incubation, clean up your doubly digested PCR amplicon and pTAC-MAT-Tag-1 samples using the Nucleospin PCR clean-up column.

Part B: Estimation of the concentration of your purified doubly digested amplicon and vector.

Estimate the concentration of your purified amplicon and vector using an agrose gel electrophoresis or a spectrophotometer (Epoch; 3uL on each spot).

Part C: Ligation of doubly digested T7 RNA polymerase amplicon into doubly digested pTAC-MAT-Tag-1.

5. Use the concentrations of T7 RNA polymerase amplicon and pTAC-MAT-Tag-1 samples given by the plate reader to fill the table below targeting an insert:vector molar ratio of 3:1 and 40 ng plasmid.

12

6. Prepare your ligation reactions as described in the table below. First, add all components except the T4 ligase, mix thoroughly, and quick spin all your tubes. Add the T4 ligase, then mix and quick spin all your tubes again.

1 You will be provided with an aliquot of pTAC-MAT-Tag-1 that had already been

digested with Hind III (20 ng/L)

7. Incubate the ligations overnight in a thermocycler pre-set to 16°C. Tomorrow store your samples at -70°C.

8. Before leaving the lab, prepare an aliquot containing 40 ng of pTAC-MAT-Tag-1 (digested with Hind III/EcoRI) in a final volume of 40 L. This solution will be used as your second negative control for the transformation.

Transformation

Theory: There are two methods to transform E. coli cells with plasmid DNA - chemical

transformation and electroporation. o For chemical transformation, cells are grown to mid-log phase,

harvested and treated with divalent cations such as CaCl2. Cells treated in such a way are said to be competent. To chemically transform cells, competent cells are mixed with the DNA , on ice, followed by a brief heat shock. Then, cells are incubated with rich medium and allowed to express the antibiotic resistant gene for 30-60 minutes prior to plating.

o For electroporation, cells are also grown to mid-log phase but are then washed extensively with water to eliminate all salts. Usually, glycerol

13

Treatments

Description H2O

(L)

Vector digeste

dwith

Hind III

(L)

Vector digested

with Hind III and EcoRI

(40 ng)(L)

T7 RNA pol.

Amplicon digested

with Hind III and EcoRI

(L)

Ligation

buffer5X

(L)

T4 DNA

ligase

(L)

Total volum

e

(L)

IT7 amplicon +pTAC-MAT-

Tag-10 8 2 40

IILigation negative control

0 0 8 2 40

IIILigation positive control

28 21 0 0 8 2 40

is added to the water to a final concentration of 10% so that the cells can be stored frozen and saved for future experiments. To electroporate DNA into cells, washed E. coli are mixed with the DNA to be transformed and then pipetted into a plastic cuvette containing electrodes. A short electric pulse, about 2400 volts/cm, is applied to the cells causing smalls holes in the membrane through which the DNA enters. The cells are then incubated with broth as above before plating.

o For chemical transformation, there is no need to pre-treat the DNA. For electroporation, the DNA must be free of all salts so the ligations are first precipitated with alcohol before they are used.

DON’T FORGET ANTIBACTERIAL RESISTANCE AND STERILE CONDITIONS (flame)

After, inoculate for a week and count the colonies that are not crosscontaminated w neighbouring colonies. A hemocytometer can count the cells.

Procedure for heat shock:Part A: Preparation of Competent Bacteria

1 mL of SOB liquid broth without ampicillin should be inoculated with a colony of Top10 cells. This inoculated broth was incubated overnight at 37°C on a rotary shaker (225 rpm/min). Transfer 500 L of this overnight SOB liquid culture, which had reached the stationary phase by then, into a 500 mL Erlenmeyer containing 350 mL of fresh SOB medium without ampicillin. The flask was then kept under vigorous agitation at 37°C until an optical density at 600nm of ~0.4-0.5 was reached (about 2 hours).

14

1. Pour 40 mL of the Top10 liquid culture into a 50 mL conical centrifuge tube and centrifuge at 1,000g for 15 min. at 4°C.

2. Discard the supernatant and resuspend the pellet in 15 mL of RF1 buffer (100 mM RbCl, 50 mM MnCl2, 30 mM Potassium acetate, 10 mM CaCl2, and 15% glycerol).

3. Incubate on ice for 15 min.

4. Centrifuge the cells for 15 min at 1,000g and 4°C.

5. Discard the supernatant and resuspend pellet by gentle swirling in 3ml of RF2 Buffer (10 mM RbCl, 10 mM MOPS, 75 mM CaCl2 and 15% glycerol). (Cells are very fragile at this point so handle your cells carefully. This step will have a great impact on your transformation efficiency. If you disrupt the cells too much, you will have a lot of mortality and therefore, low transformation efficiency.)

6. Keep the cells on ice for 15 min.

7. Your cell preparation is now ready for transformation. Transfer 200 L of your competent cells solution in seven pre-cooled 1.5mL centrifuge tubes. Your tubes should be labelled with your group number as well as with the treatment number, see table on the following page. Make sure to keep everything on ice at all times (cells are still fragile so drastic temperature change can be disastrous).

8. Keep your tubes on ice until you are ready to proceed with the transformation.

15

Part B: Transformation of Competent Top10 Cells with Ligation Products

You will transform Top10 cells made competent in Part A with aliquots of the ligation treatments performed last week.

9. Gently transfer 40 L of each plasmid DNA source into the appropriate tube (see table below). Mix well by gently tapping the tubes. Do not vortex as the cells are fragile at this point. 

Treatment Description of the transformation Volume of Top10

(L)

Volume of DNA(L)

I pTAC-MAT-Tag-1 Hind III/EcoRI + T7 ampliconHind III/EcoRI(Ligation treatment I)

200 40

II pTAC-MAT-Tag-1 Hind III/EcoRI(Ligation treatment II, Negative control for the ligation)

200 40

III pTAC-MAT-Tag-1 Hind III(Ligation treatment III, Positive control for the ligation)

200 40

IV No DNA(1st negative control for the transformation)

200 0

V pTAC-MAT-Tag-1 Hind III/EcoRI, no T4 DNA ligase (aliquot of 40 L from Step 9 of Lab Class 2)(2nd negative transformation treatment)

200 40

VI 40 ng of undigested pTAC-MAT-Tag-1 (aliquot of 40 ng in 40 L put aside at Step 3 of Lab Class 2)(Positive transformation treatment)

200 40

10. Incubate on ice for 30 min.

11. Transfer the tubes to a rack placed in a water bath preheated to 42°C and incubate for exactly 30 seconds. Do not shake the tubes.

12. Transfer the tubes to ice and allow the cells to chill for 2 min.

13. Carefully add 1 mL of pre-warmed LB broth to each tube and transfer the solution to a 15ml inoculation tube.

14. Incubate in a shaking incubator (225 cycles/min) set at 37°C for 1 hour.

At the end of this incubation, proceed to step 15 with treatment I, to step 19 for treatment II to V and to step 21 for treatment VI.

16

15. Pipet 100 L of the bacterial suspension corresponding to treatment I onto the pre-identified LB-Ampicillin agar plate (Plate Ia).

16. Spread the bacteria evenly over the entire plate surface.

17. Transfer 100 L of the remaining bacterial suspension to a new 1.5 mL microfuge tube containing 900 L of pre-warmed LB-broth (1/10 dilution).

18. Mix well and transfer 100 L of this dilution onto the pre-identified LB-Ampicillin agar plate (Plate Ib). Spread the bacteria evenly over the entire plate surface.

19. Pipet 100 L of each bacterial suspension (corresponding to treatment II to V) onto the pre-identified LB-Ampicillin agar plates (Plate II, III, IV and V).

20. Spread the bacteria evenly over the entire plate surface.

21. Transfer 100 L of the bacterial suspension corresponding to treatment VI to a new 1.5 mL microfuge tube containing 900 L of pre-warmed LB-broth (dilution #1). Mix well and transfer 100 L of this solution to a new 1.5 mL microfuge tube. Add 900 L of pre-warmed LB-broth (dilution #2). Mix well and transfer 100 L of dilution #2 onto the pre-identified LB-Ampicillin agar plate (Plate VIa; 1/100 dilution). Spread the bacteria evenly over the entire plate surface.

22. Transfer 100 L of dilution #2 to a new 1.5 mL microfuge tube containing 900 L of pre-warmed LB-broth (dilution #3). Mix well and transfer 100 L of dilution #2 onto the pre-identified LB-Ampicillin agar plate (Palte VIb; 1/1000 dilution). Spread the bacteria evenly over the entire plate surface.

23. Leave your agar plates at room temperature until the liquid is completely absorbed - this should take about 20 min. Put all agar plates at 37°C for 24 hrs, and then transfer them at 4°C until colony counting is done next week. All plates will be put upside down to prevent condensation on the lid; condensation droplets falling back onto the agar surface would result in cross contamination among the colonies.

Procedure for electroporation:I. Preparation of E. coli cells for electroporation.1. Use a fresh colony of DH5 (or other appropriate host strain) to inoculate 5 ml of αSOB (without magnesium) medium in a 50 ml sterile conical tube. Grow cells with vigorous aeration overnight at 37°C.

17

2. Dilute 2.5 ml of cells into 250 ml of SOB (without magnesium) in a 1 liter flask. Grow for 2 to 3 hours with vigorous aeration at 37°C until the cells reach an OD550 = 0.8.3. Harvest cells by centrifugation at 5000 RPM in a GSA rotor for 10 min in sterile centrifuge bottles. (Make sure you use autoclaved bottles!).4. Wash the cell pellet in 250 ml of ice-cold WB as follows. First, add a small amount of WB to cell pellet; pipet up and down or gently vortex until cells are resuspended. Then fill centrifuge bottle with ice cold WB and gently mix. NOTE- the absolute volume of WB added at this point is not important.5. Centrifuge the cell suspension at 5,000 RPM for 15 min and carefully pour off the supernatant as soon as the rotor stops. Cells washed in WB do not pellet well. If the supernatant is turbid, increase the centrifugation time.6. Wash the cell pellet a second time by resuspending in 250 ml of sterile ice-cold WB using the same technique described above. Centrifuge the cell suspension at 5000 RPM for 15 min.7. Gently pour off the supernatant leaving a small amount of WB in the bottom of the bottle. Resuspend the cell pellet in the WB - no additional WB needs to be added – and the final volume should be about 1 ml. Cells can be used immediately or can be frozen in 0.2 ml aliquots in freezer vials using a dry ice-ethanol bath. Store frozen cells at -70°C.

II. Preparing DNA for Electroporation

DNA for electroporation must have a very low ionic strength and a high resistance. The DNA may be purified by either dilution, precipitation or dialysis.For transformation of purified plasmid DNA, dilute DNA in 10 mM Tris pH 8-8.3 to about 1-50 ng/µl (do not use TE). Use 1 µl for transformation.For ligation reactions, use the following procedure.Purifying DNA by Precipitation:1. Add 5 to 10 g of tRNA to a 20 l ligation reaction in a 1.5 ml tube. Add 22 l 5M μ μ μammonium acetate (or an equal volume of ligation reaction with added tRNA). Mix well.2. Add 100 l absolute ethanol (or 2.5 volumes of ligation reaction, tRNA and salt). μIce 15 min.3. Centrifuge at >12,000 x g for 15 min at 4°C. Carefully decant the supernatant.4. Wash the pellet with 1 ml of 70% ethanol. Centrifuge at >12,000 x g for 15 min at room temperature. Remove the supernate.5. Air dry the pellet (speed vac okay but don't overdry).6. Resuspend the DNA in EB buffer (10 mM Tris-HCl, pH 8.3) or 0.5X TE buffer [5 mM Tris-HCl, 0.5 mM EDTA (pH 7.5)] to a concentration of 10 ng/ul of DNA. For ligation reactions, it is convenient to resuspend in 10 µl. Use 1 l per transformationμ of 20 l of cell suspension.μ

III. Electroporation.

18

1. Mark the required number of micro centrifuge tubes. Place the required number of Micro-electroporation Chambers on ice. Fill the temperature control compartment of the Chamber Safe with ~250 ml of ice-water slurry and place the Chamber Rack in the Chamber Safe.2. Thaw an aliquot of cells that have prepared as in Section I and aliquot 20 µl of cells to the required number of microfuge tubes on ice. Add 1 µl of the DNA (or ligation reaction) prepared as in Section II.3. Using a micro pipette, pipette 20 µl of the cell-DNA mixture between the bosses in a Micro-Electroporation Chamber. Do not leave an air bubble in the droplet of cells; the pressure of a bubble may cause arcing and loss of the sample. Place the chamber in a slot in the Chamber Rack and note its position. Repeat the process if more than one sample is to be pulsed. Up to 4 samples can be placed in the Chamber Rack at one time. Handle the chambers gently to avoid accidentally displacing the sample from between the bosses.4. Close the lid of the Chamber safe and secure it with the draw latch.5. Plug the pulse cable into the right side of the Chamber safe.6. Turn the chamber selection knob on top of the Chamber Safe to direct the electrical pulse to the desired Micro-Electroporation Chamber.7. Set the resistance on the Voltage Booster to 4 k ; set the Pulse Control unit to ΩLOW and 330 µF; double check connections.8. Charge the Pulse Control unit by setting the CHARGE ARM switch on the Pulse Control unit to CHARGE and then pressing the UP voltage control button until the voltage reading is 5 to 10 volts higher than the desired discharge voltage. For E. coli, the standard conditions are 2.4 kv, which means setting the Pulse Control unit to 405 volts (400 volts is the desired discharge voltage + 5). The voltage booster amplifies the volts by ~6-fold such that the total discharge voltage is 2400 volts, or 2.4 kv. The actual peak voltage delivered to the sample will be shown on the Voltage Booster meter after the pulse is delivered.9. Set the CHARGE/ARM switch to the ARM position. The green light indicates that the unit is ready to deliver a DC pulse. Depress the pulse discharge TRIGGER button and hold for 1 second.NOTE: The DC voltage display on the Pulse Control unit should read <10 volts after a pulse has been delivered. If not, discharge the capacitor using the DOWN button.10. For additional samples, turn the chamber selection knob to the next desired position and repeat steps 8 and 9 until all samples are pulsed.11. For ampicillin selection, inoculate the samples into 2 ml of SOC medium and shake for 30 minutes (for amp), 60 minutes (for Kan) to allow expression of the antibiotic gene. Plate cells on LB medium with appropriate antibiotic or screening reagent (e.g. 100 µg/ml ampicillin, and/or 40 l of 20 mg/ml X-Gal, XP, and 40 l of μ μ100 mM IPTG).

Screening and sequencing

Theory:

19

1. Minipreparation of plasmid DNAa. The miniprep protocol permits the rapid isolation of small amounts of

plasmid DNA (1-10 g). The plasmid isolation procedures make use of the covalently closed circular nature of bacterial plasmids and their small size in relation to the bacterial chromosome. In the alkaline lysis method that you will be using, bacterial cells are lysed in a solution containing NaOH and sodium dodecyl sulphate (SDS) (Figure 1.). Effective lysis of bacterial cells is a key step in plasmid isolation and it directly affects DNA yield and quality. The alkaline conditions (pH 12-12.5) denature both the chromosomal DNA and the plasmid DNA and SDS denatures proteins. The solution is then neutralized with potassium acetate. Under these renaturing conditions, the plasmid DNA, whose two strands remained intertwined during the alkaline lysis, rapidly reanneals. The chromosomal DNA cannot renature as quickly and is therefore trapped along with proteins in an insoluble complex. The precipitate is removed by centrifugation and the plasmid is precipitated from the supernatant through the addition of ethanol. Typical yield for the alkaline lysis protocol is about 1-2 g of plasmid DNA per mL of liquid culture.

2. DNA sequencing:a. PCR amplification w ddNTPs (w ++dNTPs) – ddNTP’s are end

terminators – and fluroescin donor dye directly linked to an energy acceptor dichlororhodamine dye (Applied Biosystem’s BigDyes)

b. Analysis of PCR amplicons by capillary electrophoresisc. Automated base calling

Procedure:Minipreparation of plasmid DNA (miniprep)

1. Recover and vortex the five culture tubes, which you inoculated yesterday, to resuspend the cells.

2. Transfer 0.5 mL of each of your five culture tubes into a distinct, labelled 1.5 mL microcentrifuge tube.

Those five microfuge tubes are to be kept on ice until you can identify, by restriction digest (Part C), which one(s) contain(s) the expected pTAC-MAT-Tag-1/T7 recombinant plasmid. Once you have identified at least one positive clone, you will retrieve the appropriate tube and proceed to its cryopreservation as described at step 25.

 3. Centrifuge your five polystyrene culture tubes at 3,000g for 5 min using

the centrifuge with a swinging bucket rotor. Discard the supernatant. 

4. Add 100 L of Resuspension Buffer (50mM Glucose, 25mM Tris-HCl pH8.0, 10mM EDTA, RNase A 20g/mL) into each of your tubes, and then

20

vortex at high speed to resuspend the pellets. Once the pellets have been completely resuspended, transfer the contents of each polystyrene culture tube into a pre-labeled 1.5 mL microcentrifuge tube.

 5. Add 200 L of Lysis Buffer (1% SDS, 0.2N NaOH) into each of your 1.5 mL

tubes and mix the content by inverting the tubes five times. Observe how the properties of the samples have changed.

Do not vortex, shake or incubate your minipreparations for more than 5 min to minimize shearing of genomic DNA. Breakdown of genomic DNA into small fragments is not desirable as the smaller fragments might be extracted along with plasmid DNA.

 6. Immediately add 150 L of K-acetate buffer (3M potassium, 5M acetate,

pH4.8) into each of your tubes. Mix thoroughly by inverting your tubes 3 times.

 7. Centrifuge your tubes at maximum speed for 5 min to pellet cell debris

and chromosomal DNA. 

8. Use a 1 mL pipettor to transfer about 75-80% of the supernatants into clean 1.5 mL microcentrifuge tubes. Avoid transferring any of the white precipitate. If some of the precipitate gets transferred, it can be removed with a pipet tip.

 9. Add 900 L ethanol 95-99% that has been pre-cooled to -20°C. Mix well

by shaking.

10. Centrifuge at maximum speed for 5 min. 

11. Discard the supernatants. Add 1 mL of 70% ethanol in each tube and rinse the pellets by vortexing for 5-10 sec (pellets do NOT have to be completely resuspended). Centrifuge again at maximum speed for 5 min then invert the tubes over absorbent paper for ten minutes to drain out the remaining ethanol.

After the 70% ethanol wash, the pellets tend to weakly adhere to the bottom of the tubes: be careful not to lose your plasmid DNA pellets!

12. Resuspend each pellet in 50 L of water.

Analysis of the Minipreparations by Restriction Digest and Cryopreservation of One Positive Clone

18. Prepare a Master mix to digest your five minipreps knowing that you will digest 3 L of each minipreps in a final volume of 20 L (do not forget to add

21

1 more reaction to the master mix to create a buffer zone so you don’t run short of your master mix)

Components Volume per reaction

(L)

Volume of the master mix (6

reactions)(L)

H2O 13 7810X NEB4 buffer 2 12

EcoRI (20 Units/L) 1 6Hind III (20

Units/L)1 6

Total volume 171 1022

1Three microliters of plasmid DNA will be added for a final digestion volume of 20 L.2To verify that your calculations were done properly, you can divide the total volume of Master mix by the number of reactions and you should get the total volume of one reaction (102L/6 reactions=17L)

19. Transfer 17 L of master mix into 5 labelled 1.5 mL microcentrifuge tubes.

20. Add 3 L of each miniprep to the corresponding tube.

21. Mix each tube well and incubate for at least one hour at 37°C.  

22. Cast a 1% agarose gel with a 20-well comb. Three groups can share one gel as follows:

a. Lanes 1-6: 5 digested and 1 undigested samples from 1st groupb. Lane 7: 10 L of the MassRuler Express Forward DNA ladderc. Lanes 8-13: 5 digested and 1 undigested samples from 2nd group.d. Lane 14: 10 L of the MassRuler Express Forward DNA laddere. Lane 15-20: 5 digested and 1 undigested samples from 3rd group.

23. Prepare your samples to be loaded on the agarose gel as follows:a. Digested samples (5X): Mix 13.5 L of each digest with 1.5 L of 10X

loading buffer

22

b. Undigested controls (1X): Mix 1.5 L of one miniprep with 12 L of H2O and 1.5 L of 10X loading buffer (1.5 L of an undigested miniprep represents approximately the same DNA amount as 13.5 L of its digested preparation: band intensities should be similar).

24. Load 15 L of each digested or undigested miniprep sample along with 10 L of the DNA ladder, and then carry out electrophoresis at 100V for about 40 minutes. Take a picture of your results.

25. Refer to your gel picture to identify one positive colony whose band profile corresponds to the expected bands for pTAC-MAT-Tag-1/T7. This positive miniprep is to be used as a template for DNA sequencing (Part D). You should also retrieve the transformant cell line corresponding to your positive miniprep among the five cell lines that were put on ice at step 7. You will require this cell line next week for the protein expression procedure. Cell cultures can be cryopreserved for long periods of time if frozen at -70°C in presence of 25% glycerol. Add the appropriate volume of 50% glycerol to your positive cell culture (0.5 mL) to reach a final concentration of 25% glycerol, invert a few times to homogenize the content, and store it at -70°C.

DNA Sequencing

Each sequencing reaction can accurately sequence about 600 to 800 bp. In this experiment, you will use five sequencing reactions to ensure the full coverage of your T7 RNA polymerase insert containing about 2,655bp. Once the five sequencing results will be returned to you, your challenge will be to examine the overlaps among the five sequencing results to deduce the complete sequence of your insert. The assembly process of different sequencing results is commonly referred to as gene assembly.

The five sequencing primers you will use for priming DNA sequencing are:

Seq F1: 5’-CTGTTGACAATTAATCATCGG-3’ Seq F2: 5’-GGGCACGTCTACAAGAAAGC-3’ Seq F3: 5’-TACAAAGCGATTAACATTGCGC-3’ Seq F4: 5’-GCTGAGCAAGATTCTCCGT-3’ Seq F5: 5’-GCTGCTGGCTGCTGAGGTC-3’

26. Retrieve the miniprep corresponding to your positive transformant and purify it using the Nucleospin PCR clean-up system as explained in Appendix E3 with one important modification. You should elute once with 30 L and then, elute a second time with 30 L (see step 8 in Appendix E3). This modification will help ensure that the final concentration of the purified plasmid DNA is enough to meet the minimum concentration requirement for DNA sequencing.

23

The procedure for DNA sequencing is relatively straightforward, but very sensitive. The amount of DNA template is critical: either a too low or a too high concentration of DNA can significantly reduce the number of nucleotides that can be read or sequenced. To ensure a good estimate of the DNA concentration of your purified miniprep product to be sequenced, an aliquot will be analysed using the Epoch microplate spectrophotometer.

27. Take 3 L of your purified plasmid to be sequenced and transfer it onto an empty spot on a Take3 microplate (see Lab 2 Procedures Part B). Please note where your sample was loaded (row and column, e.g. A1, G2, …)

28. Use the output file to calculate the concentration of your purified recombinant plasmid DNA.

The minimal concentration required for proceeding to DNA sequencing is 100 ng/L. If your concentration is below that minimum threshold, you will have to borrow the sequencing results of another group having worked with the same mutant number.

DNA sequencing will be performed at the McGill and Genome Quebec Innovation Centre in Montreal. Samples are to be labeled as Day_lab#_Group#_Mutant#_Primer (e.g. Monday_202_Gr8_M2_SeqF1). You will be asked to enter your sample names in an electronic file to be directly sent to the sequencing centre along with your samples. The sample names you enter will be the ones used when the sequencing results are posted.

29. Samples are to be loaded on a 96 well plate with 1 row for each group. Load 7.5 L of your purified DNA plasmid into each of the first five wells of your lane, and 10 L of the appropriate primer in each of the next five wells. It is very important that you follow these guidelines when loading the 96 well plates.

Protein Expression Induction

Theory:Expression of the T7 RNA polymerase from the recombinant pTAC-MAT-Tag-1/T7 construct is tightly regulated by a repressor system (usually the Lac operon).

24

Procedure:Groups 1, 9 and 17

These groups will be in charge of preparing the 1st set of extra controls (see schematic on next page)

Groups 2, 10 and 18

25

These groups will be in charge of preparing the 2nd set of extra controls (see schematic on next page)

Groups 3, 11 and 19

Prepare 500 mL of 1X Binding Buffer (0.5 M NaCl, 20 mM Tris-HCl, 10 mM imidazole, pH 7.9)

Groups 4, 12 and 20

Prepare 200 mL of 1X Binding Buffer (0.5 M NaCl, 20 mM Tris-HCl, 10 mM imidazole, pH 7.9). This binding buffer will be used to wash the column.

Groups 5, 13 and 21

Prepare 20mL of 4X Elute Buffer (1M imidazole, 2 M NaCl, 80 mM Tris-HCl, pH 7.9)

Groups 6, 14 and 22

Prepare 10 mL of 4X Strip Buffer (2 M NaCl, 400 mM EDTA, 80 mM Tris-HCl, pH7.9)

Groups 7, 15 and 23

Prepare 10 mL of 8X Charge Buffer (400 mM NiSO4)

Groups 8, 16 and 24

Prepare 100 mL of 1X T7 Storage Buffer (30 mM HEPES, 0.15M K-Acetate, 0.25 mM EDTA, 0.05% Tween 20, 1 mM DTT, pH 7.5)

26

Part A: Induction of the expression of the T7 RNA polymerase

Step 1 is to be completed between 8-10:30am on the day preceding your regular lab class. Monday groups are to return to the lab on the preceding Thursday morning. You should plan about 20 min to complete the inoculation procedure.

The schematic below is a summary of this week’s experiment (presented in A). Groups 1, 9 and 17 will be asked to do the 1st set of extra controls (B) whereas groups 2, 10 and 18 will have the responsibility of preparing the 2nd set of extra controls (C).

27

1. Put your tube with your cryopreserved transformant cell line on ice until it is completely thawed. Then transfer 10 L of your cell culture into a snap-cap tube containing 3 mL of liquid LB medium with 100 g/mL ampicillin. Put your inoculated tube in the shaking incubator at 37°C overnight.

2. Recover your inoculated snap cap tube from the incubator and transfer 0.5 mL of the cell suspension into a flask containing 50 mL of liquid LB+AMP. Return your inoculated flask to the shaking incubator at 37°C for 2 hours.

You can now prepare the solution that was assigned to your group and that will be used for the MAT tag affinity chromatography next week.

3. After 2 hr of growth, check the A600 of your cell culture. This can be done by swirling the flask gently to homogenize the contents of the flask, tilting the flask to fill the sidearm with some liquid broth, and then inserting the sidearm into the aperture of the spectrophotometer to read the absorbance at 600nm. If the absorbance is below 0.25, return your flask in the incubator for another 30 min before verifying the absorbance again.

Culture flask with a sidearm

A reference aliquot (before induction) is to be put aside before proceeding to induction with IPTG. This initial aliquot is to be compared with a second aliquot to be sampled at the end of the induction with IPTG (after induction; see steps 6 and 8).

4. Transfer 1 mL of the culture into a 1.5 mL microfuge tube. This non induced aliquot (before induction control) is to be used to prepare a total protein extract at Step 8. The groups that are responsible for the collective controls should also take a sample at this step.

5. Figure out the volume of a 100 mM IPTG stock that should be added to your culture to obtain a final concentration of 1 mM. Add the IPTG to the flask and put it back in the shaking incubator at 37°C for 2 hours.

28

6. Transfer 1 mL of the culture into a 1.5 mL microfuge tube. This IPTG-induced aliquot (after induction control) is to be used to prepare a total protein extract at Step 8. The groups that are responsible for the collective controls should also take a sample at this step.

7. Transfer the contents of your flask into a 50 mL Nalgene centrifuge tube and centrifuge at 6,000g for 5 min at 4°C . Discard the supernatant and freeze your pellet of cells at -20°C until next week.

Next week, only your IPTG-induced cell pellet will be used for the purification of your MAT-tagged T7 RNA polymerase by MAT tag affinity chromatography. The other two 1 mL aliquots put aside at steps 4 and 6 are to be kept for SDS-PAGE analysis.

8. Recuperate the two 1 mL aliquots put aside at Steps 4 and 6, and centrifuge them for 1 min at 13,000 rpm. Discard the supernatants and resuspend each cell pellet in 25 L of distilled water, which is a strong hypotonic environment triggering cell bursting and release of cytosolic proteins. Add 25 L of 2X Loading Buffer to each of your two tubes. These two aliquots are to be stored at -20°C ; you will recuperate those aliquots for SDS-PAGE analysis to be done in lab 6.

The extra two series of controls prepared by pre-designated groups should be similarly mixed with the 2X loading buffer and returned to the TA. Those controls are to be assessed by SDS-PAGE.

29

Immobilized Metal Ion Affinity Chromatography (IMAC)

Theory: Fractionate protein extracts based on their affinity for metal ions

o The molecular principle of the IMAC purification is based on the formation of a coordination bond between an immobilized metal ion (usually Ni2+ or Co2+) and an electron donor present on the recombinant protein to be purified. His-Bind ® (Novagen) is an example of an IMAC column. These columns are composed of agarose beads that are covalently linked to a metal chelater known as iminodiacetic acid (IDA). The IDA molecules chelate nickel ions (Ni2+) that can form co-ordination bonds with others substances. There are 3 sites of the coordination bond available for interaction with metal ions in the column(Site 1 to 3 that are occupied by water molecules).

Purification of MAT-tagged proteins by IMAC.o Histidine residues were chosen mainly because they have a strong

affinity for metal ions. They are present in most proteins, but due to the fact that they are mildly hydrophilic, they are not always found on the protein surface. We can therefore use IMAC to specifically purify recombinant proteins by using plasmid vectors that have been genetically engineered to add histidines to the C or N-terminals of recombinant proteins. These adjacent histidines can interact with the metal-ions of the IMAC column via the nitrogen of the imidazole ring. The MAT tag contains four histidines alternating with another amino acid (HXHXHXH). These interactions between metal ions and proteins are extremely complex. They can also be the combined effect of electrostatic (or ionic), hydrophobic, and/or donor-acceptor (coordination) interactions.

Elution of MAT-tagged proteins bound to the IMAC column.o Imidazole is used to elute recombinant MAT-tag proteins bound to the

Ni2+ of the IMAC column. An excess of imidazole is added to the column and this results in a competition between histidine and imidazole for the coordination bonds. The excess of imidazole in the column leads to the displacement of the histidines and therefore, the elution of the recombinant proteins.

Procedure:Part A: Cell Lysate Preparation

1. Resuspend your cell pellet from last week in 10 mL ice-cold 1X Binding Buffer.

30

2. Set the knob of the sonicator to half power and sonicate your cell suspension for 1 min while maintaining your tube on ice. Incubate your tube on ice for 1 min. Repeat sonication/cooling two more times.

Sonication helps solubilize proteins, but it also shears DNA. Always keep your tube on ice during sonication to prevent overheating and protein denaturation.

3. Centrifuge your sonicated cell suspension at 14,000g for 20 min at 4°C. Then put your tube on ice. This fraction is to be loaded on the IMAC column at Step 9.

4. Take a 50L sample of your sonicated cell extract and put it in a 1.5 mL microcentrifuge tube. This solution will be your “Input Control”.

Part B: MAT-Tag Affinity Chromatography

Column Preparation

4. Remove the bottom and top column caps and allow the remaining stripping buffer to flow through. Discard this fraction.

Put the caps in a ‘safe’ place so you can recover them to seal your column when you have completed the process of purification. We need to reuse these columns and a column without its caps cannot be reused.

5. Add 3 bed volumes of distilled water onto the column and let it flow through. The column bed corresponds to the matrix that is packed into the column. For the column you use, the bed volume is 1.25 mL.

When pouring a solution into a column, make sure that the level of liquid has just reached the bed surface before proceeding to another solution. If another solution is added while some liquid from the previous step still remains above the resin, the transferred solution will be diluted and this might negatively affect the chromatography process. On the other hand, avoid extended delays between steps as the surface of the bed resin might dry out.

6. Add 5 bed volumes of 1X Charge Buffer and let it flow through the column (column should turn to a blue/green color).

7. Add 3 bed volumes of 1X Binding Buffer and run through column.

Purification of MAT-Tagged Proteins

31

8. After the Binding Buffer has drained, load column with prepared cell extract (10 mL). Take a 1.5 mL aliquot of this 10 mL solution after it has gone through the column (Flowthrough control).

9. Wash column with 12.5 ml 1X Binding Buffer. Take a 1.5 mL aliquot of this 12.5 mL solution after it has gone through the column (Wash 1 control).

10. Wash column with 7.5 ml 1X Binding Buffer. Take a 1.5 mL aliquot of this 7.5 mL solution after it has gone through the column (Wash 2 control).

11. Elute protein from column with 7.5 ml 1X Elute Buffer in a 15 mL tube. The solution coming out of your column contains your recombinant T7 RNA polymerase. Keep this solution on ice until the “Desalting procedure”.

Keep all the protein fractions you generated from the purification procedure so you can assess their concentrations by absorbance at 280nm BEFORE leaving the lab. You should measure the absorbance at 280nm of all your controls as well as your purified protein

Column Stripping

12. Wash column with 3 column bed volumes of 1X Strip Buffer. Allow half of the buffer to run through column and then cap both ends of the column. Return the capped column back to TA.

Part C: Desalting of the Purified MAT-Tagged T7 RNA Polymerase

Some contaminants that are found in the elution buffer, especially the high imidazole concentration, might interfere with the activity of your recombinant T7 RNA polymerase that will be assessed next week. In this experiment, you will use a centrifugal filter column with a molecular weight cut-off of 50kDa for substituting the elution buffer (250 mM imidazole, 0.5 M NaCl, 20 mM Tris-HCl, pH 7.9) of your eluted fraction with T7 Storage Buffer (30 mM HEPES, 0.15 M K-Acetate, 0.25 mM EDTA, 0.05% Tween 20, 1 mM DTT, pH 7.5). The underlying principle for buffer substitution is to use a column with a filter that allows small molecules to flow through, but not the larger ones. After the solution has been filtered, the appropriate buffer is used to resuspend the large molecules that stayed inside the column. The figure below illustrates the procedure to be used.

32

13. Transfer the final eluted sample from Part B by filling the inner column provided in the tube. Notice that not all of your eluted sample can fit into the column tube, but you will be able to add the remaining fraction after the first centrifugation.

14. Centrifuge at 4,000g using a swinging bucket for 8 min at 4°C .

15. Transfer the rest of the purified protein sample into the column tube, and centrifuge again at 4,000g for 8 min.

It is recommended to have approximately 500 L left in the column before adding the second fraction. If too much is left inside your column after the first centrifugation, you can simply centrifuge for another 5 min before loading the remaining fraction. The rate of filtration during centrifugation can vary significantly due to the occlusion of the pores with large cell fragments. Never let the membrane dry out completely.

16. Fill up the inner column with T7 storage buffer and centrifuge at 4,000g again for 10 min.

17. Repeat step 16.

18. Transfer the solution remaining in the inner column to a 15 mL conical centrifuge tube and fill it up to 2 mL with T7 Storage Buffer.

SDS-PAGE (Polyacrylamide Gel Electrophoresis)

Theory:o When an electric potential difference is applied to two electrodes immersed

in a solution of substances whose molecules bear an electric charge, the electrostatic attraction causes movement of the charged particles towards the electrode of opposite charge. This phenomenon is called electrophoresis

33

and may lead to discharge at the electrode, electrolysis, if the particle reaches it at the appropriate potential. The sample is usually applied to a porous solid support, such as a gel, wetted with the appropriate buffer. The porous support not only decreases diffusion but it also provides a ‘molecular sieving’ effect. For protein separation, the most common support is a gel of polyacrylamide poured between 2 glass plates forming a very thin vertical slab.

o The rate of electrophoretic migration of a protein is a function of the voltage gradient, the pore size of the support matrix and the charge and "size" of the protein; the latter parameter combines both molecular weight and conformational effects. The overall size of a protein molecule is determined by the folding of the protein and by the presence of intra- or intermolecular disulphide bridges. These bridges can hold the folded molecule together or form polymers of protein molecules by linking different molecules together. To be able to distinguish between these folding and bridging effects, the sample can be treated to insure that all molecules have the same conformation, thereby making migration solely dependent upon molecular weight and electrical conditions. This treatment involves dissolving the sample in a buffer containing 1-2% sodium dodecyl sulfate (SDS, a detergent) and 0.5-1.0 M -mercaptoethanol (SHCH2CH2OH). Mercaptoethanol reduces -S-S- cross-linked polymers to monomers and SDS binds to all proteins at a high ratio (1.4 g SDS/ g protein) and also unfolds the protein at the same time. Since SDS is negatively charged at the pH used for the electrophoresis, the SDS-protein complex becomes negative with a charge density that is independent of the protein size. Thus, the mobility in SDS-polyacrylamide gel electrophoresis (SDS-PAGE) is independent of the intrinsic protein charge or conformation and is solely dependent on the protein molecular weight. A linear relationship is obtained when the log molecular weight of standards is plotted against mobility, thus serving as one of the major means to determine protein molecular weight. This technique (SDS-PAGE) has become the most widely used techniques for determining the molecular weight of a protein and is now generally used to analyse proteins in conjunction with the Western blot method.

o Once separated, the components of the sample may be recognized by a variety of means such as staining with Coomassie Blue R or other stains.

o In order to determine the molecular weight of a protein on a SDS-PAGE gel, we need to have a reference marker. In this lab, you will be using a molecular weight marker called, RainbowTM ladder. This ladder is a mixture of individually colored and purified proteins of known molecular weights.

34

Procedure:1. In this section, the protein profile of the different controls that were

prepared by some groups in lab 5 will be compared to your IPTG-induced sample. For the electrophoresis, you will be using two pre-cast gradient gels (4-20% acrylamide).

2. Run a gel electrophoresis with a rainbow marker (7.5ug/5uL -- load 5 uL), 1 mL aliquot before induction and 1 mL aliquot after induction (load 10 uL), same w sets of controls.

3. Heat all samples, except the Rainbow marker, in a thermocycler at 95°C for 5 min. After the sample has been boiled, briefly spin down your tubes to collect your sample at the bottom.

4. Assemble the gel support and position the gels in the electrophoresis apparatus. Prepare 1X Running (HEPES) Buffer and fill the upper and lower chambers. The running buffer in the outer chamber should be at least halfway between the tops of the short and the long glass plates. The level of the buffer in the inner chamber should be at least 3 cm above the bottom edge of the gel sandwich.

 5. Load 10 L of each sample, but only 5 L of the Rainbow markers. Position the

tip above the well and insert it not more than 1mm into the well, and slowly release the sample.

Do not force the pipette tip too far into the well as this will separate the plastic casing around the gel and let your sample diffuse into the surrounding buffer. This will cause the entire gel to fail.

6. Run the gel at 150V until the blue tracking dye gets close to the very bottom of the gel (about 30 to 45 minutes).

35

Gel staining

7. After electrophoresis, place your gel into a microwavable tray containing about 100 mL of distilled water, and microwave for 90 seconds without a lid.

8. Discard the water and repeat step 24.

9. Add distilled water to fully cover your gel and transfer the tray onto the waver for for 5 minutes under gentle agitation. Discard water from gel.

10. Use the pump dispenser to add just enough of the GelCode Blue Stain Reagent to cover your gel, and microwave without a lid for 1 minute or until the solution begins to boil. Do not let solution boil to evaporation.

11. Remove the tray from the microwave oven, put the lid on it and transfer the tray onto the waver for 5 min under gentle agitation.

12. To destain, discard staining reagent in the sink and replace with 200 mL of distilled water. Incubate on the orbital waver with the lid on for about 10 min or until bands become clearly visible.

13. Scan gels

Western Analysis

Theory: Allows better resolution of the protein bands than SDS PAGEo Protein transfer from polyacrylamide gels can be accomplished by

electrophoretic transfer that is done by placing the buffer-soaked gel-membrane "sandwich" between plate electrodes (semi-dry transfer).

Figure 1. Components of the semi-dry protein transfer sandwich.

36

o Use a a PVDF membrane with high binding capacity, 140-150 g/cm2 membrane, allowing for efficient protein retention.

o The immune probing of your MAT-tagged T7 RNA polymerase will be achieved with a primary monoclonal anti-MAT tag antibody able to bind with any protein containing the MAT epitope (HNHRHKH). Denaturing conditions are used to ensure full linearization and optimal exposure of the MAT tag for binding of the anti-MAT tag antibody (the MAT tag could remain concealed within the protein core under non denaturing conditions). You will be using a polyclonal secondary antibody raised against the constant or Fc fragment of the primary antibody that has been conjugated with alkaline phosphatase. This enzyme, which mediates the conversion of a colourless substrate into an insoluble blue product, is responsible for the colorimetric detection.

Figure 2. Detection of the recombinant MAT-taggedT7 RNA polymerase by western blotting. (A) Summary of the various steps in a western blotting procedure. (B) This cartoon is a zoom in of the antigen-antibody complex which is

37

representative of your western blot membrane at the end of the western blot procedure (step 7).D. Enzymatic activity of the T7 RNA polymerase

The T7 RNA polymerase catalyzes the synthesis of RNA in a 5’ to 3’ direction. T7 RNA polymerase is often used in molecular biology since it can synthesize RNA from any piece of DNA located downstream of its specific promoter, the T7 promoter. T7 RNA polymerase is relatively easy to assay as its activity doesn’t require any cofactors. The four essential reagents for assessing T7 RNA polymerase activity are:

o An enzyme source, which will be your recombinant T7 RNA polymerase

o A DNA template T7 RNA Polymerase exhibits extremely high specificity for its cognate promoter sequence. The DNA template to be used in a transcription assay for T7 RNA polymerase should therefore contain the T7 promoter motif, 5’ T AAT ACG ACT CAC TAT A 3’, upon which the T7 RNA polymerase can bind and initiate transcription. In this experiment, you will use a plasmid pre-digested with a restriction enzyme as the DNA template. The linearization of the plasmid DNA template is desirable to ensure that transcription can be terminated at a specific position and, therefore, ensure that all transcripts are the same length. In the lab, you will be provided with an open DNA template derived from a recombinant pBluescript vector whose transcription product should be approximately 1.8 kb.

o Free ribonucleoside triphosphates

o

Pyrophosphatase is added to remove inorganic pyrophosphate, a T7 polymerase inhibitor that is released during the transcription assay.

o (Optional) Ribonucleases inhibitor is facultative, but highly recommended for preventing the enzymatic degradation of the transcribed product.

o In the protocol that you will use, the transcription product will be assessed by agarose gel electrophoresis. Transcription activity will therefore be estimated based on the intensity of the RNA transcript visible on an agarose gel. In research labs, diethylpyrocarbonate (DEPC) is used to inactivate any contaminating ribonucleases, which will quickly digest your RNA transcript. Buffer and water are treated with DEPC before performing the transcription assay. However, since DEPC is toxic and volatile, our solutions won’t be treated with DEPC and therefore, you should be extremely careful while preparing your enzymatic assay. Samples collected during the enzymatic

38

assay should always be kept on ice. You should also proceed quickly when loading your agarose gel with your RNA samples.

Procedure:

Part A: Electrophoresis of the purification samples on SDS-PAGE gel

You will be using a pre-cast gradient gel with 4-20% acrylamide.

1. Prepare aliquots for electrophoresis by mixing them with an equal volume of 2X Sample Loading.

Lane Sample Sample volume

(L)

2X Loading buffer

(L)

Loading volume

(L)1 Rainbow marker (7.5ug/5ul) - - 52 Input control, 10 g or a maximum of 12.5 L3 Flowthrough control, 10 g or a maximum of 12.5 L4 Wash1 control, 1 g or a maximum of 12.5 L5 Wash2 control, 1 g or a maximum of 12.5 L6 Purified protein, 0.5 g or a maximum of 12.5 L7

-8- --------------------------Blank: cut zone-------------------------- -------- ----------- -----------9

10 Rainbow marker (7.5ug/5ul) - - 511 Input control, 50 g or a maximum of 12.5 L12 Flowthrough control, 50 g or a maximum of 12.5 L13 Wash1 control, 10 g or a maximum of 12.5 L14 Wash2 control, 10 g or a maximum of 12.5 L15 Purified protein, 0.5 g or a maximum of 12.5 L

Table 1. Loading sequence on SDS-PAGE gel

2. Refer to steps 23-30 of Experiment D in lab 6 for details on the preparation and staining of SDS-PAGE.

At the end of the electrophoresis, place the gel on a clean surface and cut it at Well #8 with a blade. The first part of the gel corresponding to Lanes 1 to 7 will be transferred to the PVDF membrane whereas the second part of the gel (Lanes #9 to 15) will be stained using the Gel code blue staining reagent.

39

Part B: Electrophoretic semi-dry protein transfer

3. Carefully remove the piece of the gel dedicated to the transfer and place it in a plastic dish containing 50 mL of Transfer Buffer (25mM Tris, 192mM glycine, pH 8, 20% methanol). Wash with gentle shaking for 15 minutes.

4. Meanwhile, cut a piece of PVDF membrane the same dimensions (6 cm x 5 cm) as your gel. You should cut one corner of the membrane diagonally so that you can orient the membrane correctly after transfer. Prepare the membrane for transfer as follows:

a. Soak the membrane in methanol for a few seconds. The colour will change from opaque white to uniform, translucent gray. Be careful working with the methanol as it is toxic. Do not get any methanol on exposed skin and wipe up any spills immediately.

b. Soak the membrane in distilled water for at least 2 minutes.c. Soak the membrane in transfer buffer for at least 10 minutes.

The membrane should not be allowed to dry out during any of the above hydration steps. If any drying occurs (opaque areas appear on the membrane), perform quick rinses as in steps 4a-c above. Handle the membrane on the edges with forceps at all times!! Finally, make sure to smooth out any air bubbles between each layer of the transfer assembly. Air bubbles will prevent efficient transfer of the proteins and will make subsequent analysis difficult.

5. Transfer will be carried out using the BioRad Transblot semi-dry transfer unit. The unit is large enough to

simultaneously accommodate four SDS-PAGE gels.

40

6. Assemble the Trans Blot Semi-Dry Transfer System as follows:a. Load the bottom of the transfer unit (the platinum anode) with

two sheets of filter paper pre- in the Transfer Buffer and cut to the same size as your membrane. Be careful not to introduce any air bubbles.

b. Roll a pipette or glass rod over the surface of the paper to exclude all air bubbles that would interfere with ionic conductivity and protein transfer.

c. Place your pre-soaked PVDF membrane on top of the filter paper and roll out any air bubbles.

d. Carefully lift the gel from the transfer buffer, place it on top of the membrane and roll a pipette or test tube over the gel to make sure that good contact is achieved with the membrane.

e. To complete this 'sandwich' put a piece of transfer buffer-saturated filter paper on top of the gel and remove any air bubbles.

f. Place the cathode of the transfer unit on top of the stack, being careful not to disturb the stack.

g. Place the safety cover on the unit and connect the cables (these are colour-coded, too).

7. Transfer is done at 0.3A for 45 minutes.

8. Turn off the power supply, remove the cover and carefully peel off the upper layer of filter paper and the gel, without the membrane.

9. Rinse the membrane two times for 5 min in a plastic dish with 50 mL of TBS + 0.05% Tween20. Maintain gentle agitation during the rinses.

If the transfer was successful, the colored markers should be visible on the membrane.

10. At this point the transfer membrane can be sealed wet in a plastic bag and stored at 4°C for a week.

Completion of the western blot analysisBlocking membrane

11. Recuperate your membrane and transfer it to a plastic dish with 50 mL of blocking buffer (TBST, 5% non-fat dry milk). Put your plastic dish onto the waver and incubate for 30 min with gentle mixing. (TBST: 20mM Tris, 150mM NaCl, pH 7,4 + 0.05% Tween20)

12. Wash the membrane with 50 mL of wash buffer (TBST) for 5 min with gentle mixing. Discard the wash buffer and repeat the wash two more times.

Primary anti-MAT antibody binding

41

13. A 5000X dilution of the commercial anti-T7 RNA polymerase antibody (Novagen) has already been prepared by the Support Staff. Place the membrane on a Ziplock bag and pipette all 3 mL of the pre-diluted primary antibody (TBST) onto the protein side of the membrane. Carefully push out all air bubbles between the membrane and close the bag. Place the bag with your membrane onto the waver for 1 hr, but gently massage the bag content with your fingers every 10-15 min to ensure complete mixing.

14. Discard the antibody/buffer solution and transfer the membrane to a plastic dish.

15. Wash the membrane with 50 mL of wash buffer (TBST) for 5 min with gentle mixing. Discard the wash buffer and repeat the wash two more times.

Binding of secondary rabbit anti-mouse IgG conjugated with alkaline phosphatase

16. A 3000X dilution of the commercial secondary antibody has already been prepared by the Support Staff. Place the membrane in a new baggie (refer to step 3) containing 3 mL of the pre-diluted secondary antibody (TBST) and put on the waver for 1 hour. Again gently massage the bag every 10-15 min.

17. Decant and discard the antibody/buffer. Transfer the membrane to a plastic dish.

18. Wash the membrane with 50 mL of wash buffer (TBST) for 10 min with gentle mixing. Discard the wash buffer and repeat three more times.

19. Rinse the membrane with 50 mL of distilled water for about 30 sec. Discard water and repeat the rinse procedure one more time. Discard the water of the second rinse.

20. Apply 5 mL of Western Blue® Substrate and monitor the appearance of the blue bands. Reaction takes about 30 sec to 10 min. Longer reaction times will result in higher background. The reaction can be stopped at any time by quickly decanting the Western Blue Substrate and substituting it with distilled water. You can rinse with water one or two more times to completely remove the Western Blue® Substrate.

21.

Part C: Optimization of the T7 RNA polymerase enzymatic assay

42

Figure 4. Examples of enzymatic assay. In A), four individual reactions are prepared. One reaction will be kept on ice as a To control. The remaining three reactions will be placed in a water bath at 37°C. At each specific time point (T1 to T3), one reaction will be taken out of the water bath and placed on ice to stop the reaction. In the second method (B), 3 to 5 reactions are combined in one tube to create a master reaction. Before you start the incubation, a 5 to 10 L aliquot is taken and transfered to a new tube on ice which is pre-labeled (T0). The master reaction is then transferred to a water bath at 37°C. At each time point, you will take a 5-10 L aliquot and transfer it to a new tube. You should notice that all aliquots should be kept on ice.

General Guidelines for the Transcription Assay

Mixture for one in vitro transcription assay with a final volume of 10L 75 ng of DNA template (1 L @ 75 ng/L) 2.0 L of 5X Transcription buffer (120mM MgCl2, 10mM spermidine,

200mM DTT, 400mM Tris pH 8.0) 1.25 L of 10mM NTP mix (Invitrogen) 0.5 L of RiboLock RNase inhibitor (40U/L) (Fermentas) 0.5 L of Pyrophosphatase 100U/mL 0.05-0.1 g of T7 RNA polymerase source per reaction Complement to 10 L with water

1. Incubate @ 37°C for up to 30 min.

43

2. Remember that each time you take an aliquot or take out a reaction from the water bath, you should immediately mix with 10X Loading Buffer.

3. Keep all your reaction on ice until you have collected all your samples.

4. Proceed to electrophoresis and take a picture of your agarose gel.

TransfectionTheory:

o Transfection is the process of deliberately introducing nucleic acids into cells. The term is often used for non-viral methods in eukaryotic cells.[1] It may also refer to other methods and cell types, although other terms are preferred: "transformation" is more often used to describe non-viral DNA transfer in bacteria, non-animal eukaryotic cells, including plant cells. In animal cells, transfection is the preferred term as transformation is also used to refer to progression to a cancerous state (carcinogenesis) in these cells. Transduction is often used to describe virus-mediated DNA transfer.

o One of the cheapest methods uses calcium phosphate. HEPES-buffered saline solution (HeBS) containing phosphate ions is combined with a calcium chloride solution containing the DNA to be transfected. When the two are combined, a fine precipitate of the positively charged calcium and the negatively charged phosphate will form, binding the DNA to be transfected on its surface. The suspension of the precipitate is then added to the cells to be transfected (usually a cell culture grown in a monolayer). By a process not entirely understood, the cells take up some of the precipitate, and with it, the DNA. This process has been a preferred method of identifying many oncogenes.

o Electroporation

ELISA (Enzyme-Linked Immunosorbent Assay) Method

Theory:ELISA uses colour changes to identify a substance’s prescence

44

SI UnitsLength: meter (m)

Mass: kilogram (kg)Time: second (s) [lower case]Electric current: ampere (A)Amount of substance: mole (mol)

SI prefix SI symbol

Decimal value 10x

(scientific) value

pico- p 0.000000000001 10-12

nano- n 0.000000001 10-9

micro- µ 0.000001 10-6

milli- m 0.001 10-3

centi- c 0.01 10-2

deci- d 0.1 10-1

(no prefix)

1 100

deca- da 10 101

hecto- h 100 102

kilo- k 1,000 103

mega- M 1,000,000 106

giga- G 1,000,000,000 109

tera- T 1,000,000,000,000

1012

45

Absorbance

Beer-Lambert Law:

Where A is the absorbance at a specific wavelength, Io is the intensity of incident light, It is the transmitted intensity, is the absorption coefficient at the specified εwavelength, c is the concentration of compound and l is the path length of the cell (cuvette).

Percent Error and Yield

Molar Ratios for Ligations

Add ratio of insert to vector (e.g. 10:1)

Bacterial competence (example)

You did a transformation with your new stock of competent cells. You used 10 ng of plasmid and you got 100 colonies on your petri dish. Knowing that you only plated 1/10 of your transformed bacteria, what is the level of competency of your bacterial stock?

With 10 ng, you get 100 colonies but this is only 1/10 of the transformation and therefore, you have to multiply by the dilution factor (10x).

46

100 colonies X 10 (dilution factor) for 10 ng

1000 colonies for 10ng or 100000 colonies for 1 g or 105 colonies/g

Making Agrose Gel and TAE buffer

1% Agarose gel casting

1. If necessary, prepare 1 liter of 1X TAE buffer using the 25X stock solution available. Write down your name and the preparation date on the flask.

2. In a 500 mL Kimax flat bottle (see figure) prepare 100 mL of 1% (weight/volume) agarose in 1X TAE buffer.

3. To prevent evaporation, the plastic lid should be loosely added mto the bottle, but not tightened.

Tightening the lid could lead to pressure buildup into the bottle during heating and possible explosion.

4. Microwave until the agarose is completely dissolved in 3 x 30 sec pulses. Do not allow the agarose to boil over!

5. Allow the agarose solution to cool down to 50-55˚C (if the agarose is too hot it will warp the gel mold).

6. Add 10 L of the 10000X stock SYBR Safe per 100 mL of gel.

7. Pour the agarose solution slowly into a casting tray fitted with a 20-well comb. Dislodge any bubbles.

8. The gel should be ready (cooled, hardened and translucent) in about 30 min.

9. Once the gel has hardened, remove the comb carefully. Pouring a little buffer on the surface of the gel around the comb can help.

10. Transfer the gel into the electrophoresis tank and add 1X TAE buffer up to 5mm above the gel upper surface – the gel should be completed covered.

For 1 litre of 25X TAE buffer 121g Tris base (2-amino-2-hydroxymethyl-propane-1,3-diol)

47

28.6 mL glacial acetic acid 50 mL 0.5M Na2EDTA (pH 8.0) Add H2O up to 1000 mL

Clontech Nucleospin PCR Clean-up system(DNA purification by affinity chromatography)

1. Combine your DNA sample with 2 volume of the NTI buffer and mix thoroughly.

2. Place a Nucleospin PCR Clean-up column into a 2 mL collection tube.

3. Apply your sample to the Nucleospin PCR Clean-up column.

4. Centrifuge for 30 sec at 11,000 x g. Discard the flow-through and return the column to the collection tube. Your PCR amplicon is now attached to the silica column. However there are also contaminants present that need to be removed.

5. To remove these contaminants from your PCR amplicon, add 700 L of the NT3 buffer to the column and centrifuge for 30 sec at 11,000 x g.

6. Discard the flow-through and place the column back in the same tube. Add again 700 L of the NT3 buffer and centrifuge for 30 sec at 11,000 x g.

7. Discard the flowthrough and return the column to the collection tube, being careful not to wet the bottom of the column with the flowthrough. Centrifuge again for 1 min at 11,000 x g to evaporate any ethanol residue on the column. It is crucial to eliminate residual ethanol left inside the column since it will prevent or lower the solubilization of DNA in water and, therefore, lower the amount of DNA that can be eluted.

8. Place the column in a clean 1.5 mL micro centrifuge tube (with a cap attach to it) and add 30 L of NE buffer directly onto the center of the membrane. (Be careful not to touch the membrane with the tip of the pipette.) Incubate your Nucleospin PCR Clean-up column at RT for 1 min (this step is really important to permit the complete desorption and resolubilization of your DNA), and then centrifuge for 1 min at 11,000 x g to elute your DNA.

9. Discard the column and keep the 1.5 mL microcentrifuge tube containing your purified DNA.

48

Chromatin Immunoprecipitation (ChIP)

Theory:Chromatin immunoprecipitation (ChIP) is the technique used to identify and

characterize the DNA motifs onto which transcription factors can bind, that is the transcription factor binding sites (TFBS). ChIP is particularly interesting as it can directly assess protein-DNA interactions under in vivo conditions. This means that ChIP results are truly representative of what happens inside the cells rather than inside plastic reaction tubes such as for conventional in vitro studies. ChIP can also be combined to high throughput sequencing such as displayed on the diagram below. The main steps of a ChIP proctocol are:

Infiltration of the cells with formaldehyde to crosslink DNA-binding proteins onto DNA.

Figure adaptée de EMBO, 2008

DNA is extracted and sheared usually by sonication, which involves an exposure to ultrasound frequencies above 20kHz, to release fragments of 300-1000bp in length.

DNA fragments can be further digested with nuclease(s) to remove as much as possible the unprotected DNA. This step ensures better quality results by cutting out the unbound DNA ends located on each side of the immediate TFBS.

Cell debris in the sheared lysate is then cleared by centrifugation. The protein–DNA complexes, which remain in suspension in the supernatant, are incubated in presence of antibodies that can specifically bind onto the protein(s) or transcription factor(s) of interest. There are several protocols that can easily separate or immunoprecipitate the antibody-protein complexes.

The DNA-binding proteins crosslinks can be reversed to release the DNA targets.

The DNA fragments can then be analysed and sequenced using different techniques, but high-throughput sequencing has now become a common practice owing to lower sequencing costs.

The DNA sequences or the reads can then be aligned to visualize the binding position of transcription factors along chromosomal DNA.

49

It is a common practice to proceed with a single antibody that can bind onto one specific DNA-binding protein. For such a scenario, the sequencing results correspond to the different DNA motifs (TFBS) onto which a given transcription factor of interest can bind. Further alignment analysis can be done to identify a consensus of the different DNA motifs recognized by a single transcription factor of interest.

50

Recommended