killer vegetables, animal-human hybrids, other scary stuff

killer vegetables, animal-human hybrids, other scary stuff.

Chapter 1: Epistasis for beginners

KEVIN HIOM

Galway 2010

Basic principles of DT40

DT40: A genetically tractable eukaryotic cell line

DT40• Genetically tractable• Good model for genome stability in mammals• Complementation by human genes• Good database

versus humans

Genetically tractable DT40

All these require manipulation of the genome

Phenotypic analysisKnocking out or mutating genes and looking at cellular function

Mapping genetic pathwaysCombining mutations- epistasis

Structure/function analysis/ cell biologyComplementation, proteomics

Genetic regulationReporter assays

Integrate DNA

Target DNA

Alter DNA

Remove DNA

*

*

Random Integration- non homologous end joining

Targeted Integration- Homologous/Homeologous recombination

Site specific recombination

Genetic Recombination is our tool

Non Homologous End Joining-Random integration

AdvantagesSimpleRelatively high frequency

Potential uncharacterised genetic effectMultiple integrationShut down of expression

Disadvantages

Ku, DNA-PKcs, LigIV,

Homologous recombination- site specific integration, gene disruption, mutation

DNA End ResectionMre11/RAD50/NBS1, CtIP, Exo1

Strand InvasionRAD51

ResolutionSlx1/4, GEN1

Branch MigrationRAD51BCDHolliday Junctions

Homologous recombination

Homologous Recombination

Advantages

Acurate/error free Introduction of multiple changes

DisdvantagesEasy to introduce errorsAberrant recombinationNeighbouring sequencesEpistasis difficult for HR genes

Site specific recombination- cre/lox

ATAACTTCGTATAGCATACATTATACGAAGTTAT

LOXP

Site specific recombination- re-using antibiotic resistance

Cre recombinase

drugr

synapsis

excision

Site specific recombination

Courtesy of the National Library of Medicine (NLM)

Understanding recombination is the key to manipulating the DT40 genome

3 copies of chromosome 2

Genomes are ‘plastic’- Don’t culture for too long

Words of warning