J Zhu et al. Nature 000 , 1-4 (2013) doi:10.1038/nature12110

View
12
Download
0
Category

Documents

Preview:

DESCRIPTION

Tissue residence and effector function of DEJ CD8 aa + T cells in post-healed tissue. J Zhu et al. Nature 000 , 1-4 (2013) doi:10.1038/nature12110. - PowerPoint PPT Presentation

Citation preview

J Zhu et al. Nature 000, 1-4 (2013) doi:10.1038/nature12110

Tissue residence and effector function of DEJ CD8+ T cellsin post-healed tissue.

J Zhu et al. Nature 000 , 1-4 (2013) doi:10.1038/nature12110

Documents

Published in Nature Materials (2016) doi:10.1038/nmat4569

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

DOI: 10.1038/NGEO2405 Moist convection in hydrogen

DOI: 10.1038/NMAT3074 Maltodextrin based imaging … · and in vivo SUPPLEMENTARY INFORMATION DOI: 10.1038/NMAT3074 ©

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

doi:10.1038/nature05202 LETTERS

doi:10.1038/nature05150 LETTERS

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3245 Supplementary Figure 6 Effect of shared controls on conditional posterior probability of association with disease

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS

SUPPLEMENTARY INFORMATION - media.nature.com · doi: 10.1038/nmat4795 1 1 s 1)

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor

Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128

Neuropsychopharmacology (2013) 38 , 2150-2159; doi:10.1038/npp.2013.112

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria