Introduction to Synthetic Biology

Preview:

DESCRIPTION

Introduction to Synthetic Biology. Dannenberg and Purdy 2012 (Tokos edits 2012). What is Synthetic Biology?. https://www.youtube.com/watch?v=rD5uNAMbDaQ. ELECTRICAL engineering solution. water = weight water

Citation preview

Introduction to Synthetic Biology

Dannenberg and Purdy 2012

(Tokos edits 2012)

What is Synthetic Biology?

• https://www.youtube.com/watch?v=rD5uNAMbDaQ

ELECTRICAL engineering solution

water = weight water<weight

MECHANICAL engineering solution

BIOLOGICAL engineering solution

BIOLOGICAL engineering solution

PCR

Genetic Engineering

Sequencing

rDNA

A LIVING HOUSE - Terreform’s Fab

Tree Hab

• How is Synthetic Biology Different? Synthetic biology uses four principles not typically found in genetics, genomics, or molecular biology: abstraction, modularity, standardization, and design and modeling.

Abstraction:

• Abstraction - you can use parts/devices/systems without having to worry about how they work.

• DNA makes parts. • Parts into devices.• Devices connected to make

systems.

Modularity:

• parts, devices and systems - connected as self-contained units and combined in any combination you want

Standardization:

• All the “Tab A’s” fit into all the “Slot B’s.”

• An everyday example - all light bulbs fit into any socket!

Designing and modeling

• build a model

• test the devices capacity – improves design – tests basic biological assumptions that

could be false

Registry of Standard biological Parts

• http://partsregistry.org/Main_Page

DNA is DNA

• E. Coli is our chassis – Can use parts from any organism– Can use parts made by a computer

Abstraction Hierarchya human invention designed to assist people in engineering complex systems

Sequences of DNA encode “parts”

Assemblies of parts make up devices

Assemblies of devices make a system

“Part” – sequence of DNA with human defined function

AAAATGCACCCGCTGTCGATCAAACGCGCGGTGGCGAATATGGTGGTCAACGCCGCCCGTTATGGCAATGGCTGGGTCAAAGTCAGCAGCGGAACGGAGCCGAATCGCGCCTGGTTCCAGGTGGAAGATGACGGTCCGGGAATTGCGCCGGAACAACGTAAGCACCTGTTCCAGCCGTTTGTCCGCGGCGACAGTGCGCGCACCATTAGCGGCACGGGATTAGGGCTGGCAATTGTGCAGCGTATCGTGGATAACCATAACGGGATGCTGGAGCTTGGCACCAGCGAGCGGGGCGGGCTTTCCATTCGCGCCTGGCTGCCAGTGCCGGTAACGCGGGCGCAGGGCATGACAAAAGAAGGGTAATCTAGAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGCC

Parts assembled into Devices

AAAATGCACCCGCTGTCGATCAAACGCGCGGTGGCGAATATGGTGGTCAACGCCGCCCGTTATGGCAATGGCTGGGTCAAAGTCAGCAGCGGAACGGAGCCGAATCGCGCCTGGTTCCAGGTGGAAGATGACGGTCCGGGAATTGCGCCGGAACAACGTAAGCACCTGTTCCAGCCGTTTGTCCGCGGCGACAGTGCGCGCACCATTAGCGGCACGGGATTAGGGCTGGCAATTGTGCAGCGTATCGTGGATAACCATAACGGGATGCTGGAGCTTGGCACCAGCGAGCGGGGCGGGCTTTCCATTCGCGCCTGGCTGCCAGTGCCGGTAACGCGGGCGCAGGGCATGACAAAAGAAGGGTAATCTAGAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGCC

Parts assembled into Devices

AAAATGCACCCGCTGTCGATCAAACGCGCGGTGGCGAATATGGTGGTCAACGCCGCCCGTTATGGCAATGGCTGGGTCAAAGTCAGCAGCGGAACGGAGCCGAATCGCGCCTGGTTCCAGGTGGAAGATGACGGTCCGGGAATTGCGCCGGAACAACGTAAGCACCTGTTCCAGCCGTTTGTCCGCGGCGACAGTGCGCGCACCATTAGCGGCACGGGATTAGGGCTGGCAATTGTGCAGCGTATCGTGGATAACCATAACGGGATGCTGGAGCTTGGCACCAGCGAGCGGGGCGGGCTTTCCATTCGCGCCTGGCTGCCAGTGCCGGTAACGCGGGCGCAGGGCATGACAAAAGAAGGGTAATCTAGAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGCC

Device to System

Plasmids and Transformation

Now for the Good Part(2009 Cambridge iGEM Team)

The Problem

• Toxins contaminate the environment

• Detection can be expensive and complicated

• Can cheap bacteria be used as toxin indicators that change color in response to toxin levels?

The Color-Generating Device

• Contain violacein pigment devices(ORF from Chromobacterium violacein)

Genes re-engineered to produce purple and green in E. Coli

• If all 5 genes in the ORF are expressed - purple pigment produced

• If third gene in ORF sequence is removed - green pigment produced

The Chassis

• To a Synthetic Biologist

=Escherichia coli

Bacterial transformation of Escherichia coli

• Two different strains of E. coli (4-1 & 4-2)• Two different plasmids (pPRL & pGRN)

• Can we expect the devices to behave the same in each Can we expect the devices to behave the same in each strain, or will the chassis have an effect on the intensity strain, or will the chassis have an effect on the intensity of color produced?of color produced?

Creation of a Bacterial Cell Controlledby a Chemically Synthesized Genome

Dan Gibson, +21, Ham Smith and Craig Venter

Science (2010) 329: 52

PCR for watermarks

M. mycoides genome

transplanted to M. capricolum

Creation of a Bacterial Cell Controlledby a Chemically Synthesized Genome

Dan Gibson, +21, Ham Smith and Craig Venter

Science (2010) 329: 52

New Directions: The Ethics of Synthetic Biology and Emerging Technologies

December 2010

Presidential Commissionfor the Study of Bioethical Issues

Recommended