View
1
Download
0
Category
Preview:
Citation preview
[CANCER RESEARCH 51. 1460-1464. March I. I99I|
Interstitial Chromosomal Deletion within 4qll-ql3 in a Human HepatomaCell Line1
Yoshio Urano,2 Kazutada VVatanabe/ C. C. Lin, Okio Hiño,and Taiki Tamaoki4
Department of Medical Biochemistry. L'nirersity of Calgary, Colgar); Alhena T2.\ 4,\I, Canada />'. Õ'..A'. H'., T. T./; Department of Pathology anil Lahoraton-Medicine, I'niveraitr of Alberta, Edmonton, Alhena TMi 2R7, Canada /('. C. L.J; and Department o/ 'Pathology. Cancer Institute. Toshimu-ku, Tokyo 170,
Japan /(). li.J
ABSTRACT
Southern blot analysis revealed the presence of an aberrant albumingene as »ellas a normal one in a human hepatoma cell line, I lui 1-7. Agenomic sequence carrying this altered gene was isolated and characterized. This clone contains a 3-kbp 3' segment of the albumin gene linked
to a non-albumin sequence at intron 11. The non-albumin sequence isassigned to chromosome 4q 12-q13 by in situ hybridization. I his indicatesan interstitial deletion of a chromosomal segment within 4qll-ql3 because the albumin gene is mapped there. The truncated albumin gene isdetected in an early passage of Mull-" cells and has been maintained
stably in cell culture.
INTRODUCTION
HCC* is a common adult tumor in regions of the world where
persistent HBV infection is endemic. HBV infection has beenfound to be an important risk factor for HCC (1) although theexact mechanism by which HBV acts in carcinogenesis remainsunclear (2, 3). Activated cellular oncogenes in various humantumors have been detected by DNA-mediated transfection assays using NIH 3T3 mouse fibroblasts (4, 5). An oncogeneactivated in common among HCCs has not been determined,although three types of sequences capable of inducing malignanttransformation in mouse cells have been isolated from humanprimary HCCs (6-10).
A variety of human tumors are also characterized by specificchromosomal deletions, suggesting that loss of tumor suppressor loci (antioncogenes) is important in the pathogenesis ofthese malignancies (11). Recent studies have detected loss ofheterozygosity of restriction fragment length polymorphismsin HCCs as well. The allelic loss in HCCs has been reportedfor loci on chromosomes 4q, 1Ip, 13q, 16q, and 17p (12-16),and the possible presence of a suppressor gene for HCC hasbeen suggested on chromosome 4q (14).
In humans, the albumin and AFP genes are present in tandem, about 14.5 kbp apart, on chromosome 4ql l-ql3 (17, 18).We have been studying the structure and regulation of thesegenes in a human hepatoma cell line, HuH-7 ( 19). In this paper,we show that the albumin gene is rearranged in this cell line.We isolated and characterized a genomic clone carrying theaberrant albumin gene. The results revealed an interstitial deletion of a chromosomal segment within 4qll-ql3, supporting
Received 10/4/90: accepted 12/19/90.The costs of publication of this article were defrayed in part by the payment
of page charges. This article must therefore be hereby marked advertisement inaccordance with 18 t!.S.C. Section 1734 solely to indicate this fact.
1This work was supported b> the National C'aneer Institute of C'anada. the
Medical Research Council of Canada, and Japan Inumino Research Laboratory.Inc.
•Present address: Department of Dermatology. University of Tokushima.
Tokushima 770. Japan.' Present address: Department of Biochemical I.ngineering and Science. Kyu
shu Institute of Technology, li/nk.i. Fukuoka 820. Japan.4Tt) whorn requests for reprints should be addressed, at Department ot Medical
Biochemistry. University of Calgary. Calgary. Alberta T2N 4NI. C'anada.5The abbreviations used are: HCC'. hepatocellular carcinoma: AFP. n-fctopro-
tein; IIBV. human hepatitis B \irus: kbp. fcilobase pairs: cDNA. complementanDNA.
the possibility that a tumor suppressor locus is present near thealbumin gene.
MATERIALS AND METHODS
Cells. A human hepatoma cell line, HuH-7 (kindly supplied by Drs.J. Sato and H. Nakabayashi. University of Okayama, Japan), wasmaintained in a serum-free medium (19). HuH-7 DNA was extracted
from cells of 50 passages and 990 culture days, unless otherwise noted,or 13 passages and 263 culture days, when described as in an earlystage. DNA from a human B-lymphoblastoid cell line. 6.1.6 (20), wasused as a control. Four subclones of the HuH-7 cell line were isolatedat 55 passages and 1095 culture days.
Albumin cDNA and Genomic Clones, phalb-7. a human albumincDNA clone, and XHAL-H14, a human albumin genomic clone, aredescribed elsewhere (18, 21). AHAL-4WU. a genomic clone carrying arearranged human albumin gene, was isolated from a genomic libraryconstructed from a partial I-~ct>Rldigest of HuH-7 DNA. Various
restriction fragments of the genomic clones were subcloned intopBR322 for further analysis. pHAL-H14-Hind6.0 is a subclone of a6.0-kbp Hindlll fragment of AHAL-H14. pHAL-4Vv U-Ecol.5 andpHAL-4\VU-Eco7.5 are subclones of 1.5-and 7.5-kbp Ea>R\ fragmentsof XHAL-4WU, respectively.
Heteroduplex Analysis. The 7.5-kbp EcoRl fragment (0.1 ¿ig)ofpHAL-4WU-Eco7.5 was labeled at the 5' end with (^-"PjATP using
T4 polynucleotide kinase (Bethesda Research Laboratories), mixed witheither the 6.0-kbp //indi 11fragment (2 ^g) of pHAL-H14-Hind6.0 orsheared salmon sperm DNA (2 *jg), denatured in 0.3 M NaOH and 1HIMEDTA at 37°Cfor 15 min, neutralized with HC1. and kepi at room
temperature overnight. The mixture was treated with mung bean nu-clease (Pharmacia) in 30 niM sodium acetate (pH 4.8), 50 niM NaC'l, ImM ZnCN. 5rr glycerol. and denatured salmon sperm DNA (200 ^g/
ml). The protected fragment was recovered by ethanol precipitationand analyzed on a 1 alkaline agarose gel.
Southern Blot Analysis. Southern blot hybridization (22) was carriedout at 65°Covernight in 50 mM Tris-HCl (pH 8.0), 1 M NaCI, 10 mMEDTA, 0.l'i sodium dodecyl sulfate and 10 x Denhardt's solution(23) containing a probe labeled with [«-"PJdCTP by the "oligo-label-ing" method (24) after prchybridization in 3 x 0.15 M NaCl-0.015 Msodium citrate and IO x Denhardt's solution for 2 h. Washing was
done in 0.2 x 0.15 M NaCl-O.OI5 M sodium citrate and 0.1% sodiumdodecyl sulfate at 65°C.
In Situ Hybridization. The 1.5-kbp £ioRl fragment of pHAL-4WU-Ecol.5 was labeled to a specific activity of 10*cpm/^g with |'H] dCTPand ['HjdATP by the "oligo-labeling" method (24) and used as a probe.
Chromosome preparation, in situ hybridization, and chromosome identification were performed according to the procedure of Lin et al. (25).
DNA Sequencing. DNA sequence was determined by the procedureof Maxam and Gilbert (26).
RESULTS
Detection of an Aberrant Albumin Gene Sequence in HuH-7.Southern blot analyses of £foRI digests of human liver and6.1.6 human B-lymphoblastoid cell DNAs using a human albumin cDNA. phalb-7, as a probe revealed two bands 10 kbpand 1.5 kbp long (Fig. 1, Lanes 2 and 3). Similar analysis ofHuH-7 human hepatoma cell DNA detected three bands, a 7.5-kbp band in addition to the two bands described above (Fig. 1,
1460
on June 5, 2020. © 1991 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from
DELETION OF CHROMOSOME 4qtl-ql.1 IN A HEPATOMA CELL LINE
kb
23 -
9.5-
6.7-
4.3-
2.2-
1.9-
Fig. I. Detection of the aberrant albumin gene in HuH-7 hepatoma cells.EcoRl digests of DNAs from a hepatoma cell line. HuH-7 (Lane /). human liver(Lane 2). and a human B lymphoblastoid cell line. 6.1.6 (Lane 3). were analyzedusing a human albumin cDNA. phalb-7. as a probe by the method of Southernblot analysis (26). kb, kilobase pairs.
Lane 1). HuH-7 DNA digested with HindlU also yielded anextra 4.5-kbp band not present in ///'«dill digests of normal
liver DNA (data not shown).In order to determine which part of the phalb-7 sequence was
contained in the 7.5-kbp EcoRl or the 4.5-kbp HindUl band,we conducted Southern blot analyses of EcoRl digests and///wdlll digests of HuH-7 DNA using four different fragmentsof phalb-7 as probes (Fig. 2, probes A, B, C, and D). Probes A,B, and C hybridized to both the 7.5-kbp EcoRl and 4.5-kbpHindlU bands, but probe D did not hybridize to either. Normalbands, on the other hand, were detected by all probes. Theseresults suggested that one alÃeleof the albumin gene in HuH-7hepatoma is rearranged at a region between the Pstl (P,) siteand the Sstl site (see the bottom diagram of Fig. 2). To furtherdelimit the region of rearrangement we conducted Southernblot analysis using a 2.0-kbp Pst\ (P,-P:) genomic fragment asa probe (probe E). No extra bands were detected in both EcoRland HindlU digests of HuH-7 DNA (Fig. 2£).This indicatesthat the site of recombination resides between the Pstl (P:) andSstl sites.
Isolation and Characterization of a Genomic Clone Carryingthe Altered Human Albumin Gene. To isolate the altered albumin gene sequence we screened a genomic library constructedfrom a partial EcoRl digest of HuH-7 DNA using probe C.Three positive clones were isolated. One of them, AHAL-4WU,did not hybridize to probe E. Digestion of this clone with EcoRlreleased five fragments 1.5, 1.8 , 2.0, 2.7, and 7.5 kbp long.Only the 7.5-kbp fragment, the size of which corresponded tothat of the extra band found by Southern blot analysis of EcoRldigests of HuH-7 DNA. hybridized to probes B and C (data notshown). This fragment was subcloned into pBR322 for furtheranalysis. Restriction sites of this subclone, pHAL-4WU-Eco7.5, were compared with those of the corresponding segment of the normal albumin gene (pHAL-H 14-Hind6.0), which
1234 234 1234 I 2 3 1234
kb
9.5- ;
5 Hp BB 1II/'
SsH1
1^53'.aOObp.X
Albumin locus |EH Hp EEIII II
BB
,1kb.
HP, PiI
SsI
EH
Cop poly AXHAL-H14
Fig. 2. Southern blot analysis of the aberrant albumin sequence using various albumin probes. EcoRl (Lanes I and 2) and //indi 11(Lanes .?and 4) digests of HuH-7 (Lanes I and J) and 6.1.6 (Lanes 2 and 4) DNAs were analyzed using four albumin cDNA fragments (A, B. C. and D) and one albumin genomic fragment (E) asprobes. The human albumin cDNA clone, phalb-7 (18. 21, 28). and a genomic clone. XHAL-H14. are drawn relative to the albumin gene. Five probes (A. B. C, D,and E) used in Southern blot analysis are shown by horizontal arrows. B, BgK\: E, EcoRl: II, HindUl; /"/and P.\ Pstl; Ss, Sstl: Hp. Hpalll; kh, kilobase pairs; poly A,polyadenylate; bp, base pairs.
1461
on June 5, 2020. © 1991 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from
DKIFTION Ol CHKOMOSOMh: 4qll gli IN A HF.PATOMA CELL LINE
PHAL-4WU-ECO 75S K
22 —
PPKA
pHAL-HI4-Hindfi.O
XHAL-HI4
Fig. 3. Comparison of restriction maps between the normal and aberrantalbumin genes. Top, genomic clone carrying the aberrant albumin gene sequence.XHAL-4WU. A finer restriction map of pHAl.-4\VU-Eco7.5. a subclone of the7.5-kbp AVoRI fragment of XHAL-4\\T!. is compared with that of pHAI.-HI4-I lindo.!), a subclonc of the 6.0-kbp///'ndlII fragment of AHAL-H14 which carries
the normal albumin gene sequence. •exons II. 12. and 15 of the albumin gene.Horizontal arrows, strategy for DNA sequencing. A. Aval: E, EcoRl. H. //mdl II:/// HinfÃ;Up, llpaìl:K, Kpnl, S, Sstl; X, Xha\: Xh, Xho\. All Hind sites exceptone used for DNA sequencing are omitted, kh, kilobase pairs.
B
kb
23 -
9.5-
6.7-
4.3-
2.2-
1.9-
resistant to the nuclease digestion was formed (Fig.4.-l, Lanes 3and 4), indicating that the 3.0-kbp regions of both fragmentshad identical DNA sequences. A control sample in whichsalmon sperm DNA replaced the 6.0-kbp ///«dill fragmentexhibited no nuclease-resistant band (Fig. 40).
DNA Sequences Surrounding the Rearrangement Site. Todetermine the site at which the albumin gene sequence wasaltered we analyzed nucleotide sequences surrounding the rightmost Ava\ site of the normal and altered albumin clones (Fig.5).DNA sequences were identical up to 98 nucleotides upstreamof the Aval site between the two clones. DNA sequences upstream of this point were completely different. The site ofsequence alteration was flanked by a 58-base pair alternatingpurine-pyrimidine stretch, consisting primarily of G and T, andan Alu sequence (27). Whether or not these sequences played arole in the generation of the altered albumin gene is not clearat present. The matched nucleotide sequence has been found inintron 11 of the albumin gene (28).
Detection of the Albumin Gene Rearrangement in Hull" Cells
at an Early Stage of Culture. A question arises as to when therearrangement of the albumin gene took place in the hepatoma.Since we were unable to obtain the primary hepatoma lesionfrom which the HuH-7 cell line was established, we examinedHuH-7 cells at an early stage of in vitro culture (13 passagesand 263 culture1 clays) and four subclones derived from the cells
of 55 passages and 1095 culture days for the presence of theaberrant albumin sequence. Southern blot analysis using ihe2.0-kbp Xbal-lùvRl fragment of pllAL-4WU-Eco7.5 (a normal genomic region in the rearranged albumin gene) as a probeshowed that the hepatoma cells of the early stage and all (hesubclones examined carried the normal ( 10 kbp) and rearranged(7.5 kbp) hands in almost an equal amount (Fig.6).
Chromosome l.ocali/alion of the Non-Albumin SequenceLinked to the Truncated Alhuinin (¿ene.To determine whichchromosome carried the non-albumin sequence linked to thealbumin sequence in XHAI.-4WU we conducted ;'/; situ hybrid
ization analysis (Fig.7). We chose the 1.5-kbp luwRl fragmentmost distal to the breakpoint (see Fig. 3) as a probe because all
AAGTGTTCTCTCrTTTATfTACTATGTTAGArAGTTTCTTCCCTTCCTCAAAACACA/V.-W.'/
N TGACTTCTTTTTTKAI,,XT ATTAGTTO.TTACAITAAI.AAAl.TAITKAA(,TCTfAA(TfCAACTfTTGTAOAGGTCTC""
N IAACAAACCTACCAAAACTCCCCACCAAATCTTCTAAACATCCTCAACCAAAAACAATCCCCTCTGCACAACACTAI^TCAA: TTCCAGTTCCAGTCAGATGAACCGGGTACCTCGGTTGGAAÕTCCAGAG
Fig. 4. Ilei* ....ii'i'l. M.i!' i ot the ,i.. ii .in albumin titile. A mixture of the.V . n.n.,1.. i, ,i 7.5-khp £VoRIfragment of pHAl.-4\Vll-Eco7.S and either the6.0 kh|)///m!lll fragment of pHAI.-ll 14 Himlh.O M ) or sonicated salmon spermDNA («)was denatured in alkaline, remmired, and treated with O.I (Lune I), I(Lane .'), 10 (/.am- .•(•or 100 units (l.ane •/)ol mung bean nuclease i he nueleaseresistant fragments were si/ed un a l'i alkaline agarose gel. kh, kilohase pairs.
hybridi/ed to probes B and C (Fig.3). Identical restriction mapswere found in the 3-kbp region on the 3' side of the DNAbetween the rightmost Aval site and the 3' end. The region
upstream of the Ava\ site, on the other hand, showed entirelydifferent maps.
The identity of the 3-khp segment on the 3' side of the DNA
was confirmed by a heteroduplex analysis using mung beannuclease (Fig.4). Hcteroduplexes were constructed between the6.0-kbp ///«dill fragment of pHAL-HI4-Hind6.0 and the 5'end-labeled 7.5-kbp EcoRl fragment of pHAL-4WU-Eco7.5and treated with mung bean nuclease. A 3.0-kbp fragment
GfCTTTAAAAAAATATAATAAATTAATAATUAAAAATTTTACCTTIAGATATTCATAATGfTAMTTTCAT«A(.fAGAA
ATCACCIGTCTTCTGTGTCCATCACCCTGGGAGCTGCTGACTGAACGTGTTCCTATtrCGCCACCfi-iitatiflrPuriacMrrriMriir
r.GAAGTAATGTCTGTGTGTCCATCmGTGTGfATGTGTGTGTGCATCrAfGTGTGTGTATCTGTCATATTGGCAGTCAA
Aval AlustyucnccGGCCCCGAGGATGATAAmnTTTUm TTTGAGAC6GAOrCTCGCTTTGTTGTCCAGGCTGGAGTGCAGTCGIGfCA
rCTCCGCTCACTCrAAIIKIUlTillACl.nrAAGCCATTCTCfTCCCTCAGffTfCrAACTAtrrCGAACTACAGCr
;CATGCC»CCATGCCTGGCIAATTTTTTGTATTTTTAGTACAjMAITTTC«crnCACCTCTTTItAATTTrTGfTfTCC
N TGCCTGTTCTTTACJCTATCCCTCCTCCTGAACCACHATCTCTCTTCCATCACAAAACCCCACTAACTCACACACTCA
Fig. S. Nucleolide sequences surroundinc the rearraniiemeni site. The mielentide sequence of the aberrant gene (A} is compared with lhal of the normalalhumin yene (.V). A ilul denotes an identical nucleolide. Exons 11 and 12 of the,11..im11,yene, an alternating purine p>riniidine streich, and an Alu sequence are
Ixi.ml. ()nl> a pan of e\on 12 is shown. Sequencing strategies are shown in Fig.3,
1462
on June 5, 2020. © 1991 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from
DELETION OF CHROMOSOME 4qll-ql.l IN A HEPATOMA CELL LINE
other EcoRl fragments of AHAL-4WU contained repetitivesequences (data not shown). Sixty-eight metaphase spreads thatshowed hybridization signals (grains) on chromosomes wereanalyzed. A total of 100 grains were located on specific chromosomal regions in these metaphase spreads. Fifteen % of thegrains were found at band 4ql2-ql3. The maximum number ofgrains located on other chromosome regions was 3%. Theseobservations indicated that the non-albumin sequence was located on chromosome 4ql2-ql3.
DISCUSSION
The isolation and characterization of a genomic clone carrying the aberrant albumin gene from HuH-7 cells revealed alinkage of albumin and non-albumin sequences in intron 11 ofthe albumin gene. In situ hybridization experiments assignedthe non-albumin sequence to chromosome 4ql2-ql3. Since thehuman albumin gene is mapped at 4ql l-ql3 (17), these resultsindicate an interstitial deletion of a chromosomal segmentwithin 4ql l-ql3 in HuH-7 cells. The deleted segment must belost from the cells because the albumin cDNA probe, whichextended beyond the rearrangement site upstream, detectedonly one extra band in both EcoRl and Hindlll digests. Deletions of DNAs in chromosomes 4q, lip, 13q, 16q, and 17phave been shown in human HCCs (12-16, 29, 30). Buetow etal. (14) have reported that five of five primary HCCs constitutionally heterozygous for the albumin locus examined show lossof an alÃelefor albumin. These results and ours suggest that asuppressor oncogene for HCC may be located in the vicinity ofthe albumin gene. The genomic clone carrying the rearrangedalbumin sequence reported in this paper may prove to be usefulin identifying the suppressor oncogene.
I
kb
23 -
9.5-6.7-
4.3-
2.2-1.9-
l'i •indi i •i M i h m I'll •<i !•¿mm\ 'ifritüÕÉii< •!u
ii
CHROMOSOME
19 2
NUMBER
Fig. 7. Chromosomal localization of the aberrant albumin gene by in situhybridization. Histogram showing the distribution of the silver grains on chromosome regions. Sixty-eight metaphase spreads were analyzed and a total of 100grains were located and recorded. The highest percentage (15%) of grains wasfound on chromosome 4ql2-ql3.
Southern blot analysis revealed the alteration of the albumingene in HuH-7 in an early stage of;«vitro culture (13 passagesand 263 culture days) and in all the subclones examined. Theamount of the rearranged alÃelein these cells was almostidentical to that of the normal alÃele(see Fig. 7), indicating thatthe abnormal alÃeleis present in all cells. These results suggestthat the deletion of the albumin locus took place in vivo and isnot an in v/fro-produced phenomenon. Since the rearrangedalÃelehas been maintained stably in the established cell line, itis possible that cells carrying the alteration may have a growthadvantage in vitro. This is compatible with the observationsthat all informative HCC samples show allelic loss of thealbumin locus (14).
Gross chromosomal rearrangements, such as translocationand deletion, have been reported near sites of HBV integrationin HCC DNAs (29-33). We could not detect HBV DNAsequences in HuH-7 or the clones carrying the truncated albumin gene by Southern blot hybridization (data not shown). Theserum of the patient from whom the HuH-7 cell line was derivedwas negative for both human hepatitis B virus surface antigenand antibodies against human hepatitis B virus surface antigen.6
Thus, HBV infection does not seem to be necessary for theinduction of the genomic alteration described above althoughthe possibility of HBV acting in a "hit-and-run" fashion (34)
cannot be ruled out.The formation of the aberrant gene shown here results in a
decrease in the albumin gene dose. In some hepatomas, such asHuH-7, albumin expression is repressed while AFP expressionis elevated (19, 35, 36). Whether the observed genomic rearrangement is causally related to the high and low expressionof the AFP and albumin genes, respectively, remains to beinvestigated.
ACKNOWLEDGMENTS
We thank Dr. A. G. Knudson and Dr. K. H. Buetow for their interestin this work and Dr. J. Sato and Dr. N. Nakabayashi for the supply ofHuH-7 cells.
Fig. 6. Detection of the aberrant gene in HuH-7 cells of an early stage of invitro culture and subclones. The EcoRl digests of HuH-7 DNAs from 1.1passagesand 263 culture days (Lane I) and from four subclones (Lanes 2-5) isolated at55 passages and 1095 culture days were analyzed using the 2.0-kbp Xhal-EcoRlfragment of pHAL-4WU-Eco7.5 (see Fig. 3) as a probe. Note that the intensityof the two bands in each lane is almost the same, kb, kilobase pairs.
REFERENCES
I. Beasley, R. P., Hwang. L. Y., Lin, C. C., and Chien, C. S. Hepatocellularcarcinoma and hepatitis B virus. A prospective study of 22,707 men in
1H. Nakabayashi and K. Taketa, personal communication.
1463
on June 5, 2020. © 1991 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from
DELETION OF CHROMOSOME 4qll-ql.l IN A HEPATOMA CELL LINE
Taiwan. Lancet. 2: 1129-11.VI. 1981. 20.2. Tiollaris. P.. Pourcel. C.. and Dejean. A. The hepatitis B virus. Nature
(Land.). 317: 489-495. 1985. 21.3. Popper. H.. Shafritz. D. A., and Hoofnagle. J. A. Relation of the hepatitis B
virus carrier state to hepatocellular carcinoma. Hepatology, 7; 764-772,1987. 22.
4. Pulciani. S.. Santos, E.. Lauver, A. V., Long, L. K., Aaronson. S. A., andBarbacid. M. Oncogenes in solid human tumors. Nature (Lond.), 300: 539- 23.542. 1982.
5. Pulciani, S.. Santos, E., Lauver. A. V.. Long. L. K.. Robbins. K. C., and 24.Barbacid. M. Oncogenes in human tumor cell lines: molecular cloning of atransforming gene from human bladder carcinoma cells. Proc. Nati. Acad.Sci. USA. 79: 2845-2849. 1982. 25.
6. Ochiya. T., Fujiyama. A.. Fukushige. S.. Hatada. !.. and Matsubara. K.Molecular cloning of an oncogene from a human hepatocellular carcinoma.Proc. Nati. Acad. Sci. USA. 83: 4993-4997, 1986. 26.
7. Nakagama. H.. Ohnishi. S.. Imawari. M.. Hirai. H.. Takaku. F.. Sakamoto,H.. Terada, M.. Nagao. M., and Sugimura. T. Identification of transforming 27.genes as hsl in DNA samples from two human hepatocellular carcinomas.Jpn. J. Cancer Res.. 78:651-654, 1987.
8. Vuasa. Y., and Sudo. K. Transforming genes in human hepatomas detected 28.by a tumorigenicity assay. Jpn. J. Cancer Res., 78: 1036-1040, 1987.
9. Gu, J. R.. Hu. L. F.. Cheng. Y. C.. and \Van, D. F. Oncogenes in humanprimary hepatic cancer. J. Cell. Physiol. Suppl.. 4: 13-20, 1986.
10. Hatada. I.. Tokino. T.. Ochiya, T.. and Matsubara. K. Coamplification of 29.integrated hepatitis B virus DNA and transforming gene hst-\ in a hepatocellular carcinoma. Oncogene, 3: 537-540. 1988.
11. Knudson. A. G. Hereditary cancer, oncogenes. and antioncogenes. CancerRes., 45: 1437-1443. 1985. 30.
12. Smith, M., Hiroshige. S.. and Murray. J. Evidence in human hepatomas forstructural chromosome changes and alteration in the expression of genes inthe region 4q21-4q27. Am. J. Hum. Genet.. 39: A220. 1986.
13. Wang, H. P., and Rogler. C. E. Deletions in human chromosome arms lip 31.and I3q in primary hepatocellular carcinomas. Cytogenet. Cell Genet.. 48:72-78. 1988.
14. Buetow. K. H.. Murray. J. C.. Israel. J. L.. London. W. T.. Smith. M.. Kew. 32.M., Blanquet, V., Brechet. C.. Redeker. A., and Govindarajah. S. Loss ofheterozygosity suggests tumor suppressor gene responsible for primary hepatocellular carcinoma. Proc. Nati. Acad. Sci. USA, 86: 8852-8856. 1989.
15. Zhang. \V.. Hirohashi, S.. Tsuda. H.. Shimosato, V.. Yokota, J.. Terada, M.. 33.and Sugimura. T. Frequent loss of heterozygosity on chromosomes 16 and 4in human hepatocellular carcinoma. Jpn. J. Cancer Res.. 81: 108-111, 1990.
16. Bressac. B.. Galvin. K. M.. Jake Liang, T., Isselbacher, K. J.. Wands. J. R.. 34.and Ozturk, M. Abnormal structure and expression of p53 gene in humanhepatocellular carcinoma. Proc. Nati. Acad. Sci. USA, 87: 1973-1977,1990.
17. Human Gene Mapping 10. Cytogenet. Cell Genet., 51: 121-136, 1989. 35.18. Urano. Y., Sakai, M.. Watanabe. K.. and Tamaoki. T. Tandem arrangement
of the albumin and «-fetoprotein genes in the human genome. Gene, 32:255-261. 1984.
19. Nakabayashi. H., Taketa. K.. Miyano, K., Yamane. T., and Sato, J. Growth 36.of human hepatoma cell lines with differentiated functions in chemicallydefined medium. Cancer Res.. 42: 3858-3863, 1982.
Gladstone. P.. and Pious. D. Stable variants affecting B cell alloantigens inhuman lymphoid cells. Nature (Lond.). 271: 459-461. 1978.Urano. Y., Watanabc. K.. Sakai. M.. and Tamaoki. T. The human albumingene. Characterization of the 5' and 3" flanking regions and the polymorphicgene transcript. J. Biol. Chem.. 261: 3244-3251. 1986.Southern. E. M. Detection of specific sequences among DNA fragmentsseparated by gel clectrophoresis. J. Mol. Biol.. 98: 503-517, 1975.Dcnhardt. D. T. A membrane-filter technique for the detection of complementary DNA. Biochem. Biophys. Res. Commun., 23: 641-646. 1966.Feinberg. A. P.. and Vogelstein. B. A technique for radiolabelling DNArestriction endonuclease fragments to high specific activity. Addendum Anal.Biochem.. 137: 266-267. 1984.Lin. C. C.. Draper, P. M., and De Braekeleer. M. High-resolution chromosomal localization of the /i-gene of the human li-globin complex by in situhybridization. Cytogenet. Cell Genet.. 39: 269-274. 1985.Maxam. A. M.. and Gilbert. W. Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol.. 65: 499-560. 1980.Deininger. P. L.. Jolly. D. J.. Rubin, C. M.. F'riedmann. T.. and Schmid. C.
W. Base sequence studies of 300 nucleotide renatured repeated human DNAclones. J. Mol. Biol.. 151: 17-33. 1981.Minghetti, P. P.. Ruffner. D. E.. Kuang. W. J.. Dennison. O. E., Hawkins,J. W'., Beatties. W. G.. and Dugaiczyk. A. Molecular structure of the humanalbumin gene is revealed by nucleotide sequence within qll-22 of chromosome 4. J. Biol. Chem.. 261: 6747-6757, 1986.Rogler. C. E.. Sherman. M.. Su. C. Y., Shafritz, D. A., Summers, J., Shows,T. B.. Henderson. A., and Kcw. M. Deletion in chromosome 1Ip associatedwith a hepatitis B integration site in hepatocellular carcinoma. Science(Washington DC), 230: 319-322. 1985.Pasquinelli. C.. Garreau. F., Bougeuleret, L., Carfani, E. Grzeschik, K.H..Thiers, V.. Croissant. O.. Hadchouel. M.. Tiollais. P.. and Brecho!. C.Rearrangement of a common cellular DNA domain on chromosome 4 inhuman liver tumors. J. Virol.. 62: 629-632. 1988.Hiño,O.. Shows, T. B., and Rogler. C. E. Hepatitis B virus integration sitein hepatocellular carcinoma at chromosome 17:18 translocation. Proc. Nati.Acad. Sci. USA. 83: 8338-8342. 1986.Tokino. T.. Fukushige. S.. Nakamura. T., Nagaya, T., Murotsu, T.. Shiga.K., Aoki. N.. and Matsubara. K. Chromosomal translocation and integratedhepatitis B virus in hepatocellular carcinomas. J. Virol.. 61: 3848-3854,1987.Koch. S.. Freytag von Loringhoven. A.. Hofschneidcr. P. H.. and Koshy, R.Amplification with integrated hepatitis B virus DNA. EMBO J.. 3: 2185-2189, 1984.Galloway. D. A., and McDougall, J. K. The oncogcnic potential of herpessimplex viruses: evidence for a 'hit-and-run' mechanism. Nature (Lond.).J02.-2I-24, 1983.Schwarz. M., Peres. G.. Beer. D. D.. Maor. M.. Buchmann, A., Run/, W.,and Pilot. H. C. Expression of albumin messenger RNA detected by in situhybridization in preneoplastic and neoplastic lesions in rat liver. Cancer Res.,46: 5903-5912. 1986.Breborowicz. J.. and Tamaoki. T. Detection of messenger RNAs of n-fetoprotein and albumin in a human hepatoma cell line by in situ hybridization. Cancer Res.. 45: 1730-1736. 1985.
1464
on June 5, 2020. © 1991 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from
1991;51:1460-1464. Cancer Res Yoshio Urano, Kazutada Watanabe, C. C. Lin, et al. Hepatoma Cell Line
q13 in a Human−Interstitial Chromosomal Deletion within 4q11
Updated version
http://cancerres.aacrjournals.org/content/51/5/1460
Access the most recent version of this article at:
E-mail alerts related to this article or journal.Sign up to receive free email-alerts
Subscriptions
Reprints and
.pubs@aacr.orgDepartment at
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Permissions
Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)
.http://cancerres.aacrjournals.org/content/51/5/1460To request permission to re-use all or part of this article, use this link
on June 5, 2020. © 1991 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from
Recommended