Integrated gene prediction for eukaryotic and prokaryotic ... · May 2012 – PLUME –...

May 2012 – PLUME – Erika.Sallet@toulouse.inra.fr

Integrated gene prediction for eukaryotic and prokaryotic genome

using EuGène

Erika Sallet, Jérôme Gouzy, Brice Roux, Delphine Capela, Laurent Sauviac, Claude Bruand, Pascal Gamas and Thomas Schiex

Journée PLUME Biologie

Terminology: eukaryotic gene structure

Structural annotation of prokaryotic genomes

►Sequencing technology gives access to prokaryote transcriptome

►Need to reconsider prokaryotic genome annotation taking into account such data

►Already used in eukaryote gene prediction

RNA-seq

► Strong gene density in prokaryotic genomes

RNAseq reads not so informative ?

Apollo view (Lewis SE et al Genome Biology 2002)

Oriented RNA-seq

Informative signal to detect transcription

EuGène http://eugene.toulouse.inra.fr

► Integrative modular eukaryotic gene finder

► Integrates different kinds of evidence such as: Statistical properties of region Known protein similarity, EST (Expressed Sequence Tag)

► Extensible and generic software

►Artistic license

► Forge https://mulcyber.toulouse.inra.fr/projects/eugene

►Contributors

Created by Thomas Schiex (INRA, Applied Mathematics and Informatics) in 1999

8 different developers

Current EuGène team = 3 members

►Users

Intended for bioinformaticians

We are the main user of EuGène

►Genome annotation of M. truncatula, S. lycopersicum,

A. thaliana, fungi (Botrytis cinerea, …), M. incognita, …

EuGène http://eugene.toulouse.inra.fr

Eukaryotic gene

►= A sequence of “regions” separated by “sites”

EuGène eukaryotic automaton

How does EuGène work ? ► Transforms a nucleic sequence into a graph ► Edits/weights it according to biological & statistical evidence

CATGACGTAGGCCTACGTGCACATGCAAGCTAC CCTACGTGCACATGCAAGCTAC

How does EuGène work ?

► Transforms a nucleic sequence into a graph ► Edits/weights it according to biological & statistical evidence

► Transforms a nucleic sequence into a graph ► Edits/weights it according to biological & statistical evidence ► A gene structure = a path in the graph ► The prediction = an optimal path in the graph

From eukaryote to prokaryote

EuGène prokaryote automaton

► Prokaryotic genomes:

Protein genes on both strands (possibly overlapping)

Transcribed regions (operon)

RNA genes (possibly antisense)

Integrating evidence

► Translation starts

Ribosome hybridation energetic model (1)

►Transcription

Based on the expression level of RNAseq data

► Transcription start

Simple signal processing of RNAseq data

► Segmentation of transcription profiles G. Rigaill, S.

Robin. An exact Algorithm for the Segmentation of NGS Profiles Using Compression

1) FrameD: a flexible program for quality check and gene prediction in prokaryotic genomes and noisy matured eukaryotic sequences T Schiex, J Gouzy, A Moisan, and Y de Oliveira Nucl. Acids. Res. 2003 31: 3738-3741.

► Sinorhizobium meliloti Nitrogen fixing bacteria Symbiosis with legumes (ex : M. truncatula) 6.69 Mb (62% GC)

► EuGène « recipe » to annotate the genome 19 RNAseq oriented libraries (48Gb)

►Paired-end and single-end Solexa reads ►6 triplicates ►3 biological conditions

Results of BlastX vs SwissProt and Sm1021 RNAmmer and tRNAscanSE results IMM (Interpolated Markov Model)

Application to Sinorhizobium meliloti Sm2011

Prediction strand +

Lib 2 long inserts

Lib1 short inserts

Lib2 short inserts

Lib 1 long inserts

Prediction strand -

Operon CDS UTRs

►Results of the EuGène prediction 6 367 protein coding genes

►135 new (compared to Sm1021)

►Covering 87.35% of the genome

1 969 ncRNA genes (54 tRNA, 9 rRNA) ►Covering 2.98% of the genome

►Published ncRNA (Valverde 2008): 76/140 found

►Antisense ncRNA candidate

88.8% of the genome is annotated (86,5% previously)

Overall

Many thanks

►ANR Symbimics projects participants:

Pascal Gamas (coordinator)

Brice Roux, Claude Bruand, Delphine Capela, Laurent Sauviac, Nathalie Rhodde

►“EuGène team” members

Thomas Schiex and Jérôme Gouzy

http://eugene.toulouse.inra.fr

Integrated gene prediction for eukaryotic and prokaryotic ... · May 2012 – PLUME –...

Documents

1 Environmental Economics The Agrofood Chain, Unit S2M18 Alban THOMAS thomas@toulouse.inra.fr

Prokaryotic Cell

Osceola’s Plume

Plume Classification

The Cell. Prokaryotic v. Eukaryotic Cells Prokaryotic Cell Cell membrane Cytoplasm Nucleus Organelles Eukaryotic Cell Section 7-1 Prokaryotic and Eukaryotic

Structureof Prokaryotic Eukary

Plume characteristics

Prokaryotic eukaryoticgenome

Prokaryotic Cells. Prokaryotic Cell Shapes Bacillus Coccus Spirillus

Questions of the Day Eukaryotic or Prokaryotic? Prokaryotic or Eukaryotic?

Mantle Plume

2.2 prokaryotic cells

Cellular Structure and Organization€¦ · Prokaryotic Cell Features Prokaryotic cell organization is a characteristic of the kingdoms Eubacteria and Archaebacteria. Prokaryotic

Prokaryotic Regulation:

Fire Plume

Transcription Prokaryotic

Prokaryotic DNA Replication - RUA: Principal€¢ Prokaryotic DNA Replication ... DNA is proofread during the process Termination of replication ... Comparison prokaryotic vs eukaryotic

Prokaryotic transcription

Bounds Arc Consistency for Weighted CSPs · Christine Gaspin Christine.Gaspin@toulouse.inra.fr Simon de Givry Simon.DeGivry@toulouse.inra.fr Thomas Schiex Thomas.Schiex@toulouse.inra.fr

Prokaryotic Cells. Kingdom Protista Plantae Fungi Animalia Protista Monera prokaryotic eukaryotic