View
2
Download
0
Category
Preview:
Citation preview
Insights into Glomerular Cell Biology in Health and Disease
by
Tamadher Alghamdi
A thesis submitted in conformity with the requirements for the degree of the Doctor of Philosophy
Institute of Medical Science University of Toronto
© Copyright by Tamadher Alghamdi 2019
ii
Insights into Glomerular Cell Biology
in Health and Disease
Tamadher Alghamdi
Doctor of Philosophy
Institute of Medical Science
University of Toronto
2019
Abstract
The integrity of the kidney glomerular filtration barrier relies on the health of its components,
which include podocytes forming the final layer of the filtration barrier, and endothelial cells
lining the glomerular capillaries. Both cell types are important for kidney development and
normal kidney homeostasis, and their injury is implicated in a range of kidney diseases, notably
diabetic kidney disease, the most common cause of kidney failure. Here, I used podocytes to
explore novel autophagic regulation and paracrine communication mechanisms. By examining
the phenotypic effects of JAK2 absence in podocytes, I identified a role for JAK2 in regulating
podocyte autophagy completion, specifically through regulating the expression of a master
regulator of lysosomal gene expression known as transcription factor TFEB. Since JAK2 has
garnered attention as a promising therapeutic target for the treatment of diabetic kidney disease, I
explored the effects of systemic JAK2 inhibition, and JAK2 deletion from podocytes in
experimental models of diabetes. Pharmacological inhibition of JAK2 prevented progression of
albuminuria and reduced urine excretion of the chemokine CCL2. Likewise, podocyte-specific
JAK2 knockout resulted in a marked reduction in urine excretion of CCL2, which was also
iii
enriched in culture media conditioned by podocytes exposed to high glucose. Podocyte secreted
CCL2 signaling via its receptor CCR2 induced glomerular endothelial activation, characterized
by VCAM-1 upregulation, through a pathway regulated by p38 MAPK, MSK1/2, and
phosphorylation of histone protein H3 on serine residue 10 (phospho-histone H3Ser10).
Moreover, increased phospho-histone H3Ser10 levels were observed in the kidneys of diabetic
endothelial nitric oxide synthase knockout mice and in the glomeruli of humans with diabetic
kidney disease. Collectively, these findings: i) identified the homeostatic actions of JAK2 in
podocyte autophagy, also raising the possibility that therapeutically modulating TFEB activity
may improve podocyte health in glomerular disease; ii) highlight the anti-inflammatory effects of
JAK2 inhibition and podocyte-specific JAK2 deletion in diabetes; and iii) demonstrate the
influence that histone protein phosphorylation may have on gene activation in diabetic kidney
disease.
iv
Acknowledgments
The completion of my doctoral research studies and dissertation would not have been possible
without the support of key mentors and remarkable individuals, whom I had the pleasure to learn
from and work with over the past few years.
First and foremost, I would like to express my heartfelt gratitude to my supervisor, my mentor,
and my lifelong teacher, Dr. Andrew Advani. No words, not even in my native language, can
describe how grateful and thankful I am for his guidance, excellent mentorship, and unswerving
support throughout my PhD journey. It has been an absolute pleasure to learn from him, and
observe him over the past few years wearing multiple hats—an outstanding scientist, a
remarkable physician, and an exceptional mentor. I am profoundly thankful for his mentorship
and for the countless opportunities throughout the years that helped me grow as a scientist, and
independent thinker. I also thank him for his patience, for always challenging me with his lofty
expectations, and for pushing me to be the best version of myself, academically and personally. I
thank him for his faith in me and for the doses of encouragement that helped me persevere even
when faced with adversities and uncertainty. Beyond my research, I thank him for the
opportunity to shadow him on multiple occasions in the Diabetes Clinic at St. Michael’s Hospital,
an experience that has been a constant reminder to not lose sight of the big picture, and of the
potential impact that scientific research can have on people’s lives. Under his mentorship, I have
been able to develop invaluable skills and achieve several milestones beyond what I could
imagine. My time in his lab has been instrumental in shaping my career aspirations, and I
genuinely value the great life lessons that came with his mentorship. I sincerely thank him for his
dedication and for his tremendous efforts throughout these years, without which this thesis would
not have come to fruition. Dr. Advani has been and will continue to be an excellent role model
for me and for aspiring clinician scientists.
I would like to extend my thanks to the members of my advisory committee, Dr. Minna Woo, and
Dr. James Scholey for their mentorship and guidance. I am genuinely thankful for their
continuous support, their insightful suggestions, constructive feedback, and for the fruitful
discussions during our committee meetings that ensured my progress and helped shaping my
thesis research. Their time and continuous support throughout my PhD studies are deeply
appreciated. Special thanks also go to Dr. Richard Gilbert, the Head of the Division of
Endocrinology at St. Michael’s Hospital in Toronto and Canada Research Chair in Diabetes
Complications, for reviewing my thesis and for his valuable comments and feedback. I would
also like to thank the members of my Final Oral Examination committee, Dr. Pedro Geraldes and
Dr. York Pei for their insightful feedback and for participating in my PhD thesis defense.
I would also like to convey my sincere gratitude to the wonderful members of Advani Lab for
their immense support and contributions to this thesis work. Specifically, I would like to thank
Bridgit Bowskill for teaching me excellent animal handling skills during my first year, and for
her indispensable help in maintaining the mouse colonies required for the in vivo studies. I also
thank her for always offering to help when I am overwhelmed and for being there to share a
v
laugh. I would also like to thank Suzanne Advani, also distinctively known as the Queen of
Histology, for sharing her passion for microscopy with me over the years, and for teaching me
about essential histological techniques that helped with the contents of this thesis. I also thank her
for always being supportive especially when the going gets tough, and for her dedication, all
while juggling work and family responsibilities. I would also like to thank Dr. Youan Liu for her
excellent assistance in maintaining cultured cells for the in vitro experiments. Her motherly hugs
and generous treats are deeply appreciated. I would also like to thank Dr. Golam Kabir for his
outstanding surgical skills and for the enjoyable conversations that made the long hours in the
OR so much fun. Outside the lab, I would like to thank the Advani family (Suzanne, Andrew,
Mathew, and Katie) for celebrating several milestones throughout the years, and for their
kindness and generosity. The international potluck and the annual lab Christmas party at their
house made the cold days in Toronto bearable.
Special thanks go to former and current post-doctoral fellows in the Advani Lab. In particular, I
would like to thank Dr. Sri Batchu, Dr. Syamantak Majumder, and Dr. Karina Thieme. I thank
each one of you for your unwavering support every step of the way. I am grateful to have been
able to conduct my PhD studies with such talented individuals who became dear friends. I thank
them for the countless intellectually stimulating discussions over coffee, and for teaching me a
range of excellent research skills and scientific techniques especially during the first few years of
my PhD. I also thank them for the opportunity to collaborate on several publications beyond my
thesis work. I would also like to thank Dr. Hana Vakili and Dr. Veera Ganesh Yerra for their
incredible support especially during the last two years of my PhD. I am also grateful for the
support of current and former graduate and summer students. Specifically, I would like to thank
my awesome friend Angela Brijmohan for being part of this journey. I truly enjoyed her company
at the bench and I thank her for her support throughout the years, and for making the long hours
in the lab and the late night experiments a wonderful time to show off our dancing skills. I would
also like to thank Ben Markowitz for his friendship, and for the great memories that I will always
cherish. I am also thankful for Mitchell Hadden for giving me a hand when I needed especially
during crunch time. I also thank my wonderful fellow PhD student Razan for always being
supportive and for her words of encouragement. To all my fellow graduate students at the Keenan
Research Centre for Biomedical Science, I thank you all dearly for helping me in one way or
another throughout this journey, whether it is through exchanging ideas, sharing lab equipment,
or engaging in social events.
I am thankful for the critical insights and the scholarly peer-review by several reviewers and the
editors of the Journal of the American Society of Nephrology and Diabetes that helped enhance
the quality of my thesis work. Sincere thanks go to our collaborators Dr. Laurette Geldenhuys
and Dr. Ferhan Siddiqi from Dalhousie University in Halifax, and Dr. Kathryn White from
Newcastle University in the UK. The contributions of our collaborators and their feedback during
manuscript revision are sincerely appreciated.
The generous support of the King Abdullah Foreign Scholarship Program and the Canadian
Institutes of Health Research that have made it possible for me to achieve my academic goals are
greatly appreciated. I would also like to thank the St. Michael’s Hospital research community and
the Institute of Medical Science at the University of Toronto for providing such a wonderfully
vi
rich academic and research experience. I also thank the Institute of Medical Science Students
Association (IMSSA) and the St. Michael’s Hospital Research Students Association for the
opportunity to take on several leadership positions to serve students, connect with my peers, and
engage in several events that enriched my academic experience beyond the lab.
Outside the lab, I have been blessed with a group of friends who have been my support system
over the past years. In particular, I would like to thank my dear friend Samah and her adorable
son Rashad for being part of this educational journey. I thank you for your incredible support and
for all the stress therapy and yoga sessions that shamefully did not count towards your psychiatry
residency training. I would also like to thank my dear friend Hanin, who has been more than just
a friend. Thank you for your unconditional support all the way from Kingston. Despite the
distance and being in the same boat with your own PhD studies, you have always been there for
me, and for that, I am deeply grateful. M5 friends, you know who you are! I thank every one of
you for your support, for finding every reason to celebrate my successes no matter how small, for
the wonderful adventures across Canada, and for everything you have done that made this
journey an exceptional one.
Most importantly, I am grateful for having a loving and caring family. My dear mother Norah
and my dear father Abdullah, I thank you for your unconditional love, support, and sacrifice.
Thank you for instilling in me the value of education, and for always supporting me to live up to
my potential even if it takes me away from you for a while. I also thank my dear brother Turki for
being my true inspiration to become a scientist, my dear sister-in-law Ameera for being my
cheerleader, and my precious little nephew Abdullah junior for being my source of joy. I am
indebted to my beloved brother Tameem for being the best companion since the beginning of my
educational journey in Canada. I could not have made it throughout these years without your love
and support. I also thank my dear cousin Rofan for the great times we had and for being by my
side during the most stressful times. Last, but not least, I would like to thank my one and only
loving sister Tasneem for being my best friend, for sharing my passion for science and education,
and for always finding a reason to make me laugh. Finally, my humble gratitude goes to God for
his endless blessings, and for giving me the strength to achieve this major milestone.
vii
To my late grandfathers,
May Allah rest their souls,
and to the people who have battled a chronic illness,
this work is dedicated to you.
viii
Table of Contents
Acknowledgments ......................................................................................................................... iv
Table of Contents ....................................................................................................................... xiii
Contributions .............................................................................................................................. xiii
Publications generated from thesis work ............................................................................... xviv
Other publications ...................................................................................................................... xvi
List of Tables .............................................................................................................................. xvii
List of Figures ........................................................................................................................... xviii
List of Abbreviations .................................................................................................................. xxi
List of Appendices .................................................................................................................... xxiv
CHAPTER 1: LITERATURE REVIEW .................................................................................... 1
1.1. Chronic kidney disease: scope of the problem .................................................................... 2
1.1.1. Prevalence and challenges .......................................................................................................... 2
1.2. Causes of chronic kidney disease ........................................................................................ 4
1.3. Diabetic kidney disease ....................................................................................................... 5
1.3.1. Pathophysiology of DKD ........................................................................................................... 6
1.3.1.1. Hyperglycemia ....................................................................................................... 8
1.3.1.2. Hemodynamic changes ........................................................................................ 10
1.3.1.3. Inflammation ........................................................................................................ 12
1.3.1.4. Growth factors and fibrotic factors ...................................................................... 13
1.3.2. Current available treatments for diabetic kidney disease .......................................................... 15
1.3.3. Emerging treatments for diabetic kidney disease ...................................................................... 16
1.3.3.1. The JAK/STAT pathway ...................................................................................... 16
1.3.3.1.1. Role of the JAK/STAT pathway in diabetic kidney disease ........................ 20
1.3.3.1.2. Development of JAK inhibitors ................................................................... 21
1.3.3.2. CCL2/CCR2 signaling pathway ........................................................................... 22
1.3.3.2.1. Development of CCL2/CCR2 blockers........................................................ 23
ix
1.4. Understanding podocyte (patho)biology: a key driver of therapeutic interventions for
glomerular diseases .................................................................................................. 24
1.4.1. Podocyte structure and function ............................................................................................... 25
1.4.2. Podocytopathies in glomerular diseases ................................................................................... 27
1.4.3. Podocytes and repair mechanisms ............................................................................................ 29
1.4.3.1. The autophagy-lysosomal pathway ...................................................................... 30
1.4.3.2. Role of TFEB: a major regulator of the autophagy-lysosomal pathway .............. 32
1.4.4. Podocytes as a model for paracrine communication ................................................................. 34
1.5. Glomerular endothelial cells .............................................................................................. 35
1.5.1. Podocyte-glomerular endothelial cell crosstalk ......................................................................... 37
1.5.1.1. Role of VEGF ....................................................................................................... 37
1.5.1.2. Other mediators of endothelial-podocyte communication ................................... 38
1.5.2. Glomerular endothelial dysfunction in DKD ............................................................................ 40
1.6. The emerging role of epigenetics in DKD......................................................................... 41
1.7. Research aims and hypotheses .......................................................................................... 44
CHAPTER 2: Janus Kinase 2 Regulates Transcription Factor EB Expression and
Autophagy Completion in Glomerular Podocytes ................................................................... 46
2.1. INTRODUCTION ............................................................................................................. 47
2.2. RESEARCH DESIGN AND METHODS ......................................................................... 48
2.2.1. Animal studies ........................................................................................................................... 48
2.2.1.1. Generation of Podocin-cre+R26Rfl/fl mice ......................................................... 48
2.2.1.2. Generation of podocyte-specific JAK2 knockout mice .................................... 48
2.2.2. β-Galactosidase expression ....................................................................................................... 49
2.2.3. Primary culture of podocytes .................................................................................................... 49
2.2.4. Immunoblotting ......................................................................................................................... 51
2.2.5. Immunofluorescence staining .................................................................................................... 51
2.2.6. Transmission electron microscopy ............................................................................................ 52
2.2.7. Conditionally immortalized mouse podocytes .......................................................................... 52
2.2.8. Real-Time PCR ......................................................................................................................... 52
2.2.9. Promoter Reporter Assay .......................................................................................................... 53
2.2.10. Chromatin Immunoprecipitation .......................................................................................... 53
x
2.2.11. Albumin Permeability Assay ............................................................................................... 53
2.2.12. Statistical Analyses .............................................................................................................. 54
2.3. RESULTS .......................................................................................................................... 54
2.3.1. Knockout of JAK2 from podocytes impairs autophagy completion in mice ............................ 54
2.3.2. JAK2 knockdown impairs autophagy completion in differentiated immortalized podocytes.. 61
2.3.3. JAK2 knockdown downregulates the transcription factor TFEB ............................................. 66
2.3.4. TFEB overexpression restores podocyte function after JAK2 knockdown .............................. 71
2.4. DISCUSSION .................................................................................................................... 73
CHAPTER 3: Podocyte-specific JAK2 Deletion and JAK Inhibition Have an Anti-
inflammatory Effect in the Diabetic Kidney ............................................................................. 78
3.1. INTRODUCTION ............................................................................................................. 79
3.2. RESEARCH DESIGN AND METHODS ......................................................................... 80
3.2.1. Animal studies ........................................................................................................................... 80
3.2.1.1. JAK inhibition study in streptozotocin (STZ)-diabetic eNOS-/- mice ............... 80
3.2.1.2. Generation of STZ-diabetic podocyte-specific JAK2 knockout mice .............. 80
3.2.2. Mesangial matrix index ............................................................................................................. 81
3.2.3. Cell culture studies .................................................................................................................... 82
3.2.4. Statistical analysis ..................................................................................................................... 82
3.3. RESULTS ................................................................................................................ 83
3.3.1. JAK2 inhibition attenuates albuminuria in STZ-diabetic eNOS knockout mice ...................... 83
3.3.2. JAK inhibition attenuates urine CCL2 excretion and mesangial matrix accumulation in STZ-
diabetic eNOS knockout mice ................................................................................................... 85
3.3.3. Podocyte-specific JAK2 deletion does not influence urine albumin excretion in STZ-diabetic
mice ........................................................................................................................................... 87
3.3.4. Podocyte-specific JAK2 deletion attenuates urine CCL2 excretion ......................................... 89
3.3.5. The chemokine CCL2 is enriched in culture media conditioned by podocytes exposed to high
glucose ....................................................................................................................................... 90
3.4. DISCUSSION .................................................................................................................... 92
CHAPTER 4: Histone H3 Serine 10 Phosphorylation Facilitates Endothelial Activation in
Diabetic Kidney Disease .............................................................................................................. 95
4.1. INTRODUCTION ............................................................................................................. 96
xi
4.2. RESEARCH DESIGN AND METHODS ......................................................................... 97
4.2.1. Cell culture ............................................................................................................................... 97
4.2.2. Immunoblotting ........................................................................................................... 98
4.2.3. Animal Studies ......................................................................................................................... 98
4.2.4. Chromatin Immunoprecipitation .............................................................................................. 99
4.2.5. Quantitative reverse transcriptase PCR .................................................................................... 99
4.2.6. Human tissue study ................................................................................................................. 100
4.2.7. In situ hybridization ................................................................................................................ 100
4.2.8. Statistical Analysis ................................................................................................................. 101
4.3. RESULTS ........................................................................................................................ 102
4.3.1. Podocyte-derived CCL2 promotes VCAM-1 upregulation in human glomerular endothelial cells
and knockout of the CCL2 receptor, CCR2 decreases glomerular VCAM-1 upregulation in
diabetic mice ............................................................................................................ 102
4.3.2. CCL2/CCR2 signaling controls glomerular endothelial cell VCAM-1 expression through p38
MAPK and MSK1/2 dependent pathways .............................................................................. 109
4.3.3. CCL2 induces histone H3 serine 10 phosphorylation, which is enriched at the VCAM-1
promoter in human glomerular endothelial cells and the Vcam-1 promoter in mouse kidneys
112
4.3.4. Histone H3 serine 10 phosphorylation is increased in murine and human diabetic kidney
disease ..................................................................................................................................... 114
4.4. DISCUSSION .................................................................................................................. 118
CHAPTER 5: SUMMARY AND LIMITATIONS ................................................................ 124
5.1. Summary of results .......................................................................................................... 125
5.2. Limitations ....................................................................................................................... 128
CHAPTER 6: GENERAL DISCUSSION AND FUTURE DIRECTIONS ......................... 136
6.1. TFEB and the autophagy-lysosomal pathway as potential therapeutic targets in kidney
disease .. ..................................................................................................................................... 137
6.2. Targeting inflammatory mediators for treatment of diabetic kidney disease ............................ 141
6.2.1. JAK2 as a therapeutic target for DKD .................................................................. 141
6.2.2. CCL2/CCR2 signaling as a therapeutic target for DKD ....................................... 145
6.3. Histone phosphorylation in DKD .............................................................................................. 148
xii
6.4. Conclusion ....................................................................................................................... 151
Appendices ................................................................................................................................. 152
List of primer sequences used in the studies. ......................................................................... 152
Copyright Acknowledgments ................................................................................................... 155
CHAPTER 7: REFERENCES ................................................................................................. 156
xiii
Contributions
Chapter 2:
T.A.A. designed and performed the experiments, analyzed the data, and wrote the manuscript.
S.M., K.T., and S.N.B. contributed to the experiments and generation of data, specifically Figure
2.4B and C, Figure 2.6C and E, Figure 2.8, Table 2.2, Table 2.3, Figure 2.9G, Figure 2.10, Figure
2.11A and E. K.W. contributed to the transmission electron microscopic data. Y.L. assisted with
the in vitro experiments. A.S.B. contributed to the immunofluorescence staining data presented in
Figure 2.9F. B.B.B assisted with the animal studies. S.L.A. contributed to the
immunohistological data presented in Figure 2.5. M.W. contributed to the in vivo data and
revised the manuscript. A.A. designed the experiments, supervised the study, and wrote the
manuscript.
Chapter 3:
T.A.A. designed and performed the experiments, analyzed the data, and wrote this chapter.
S.N.B. contributed to the data presented in Table 3.2. B.B.B. assisted with the animal studies.
S.L.A. assisted with the immunohistological experiments. A.A. designed the experiments,
supervised the study, and revised and edited this chapter.
Chapter 4:
T.A.A. designed and performed the experiments, analyzed the data, and wrote the manuscript.
S.N.B. contributed to the experiments, generation and analysis of the data presented in Figure
4.1B-D, Figure 4.3, and Figure 4.7. M.J.H. contributed to the immunohistochemical image
analysis presented in Figure 4.4B. V.G.Y. contributed to the experiments, generation and analysis
of the data presented in Figure 4.2. Y.L. assisted with in vitro experiments. B.B.B. assisted with
animal studies. S.L.A. contributed to the experiments and generation of data presented in Figure
4.5, 4.10D, and 4.11. L.G. and F.S.S. contributed to the human data presented in Figure 4.11.
S.M. contributed to data analysis and revised the manuscript. A.A. designed the experiments,
supervised the study, and wrote the manuscript.
xiv
Publications generated from thesis work
International peer-reviewed articles:
1. The study described in Chapter 2 was published and reproduced with permission from:
Alghamdi, T.A., Majumder, S., Thieme, K., Batchu, S.N., White, K., Liu,Y., Brijmohan,
A.S., Bowskill, B., Advani, S.L., Woo, M., Advani, A. (2017). JAK2 regulates
transcription factor EB expression and autophagy completion in glomerular podocytes.
The Journal of American Society of Nephrology. 28(9):2641-2653.
2. Table 3.2 in Chapter 3 and the study described in Chapter 4 were published and
reproduced with permission from: Alghamdi, T.A., Batchu, S.N., Hadden, M.J., Yerra,
V.G., Liu, Y., Bowskill, B.B., Advani, S.L., Geldenhuys, L., Siddiqi, F.S., Majumder, S.,
Advani, A. (2018) Histone H3 serine 10 phosphorylation facilitates endothelial activation
in diabetic kidney disease. Diabetes. 67(12): 2668-2681.
Abstracts:
1. Part of the results from Chapter 2 was presented as an abstract and received the first prize
for an oral presentation at the Annual Research Day, St. Michael’s Hospital, Toronto, ON,
Canada. (April 18th, 2016).
2. Part of the results from Chapter 2 was presented as a poster abstract at the Annual
Institute of Medical Science (IMS) Scientific Day at the University of Toronto, Toronto,
ON, Canada. (May 20th, 2016).
3. Part of the results from Chapter 2 was presented as a poster abstract (#SA-PO355) at
Kidney Week 2016, the Annual Meeting of American Society of Nephrology, Chicago,
IL, USA. (Nov 15-20, 2016).
4. The study described in Chapter 2 was presented as a manuscript for the Jack Laidlaw
Manuscript Competition in the format of a letter to “Nature: International Weekly Journal
of Science”. It was orally presented at the IMS50 Scientific Day and obtained the first
xv
prize of the Jack Laidlaw Manuscript Award for the best research paper from the
University of Toronto IMS, Toronto, ON, Canada. (May 9th, 2018).
5. Part of the results from Chapter 3 and 4 were presented as a poster abstract (#0095-PD)
and as an electronic poster selected for a moderated discussion at the World Diabetes
Congress, Vancouver, BC, Canada. (November 30th- Dec 4th, 2015).
6. Part of the results from Chapter 3 and 4 was presented as a poster abstract (#492-P) and
was selected for a moderated discussion at the 78th Scientific Sessions of the American
Diabetes Association, Orlando, FL, USA. (June 22-26, 2018).
xvi
Other publications
1. Batchu, S.N., Thieme, K., Zadeh, F.H., Alghamdi, T.A., Hadden, M.J., Majumder, S., Kabir,
M.G., Bowskill, B.B., Ladha, D., Klein, T., Gramolini, A.O., Connelly, K.A, Advani, A.
(2018). The dipeptidyl peptidase-4 substrate CXCL12 has opposing cardiac effects in young
mice and aged diabetic mice mediated by Ca2+ flux and phosphoinositide-3 kinase γ.
Diabetes. 67(11):2443-2455.
2. Majumder, S., Thieme, K., Batchu, S.N., Alghamdi, T.A., Bowskill, B.B., Kabir, M. G., Liu,
Y., Advani, S.L., White, K.E., Geldenhuys, L., Tennankore, K.K., Poyah, P., Siddiqi, F.S.,
Advani, A. (2018). Shifts in podocyte histone H3K27me3 regulate mouse and human
glomerular disease. Journal of Clinical Investigation. 128(1):483-499.
3. Brijmohan, A.S., Batchu, S.N., Majumder, S., Alghamdi, T.A., McGaugh, S., Liu, Y.,
Advani, S.L., Bowskill, B.B., Kabir, M.G., Geldenhuys, L., Siddiqi, F.S., Advani, A. (2018).
HDAC6 inhibition promotes transcription factor EB activation and is protective in
experimental kidney disease. Frontiers in pharmacology. 9:34
4. Thieme, K., Majumder, S., Brijmohan, A.S., Batchu, S.N., Bowskill B.B., Alghamdi, T.A.,
Advani, S.L., Kabir, M.G., Liu, Y., Advani, A. (2017). EP4 inhibition attenuates the
development of diabetic and non-diabetic experimental kidney disease. Scientific
Reports.13;7(1):3442.
5. Siddiqi, F.S., Chen, L.H., Advani, S.L. Thai, K. Batchu, S.N. Alghamdi, T.A. White, K.E.,
Sood, M.M. Gibson, I. W., Connelly, K.A. Marsden P.A., Advani, A. (2014). CXCR4
promotes renal tubular cell survival in male diabetic rats: implications for ligand inactivation
in the human kidney. Endocrinology. 156(3):1121-32.
xvii
List of Tables
Chapter 2
Table 2.1: Body weight, kidney weight and systolic blood pressure (SBP) in JAK2Ctrl and
JAK2podKO mice.
Table 2.2: Relative mRNA levels of genes involved in the fusion of autophagosomes with
lysosomes.
Table 2.3: Relative mRNA levels of likely direct targets of TFEB with a known role in lysosome
function in mouse podocytes transfected with JAK2 siRNA or scramble.
Chapter 3
Table 3.1: Functional characteristics of control and streptozotocin-diabetic (STZ) wildtype (WT)
and endothelial nitric oxide synthase knockout (eNOS-/-) mice treated with vehicle or AZD1480 .
Table 3.2: Chemokine and cytokine content of culture medium of human podocytes under control
conditions or after incubation with high (25 mM) glucose or mannitol for 48 h.
xviii
List of Figures
Chapter 1
Figure 1.1: The prevalence rate of chronic kidney disease (CKD) per 100,000 of the global
population across age groups and by sociodemographic index (SDI) quintiles.
Figure 1.2: Chronic kidney disease classification based on glomerular filtration rate (GFR) and
albuminuria.
Figure 1.3: Glomerular filtration barrier.
Figure 1.4: The JAK/STAT signaling pathway.
Figure 1.5: JAK2 structure.
Figure 1.6: The intricate beauty of podocytes.
Figure 1.7: Autophagy process.
Chapter 2
Figure 2.1: An isolated Dynabeads-perfused glomerulus.
Figure 2.2: Characterization of Podocin-cre+ R26Rfl/fl mice.
Figure 2.3: Characterization of JAK2 deletion from podocytes in mice.
Figure 2.4: Representative periodic acid-Schiff stained kidney sections from JAK2Ctrl and
JAK2podKO mice aged 10 weeks.
Figure 2.5: JAK2 deletion impairs podocyte autophagy completion in vivo.
Figure 2.6: JAK2 knockdown with siRNA causes autophagosome and lysosome accumulation in
cultured immortalized mouse podocytes.
xix
Figure 2.7: Representative flow cytometry histograms from primary cultured cells stained for
nephrin.
Figure 2.8: JAK2 knockdown or knockout impairs lysosome function and decreases TFEB
expression in mouse podocytes.
Figure 2.9: Putative binding sites for STAT1 within the mouse TFEB promoter.
Figure 2.10: TFEB overexpression restores lysosome function and albumin permselectivity in
JAK2-deficient mouse podocytes.
Figure 2.11: JAK2 regulates autophagy completion in podocytes.
Chapter 3
Figure 3.1: Effect of JAK2 inhibition on urine CCL2 excretion and mesangial matrix
accumulation in the glomeruli of STZ-diabetic eNOS-/- mice.
Figure 3.2: Effect of podocyte-specific JAK2 deletion on kidney function in STZ-diabetic mice.
Figure 3.3: Effect of JAK2 knockout from podocytes on urine CCL2 excretion in STZ-diabetic
mice.
Chapter 4
Figure 4.1: Anti-CCL2 neutralizing antibody diminishes VCAM-1 upregulation induced by
exposure of human glomerular endothelial cells (hGECs) to culture media conditioned by high
glucose-exposed podocytes.
Figure 4.2: Immunoblotting hGECs for VCAM-1 under control conditions or following
incubation with recombinant angiopoietin-1, angiopoietin-2 or endothelin-1.
Figure 4.3. Effect of high glucose on CCR2 and CCL2 expression in cultured hGECs.
xx
Figure 4.4: Knockout of the CCL2 receptor, CCR2 decreases glomerular VCAM-1 upregulation
in diabetic mice.
Figure 4.5: In situ hybridization for VCAM-1 and immunostaining for nephrin and CD31 in
mouse and human kidneys.
Figure 4.6: CCL2 increases human glomerular endothelial cell (hGEC) VCAM-1 levels through
CCR2, p38 MAPK, MSK1/2 regulated mechanisms.
Figure 4.7: Immunoblotting for ICAM-1, E-selectin and P-selectin in hGECs under control
conditions or following incubation with recombinant CCL2.
Figure 4.8: CCL2 increases hGEC histone H3 serine 10 (H3Ser10) phosphorylation and phospho-
histone H3Ser10 is enriched at the VCAM-1 promoter in hGECs and mouse kidneys.
Figure 4.9: qRT-PCR for miR-93 in hGECs under control conditions or following incubation
with recombinant CCL2.
Figure 4.10: Urine CCL2 excretion and renal histone H3 serine 10 phosphorylation and VCAM-
1 expression are increased in STZ-diabetic endothelial nitric oxide synthase (eNOS) knockout
(eNOS-/-) mice.
Figure 4.11: Histone H3 serine 10 phosphorylation is increased in human diabetic kidney
disease.
Figure 4.12: Schematic illustration of the role histone H3 serine 10 (H3Ser10) phosphorylation
plays in regulating glomerular endothelial VCAM-1 expression and endothelial activation in
diabetes.
Chapter 5
Figure 5.1. Summary of key findings.
xxi
List of Abbreviations
ACE Angiotensin converting enzyme
ACEi ACE inhibitors
AGEs Advanced glycation end products
Ang I Angiotensin I
Ang II Angiotensin II
AKI Acute kidney injury
ARBs Angiotensin receptor blockers
ANOVA Analysis of variance
ATG Autophagy related gene
CB Cell body
CCL2 C-C motif chemokine ligand 2
CCL5 C-C motif chemokine ligand 5
CCR2 C-C motif chemokine receptor 2
CKD Chronic kidney disease
CLEAR Coordinated lysosomal expression and regulation
CSTN Cystinosin
CTGF Connective tissue growth factor
CX3CL1 CX3-C motif chemokine 1
CXCL12 C-X-C motif ligand 12
CVD Cardiovascular disease
DAPI 4′,6-diamidino-2-phenylindole
DKD Diabetic kidney disease
EBSS Earl’s Balanced Salt Solution
eGFR Estimated glomerular filtration rate
EGF Epidermal growth factor
eNOS Endothelial nitric oxide synthase
ESAM Endothelial cell-selective adhesion molecule
ESKD End-stage kidney disease
ESL Endothelial surface layer
FP foot processes
FPE foot process effacement
FSGS Focal segmental glomerulosclerosis
GAPDH Glyceraldehyde 3-phosphate dehydrogenase
GBM Glomerular basement membrane
GFB Glomerular filtration barrier
HbA1c Hemoglobin A1c
HBSS Hank’s Balanced Salt solution
HG High glucose (25 mmol/L)
H3K9ac Histone H3 lysine 9 acetylation
H3K27me3 Histone H3 lysine 27 trimethylation
H3Ser10 Histone H3 serine 10 phosphorylaion
IC50 Concentration at which the inhibition of activity is reduced by 50%
ICAM-1 Intraceullar adhesion molecule 1
xxii
IL-1 Interleukin 1
IL-6 Interleukin 6
IL-18 Interleukin 18
JAK Janus kinase
JH JAK homology
KIM-1 Kidney injury molecule 1
Lamβ1 Laminin β1
LAMP2 Lysosome-associated membrane protein 2
LC3 microtubule-associated protein 1 light chain 3
lncRNAs Long non-coding RNAs
MCD Minimal change disease
MCOLN1 Mucolipin 1
MCP-1 Monocyte chemoattractant protein 1
MET Mesenchymal–epithelial-transition
miRNAs micro ribonucleic acid
MiT Microphthalmia
MN Membranous nephropathy
MP Major processes
Msk1/2 Mitogen and stress-activated kinase 1/2
mTOR mammalian target of rapamycin
NO Nitric oxide
NFκB Nuclear factor kappa-light-chain-enhancer of activated B cells
p38 MAPK p38 mitogen-activated protein kinase
PBS Phosphate-buffered saline
PDGF Platelet-derived growth factor
PDGF-B Platelet-derived growth factor B
PDGFR-β Platelet-derived growth factor receptor β
PE Phosphatidylethanolamine
PIAS Protein inhibitors of activated STAT
PKD Polycystic kidney disease
PtdIns3K Phosphatidylinositol 3-kinase
PTHMs Post-translational histone modifications
PTMs Post-translational modifications
RAAS Renin-angiotensin-aldosterone system
RANTES regulated on activation, normal T cell expressed and secreted
RPLP0 Large ribosomal protein P0
ROS reactive oxygen species
SD Slit diaphragm
SD Standard deviation
SDF-1 Stromal cell–derived factor-1
SEM Standard error of the mean
SGLT2 sodium-dependent glucose transporter 2
siRNA short interfering RNA
SOCS suppressors of cytokine signaling
SP Secondary processes
xxiii
SQSTM1 Sequestosome 1
STAT Signal transducer and activator of transcription
STK4 Serine/threonine kinase 4
TGF-β Transforming growth factor β
TFEB Transcription factor EB
TNF-α Tumor necrosis factor-α
TYK2 Tyrosine kinase 2
UACR Urine albumin/creatinine ratio
ULK1/2 Unc-51-like autophagy activating kinase 1 and 2
VCAM-1 Vascular cell adhesion protein 1/ vascular adhesion molecule 1
VEGF Vascular endothelial growth factor
xxiv
List of Appendices
List of primer sequences used in the studies
1
CHAPTER 1: LITERATURE REVIEW
2
1.1. Chronic kidney disease: scope of the problem
1.1.1. Prevalence and challenges
Since the first successful kidney transplant in animals almost a century ago and six decades later
in humans, the global nephrology community has come a long way and made major advances in
the care and treatment of chronic kidney disease (CKD) (reviewed in Klintmalm 2004).
Nonetheless, the global health challenge of CKD continues to impose a high epidemiological and
economic burden on health care systems (Kassebaum, Arora et al. 2016, reviewed in Jager and
Fraser 2017). Today, almost one in 10 people worldwide are affected by CKD and the number is
on the rise (Mills, Xu et al. 2015, Hill, Fatoba et al. 2016, reviewed in Levin, Tonelli et al. 2017).
The prevalence rate of CKD has increased substantially and it correlates with aging and socio-
demographic status (Figure 1.1) (Xie, Bowe et al. 2018). In Canada alone, the number of people
living with kidney disease has increased to 36% since 2007, and of the 4,500 Canadians on the
waiting list for an organ transplant, almost 77% are waiting for a kidney (Canadian Organ
Replacement Register Annual Statistics 2016).
Figure 1.1: The prevalence rate of chronic kidney disease (CKD) per 100,000 of the global
population across age groups and by sociodemographic index (SDI) quintiles. Adapted from
(Xie, Bowe et al. 2018) with no copyrights permission required as per Creative Commons
Attribution-NonCommercial-No Derivatives License (CC BY NC ND).
3
The term CKD denotes abnormalities of kidney structure or function, present for more than three
months regardless of the underlying cause (Mills, Xu et al. 2015). Improper kidney function
results in loss of essential proteins such as albumin into the urine (albuminuria) and reduction in
estimated glomerular filtration rate (eGFR), which are standard measures for the diagnosis and
the stage classification of CKD (Figure 1.2) (reviewed in Romagnani, Remuzzi et al. 2017). If
left untreated, CKD can progress to end-stage kidney disease (ESKD), the most severe form of
CKD, commonly known as kidney failure.
Figure 1.2: Chronic kidney disease classification based on glomerular filtration rate (GFR) and
albuminuria. Adapted from (reviewed in Romagnani, Remuzzi et al. 2017) with permission from
Springer Nature ©.
Renal replacement therapies in the form of dialysis or kidney transplantation are the only
available treatment options for patients with ESKD (reviewed in Romagnani, Remuzzi et al.
2017). Although renal replacement therapies are life saving treatments, they are often associated
with low life expectancy, impaired quality of life, and adverse health outcomes including risk of
cardiovascular disease (CVD), death, acute kidney injury (AKI), infection and hospitalization
4
(Go, Chertow et al. 2004, reviewed in Pannu 2013). Moreover, inequity in access to renal
replacement therapies and health services increases the high risk of mortality in patients with
CKD (reviewed in Liyanage, Ninomiya et al. 2015). Furthermore, the number of deaths from
CKD has nearly doubled over the past three decades and CKD became the 11th leading cause of
death in 2016 (Naghavi, Abajobir et al. 2017).
The staggering costs of dialysis and kidney transplantation impose a financial burden to patients
and their families, and a global economic burden to health care systems. For instance, dialysis
and kidney transplantation alone cost between US$35,000 and $100,000 per year per patient
(reviewed in Levin, Tonelli et al. 2017). Current treatment strategies to prevent or slow CKD
progression remain limited and little progress has been made to find better diagnostic markers,
prognostic tools, and therapeutic targets (reviewed in Levin, Tonelli et al. 2017). Multiple
prominent interventional trials of potential therapies for CKD have shown no significant benefits
(Pfeffer, Burdmann et al. 2009, Mann, Green et al. 2010, Walz, Budde et al. 2010, Parving,
Brenner et al. 2012, De Zeeuw, Akizawa et al. 2013, Fried, Emanuele et al. 2013). Furthermore,
the pathophysiology and the underlying mechanisms of CKD are still not fully understood
(reviewed in Levin, Tonelli et al. 2017). Based on these challenges a global initiative led by
Kidney Disease Improving Global Outcomes (KDIGO) recently proposed an action plan to close
gaps in kidney care, research, and policy (reviewed in Levin, Tonelli et al. 2017). In line with the
proposed action plan, my doctoral thesis research was conducted to: i) advance understanding of
renal biology at the fundamental level, ii) contribute to the knowledge surrounding the causes of
kidney damage in CKD, and iii) provide insights that would lead to the development of better
therapeutic strategies for CKD.
1.2. Causes of chronic kidney disease
Identifying the underlying causes of CKD is essential for proper CKD management and
treatment. Globally, diabetes followed by hypertension are the leading causes of CKD (Xie,
Bowe et al. 2018). Between 1990 and 2016, it has been estimated that diabetes and hypertension
account for 50.62% and for 23.26% respectively of the overall increase in CKD disability-
adjusted life years (Xie, Bowe et al. 2018). Although agents that aim at lowering blood pressure
5
and blood glucose levels have been the standard therapy for patients with CKD, kidney
dysfunction continues to progress in many of these patients (Ismail-Beigi, Craven et al. 2012).
Moreover, the majority of patients with CKD die prematurely from CVD before progression to
ESKD (reviewed in Go, Chertow et al. 2004, Tonelli, Wiebe et al. 2006, reviewed in Dalrymple,
Katz et al. 2011). Other causes, although less common, can also contribute to the development of
CKD, which could be hereditary, developmental, or acquired (reviewed in Romagnani, Remuzzi
et al. 2017). Mutations in certain genes have been shown to contribute to development of CKD.
For instance, a loss of kidney function in Alport syndrome is caused by a mutation in the genes
encoding type IV collagen, which is an essential structural component of the glomerular
basement membrane (Barker, Hostikka et al. 1990). Developmental defects may also accelerate
progression of CKD. For example, those born with congenital defects such as low number of
nephrons are more prone to kidney dysfunction leading to CKD (reviewed in Brenner, Garcia et
al. 1988). Other factors such as infections, exposure to drugs and toxins, genetics, ethnicity,
aging, and gender also play a role in increasing the risk for CKD (reviewed in Webster, Nagler et
al. 2017). Early detection of these risk factors is important to mitigate progression of CKD.
However, out of all causes of CKD, diabetes is of particular global concern as the prevalence of
diabetes in adults is expected to increase from 8.8% in 2015 to 10.4% in 2040 across the globe
(Ogurtsova, da Rocha Fernandes et al. 2017). As the incidence of diabetes is expected to rise in
the next few decades, diabetes complications notably diabetic kidney disease will continue to
develop, urging for better prevention and treatment strategies.
1.3. Diabetic kidney disease
Diabetes is the leading cause of kidney failure worldwide (reviewed in Reidy, Kang et al. 2014).
Nearly half of all patients with type 2 diabetes and one third of patients with type 1 diabetes will
likely develop CKD (reviewed in Thomas, Brownlee et al. 2015). Development of CKD due to
diabetes is referred to as diabetic kidney disease (DKD), which was initially described in the
1980s (Mogensen, Christensen et al. 1983). Historically, the term diabetic nephropathy was
coined to characterize a condition that progress through a series of stages; a mild increase in
albuminuria (microalbuminuria; 30-300 mg/day), which subsequently progresses to overt
albuminuria (macroalbuminuria; >300 mg/day), followed by a decline in GFR (<60 ml/min/1.73
6
m2) and ultimately to ESKD (de Boer, Rue et al. 2011). Histologically, renal impairment in
patients with this form of diabetic nephropathy is often associated with specific structural
changes in the kidney such as nodular glomerulosclerosis (the classic Kimmelstiel-Wilson
nodule) (reviewed in Umanath and Lewis 2018). However, a growing body of evidence suggests
that not all patients with DKD follow the historically described path. In fact, patients with DKD
can develop albuminuria with no structural changes in the kidney, and microalbuminuria may not
progress or it may even regress, and patients may develop a significant reduction in GFR without
albuminuria (Kramer, Nguyen et al. 2003, Perkins, Ficociello et al. 2003, De Boer, Rue et al.
2011, reviewed in Umanath and Lewis 2018). Accordingly, DKD has recently been recognized as
a heterogeneous condition of disorders affecting the kidney in patients with diabetes and the
definition continues to evolve (reviewed in Persson and Rossing 2018).
1.3.1. Pathophysiology of DKD
The human kidney consists of approximately one million nephrons on average (Hinchliffe,
Sargent et al. 1991) and each nephron is composed of a single glomerulus, the main site of blood
filtration that has historically been much of the focus of the investigation in DKD research. A
single glomerulus consists of a small network of capillaries surrounded by Bowman’s capsule
connected to a segmented tubular reabsorption compartment. Within the glomerulus, there are
four types of cells: endothelial cells lining the capillaries, mesangial cells that reside in between
the capillaries, specialized epithelial cells known as podocytes covering the capillaries, and
parietal epithelial cells lining Bowman’s capsule (reviewed in Scott and Quaggin 2015). Each
cell plays an important role in maintaining proper glomerular filtration and each of these cells is
affected by diabetes (Holderied, Romoli et al. 2015). Endothelial cells and podocytes are
separated by a glomerular basement membrane (GBM) and together they form the glomerular
filtration barrier (GFB) that prevents passage of valuable large molecules such albumin into the
urine (Figure 1.3).
7
Figure 1.3: Glomerular filtration barrier. Depiction of the glomerular filtration barrier and its
components within the kidney glomerulus including fenestrated endothelial cells lining the
capillary lumen, GBM, and podocytes lining the urinary space and forming the final layer of the
filtration barrier.
In the normal kidney, the blood enters the glomerulus through the afferent arteriole and flows
through glomerular capillaries where permselectivity occurs. Filtered blood containing essential
macromolecules exits the glomerulus through the efferent arteriole and the primary urinary
filtrate passes through the glomerular filtration barrier to tubule cells for reabsorption of leaked
proteins (reviewed in Scott and Quaggin 2015). In the diabetic state, however, this normal blood
filtration process is disturbed by several factors that induce structural and functional
abnormalities in the kidney glomerulus and ultimately lead to renal dysfunction (reviewed in
Thomas, Brownlee et al. 2015). The mechanisms leading to DKD are still not fully understood
and the pathogenesis of DKD is multifactorial. However, preclinical and clinical studies of DKD
have improved our understanding of the underlying pathophysiology of DKD. A number of key
players implicated in the pathogenesis of DKD including hyperglycemia, hemodynamic changes,
inflammation and fibrotic factors are summarized below.
8
1.3.1.1. Hyperglycemia
DKD is one of the classical microvascular complications of diabetes. The implication of
hyperglycemia in the development of DKD has been extensively studied and two landmark trials
in particular, the Diabetes Control and Complications Trial (DCCT) and the United Kingdom
Prospective Diabetes Study (UKPDS) established that strict glycemic control slows development
and progression of DKD in patients with diabetes (DCCT 1993, UKPDS 1998). Further
highlighting the importance of hyperglycemia in the pathogenesis of DKD, diabetic glomerular
lesions have been reported to be reversed following pancreas transplantation in patients with type
1 diabetes with 10 years of normoglycemia (Fioretto, Barzon et al. 2014). In the healthy kidney,
180 g/day of glucose is filtered in the glomeruli and almost all of the filtered glucose is
reabsorbed by the proximal tubules (reviewed in Mather and Pollock 2011). In diabetes,
prolonged exposure of the kidney to the diabetic milieu causes metabolic changes that result in
modulation of signaling pathways implicated in kidney injury (reviewed in Reidy, Kang et al.
2014).
Kidney cells exposed to high glucose concentrations are amenable to functional abnormalities
and structural changes and these may be manifested as mesangial matrix expansion, loss of
endothelial fenestrations, effacement of podocyte foot processes, podocyte loss, and tubule
epithelial cell atrophy (reviewed in Reidy, Kang et al. 2014). The increase in cellular glucose
uptake is largely attributable to the expression and activity of glucose transporters (GLUTs),
which vary depending on the cell type (reviewed in Brownlee 2001). For instance, mesangial
cells and endothelial cells lack the ability to downregulate their glucose transporters when
exposed to hyperglycemia resulting in an increase in intracellular glucose levels, which in turns
induces mesangial extracellular matrix synthesis and endothelial dysfunction (Kaiser, Sasson et
al. 1993, Heilig, Concepcion et al. 1995). Moreover, a marked increase in the expression levels of
glucose transporters, namely sodium-dependent glucose transporter 2 (SGLT2) and GLUT2, was
observed in primary proximal tubule cells isolated from the urine of patients with type 2 diabetes
compared to cells from healthy individuals, suggesting that dysregulation of glucose metabolism
is implicated in the pathogenesis of DKD (Rahmoune, Thompson et al. 2005). However,
conflicting data from several studies showed that SGLT2 expression could be either upregulated
or downregulated in kidney biopsies from patients with diabetes highlighting the heterogeneity of
9
SGLT2 expression (Rajasekeran, Reich et al. 2017, Solini, Rossi et al. 2017, Wang, Levi et al.
2017).
Excessive glucose flux into kidney cells induces generation of toxic metabolites such as reactive
oxygen species (ROS), which is a feature of mitochondrial dysfunction in the diabetic kidney and
can activate pathogenetic pathways that lead to cellular dysfunction, vascular injury,
inflammation, apoptosis and fibrosis (reviewed in Forbes, Coughlan et al. 2008, Dugan, You et
al. 2013, Coughlan, Nguyen et al. 2016).
Hyperglycemia has also been shown to affect nutrient-sensing pathways in the kidney essential
for cellular homeostasis such as autophagy, mitochondrial biogenesis, and apoptosis. High levels
of glucose causes dysregulation of key players in nutrient-sensing pathways such as mammalian
target of rapamycin (mTOR) (reviewed in Kume, Thomas et al. 2012). Several studies in
streptozotocin-induced diabetes showed that hyperglycemia induces mTOR-dependent kidney
hypertrophy and inhibition of mTOR activity using the specific mTOR inhibitor rapamycin
reduced secretion of profibrotic and proinflammatory cytokines and chemokines within the
kidney (Lloberas, Cruzado et al. 2006, Sakaguchi, Isono et al. 2006, Yang, Wang et al. 2007).
Moreover, rapamycin caused marked reduction in albuminuria and ameliorated renal
hypertrophy, glomerular basement membrane thickening, and accumulation of mesangial matrix
(Lloberas, Cruzado et al. 2006, Sakaguchi, Isono et al. 2006, Yang, Wang et al. 2007). However,
other studies have shown opposing effects of mTOR inhibition in animal models and patients
including proteinuria and glomerulosclerosis (Torras, Herrero-Fresneda et al., 2009;
Munivenkatappa, Haririan et al., 2010; Letavernier, Bruneval et al., 2007). In comparison,
activation of mTOR specifically in podocytes has been shown to facilitate DKD in mice and
humans (Inoki, Mori et al. 2011). The role of mTOR signaling in the kidney in health and in
DKD has been demonstrated by Gödel and colleagues in a series of elegant experiments in
genetically modified mouse models (Gödel, Hartleben et al., 2011). In this study, podocyte-
specific deletion of rapamycin-sensitive adaptor protein of mTOR (Raptor), and rapamycin-
insensitive subunit (Rictor), which are essential components of mTORC1 and mTORC2,
respectively, worsened glomerular lesions, suggesting that both mTOR complexes are required
for podocyte homeostasis and development. However, reducing mTORC1 activity by genetically
deleting one allele of Raptor prevented progression of glomerular disease in diabetic mice. These
10
findings suggest that tight regulation of mTOR signaling is essential for podocyte homeostasis
and preventing progressive glomerular dysfunction (Gödel, Hartleben et al., 2011).
Dysregulation of autophagy, a highly conserved self-repair mechanism essential for cell survival,
has also been reported in the kidneys of experimental models and humans with diabetes
(reviewed in Ding and Choi 2015). Studies from multiple groups reported an accumulation of the
autophagy substrate p62/Sequestosome 1 (SQSTM1), indicative of impaired autophagic
clearance, in kidneys of experimental models of type 1 diabetes (Vallon, Rose et al. 2012) and
type 2 diabetes (Kitada, Kume et al. 2011), and in kidney biopsy samples obtained from patients
with type 2 diabetes (Yamahara, Kume et al. 2013). In addition, a study from our own group
revealed that not only accumulation of p62 was observed, but the transcription factor termed
transcription factor EB (TFEB), a master regulator of the autophagy-lysosomal pathway, was also
downregulated in kidney biopsies from patients with DKD (Brijmohan, Batchu et al. 2018).
Despite the importance of intensive glucose lowering, follow up of the DCCT trial participants
showed that in some patients, poor glycemic control can have a lasting effect in the kidney even
after strict glycemic control (De Boer, Rue et al. 2011). This phenomenon is commonly referred
to as ‘metabolic memory’ whereby exposure to the diabetic milieu results in a deleterious effect
that lasts despite glucose normalization and this has been suggested to be attributable to persistent
epigenetic changes (reviewed in Brownlee 2001, reviewed in Giacco and Brownlee 2010,
reviewed in Reddy, Zhang et al. 2015). Furthermore, it has been recently suggested that high
variability in blood glucose levels may also contribute to the development of DKD (reviewed in
Subramanian and Hirsch 2018).
1.3.1.2. Hemodynamic changes
The causes of kidney damage in diabetes are not solely attributed to the direct cellular effect of
hyperglycemia. Interaction of metabolic abnormalities with hemodynamic changes also
contributes to the development of DKD. The seminal work by Brenner’s group in experimental
models of diabetes and CKD revealed that glomerular hyperfiltration contributes to the
development of glomerulosclerosis and progression of kidney dysfunction (Hostetter, Olson et al.
1981, Hostetter, Troy et al. 1981). The renin-angiotensin-aldosterone system (RAAS) is one of
11
the main hormonal pathways that control blood pressure and fluid balance in the kidney
(reviewed in Brewster and Perazella 2004). The RAAS consists of hormones that control
systemic blood pressure and glomerular perfusion by maintaining the balance between
vasoconstriction and vasodilation of the glomerular afferent and efferent arterioles. Key
stimulants of the RAAS include low blood pressure, reduced renal perfusion pressure, low
concentration of sodium and chloride ions in the distal tubules, and increase in the activity of the
sympathetic nervous system (reviewed in Brewster and Perazella 2004). When the RAAS is
stimulated, the juxtaglomerular cells located in the glomerular arterioles release the hormone
renin into the blood, which subsequently converts the circulating substrate angiotensinogen
(secreted from the liver) to angiotensin I (Ang I). Vascular endothelial cells then convert Ang I to
Ang II by angiotensin converting enzyme (ACE), which cleaves the C-terminal dipeptide of Ang
I to form the active vasoconstrictor Ang II. Ang II in turn acts on multiple targets leading to an
increase in systemic and renal pressure, glomerular hyperperfusion, and sodium and fluid
retention (reviewed in Brewster and Perazella 2004).
The role of the RAAS in the development of DKD is well documented (reviewed in Tuttle,
Bakris et al. 2014, reviewed in Yamout, Lazich et al. 2014). Elevated levels of RAAS
components notably Ang II have been observed to be associated with renal injury and
albuminuria in rodent models and in patients with diabetes (Rudberg, Rasmussen et al. 2000,
Huang, Gallois et al. 2001). In the diabetic setting, increased Ang II stimulates both
hemodynamic and non-hemodynamic changes. Hemodynamic changes include systemic and
renal vasoconstriction, high intraglomerular pressure, and increase in permeability of the GFB.
On the other hand, non-hemodynamic abnormalities include: ROS production, glomerular and
tubule cell proliferation, accumulation of extracellular matrix, and stimulation of secretion of
growth factors such as transcription growth factor β (TGF-β), vascular endothelial growth factor
(VEGF), and endothelin (reviewed in Leehey, Singh et al. 2000). Therapeutically, several studies
have demonstrated the renoprotective effects of RAAS blockade and its critical role in slowing
disease progression in patients with DKD (Lewis, Hunsicker et al. 1993, Brenner, Cooper et al.
2001, Lewis, Hunsicker et al. 2001, Sarafidis and Ruilope 2014). Thus, to date, RAAS blockers
including ACE inhibitors (ACEi) or angiotensin receptor blockers (ARBs) are standard of care
therapy for DKD (reviewed in Yang and Xu 2017).
12
1.3.1.3. Inflammation
Inflammation is a natural response triggered by infections and tissue injury (reviewed in
Medzhitov 2008). Dysregulation of inflammatory responses can lead to irreversible tissue
damage resulting in chronic inflammatory diseases including DKD (reviewed in Medzhitov 2008,
reviewed in García-García, Getino-Melián et al. 2014). Kidney injury in DKD was traditionally
attributed to metabolic and hemodynamic changes (reviewed in Zatz, Meyer et al. 1985).
However, it was not until the 1990s that inflammatory mechanisms were proposed to be
implicated in the pathogenesis of DKD (Hasegawa, Nakano et al. 1991). Hasegawa and
colleagues showed that peritoneal macrophages secreted higher levels of proinflammatory
cytokines specifically tumor necrosis factor (TNF)-α and interleukin 1 (IL-1) when incubated
with glomerular basement membranes isolated from diabetic rats compared to non-diabetic rats,
suggesting that inflammation plays a role in the development of DKD (Hasegawa, Nakano et al.
1991). Since then, a growing body of evidence has supported the notion that DKD is an
inflammatory disease (reviewed in García-García, Getino-Melián et al. 2014, reviewed in
Donate-Correa, Martín-Núñez et al. 2015).
Several activated inflammatory molecules have been shown to mediate kidney damage and
leukocyte infiltration in diabetes including transcription factors, cytokines, chemokines, and their
receptors, and adhesion molecules (reviewed in García-García, Getino-Melián et al. 2014).
Moreover, activated inflammatory molecules have been identified in urine samples from patients
with diabetes and recently have been regarded as being predictors of kidney dysfunction in
diabetes preceding the onset of microalbuminuria (reviewed in Van, Scholey et al. 2017). Nuclear
factor kappa-light-chain-enhancer of activated B cells (NFκB) is among the key transcription
factors that regulate expression of genes implicated in the inflammatory response in DKD
(reviewed in Sanz, Sanchez-Niño et al. 2010). Activation of NFκB has been reported in kidneys
of humans and rodents with diabetes (Mezzano, Aros et al. 2004, Iwamoto, Mizuiri et al. 2005)
and has been shown to increase expression of proinflammatory cytokines, chemokines and
adhesion molecules (reviewed in Baker, Hayden et al. 2011). Hemodynamic and metabolic
changes in DKD promote secretion of proinflammatory cytokines and chemokines, which can be
produced by kidney resident cells as well as inflammatory cells including macrophages,
13
neutrophils, and lymphocytes (reviewed in García-García, Getino-Melián et al. 2014, reviewed in
Donate-Correa, Martín-Núñez et al. 2015). The actions of key inflammatory cytokines such as
IL-1, IL-6 and IL-18 have been shown to contribute to inflammatory responses in the diabetic
kidney (reviewed in Navarro-Gonzalez and Mora-Fernández 2008). For instance, upregulation of
IL-18 induces chemokine receptor expression in mesangial cells (Schwarz, Wahl et al. 2002) and
promotes tubulointerstitial lesions (reviewed in Turner, Arulkumaran et al. 2014). Moreover, it
has been demonstrated that IL-18 correlates with albuminuria in the early stages of DKD (Kim,
Song et al. 2012). Proinflammatory cytokines promote activation of adhesion molecules that
mediate intracellular binding and cell migration such as vascular cell adhesion protein 1 (VCAM-
1; also known as vascular adhesion molecule 1), intraceullar adhesion molecule 1 (ICAM-1), E-
selectin, endothelial cell-selective adhesion molecule (ESAM), and α-actinin-4 (reviewed in
Navarro-González, Mora-Fernández et al. 2011). Several chemokines, which function as
chemoattractants for inflammatory cells, are also implicated in the development of DKD,
including C-C motif chemokine 2 (CCL2) also known as monocyte chemoattractant protein 1
(MCP-1), CX3-C motif chemokine 1 (CX3CL1) also known as fractalkine, and C-C motif
chemokine 5 (CCL5) also known as regulated on activation, normal T cell expressed and secreted
(RANTES). (reviewed in Navarro-González, Mora-Fernández et al. 2011).
Upregulation of inflammatory signalling pathways notably the Janus kinase/signal transducer and
activator of transcription (JAK/STAT) and CCL2/CCR2 signalling pathways has been reported in
kidneys of patients with DKD (Morii, Fujita et al. 2003, Berthier, Zhang et al. 2009, Tarabra,
Giunti et al. 2009). Pharmacological agents have been developed to target both of these pathways
for the treatment of DKD although none of these agents have yet received regulatory approval for
this indication and their mechanisms of action remain incompletely understood (de Zeeuw,
Bekker et al. 2015, Tuttle K 2015, Menne, Eulberg et al. 2016).
1.3.1.4. Growth factors and fibrotic factors
Kidney fibrosis is the final common pathway to ESKD in all forms of CKDs including DKD
(reviewed in Choi, Ding et al. 2012). All the diverse mechanisms implicated in the pathogenesis
of DKD mentioned thus far can ultimately lead to kidney fibrosis. TGF-β is one of the main
14
growth factors that promotes formation of tissue scarring and it exists in three different isoforms:
TGF-β1, TGF-β2, and TGF-β3 (reviewed in Massague 1990). Out of the three isoforms, TGF-β1
is the main driver of kidney fibrosis (Ketteler, Noble et al. 1994). Studies in mouse models of
type 1 diabetes that were genetically engineered to express various levels of TGF-β1
demonstrated that severity of DKD is directly proportional to high expression levels of TGF-β1
(Hathaway, Gasim et al. 2015). TGF-β1 mediates fibrosis by canonical or noncanonical
signalling pathways that are beyond the scope of this thesis (Fujimoto, Maezawa et al. 2003).
However, these signalling pathways ultimately facilitate the development of glomerulosclerosis
and tubulointerstitial fibrosis in DKD by stimulation of extracellular matrix deposition,
dedifferentiation of kidney cells, increase in excretion of urine albumin, and suppression of
water, electrolyte and glucose reabsorption (reviewed in Chang, Hathaway et al. 2015).
Several research efforts have been focused on targeting TGF-β1 for the treatment of DKD. For
instance, neutralizing anti-TGF-β antibodies have been shown to mitigate glomerulosclerosis,
interstitial fibrosis, and excess matrix gene expression in mouse models of type 1 and type 2
diabetes (Sharma, Jin et al. 1996, Ziyadeh, Hoffman et al. 2000). Although TGF-β1 neutralizing
antibody treatment was observed to have renoprotective effects in experimental models of
diabetes, results from a recent phase 2 clinical trial showed that this therapeutic approach added
to RAAS inhibitors, failed to slow progression of DKD, suggesting that global blockade of TGF-
β1 signalling may not be a suitable therapeutic strategy (Voelker, Berg et al. 2017). Other growth
factors have also been identified to induce kidney fibrosis including endothelin 1, VEGF,
connective tissue growth factor (CTGF), epidermal growth factor (EGF), and platelet-derived
growth factor (PDGF) (reviewed in Kok, Falke et al. 2014, reviewed in Gagliardini, Zoja et al.
2015, reviewed in Majumder and Advani 2017).
Having highlighted the diverse mechanisms that can lead to the development of DKD, it is
important to note that these mechanisms and their underlying signalling pathways are interrelated
and whereas a large body of literature has described the multifactorial pathophysiology of DKD,
the implicated molecular mechanisms and the cell-specific roles of implicated signalling
pathways have not been fully defined.
15
1.3.2. Current available treatments for diabetic kidney disease
The current available biomarkers routinely used for the clinical assessment and the classification
of DKD are albuminuria and eGFR based on serum creatinine concentrations (reviewed in Rocco
and Berns 2012, reviewed in Tuttle, Bakris et al. 2014). Although these biomarkers have been
valuable in assessing and managing kidney diseases, they are not constantly reflective of kidney
damage and both eGFR and albuminuria have been shown to underestimate the early stages of
DKD in some cases (Krolewski, Niewczas et al. 2014). In addition to albuminuria and eGFR,
histopathological manifestations of DKD can be evaluated by kidney biopsy samples obtained
from patients although renal biopsy is not routine practice in DKD and obtaining kidney biopsy
specimen is associated with risk of severe bleeding and kidney injury (Corapi, Chen et al. 2012).
The current treatment strategies for patients with DKD aim to prevent or delay the progression of
kidney dysfunction by maintaining intensive glycemic and blood pressure control (reviewed in
Rocco and Berns 2012, reviewed in Tuttle, Bakris et al. 2014). Blockade of the RAAS with ACE
inhibitors (ACEi) or ARB medications remains standard of care therapy for patients with DKD
(reviewed in Ruggenenti, Cravedi et al. 2010, reviewed in Breyer and Susztak 2016). ACEi/ARB
therapy has been shown to be effective in diminution of albuminuria in patients with DKD and
reduces the yearly incidence of dialysis for patients with diabetes (Lewis, Hunsicker et al. 1993,
Brenner, Cooper et al. 2001, Lewis, Hunsicker et al. 2001). Although RAAS blockers have been
effective in slowing progression of kidney disease, they cannot halt progression of kidney
dysfunction and the prevalence of DKD continues to grow (Ruggenenti, Mosconi et al. 1999, de
Boer, Rue et al. 2011). Beyond RAAS blockers, efforts have been made to apply intensive
glycemic control in patients with diabetes, which has been proven to slow development and
progression of kidney disease and retinopathy (DCCT 1993). More recently, the glucose-
lowering agents SGLT2 inhibitors have demonstrated favorable effects in patients with type 2
diabetes including improved renal and cardiovascular outcomes (Wanner, Inzucchi et al. 2016,
Neal, Perkovic et al. 2017). Similarly, short-term treatment with the SGLT2 inhibitor
empagliflozin reduced kidney hyperfiltration in patients with type 1 diabetes (Cherney, Perkins et
al. 2013). Despite their benefits, however, treatment with SGLT2 inhibitors is not recommended
for advanced stage CKD and SGLT2 inhibition has been shown to be associated with increased
16
risk of ketoacidosis in patients with type 1 diabetes (Yale, Bakris et al. 2013, Kohan, Fioretto et
al. 2014, Krumholz, Wang et al. 2017, Rosenstock, Marquard et al. 2018).
As the diabetes pandemic continues to grow and given the limitations of the current available
treatments for DKD, there is an urgent need to identify new biomarkers and novel therapeutic
targets beyond standard therapy for DKD.
1.3.3. Emerging treatments for diabetic kidney disease
In an attempt to explore better therapeutic targets, researchers have investigated targeting
inflammatory signaling pathways for the treatment of DKD. Among these signaling pathways are
the JAK/STAT pathway and the CCL2/CCR2 pathway, which have been targeted in clinical trials
and have been the focus of my thesis research.
1.3.3.1. The JAK/STAT pathway
The JAK/STAT pathway is a major ubiquitously expressed signalling pathway that regulates
gene expression and fundamental cellular processes including cellular growth, proliferation,
differentiation, and immune response (Marrero, Banes-Berceli et al. 2006, reviewed in Chuang
and He 2010). Activation of the JAK/STAT pathway is initiated when an extracellular cytokine
or growth factor binds to its cognate receptor. The ligand-receptor binding results in recruitment
of JAK tyrosine kinases to the intracellular domain of the receptor followed by tyrosine
phosphorylation (reviewed in Chuang and He 2010, Ortiz-Munoz, Lopez-Parra et al. 2010).
Activated JAK kinases subsequently phosphorylate tyrosine motifs on the cytoplasmic domain of
the receptor, which serve as binding sites for STATs on the receptor. STATs are then recruited to
the receptor and activated STATs translocate to the nucleus to facilitate gene expression. The
JAK/STAT signalling cascade is illustrated in Figure 1.4. Activation of the JAK/STAT pathway
is controlled by a number of negative regulators including tyrosine phosphatases, suppressors of
cytokine signaling (SOCS) (reviewed in O'Sullivan, Liongue et al. 2007, reviewed in Yoshimura,
Naka et al. 2007, Ortiz-Munoz, Lopez-Parra et al. 2010), and protein inhibitors of activated
STAT (PIAS) (reviewed in Rakesh and Agrawal 2005, reviewed in Valentino and Pierre 2006).
17
Figure 1.4: The JAK/STAT signalling pathway. Ligand-receptor binding initiates a signalling
cascade that starts with autophosphorylation of JAK, followed by phosphorylation of STAT by
the activated JAK. Phosphorylation of STAT induces activation and dimerization. The activated
STAT dimer then translocates to the nucleus and binds to target genes to facilitate gene
expression.
18
There are four types of JAKs: JAK1, JAK2, JAK3, and tyrosine kinase 2 (TYK2); and seven
types of STATs: STAT1, STAT2, STAT3, STAT4, STAT5A, STAT5B, and STAT7, expressed
in mammals (reviewed in Darnell, Kerr et al. 1994, reviewed in Schindler and Darnell 1995,
reviewed in Chuang and He 2010, Pang, Ma et al. 2010). All types of JAK kinases are
ubiquitously expressed except for JAK3, which is expressed exclusively in hematopoietic cells
(reviewed in Yamaoka, Saharinen et al. 2004, reviewed in Kurdi and Booz 2009). Different
combinations of JAKs and STATs are specifically activated depending on the cytokine or growth
factor that initiates the signaling cascade (reviewed in Rawlings, Rosler et al. 2004).
The best-studied member of the JAK family is the cytosolic tyrosine kinase JAK2, which was
first cloned by Harpur and colleagues in 1992 (Harpur, Andres et al. 1992). The kinase JAK2 is a
130 kDa protein consisting of seven JAK homology domains (JH1-7) including: a tyrosine kinase
(JH1) domain in the C-terminus, a pseudokinase (JH2) domain that regulates the catalytic activity
of the JH1 domain, and non-catalytic JH3-7 domains that contain a FERM domain essential for
cytokine receptor binding in the N-terminus (reviewed in Amiri, Shaw et al. 2002, Banes, Shaw
et al. 2004, LaFave and Levine 2012). The primary structure of JAK2 is depicted in Figure 1.5.
19
Figure 1.5: JAK2 structure. Adapted from (Wallace and Sayeski 2006) with permission from
Springer Nature ©.
20
1.3.3.1.1. Role of the JAK/STAT pathway in diabetic kidney disease
A range of cytokines and growth factors that mediate activation of the JAK/STAT pathway have
been shown to contribute to the pathogenesis of DKD including PDGF (Wang, Wharton et al.
2000, Vij, Sharma et al. 2008), TGF- β1 (Yamamoto, Matsuda et al. 2001), IL-6 (Kretzschmar,
Dinger et al. 2004, Lim, Phan et al. 2009), EGF (Ruff-Jamison, Zhong et al. 1994), and Ang II
(Marrero, Schieffer et al. 1995, Amiri, Venema et al. 1999, Amiri, Shaw et al. 2002). Moreover,
upregulation of the JAK/STAT pathway has been reported in the diabetic kidney of both humans
and rodent models (Berthier, Zhang et al. 2009, Hodgin, Nair et al. 2013).
Several studies have highlighted the pathogenetic role of JAK/STAT activation in the kidney. In
cultured mesangial cells, studies showed that activation of the JAK/STAT pathway plays a role in
mesangial cell growth and proliferation and results in an augmentation of fibrotic growth factor
expression following exposure to Ang II and high glucose concentrations (Amiri, Shaw et al.
2002, Wang, Shaw et al. 2002). In kidney fibroblasts, JAK2 activation plays a role in collagen
synthesis and fibroblast mitogenesis and inhibition of its downstream transcription factor STAT3
was shown to reduce fibroblast activation in a model of CKD (Huang, Guh et al. 1999, Guh,
Huang et al. 2001, Huang, Guh et al. 2001, Pang, Ma et al. 2010). In podocytes, however, studies
examining the fundamental actions of the JAK/STAT pathway have been lacking and the few
studies that have explored this pathway in podocyte injury are not entirely consistent. For
instance, inducing apoptosis in cultured immortalized mouse podocytes showed that intact JAK2
is required for the pro-survival effect of erythropoietin, suggesting a protective role for JAK2
(Logar, Brinkkoetter et al. 2007). Conversely, initial studies by Brosius’s group in kidney
biopsies from patients with early DKD reported a marked increase in JAK2 expression in
glomerular cells including podocytes, suggesting that upregulation of podocyte JAK2 contributes
to the development of DKD (Berthier, Zhang et al. 2009). More recently, Brosius’s group
reported that overexpression of JAK2 in podocytes exacerbates kidney dysfunction in a mouse
model of DKD (Zhang, Nair et al. 2017). However, the detrimental effects of JAK2
overexpression in podocytes were only observed under diabetic conditions with modest effects
under normal conditions, suggesting that the effects of JAK2 expression are context-dependant
(Zhang, Nair et al. 2017).
21
1.3.3.1.2. Development of JAK inhibitors
The discovery of an activating JAK2 mutation (V617F) within the region of the gene encoding
the JH2 domain as the underlying cause of myelofibrosis has increased interest in targeting the
JAK/STAT pathway therapeutically (Baxter, Scott et al. 2005, James, Ugo et al. 2005).
Consequently, the first JAK inhibitor, ruxolitinib was clinically approved in 2011 for the
treatment of myelofibrosis and other myeloproliferative disorders (reviewed in Moran 2012).
Concurrently, preclinical studies have implicated JAK/STAT pathway activation in a range of
diseases including cancer (Hedvat, Huszar et al. 2009), inflammatory conditions and autoimmune
diseases (West 2009). Following these studies, there has been a growing interest in the
development of a number of other small molecule JAK inhibitors with varying levels of
selectivity. Moreover, the multiple reports demonstrating enhanced activity of the JAK/STAT
pathway in the diabetic kidney and its association with DKD progression encouraged targeting
this pathway for treatment of DKD (Amiri, Shaw et al. 2002, Banes, Shaw et al. 2004, Berthier,
Zhang et al. 2009, Hodgin, Nair et al. 2013, Zhang, Nair et al. 2017). Baricitinib is a selective
JAK1 and JAK2 inhibitor that was initially developed for the treatment of chronic inflammatory
conditions such as rheumatoid arthritis (Keystone, Taylor et al. 2015). In 2012, Eli Lilly and
Company and Incyte Corporation launched a phase 2 repurposing trial of baricitinib for the
treatment of DKD (NCT01683409). The study involved 129 participants with type 2 DKD
already receiving RAAS blockers, with impaired kidney function (eGFR 25–75 ml/min/1.73 m2)
and overt albuminuria (>300 mg/day) (Tuttle, Brosius et al. 2018). The participants received
placebo or baricitinib orally at low-high daily doses for 24 weeks. In comparison to the placebo
group, treatment with baricitinib resulted in an approximately 40% reduction in albuminuria in
the highest dose group accompanied by a decrease in urinary proinflammatory markers including
CCL2 and CXCL10 (IP-10), which both have been implicated in DKD pathophysiology. Despite
the benefits, the study has several limitations including modest sample size and short time frame,
lack of diversity in the study population, and adverse events such as hypoglycemia, and anemia.
In addition, it is not clear whether the beneficial effects of baricitinib were specific to JAK1 or
JAK2; thus, additional studies are required to determine whether JAK2 inhibition represents a
viable treatment strategy for DKD.
22
It is worth noting that while drug repurposing provides a strategic approach for finding novel
treatments for DKD, lessons from past trials caution against rushing into clinical trials without
adequate preclinical studies. The importance of rigorous evaluation of therapeutic targets in
preclinical studies is evidenced by the disappointing clinical outcome of the Bardoxolone
Methyl Evaluation in Patients with Chronic Kidney Disease and Type 2 Diabetes Mellitus: the
Occurrence of Renal Events (BEACON) trial (De Zeeuw, Akizawa et al. 2013). In the phase 3
BEACON trial, bardoxolone methyl, an anti-oxidant and anti-inflammatory agent, was
evaluated for its effects on delaying progression of DKD to ESKD and cardiovascular death.
Although the data from a phase 2 trial showed that bardoxolone methyl treatment increased
eGFR (Pergola, Raskin et al. 2011), the phase 3 trial was terminated prematurely due to severe
adverse effects including mortality, heart failure, high blood pressure, and increase in
albuminuria (De Zeeuw, Akizawa et al. 2013). These severe adverse events were recapitulated
in animal studies (Zoja, Corna et al. 2012). More recently, the United Kingdom Heart and
Renal Protection-III (UK HARP-III) trial aiming to repurpose and compare the effects of
sacubitril/valsartan (approved for the treatment of patients with heart failure) versus irbesartan
(a licenced ARB for DKD) failed to have any additional effects on kidney function in patients
with CKD (Haynes, Judge et al. 2018). Taken together, these findings highlight the need for
proper understanding of pathomechanisms in preclinical studies, which may inform our
interpretation of clinical trial results.
1.3.3.2. CCL2/CCR2 signaling pathway
Migration of immune cells to the sites of inflammation in the kidney is one of the early events
that lead to kidney damage in diabetes (reviewed in Galkina and Ley 2006). In the diabetic
setting, hemodynamic and metabolic changes promote secretion of a wide range of
proinflammatory cytokines and chemokines that mediate kidney injury through autocrine,
paracrine, or juxtacrine actions (reviewed in Navarro-Gonzalez and Mora-Fernández 2008).
MCP-1 (also known and hereafter referred to as CCL2) is one of the most extensively studied
chemokines playing a major role in migration of monocytes and macrophages (reviewed in
Panzer, Steinmetz et al. 2006). Upon stimulation, CCL2 is secreted and binds to its cognate
receptor CCR2, which is predominantly expressed by monocytes, to mediate
23
monocyte/macrophage recruitment to inflammatory sites (reviewed in Panzer, Steinmetz et al.
2006). Upregulation of CCL2 and its cognate receptor CCR2 has been reported in kidney
biopsies from patients with DKD (Wada, Furuichi et al. 2000, Tarabra, Giunti et al. 2009). An
increase in urine CCL2 excretion has been observed in patients with DKD, which positively
correlated with albuminuria (Tashiro, Koyanagi et al. 2002). Moreover, knockout of CCL2 has
been shown to play a protective role in rodent models of diabetes including reduced
macrophage infiltration and attenuated albuminuria (Chow, Nikolic-Paterson et al. 2007,
Tarabra, Giunti et al. 2009).
A number of cell types in the kidney express CCL2 including glomerular endothelial cells
(Kakizaki, Waga et al. 1995), mesangial cells (Gruden, Setti et al. 2005), podocytes (Gu,
Hagiwara et al. 2005), and tubule epithelial cells (Wada, Furuichi et al. 2000, Mezzano, Aros
et al. 2004). However, podocytes are the predominant source of CCL2 in the glomerulus
(Prodjosudjadi, Gerritsma et al. 1995, Chow, Ozols et al. 2004, Hartner, Veelken et al. 2005) .
Exposure of mesangial cells to CCL2 results in increased expression of the adhesion molecule
ICAM-1 and interstitial matrix molecules such as fibronectin (Giunti, Pinach et al. 2006,
Giunti, Tesch et al. 2008). Similarly, CCL2 induces ICAM-1 expression and IL-6 secretion in
human tubule epithelial cells (Viedt, Dechend et al. 2002). Activation of CCL2/CCR2
signalling caused a migratory response in podocytes with marked reduction in the expression
of the podocyte cytoskeleton protein, nephrin (Burt, Salvidio et al. 2007), and was observed to
be implicated in diabetes-induced podocyte apoptosis (Nam, Paeng et al. 2012). Data from
recent studies in transgenic mice with podocyte-specific CCR2 overexpression demonstrated
that CCL2/CCR2 contributes to the pathogenesis of DKD by directly affecting podocytes
possibly through podocyte loss, suggesting that the CCL2/CCR2 system plays a role in the
renal glomerulus independently of monocyte/macrophage recruitment (Awad, Kinsey et al.
2011, You, Gao et al. 2017).
1.3.3.2.1. Development of CCL2/CCR2 blockers
Targeting inflammatory pathways as a new strategy to slow DKD along with the implication
of CCL2/CCR2 in DKD pathophysiology has led the pharmaceutical industry to develop
24
CCL2 and CCR2 inhibitors for these indications. Findings from recent clinical trials aimed at
inhibition of CCL2/CCR2 signalling for treatment of DKD appear promising. In a phase 2
clinical trial, inhibition of CCL2/CCR2 signalling with the CCL2 antagonist emapticap pegol
(NOX-E36) significantly lowered urinary albumin/creatinine ratio (UACR) and hemoglobin
A1c (HbA1c) in patients with type 2 diabetes and albuminuria (Menne, Eulberg et al. 2016).
Similarly, inhibition of CCL2/CCR2 signalling with the selective CCR2 antagonist CCX140-B
decreased UACR after 52 weeks of treatment in patients with type 2 diabetes (de Zeeuw,
Bekker et al. 2015). Recently, two CCR2/CCR5 antagonists have been investigated in clinical
trials although the data from these trials are yet to be published (NCT01752985,
NCT01712061).
Although these developed anti-inflammatory agents may be promising treatments for DKD,
their mechanisms of benefit in the kidney are not completely understood. Moreover, in each of
the examples I have cited of promising anti-inflammatory therapies for DKD, there has been a
central role of glomerular podocytes as either sites of action (JAK/STAT) or sites of
expression (CCL2).
1.4. Understanding podocyte (patho)biology: a key driver of therapeutic interventions for glomerular diseases
Podocytes are one of four resident cell types in the kidney glomerulus, along with endothelial
cells, mesangial cells, and parietal epithelial cells. They are important for kidney development
and normal kidney homeostasis and their injury is implicated in a range of kidney diseases.
Podocytes are highly specialized epithelial cells that form the final layer of the glomerular
filtration barrier, and therefore they act as the last gatekeeper by allowing passage of water and
small solutes and preventing large proteins from passing through the filtration barrier (reviewed
in Pavenstadt, Kriz et al. 2003). Over two decades ago, a landmark study by Pagtalunan and
colleagues demonstrated that podocyte loss plays a role in kidney disease progression in patients
with diabetes (Pagtalunan, Miller et al. 1997). Following this study, other research groups have
shown that podocyte depletion correlates with proteinuria, glomerulosclerosis, and kidney disease
progression in glomerular diseases (Lemley, Lafayette et al. 2002, Wharram, Goyal et al. 2005,
25
Weil, Lemley et al. 2012). Moreover, podocyte injury has been shown to contribute to the
pathogenesis of multiple glomerular diseases including membranous nephropathy (MN), minimal
change disease (MCD), focal segmental glomerulosclerosis (FSGS), and DKD (reviewed in
Mallipattu and He 2016).
Podocyte injury is far from the sole cause of glomerular disease and other glomerular cells,
notably mesangial cells, likely play a greater role in the progression of glomerular scarring
(Nahman, Leonhart et al. 1992, Amiri, Shaw et al. 2002, Giunti, Tesch et al. 2008). However,
there are a number of aspects about podocytes that make them particularly useful to model
(patho)biological mechanisms in glomerular diseases. Firstly, they are terminally differentiated
(reviewed in Mundel and Kriz 1995). Because they cannot regenerate, podocytes employ other
strategies to maintain their health. In particular, they have a high rate of autophagy, a self-repair
process that removes unnecessary or dysfunctional cellular components (Sato, Kitamura et al.
2006). Secondly, they communicate closely with other cells within the glomerulus (especially
endothelial cells), which makes them a good model to study paracrine signaling mechanisms
(reviewed in Siddiqi and Advani 2013). Thirdly, they are amenable to in vivo genetic
manipulation, thus the specific role of specific genes can be studied in experimental rodents
(reviewed in Bierzynska, Soderquest et al. 2015). Although advances in podocyte research in
recent decades have improved our understanding of the glomerular filtration process and helped
to unravel the underlying mechanisms of glomerular diseases, a better understanding of podocyte
biology in health and disease may lead to the discovery of new avenues to improve podocyte
function in glomerular diseases.
1.4.1. Podocyte structure and function
Podocytes have a fascinating cellular architecture that is uniquely tailored to their biological role
in the kidney (Figure 1.6). Under electron microscopy, podocytes can be seen to have a zipper-
like morphology that covers the GFB, which reflects their crucial role in preserving glomerular
integrity and function (Figure 6) (reviewed in Mundel and Shankland 2002). The term ‘podocyte’
derives from the Greek roots ‘podo’ (foot) and ‘cyte’ (cell) (reviewed in Weller and Wiley 1985).
A single podocyte consists of a cell body, major processes, and foot processes (reviewed in Kriz,
26
Kobayashi et al. 1998). The cell body faces the urinary space and it contains the main organelles
of the cell including nucleus, Golgi apparatus, rough and smooth endoplasmic reticulum,
lysosomes, and mitochondria (reviewed in Kriz, Kobayashi et al. 1998). Major processes
branching off the cell body are enriched in microtubules and they split into foot processes, which
are enriched in actin filaments. Podocyte foot processes interdigitate on the outer surface of the
GBM and they are linked by a unique junction referred to as the slit diaphragm (SD). The SD
consists of several proteins that play a pivotal role in maintaining the integrity of the podocyte
cytoskeleton (Kelly, Aaltonen et al. 2002).
Figure 1.6: The intricate beauty of podocytes. A scanning electron micrograph of podocytes
demonstrates podocyte morphology across the glomerulus. A single podocyte consists of a cell
body (CB), major processes (MP), secondary processes (SP), and foot processes (FP)
interdigitating with adjacent podocyte FP. Adapted from (Welsh and Saleem 2012) with
copyright permission from Springer Nature ©.
27
Advances in genetic tools allowed identification of podocyte cytoskeleton proteins such as
nephrin, podocin, and synaptopdin, and they commonly serve as podocyte-specific markers
(reviewed in Welsh and Saleem 2012). Dysregulation of the molecular machinery of the
podocyte cytoskeleton results in abnormal podocyte morphology notably foot process effacement
(FPE), which is one of the key features observed in proteinuric glomerular diseases (reviewed in
Mundel and Shankland 2002).
1.4.2. Podocytopathies in glomerular diseases
Podocytopathy is a term used to refer to a group of glomerular diseases that develop as a result of
podocyte loss or dysfunction (Pollak 2002). The unique position of podocytes in the glomerulus
and their inability to proliferate make them prone to various stressors (reviewed in Mundel and
Shankland 2002). When these stressors exceed the podocyte physiological limit, development of
podocytopathy occurs, which can be manifested as podocyte cytoskeleton remodeling, podocyte
loss, podocyte dedifferentiation, and abnormal crosstalk between podocytes and adjacent
glomerular cells.
One of the most common morphological features of podocytopathies is FPE, which can result
from disorganization of the podocyte cytoskeleton and impaired SD function (reviewed in
Brinkkoetter, Ising et al. 2013). Alterations in key podocyte cytoskeleton and SD genes have
been implicated in a range of glomerular diseases including DKD, MCD, FSGS, and MN
(reviewed in Kerjaschki 2001). For instance, hemodynamic and metabolic changes in DKD have
been shown to reduce expression of proteins essential for SD function such as nephrin, resulting
in FPE and an increase in albuminuria (Langham, Kelly et al. 2002, Doublier, Salvidio et al.
2003). Moreover, mutations in the gene encoding nephrin, NPHS1 has been found to cause
congenital nephrotic syndrome, which was first identified in Finnish patients and is characterized
by massive proteinuria shortly after birth (Huttunen, 1976; Kestilä, Lenkkeri et al., 1998). Other
mutations in genes critical for the actin cytoskeleton have been also identified including the gene
encoding α-actinin, which has been shown to contribute to the development of FSGS (Kaplan,
Kim et al. 2000). In addition to alterations in expression of genes essential for the podocyte
cytoskeleton, mechanical forces such as increased glomerular capillary pressure can also result in
28
remodeling of the podocyte cytoskeleton leading to podocyte loss and glomerulosclerosis (Kriz
and Lemley 2015).
Podocyte loss has been shown to contribute to proteinuric glomerular diseases (reviewed in
Tharaux and Huber 2012). Although the underlying mechanism of podocyte loss has been the
subject of debate, several studies have demonstrated that podocyte loss can result from podocyte
apoptosis or detachment from the GBM. Most of the data supporting podocyte apoptosis as a
leading mechanism for podocyte loss come from in vitro studies whereas podocyte apoptosis is
rarely observed in vivo, suggesting that podocyte loss is most likely attributable to detachment
(reviewed in Braun, Becker et al. 2016). Podocyte detachment was first observed in seminal
studies conducted in urine samples from patients with kidney diseases (Hara, Yamamoto et al.
1995, Hara, Yanagihara et al. 1998, Nakamura, Ushiyama et al. 2000, Nakamura, Ushiyama et al.
2000, Nakamura, Ushiyama et al. 2000). In these studies, podocytes were detected in urine
sediments from patients with several forms of glomerular diseases. In a subsequent study, the
investigators showed that the majority of the podocytes found in urine samples from patients with
glomerular diseases are viable, suggesting that podocyte depletion results from detachment from
the GBM rather than apoptosis (Vogelmann, Nelson et al. 2003). Irrespective of its underlying
mechanisms, podocyte loss leads to ‘bare’ regions of the GBM, which causes the denuded GBM
to come into direct contact with the Bowman’s capsule contributing to the development of FSGS
(reviewed in Kriz, Gretz et al. 1998).
Podocytes normally arise from mesenchymal cells via a mesenchymal–epithelial-transition
(MET) event (reviewed in May, Saleem et al. 2014). Mature podocytes have to be maintained in
their uniquely differentiated state to function properly. However, in the disease setting, mature
podocytes can undergo dedifferentiation, a process whereby cells lose their differentiated
characteristics to gain features of mesenchymal cells (reviewed in Jopling, Boue et al. 2011).
Reactivation of developmental pathways has been shown to contribute to the development of
kidney fibrosis (reviewed in Edeling, Ragi et al. 2016). Moreover, the phenotypic changes seen in
dedifferentiated podocytes have been observed to be associated with podocyte dysfunction and
proteinuria (Li, Kang et al. 2008). Recent work from our lab showed that reactivation of
developmental pathways in podocytes sensitized mice to glomerular disease and this has been
29
partly attributed to a decrease in the repressive histone H3 lysine 27 trimethylation (H3K27me3)
mark (Majumder, Thieme et al. 2018).
Accumulating evidence also supports the role of crosstalk between different glomerular cells in
the development and maintenance of glomerular function (reviewed in Menon, Chuang et al.
2012, reviewed in Siddiqi and Advani 2013). The podocyte response to external signals such as
growth factors or hormones and their communication with neighbouring cells are crucial for
podocyte health. Dysregulation of paracrine signalling pathways between podocytes and resident
cells such as endothelial cells in the glomerulus has been shown to contribute to podocytopathy
and heavy albuminuria in diabetic mice (Yuen, Stead et al. 2012).
1.4.3. Podocytes and repair mechanisms
Given that podocytes are terminally differentiated cells, they employ certain strategies to
maintain their health and adapt to stress. For instance, they have high levels of autophagy under
basal conditions compared to other cell types in the kidney (Asanuma, Tanida et al. 2003,
Mizushima, Yamamoto et al. 2004, Sato, Kitamura et al. 2005, Periyasamy-Thandavan, Jiang et
al. 2008, Hartleben, Gödel et al. 2010, Kimura, Takabatake et al. 2011). Autophagy is a self-
degradative process that involves delivering damaged proteins and organelles into double
membrane structures known as autophagosomes to lysosomes for digestion (reviewed in
Klionsky 2005). The presence of autophagosomes in podocytes has been reported in cultured
cells (Lemley, Lafayette et al. 2002, Cinà, Onay et al. 2012), in mice (Mizushima, Yamamoto et
al. 2004), and in human kidney biopsies (Sato, Kitamura et al. 2006). Several studies have
emphasized the similarity between podocytes and neuronal cells (reviewed in Kobayashi, Gao et
al. 2004, Rastaldi, Armelloni et al. 2006). Similar to neurons, autophagy has been recognized as a
key homeostatic mechanism to maintain podocyte integrity that is particularly essential for
postmitotic cells (reviewed in Hartleben, Wanner et al. 2014). A study conducted by Hartleben
and colleagues demonstrated that podocyte-specific deletion of autophagy related gene 5 (Atg5)
resulted in impaired autophagy, a remarkable increase of proteinuria, and glomerulosclerosis
(Hartleben, Gödel et al. 2010). Moreover, autophagy was shown to play a protective role in
hyperglycemia-induced podocyte injury (Fang, Zhou et al. 2013).
30
1.4.3.1. The autophagy-lysosomal pathway
Autophagy is a tightly regulated and conserved cellular process essential for eukaryotic cells to
survive and cope with stress. This process enables the cells to digest and recycle their own
damaged components, hence, the name autophagy– a Greek term that means self-eating
(reviewed in Klionsky 2008). There are three types of autophagy: microautophagy, chaperone-
mediated autophagy, and macroautophagy (reviewed in Mizushima and Komatsu 2011).
Microautophagy involves the direct lysosomal engulfment of cytoplasmic materials whereas
chaperone-mediated autophagy is a selective process that involves lysosomal degradation of
unfolded proteins delivered via specific chaperone proteins. Of the three types, the best-studied
and characterized process is macroautophagy, which is generally referred to as autophagy.
Autophagy is a dynamic process that involves multiple steps (reviewed in Mizushima and
Komatsu 2011). Activation of autophagy is normally induced by cellular stress or starvation. The
process begins by formation of a cup-like double-membrane structure that originates from the
endoplasmic reticulum known as a phagophore, which sequesters a portion of the cytoplasm.
This is followed by elongation and nucleation of the phagophore to form a sealed double-
membrane vesicle known as an autophagosome, which contains damaged organelles and cellular
components destined for degradation. The autophagosome then fuses with lysosomes for
digestion and the degraded substances are subsequently recycled back to the cytoplasm to be used
as a source of energy. A summary of autophagy steps is depicted in Figure 1.7.
31
Figure 1.7: Autophagy process. Activation of autophagy initiates a series of steps: 1) Initiation,
which involves assembly of initiation protein complexes and formation of the phagophore; 2)
Autophagosome formation, which involves elongation of the phagophore and autophagosome
maturation mediated by LC3 and ATG conjugation systems (recognition of damaged organelles
and cellular components is mediated by ubiquitin like proteins such as p62); 3) Fusion, a step in
which the autophagosome fuses with a lysosome for cargo delivery; and 4) Degradation, the final
step in which lysosomal enzymes facilitate breakdown of damaged cellular materials into
building blocks for recycling.
Each of the steps in the autophagy-lysosomal pathway is highly regulated by specific molecular
machinery. Several ATG proteins and protein complexes essential for autophagy processes have
been identified (reviewed in Yang and Klionsky 2010). Formation of the phagophore is regulated
by two initiation complexes: Unc-51-like autophagy activating kinase 1 and 2 (ULK1/2)
complex, and the class III phosphatidylinositol 3-kinase (PtdIns3K) complex. Activation of
ULK1 promotes recruitment of the initiation complexes essential for phagophore formation.
Phagophore elongation and autophagosome formation is mediated by microtubule-associated
protein 1 light chain 3 (LC3, the mammalian homologue of yeast ATG8) and ATG5-ATG12-
32
ATG16 conjugation systems. Activation of autophagy stimulates cleavage of the inactive pro-
LC3 precursor by the cysteine protease Atg4 to form the cytosolic protein LC3-I, which is then
converted to LC3-II via conjugation with phosphatidylethanolamine (PE). The lipidated LC3-II
acts as a cargo receptor and is incorporated into the autophagosomal membrane and therefore, it
is one of the reliable autophagosome markers commonly used to study autophagy (Kabeya,
Mizushima et al. 2000). The Atg5–Atg12 conjugation system is required for membrane tethering
and facilitates formation of LC3-II. Increase in LC3-II reflects an upregulation of autophagy
either as a result of increase in autophagic activity or a defect in autophagy completion. To
differentiate between the two, autophagy inhibitors and other markers are commonly used. For
instance, p62, a ubiquitin- and LC3-binding protein typically destined for degradation in the
lysosome, is used as a marker to assess autophagy turnover. Accumulation of p62 is indicative of
defective autophagic degradation. Moreover, chemical autophagy inhibitors (e.g. bafilomycin A1
and wortmannin) are also used in combination with autophagy markers to evaluate autophagic
activity.
The serine/threonine kinase mTOR complex 1 (mTORC1) plays a central role in autophagy
regulation (Roczniak-Ferguson, Petit et al. 2012). Under fed conditions, mTORC1 suppresses
autophagy via phosphorylation-dependent inhibition of ULK1/2 and class III PtdIns3K
complexes. At the transcriptional level, mTORC1 regulates the autophagy-lysosomal pathway by
regulating the activity of the transcription factor TFEB, a master regulator of autophagy and
lysosomal biogenesis (Settembre, Di Malta et al. 2011). Under basal conditions, mTORC1
phosphorylates TFEB at the lysosomal surface to remain in its inactive state in the cytoplasm.
However, when autophagy is activated, TFEB de-phosphorylates and translocates to the nucleus
to coordinate expression of genes essential for autophagy and lysosomal function.
1.4.3.2. Role of TFEB: a major regulator of the autophagy-lysosomal pathway
TFEB is a member of the microphthalmia (MiT) family of basic helix-loop-helix and leucine-
zipper transcription factors (reviewed in Steingrímsson, Copeland et al. 2004). Work by
Ballabio’s group nearly a decade ago revealed that expression of lysosomal genes is coordinated
at the transcription levels (Sardiello, Palmieri et al. 2009). In this study, the investigators
33
discovered that lysosomal genes share a palindromic conserved 10-base E-box-like sequence in
their promoter region, named coordinated lysosomal expression and regulation (CLEAR)
network, and that this motif was shown to be regulated by and bound to a single transcription
factor (i.e. TFEB). Moreover, TFEB overexpression in HeLa cells resulted in a significant
increase in the mRNA levels and the enzymatic activity of lysosomal genes (Sardiello, Palmieri
et al. 2009). Following this study, the same group showed that TFEB also regulates cellular
clearance pathways including autophagy and lysosomal exocytosis (Palmieri, Impey et al. 2011,
Settembre, Di Malta et al. 2011). TFEB has been shown to induce autophagy by enhancing the
expression of genes implicated in various autophagic steps including autophagosome synthesis
and autophagosome-lysosome fusion (Settembre, Di Malta et al. 2011). Furthermore, TFEB
activates the lysosomal Ca2+ channel Mucolipin 1 (MCOLN1) essential for Ca2+ release in
lysosomal exocytosis, a process that involves removal of lysosomal contents outside the cell via
fusion of lysosomes with the plasma membrane (Medina, Fraldi et al. 2011).
The importance of TFEB has been evidenced by the embryonic lethality of TFEB knockout in
mice (Steingrímsson, Tessarollo et al. 1998) and by subsequent studies that have explored the
tissue specific role of TFEB. The role of TFEB has been described in the liver (Settembre, De
Cegli et al. 2013), bone tissue (Ferron, Settembre et al. 2013), skeletal muscle (Mansueto,
Armani et al. 2017), and immune system (Visvikis, Ihuegbu et al. 2014, Samie and Cresswell
2015). Deletion of TFEB in the liver was shown to impair lipid break down and its
overexpression was able to prevent weight gain and enhance lipid catabolism in two mouse
models of obesity (Settembre, De Cegli et al. 2013). Moreover, absence of TFEB in osteoclasts
was demonstrated to cause a defect in bone resorption and reduction in expression of lysosomal
genes, highlighting the role of TFEB in lysosomal function in these cells (Ferron, Settembre et al.
2013). Activation of TFEB in macrophages and dendritic cells was reported to be required for
host defense in response to bacterial infection, suggesting that TFEB plays a protective role in the
immune response (Visvikis, Ihuegbu et al. 2014, Samie and Cresswell 2015). The protective role
of TFEB was also reported in skeletal muscle in which TFEB was observed to control glucose
homeostasis and mitochondrial biogenesis (Mansueto, Armani et al. 2017).
34
Although several studies have demonstrated that gene translocation in MiT family transcription
factors including TFEB is implicated in kidney cancers (reviewed in Kauffman, Ricketts et al.
2014, Argani 2015), comparatively little has been known about the functional role of TFEB in
the kidney and its implication in CKD. However, one study demonstrated that activation of TFEB
restored lysosomal dysfunction in proximal tubule cells isolated from urine of patients with
nephropathic cystinosis, a lysosomal storage disease caused by mutation in the lysosomal enzyme
cystinosin (CSTN) (Rega, Polishchuk et al. 2016). Moreover, decreased nuclear TFEB
localization was recently reported in podocytes from mice and humans with DKD and TFEB
overexpression was shown to rescue impaired autophagy completion in cultured podocytes
induced by advanced glycation end products (AGEs) (Zhao, Chen et al. 2018). In a separate
study, inhibition of TFEB has been reported to suppress podocyte autophagy following amino
acid starvation (Chen, Zhao et al. 2018). Collectively, these studies highlight the important role
of TFEB in maintaining cellular homeostasis in the kidney. Understanding the cell specific role
of TFEB in the kidney and enhancing cellular clearance by modulating TFEB activity may serve
as an attractive therapeutic strategy for CKD.
1.4.4. Podocytes as a model for paracrine communication
The integrity of the kidney glomerulus depends on the normal communication between its
components. Each of the glomerular components, which include mesangial cells, endothelial
cells, GBM, podocytes and parietal cells, has a unique position in the glomerulus tailored to their
function. Mesangial cells are located in between the glomerular capillaries to maintain the
structure and function of the capillary loops (reviewed in Scott and Quaggin 2015). The
glomerular vasculature is separated from the urine by the GBM, a thick matrix primarily made of
collagen IV and laminin, that acts as a scaffold for both glomerular endothelial cells lining the
glomerular capillaries and podocytes facing the urinary space; and all together they form the GFB
(reviewed in Miner 2012). Parietal epithelial cells line Bowman’s capsule and they have been
proposed to be involved in podocyte regeneration (reviewed in Shankland, Freedman et al. 2017).
Several studies have investigated crosstalk between podocytes and each of these components. For
instance, podocytes have been shown to be the principal source of collagen IV, which is one of
the essential proteins present in the fully mature GBM (Abrahamson, Hudson et al. 2009).
35
Moreover, podocyte-specific overexpression of laminin β1 (Lamβ1), a homolog of the major
laminin in the GBM known as Lamβ2, has been shown to prevent the development of nephrotic
syndrome in Lamβ2 knockout mice, a model of Pierson syndrome caused by Lamβ2 mutation in
humans (Suh, Jarad et al. 2011). Furthermore, podocyte-generated growth factors have been
shown to contribute to the development of mesangial matrix accumulation and
glomerulosclerosis in glomerular diseases, highlighting possible paracrine effects on mesangial
cells (Eremina, Cui et al. 2006, Lenoir, Milon et al. 2014). Podocytes have been also implicated
in activation of parietal epithelial cells in crescentic glomerulonephritis, demonstrating the
interaction between podocytes and parietal epithelial cells (reviewed in Shankland, Smeets et al.
2014). Additionally, dysregulated podocyte-endothelial crosstalk has been observed to contribute
to the development of DKD (Eremina, Sood et al. 2003, Yuen, Stead et al. 2012). The intimate
association of podocytes with glomerular cells, notably endothelial cells and the availability of
genetic tools that allow alterations of gene expression in podocytes make podocytes and
endothelial cells an ideal model to study paracrine communication within the glomerulus.
1.5. Glomerular endothelial cells
The vascular endothelium is a vital organ that plays multiple roles in the body to maintain
vascular homeostasis. Under physiological conditions, the vascular endothelium secretes
vasodilators (e.g. nitric oxide) and vasoconstrictors (e.g. endothelin) to control vascular tone
(reviewed in Deanfield, Halcox et al. 2007). Moreover, the vascular endothelium regulates
biological processes essential for maintaining vascular health including thrombosis, platelet
activation, leukocyte interaction, and fibrinolysis (reviewed in Deanfield, Halcox et al. 2007).
Being constantly exposed to the blood stream in the capillaries, glomerular endothelial cells are
placed at the front line of the filtration process and therefore, their integrity is crucial for normal
glomerular function. Glomerular endothelial cells control transcellular permeability through their
sieve-like fenestrations covered by a negatively charged layer of glycocalyx and an outer layer of
proteins known as the endothelial surface layer (ESL) (reviewed in Pries, Secomb et al. 2000,
reviewed in Reitsma, Slaaf et al. 2007). These integral components of the endothelium play a
central role in vascular permeability and regulate paracrine signalling between endothelial cells
36
and circulating blood or surrounding tissues (reviewed in Satchell and Braet 2009). The
glycocalyx is made up of glycoproteins and proteoglycans and is enriched with heparan sulphate
proteoglycans responsible for the negative charge characteristics of the endothelium (reviewed in
Reitsma, Slaaf et al. 2007). Disruption of the glycocalyx results in an increase in vascular protein
permeability, suggesting that the glycocalyx has an important role in restricting the passage of
large molecules across the filtration barrier (Singh, Satchell et al. 2007).
The role of glomerular endothelial cells extends beyond maintaining vascular homeostasis. For
instance, glomerular endothelial cells contribute to GBM formation (reviewed in Abrahamson
2012). Moreover, knockout studies have revealed the influence of glomerular endothelial cells on
mesangial cell growth via the actions of the growth factor platelet-derived growth factor B
(PDGF-B) and its receptor PDGFR-β (reviewed in Floege, Eitner et al. 2008). Mice lacking
PDGF-B in glomerular endothelial cells fail to form mesangial cells and similar phenotypes has
also been observed in PDGFR-β knockout mice (Leveen, Pekny et al. 1994, Soriano 1994).
Glomerular endothelial cells secrete and respond to a wide range of signalling factors that are
important for maintaining vascular tone and glomerular homeostasis. Nitric oxide (NO) is one of
the important factors synthesized by the enzymatic action of endothelial NO synthase (eNOS)
that mediates vasodilation, inhibition of inflammation, thrombosis, and cellular proliferation
(reviewed in Takahashi and Harris 2014). Loss of eNOS has been shown to predispose podocytes
to acute injury and accelerates kidney damage in diabetes, suggesting that the integrity of
glomerular endothelial cells is important for preserving podocyte function (Yuen, Stead et al.
2012). The role of glomerular endothelial cells in maintaining podocyte health has also been
evidenced by the protective role of the endothelial thrombomodulin–protein C system implicated
in thrombosis, inflammation, and fibrinolysis (Esmon 2001, Isermann, Vinnikov et al. 2007).
Increased thrombomodulin-mediated activation of protein C inhibits endothelial and podocyte
apoptosis, and protects against kidney dysfunction in diabetes (Isermann, Vinnikov et al. 2007).
Emerging research indicates that paracrine communication between podocytes and glomerular
endothelial cells is crucial for maintaining the integrity of the GFB, and abnormal podocyte-
endothelial crosstalk has been proposed as contributing to the development of albuminuria in
DKD (reviewed in Siddiqi and Advani 2013).
37
1.5.1. Podocyte-glomerular endothelial cell crosstalk
Glomerular endothelial cells are an integral component of the glomerular filtration barrier. Unlike
other endothelial cells, glomerular endothelial cells are highly specialized fenestrated cells lining
the glomerular capillaries with a glycocalyx layer coating the luminal surface essential for
regulating vascular permeability (Singh, Satchell et al. 2007). Loss- and gain-of- function studies
have identified several paracrine factors that mediate podocyte-endothelial crosstalk including
stromal cell–derived factor-1 (SDF-1) (Takabatake, Sugiyama et al. 2009), angiopoietins (Davis,
Dei Cas et al. 2007, Jeansson, Gawlik et al. 2011), semaphorins (Reidy, Villegas et al. 2009), and
VEGF (Eremina, Sood et al. 2003, Eremina, Jefferson et al. 2008). Here, the role of VEGF and
other mediators implicated in podocyte-endothelial crosstalk are reviewed as a means of
highlighting the biological importance of podocyte-endothelial communication.
1.5.1.1. Role of VEGF
VEGF is one of the podocyte-derived factors that has been most extensively studied in the
glomerulus (reviewed in Advani 2014, reviewed in Bartlett, Jeansson et al. 2016, reviewed in
Majumder and Advani 2017). VEGF is a member of the VEGF/ PDGF family that plays an
important role in blood vessel (patho)biology. There are five members of the VEGF family
identified in mammals including VEGF-A, VEGF-B, VEGF-C, VEGF-D and placental growth
factor (PGF). VEGF-A is the best-studied member of the VEGF family and its role is critical for
glomerular development and function. Although VEGF-A expression has been reported in other
cell types in the kidney, podocytes are the major source of VEGF-A in the renal glomerulus
(Cooper, Vranes et al. 1999). VEGF-A exerts its actions via binding to two cognate receptors
VEGFR-1 and VEGFR-2, and two co-receptors neuropilin-1 and neuropilin-2 (reviewed in
Advani 2014). However, most of the biological actions of VEGF-A occur mainly through
signaling by binding to VEGF-R2, which is expressed by the glomerular endothelial cells
(Cooper, Vranes et al. 1999). VEGF-A plays a central role in blood vessel formation,
angiogenesis, and proliferation, differentiation, and survival of endothelial cells (reviewed in
Eremina and Quaggin 2004). Moreover, the actions of VEGF-A have been reported in several
physiological and pathological conditions including tumor angiogenesis (reviewed in Ferrara
38
2002), wound healing (Nissen, Polverini et al. 1998), diabetic retinopathy (Awata, Inoue et al.
2002), age-related macular degeneration (Heier, Brown et al. 2012), and glomerular diseases
(reviewed in Advani 2014).
VEGF-A has five different isoforms in humans as a result of alternative splicing including
VEGF121, VEGF145, VEGF165, VEGF189, and VEGF206 (reviewed in Majumder and Advani 2017).
In humans, VEGF-A165 is the most abundant isoform. The paracrine effect of podocyte-secreted
VEGF-A on glomerular endothelial cells has been well documented (reviewed in Advani and
Gilbert 2012, reviewed in Siddiqi and Advani 2013, reviewed in Advani 2014, reviewed in
Bartlett, Jeansson et al. 2016, reviewed in Majumder and Advani 2017). Podocyte-derived VEGF
has a primary role in fenestrae formation (Breier, Albrecht et al. 1992, Esser, Lampugnani et al.
1998, reviewed in Quaggin and Kreidberg 2008). Moreover, upregulation of both VEGF-A and
VEGFR-2 has been reported in diabetic rodents (Cooper, Vranes et al. 1999, Braun, Kardon et al.
2001, Cheng, Wang et al. 2002), and its blockade has been demonstrated to attenuate albuminuria
and kidney dysfunction in experimental models of diabetes (De Vriese, TILTON et al. 2001,
Flyvbjerg, Dagnæs-Hansen et al. 2002). Gene manipulations of VEGF-A in the podocytes of
experimental animals and later studies in human kidney biopsies have improved our
understanding of VEGF-A role in the glomerulus. Complete knockout of VEGF-A in podocytes
was shown to result in impaired formation of the GFB and prenatal death whereas podocyte-
specific VEGF-A heterozygous deletion causes proteinuria and endotheliosis (Eremina, Sood et
al. 2003). Overexpression of VEGF-A165 in podocytes also had detrimental effects in the kidney
including causing progressive proteinuria, and considerable glomerular hypertrophy as a result of
podocyte hypertrophy, and augmented proliferation of mesangial cells and glomerular capillaries
(Liu, Morimoto et al. 2007).
1.5.1.2. Other mediators of endothelial-podocyte communication
During embryonic development, podocytes produce the chemokine SDF-1 (also known as
chemokine C-X-C motif ligand 12 (CXCL12) , which binds to the G-protein coupled receptor
CXCR4 expressed by endothelial cells to mediate renal vessel formation (Takabatake, Sugiyama
et al. 2009). Blocking SDF-1/CXCR4 signalling was shown to prevent progression of
39
glomerulosclerosis and albuminuria in an experimental model of diabetes (Sayyed, Hägele et al.
2009).
Angiopoietins are another family of vascular growth factors implicated in normal vascular
development. Angiopoietin-1 and angiopoietin-2 are two members of angiopoietin proteins that
have been well investigated. Both angiopoietin-1 and angiopoietin-2 mediate their actions via
binding to their tyrosine kinase receptor Tie2 expressed by glomerular endothelial cells.
However, they have opposing effects in endothelial cells (Maisonpierre, Suri et al. 1997).
Podocyte-derived angiopoietin-1 is essential for vascular development and has been shown to
protect glomerular vasculature in DKD (Jeansson, Gawlik et al. 2011). Angiopoietin-2 is a
natural antagonist for Tie-2 expressed in endothelial cells and its upregulation has been reported
in DKD (Sun, Zheng et al. 2007). Podocyte-specific overexpression of angiopoietin-2 was
observed to result in glomerular endothelial cell apoptosis and albuminuria (Davis, Dei Cas et al.
2007).
Semaphorins are membrane-associated proteins expressed in most tissues and best known for
their roles in axonal growth (reviewed in Yazdani and Terman 2006). In the kidney, the
semaphorin, Sema3a, is produced by podocytes and it plays an essential role in glomerular
development (Reidy, Villegas et al. 2009). Overexpression of Sema3a in podocytes has been
shown to promote glomerular endothelial apoptosis, and its deletion results in endothelial
overgrowth (Villegas and Tufro 2002). Moreover, the phenotypic effect of Sema3a
overexpression in podocytes, particularly dysregulated αvβ3 integrin activity, is similar to that
seen with podocyte-specific VEGF-A deletion, suggesting a convergence between semaphorin
signalling and VEGF signalling (Veron, Villegas et al. 2012, Reidy, Aggarwal et al. 2013).
Taken together, these observations highlight the intimate association between podocytes and
glomerular endothelial cells and the importance of paracrine communication between the two cell
types in preserving the permselectivity of the GFB and maintaining the integrity of the kidney
glomerulus.
40
1.5.2. Glomerular endothelial dysfunction in DKD
Several studies have emphasized both the role of glomerular endothelial cells in the maintenance
of glomerular homeostasis, and the impact of the diabetic milieu on glomerular endothelial cells.
Endothelial dysfunction is a term used frequently in the literature to describe the inability of the
endothelium to maintain vascular homeostasis (reviewed in Widlansky, Gokce et al. 2003). In
diabetes, imbalance in metabolic, hemodynamic and inflammatory factors induced by persistent
hyperglycemia contributes to glomerular endothelial dysfunction, which is regarded as an early
event that leads to microalbuminuria occurrence in DKD (Deckert, Feldt-Rasmussen et al. 1989,
reviewed in Stehouwer 2004, Nieuwdorp, Mooij et al. 2006). Loss of the glomerular ESL
containing glycocalyx has been observed to be associated with albuminuria in rodent models of
diabetes (Kuwabara, Satoh et al. 2010), in patients with type 1 diabetes (Nieuwdorp, Mooij et al.
2006), and in patients with type 2 diabetes (Broekhuizen, Lemkes et al. 2010). Loss of the
glomerular ESL has been attributed to high levels of ROS resulting in upregulation of the ESL
degrading enzyme, heparanase, and the development of albuminuria (Kuwabara, Satoh et al.
2010). The diabetic milieu was also shown to cause a reduction in eNOS expression in
glomerular endothelial cells leading to impaired production of NO, which has been shown to
accelerate DKD progression in experimental models of diabetes (Zhao, Wang et al. 2006,
reviewed in Nakagawa 2007, reviewed in Brosius, Alpers et al. 2009, Yuen, Stead et al. 2012). In
a recent study, restoration of glomerular endothelial glycocalyx by the selective endothelin A
receptor antagonist, atrasentan, was shown to be associated with an increase in NO levels, and
reduction in albuminuria in streptozotocin (STZ)-diabetic apolipoprotein E knockout (apoE KO)
mice, a model of DKD that combines renal and vascular injury (Boels, Avramut et al. 2016).
The role of the vascular endothelium in controlling inflammatory activities is also well
recognized (reviewed in Trepels, Zeiher et al. 2006). Under physiological conditions, NO limits
leukocyte adhesion and maintains an anti-inflammatory effect in the blood vessel wall (reviewed
in Widlansky, Gokce et al. 2003). In diabetes, elevation of proinflammatory cytokines and
chemokines contributes to endothelial activation, an inflammatory response that results in
upregulation of adhesion molecules such as VCAM-1, ICAM-1, and E-selectin (reviewed in
Galkina and Ley 2006). Upregulation of adhesion molecules in response to pro-inflammatory
cytokines promotes migration of leukocytes to the vessel wall leading to vascular damage, and
41
kidney dysfunction (reviewed in Galkina and Ley 2006). Although many studies have
demonstrated the involvement of glomerular endothelial cells in the pathogenesis of DKD, the
molecular mechanisms that lead to glomerular endothelial activation remain incompletely
understood. In the case of activated protein C, however, activated protein C in endothelial cells
was shown to regulate glucose-mediated mitochondrial ROS production in podocytes via changes
in DNA hypomethylation and histone modification (i.e. histone H3 acetylation) (Bock, Shahzad
et al. 2013), two processes that are involved in a set of gene regulatory mechanisms termed
epigenetics.
1.6. The emerging role of epigenetics in DKD
The term epigenetics, originally coined by Conrad Waddington (Waddington 1939), has been
commonly used in the literature to refer to the study of external modifications that alter gene
expression without changing the DNA base sequence (Waddington 1939, reviewed in Lewin
1998). Epigenetic mechanisms have been postulated as underlying the mechanism of the
‘metabolic memory’ phenomenon in diabetes, which refers to increase in complication risk
following an early exposure to hyperglycemia even after glycemic control improvement
(reviewed in Reddy, Zhang et al. 2015). This phenomenon emerged after the publication of an
observational study of the DCCT cohort, the Epidemiology of Diabetes Interventions and
Complications (EDIC) trial (DCCT/EDIC and Group 2000). The data from the EDIC trial
showed that reduction in microvascular complications as a result of intensive glycemic control in
the DCCT trial was notably maintained despite increasing hyperglycemia (DCCT/EDIC 2011). A
biochemical basis for glycemic memory is supported by a former study in which the investigators
demonstrated that the effect of hyperglycemia on increased expression of fibronectin in
endothelial cells and in kidneys from diabetic rats persisted even after restoration of
normoglycemic conditions (Roy, Sala et al. 1990). Because epigenetic processes provide a means
by which a transient environmental insult (e.g. hyperglycemia) can cause persistent phenotypic
changes (e.g. long term complications), they have been postulated as being responsible for the
paradigm of metabolic memory, and a number of studies support this assertion. For instance,
transient exposure of mice and cultured endothelial cells to high glucose has been shown to cause
persistent epigenetic changes (in this case increased monomethylation of histone 3 H3 lysine 4)
42
in the promoter of the NF-B p65 subunit, a major transcription factor that drive
proinflammatory gene expression (El-Osta, Brasacchio et al. 2008).
Epigenetic changes can be mediated by DNA methylation, post-translational histone
modifications (PTHMs), and non-protein coding RNA, including long non-coding RNAs
(lncRNAs) and microRNAs (miRNAs) (reviewed in Goldberg, Allis et al. 2007). However, DNA
methylation and PTHMs are the most extensively investigated epigenetic mechanisms in
metabolic memory (Brasacchio, Okabe et al. 2009, reviewed in Keating and El Osta 2013).
Hyperglycemia can induce irreversible modifications in DNA methylation and PTHMs overtime,
which may explain the lasting detrimental effects of metabolic memory (reviewed in Reddy,
Zhang et al. 2015).
DNA methylation involves addition of a methyl group to DNA cytosine residues (reviewed in
Portela and Esteller 2010). The implication of DNA methylation changes in kidney disease was
discovered more than a decade ago when Stenvinkel and colleagues reported that high levels of
global DNA methylation are associated with inflammation and increased mortality in patients
with CKD (Stenvinkel, Karimi et al. 2007). The observation coincided with emerging reports
connecting hyperglycemia, DKD, and metabolic syndrome with epigenetic changes (Heijmans,
Tobi et al. 2008, Holman, Paul et al. 2008, DCCT/EDIC 2011). Subsequent studies examined
the effect of DNA methylation on the expression of key pathological genes implicated in
CKDs. For instance, DNA methylation was identified in enhancer regions of key fibrotic genes
in human kidney tissues from patients with hypertensive and diabetic CKD, suggesting that
DNA methylation contributes to fibrogenesis in CKD (Ko, Mohtat et al. 2013). Furthermore,
DNA hypomethylation has also been reported to contribute to heritable glycemic memory in
zebrafish (Olsen, Sarras et al. 2012).
Epigenetic changes due to chromatin remodelling play a central role in regulating gene
expression via changing the conformation of the DNA-histone complex between a
transcriptionally accessible or inaccessible state (reviewed in Goldberg, Allis et al. 2007). This
is mainly mediated by post-translational modifications (PTMs) of octameric core histone
proteins known as H2A, H2B, H3 and H4, around which DNA approximately 147 base pairs
long are coiled to form the nucleosome. These histones are subject to different types of PTMs
43
regulated by specific enzymes including methylation, phosphorylation, acetylation,
ubiquitylation, and sumoylation (reviewed in Portela and Esteller 2010). The best studied of
these modifications are histone acetylation and histone methylation, which both have been
associated with the development of diabetes complications (El-Osta, Brasacchio et al. 2008,
reviewed in Villeneuve and Natarajan 2010, Advani, Huang et al. 2011, Gilbert, Huang et al.
2011). Each of these modifications denotes epigenetic signatures associated with gene silencing
or activation and they can exert their effects in a combinatorial fashion (reviewed in Strahl and
Allis 2000). For example, H3K27me3 is a repressive epigenetic mark whereas acetylation of
histone H3 lysine 9 (H3K9ac) at gene promoters is an activating epigenetic mark, and both
coordinate to regulate gene expression (Ha, Ng et al. 2011). Decreased H3K27me3
trimethylation has been shown to contribute to pathophysiological mechanisms in DKDs
(Siddiqi, Majumder et al. 2016). Moreover, recent work from our own group showed that
decreased H3K27me3 levels in adult glomerular podocytes promoted podocyte
dedifferentiation and enhanced glomerular disease progression whereas gain of H3K27me3
levels restored kidney function in several experimental models of glomerular disease
(Majumder, Thieme et al. 2018). Contribution of other histone modifications to the
pathogenesis of DKD has only begun to be explored. For instance, upregulation of the
epigenetic phospho-serine 10 modification of histone H3 (H3Ser10) has recently been reported
to be implicated in chromatin remodelling in podocytes of diabetic mice with key features of
DKD (Badal, Wang et al. 2016). In this work, the investigators showed that attenuation of
H3Ser10 phosphorylation by modulating two upstream regulators including miRNA-93 and
mitogen and stress-activated kinase-2 (Msk2) improved biochemical and histological features
of DKD. Unravelling the epigenetic processes implicated in glomerular dysfunction in diabetes
and mapping the sites and the cell type of epigenetic marks in kidney in health and disease may
open new avenues for targeted drug development that can improve outcomes in patients with
CKD including CKD caused by diabetes.
44
1.7. Research aims and hypotheses
As reviewed in this Chapter, CKD is a global health problem and diabetes is a major contributor
to the pandemic predicted to increase over the next decade (reviewed in Zimmet, Magliano et al.
2014). CKD caused by diabetes accounts for the majority of kidney disease cases, which can
progress to kidney failure despite current available treatments, urging for new therapies to
prevent or slow the disease progression. In my doctoral research, I have explored emerging
(patho)biological processes in glomerular cell health and disease. I began by exploring the
actions of JAK2 in podocytes identifying a key role for the kinase in regulating podocyte
autophagy (Chapter 2). I then explored the effects of JAK2 deletion or inhibition in the setting
of diabetes and identified a pivotal importance of proinflammatory pathway upregulation, in
particular, upregulation of the chemokine CCL2 (Chapter 3). Finally, I examined the signalling
process by which CCL2 affects glomerular endothelial cell activation in diabetes, identifying
that this involves epigenetic processes, specifically, phosphorylation of histone 3 H3 on seine
residue 10 (Chapter 4).
Study 1
Rationale:
Podocyte integrity is important for proper glomerular filtration. To maintain their health,
podocytes rely on homeostatic cellular processes such as autophagy and intrinsic signaling
pathways including the JAK/STAT pathway, which is a major signaling pathway essential for
cell survival and function. Deletion of JAK2 in mice is embryonic lethal and upregulation of its
activity has been reported in mice and humans with DKD. Several studies highlighted the role of
JAK2 in kidney cells; however, the fundamental role of JAK2 in podocytes remains unknown.
This study (Chapter 2) aimed to characterize the effect of JAK2 deletion in podocytes under
physiological conditions using podocyte-specific JAK2 knockout mice.
Hypothesis:
JAK2 is an essential regulator of podocyte homeostasis.
45
Study 2
Rationale:
Having described the homeostatic action of JAK2 in podocytes in the normal setting in Study 1
(Chapter 2), and recognizing that JAK2 inhibition is being trialed for the treatment of DKD, this
study aimed to explore the effect of both systemic JAK2 inhibition and JAK2 deletion from
podocytes in mouse models of diabetes.
Hypotheses:
1. Systemic JAK2 inhibition will attenuate kidney dysfunction in diabetes
2. JAK2 deletion in podocytes will exacerbate kidney dysfunction in diabetes
Study 3
Rationale:
Paracrine communication between podocytes and glomerular endothelial cells is critical for
preserving the permselectivity of the GFB. In diabetes, the diabetic milieu induces the release of
inflammatory cytokines and chemokines by resident cells in the kidney. Having identified that
the chemokine CCL2 is upregulated in cultured podocytes under high glucose conditions in
Study 2 (Chapter 3), in this study (Chapter 4), we set out to determine the effect of podocyte-
secreted CCL2 on glomerular endothelial cell activation focusing on VCAM-1 as a marker for
endothelial activation.
Hypothesis:
Podocyte-secreted CCL2 contributes to endothelial activation in the kidney glomerulus in
diabetes.
46
CHAPTER 2: Janus Kinase 2 Regulates Transcription
Factor EB Expression and Autophagy Completion in
Glomerular Podocytes
Sections have been adapted with permission from Alghamdi, T.A., Majumder, S., Thieme, K.,
Batchu, S.N., White, K., Liu,Y., Brijmohan, A.S., Bowskill, B. Advani, S.L., Woo, M., Advani,
A. (2017). JAK2 regulates transcription factor EB expression and autophagy completion in
glomerular podocytes. Journal of American Society of Nephrology. 28(9):2641-2653.
Contribution of authors:
T.A.A. designed and performed the experiments, analyzed the data, and wrote the manuscript.
S.M., K.T., and S.N.B. contributed to the experiments and generation of data (specifically, Figure
2.4B and C, Figure 2.6C and E, Figure 2.8, Table 2.2, Table 2.3, Figure 2.9G, Figure 2.10, Figure
2.11A and E). K.W. contributed to the transmission electron microscopic data. Y.L. assisted with
the in vitro experiments. A.S.B. contributed to the immunofluorescence staining data presented in
Figure 2.9F. B.B.B assisted with the animal studies. S.L.A. contributed to the
immunohistological data presented in Figure 2.5. M.W. contributed to the in vivo data and
revised the manuscript. A.A. designed the experiments, supervised the study, and wrote the
manuscript.
47
2.1. INTRODUCTION
Podocytes are in a unique situation. As terminally differentiated epithelial cells with
interdigitating feet that encompass the capillary walls within the glomerular tuft, they are
uniquely exposed to metabolic shifts and hemodynamic pressures that render them vulnerable to
injury in glomerular disease. Where the potential for regeneration and replacement is limited,
podocytes depend heavily on their use of homeostatic pathways to mitigate the pressures that
they face. For instance, they possess a high basal rate of macroautophagy (henceforth referred to
as autophagy), a self-degradative process that removes protein aggregates and damaged
organelles (Hartleben, Gödel et al. 2010). They also depend on intrinsic survival signals, among
them signals that are mediated by the nonreceptor kinase, JAK2 (Logar, Brinkkoetter et al. 2007).
The JAK/STAT pathway is an intracellular signaling cascade that regulates cell growth,
proliferation, and differentiation (reviewed in Chuang and He 2010). Of the four JAK family
members (JAK1, JAK2, JAK3, and TYK2), the JAK2 isoform has become a focus of accelerated
drug discovery attentions since 2005, when activating mutations of its encoding gene were first
shown to underlie the development of certain myeloproliferative neoplasias (Kralovics,
Passamonti et al. 2005). In kidney disease, evidence of JAK/STAT pathway activation in human
diabetic nephropathy (Berthier, Zhang et al. 2009, Hodgin, Nair et al. 2013) encouraged the
repurposing of the JAK1/2 inhibitor baricitinib, and this was recently shown to reduce
albuminuria and markers of renal inflammation in a phase 2 study (Tuttle, Brosius et al. 2018).
Although current advances have shone the spotlight on JAK/STAT signaling as a promising
treatment target for kidney disease (reviewed in Brosius Iii and He 2015), this is not itself a new
concept. It has been a decade and a half since JAK2-mediated signaling was first implicated in
the development of kidney inflammation and fibrosis, an inference that came about with the
publication of a collection of reports describing its actions in glomerular mesangial cells (Amiri,
Shaw et al. 2002, Wang, Shaw et al. 2002, Banes, Shaw et al. 2004). Since then, podocyte
preservation has gained increasing traction for its importance in preventing both the initiation and
propagation of glomerular disease (reviewed in Wolf, Chen et al. 2005, reviewed in Shankland
2006), and in contrast to the studies in replicating mesangial cells, the few reports that have
examined the actions of JAK2 in podocytes have cited the kinase as being a mediator of cell
survival (Logar, Brinkkoetter et al. 2007, Schiffer, Park et al. 2008). Cognizant of the growing
48
interest in therapeutic applications that alter JAK/STAT signaling in kidney disease and the
dearth of literature espousing the homeostatic actions of the pathway in podocytes, in this study,
we set out to examine the phenotypic effects of JAK2 absence. To our surprise, we found that
JAK2 deficiency in mice led to an impairment in autophagy in podocytes, and in exploring the
means by which this occurred, we identified a hitherto unrecognized action of JAK2 in
controlling the expression of the master regulator of autophagy (Settembre, Di Malta et al. 2011)
and lysosome function (Sardiello, Palmieri et al. 2009), the transcription factor TFEB.
2.2. RESEARCH DESIGN AND METHODS
2.2.1. Animal studies
2.2.1.1. Generation of Podocin-cre+R26Rfl/fl mice
Podocin-cre+ mice, transgenic mice that express Cre recombinase specifically in podocytes
controlled by the human podocin (NPHS2) promoter [B6.Cg-Tg(NPHS2-cre)295Lbh/J] (Moeller,
Sanden et al. 2003), and R26Rfl/fl mice, reporter mice that have a loxP-flanked DNA STOP
sequence to prevent β-galactosidase expression [B6;129S4-Gt(ROSA)26Sortm1Sor/J](Soriano
1999), were obtained from the Jackson Laboratory (Bar Harbor, ME). Mice were bred in the St.
Michael’s Research Vivarium.
2.2.1.2. Generation of podocyte-specific JAK2 knockout mice
Jak2fl/fl mice were provided by Dr. Kay-Uwe Wagner (Nebraska Medical Center) (Krempler, Qi
et al. 2004). Podocin-cre+ mice were bred with Jak2fl/fl mice to generate podocyte-specific JAK2
knockout mice Podocin-cre+Jak2fl/fl (JAK2podKO) and their Cre expressing littermates (JAK2Ctrl).
Male JAK2Ctrl (n=10) and JAK2podKO mice (n=12) were studied at 10 weeks of age, and
albuminuria was determined in an additional four mice per group at age 6 months old. Systolic
BP was measured using a CODA Noninvasive BP System (Kent Scientific, Torrington, CA)
(Yuen, Stead et al. 2012). Urine albumin excretion was determined by ELISA (Assaypro, St.
Charles, MO) after housing mice individually in metabolic cages for 24 hours. After harvesting,
49
mouse kidneys were immersed in 10% neutral buffered formalin, routinely processed, and
embedded in paraffin; cryoembedded in Tissue-Tek optimum cutting temperature formulation
compound (VWR International, Mississauga, ON, Canada); flash frozen in liquid nitrogen and
stored at -80°C; or fixed in 2.5% gluteraldehyde for later analysis by transmission electron
microscopy. All experimental procedures adhered to the guidelines of the Canadian Council on
Animal Care and were approved by the St. Michael’s Hospital Animal Care Committee.
2.2.2. β-Galactosidase expression
Kidney cryosections were obtained from Podocin-cre+R26Rfl/fl mice and their control group
Podocin-cre- mice. X-gal staining of kidney cryosections was performed using an X-Gal
Staining Kit (Oz Biosciences, San Diego, CA) according to the manufacturer’s instructions.
Briefly, tissue section slides were fixed with the provided fixing solution and incubated for 10-15
minutes at room temperature. The fixing solution was discarded and the slides were carefully
washed twice with 1X phosphate-buffered saline (PBS). After washing, freshly prepared 1X
staining solution of X-Gal was added to each slide. The slides were then incubated at 37 ºC
overnight. The following day, the X-Gal staining solution was removed and slides were washed
once with 1X PBS. Mounting media was added to each slide. The slides were left to dry and the
tissue sections were examined under a light microscope for blue stained cells.
2.2.3. Primary culture of podocytes
Glomeruli were isolated from JAK2Ctrl and JAK2podKO mice using Dynabeads. After isoflurane
anesthesia, the abdominal aorta was cannulated with a 24-gauge angiocath, and the mouse was
perfused with 1×105 Dynabeads (ThermoFisher Scientific, Rockford, IL) in 5 ml Hank’s
Balanced Salt solution (HBSS) (ThermoFisher Scientific). Podocytes were isolated using
previously reported methods (Shankland, Pippin et al. 1999, Stitt-Cavanagh, Faour et al. 2010).
Briefly, for each animal, both kidneys were minced into 1 mm3 and digested at 37 °C for 30 min
with gentle agitation in 5 ml of Collagenase type I (Thermofisher Scientific) freshly prepared at a
50
concentration of 2 mg/ml. The digested kidney tissues were then gently pressed through a 100
µm sterile cell strainer (Thermofisher Scientific) using a flattened pestle. The filtered cells were
passed through a new 100 µm sterile cell strainer without pressing and the cell strainer washed
with 5 ml HBSS. The cell suspension was then centrifuged at 200 g for 5 min. The supernatant
was then discarded and the cell pellet was resuspended in 2 ml of HBSS. Glomeruli containing
Dynabeads were gathered using MagRack 6 (VWR International, Mississauga, ON, Canada).
Isolated glomeruli were visualized under light microscope (Figure 2.1). Glomeruli were then
seeded on collagen 1–coated plates in a 1:1 mixture of F-12 Kaighn’s Modification media
(HyClone Laboratories, Logan, UT) with media harvested from NIH/3T3 cells (American Type
Culture Collection, Manassas, VA). Cell cultures were maintained for approximately 4–6 days
and were not passaged (Katsuya, Yaoita et al. 2006). For flow cytometry, cells were stained with
anti-nephrin antibody (1:100; R&D Systems, Minneapolis, MN) and Alexa Fluor 488 donkey
anti-goat antibody (1:100; ThermoFisher Scientific) before analysis using a Fortessa X-20 (BD
Biosciences, San Jose, CA). Data analysis was with FlowJo software version 10.2 (FlowJo LLC,
Ashland, OR).
Figure 2.1: An isolated Dynabeads-perfused glomerulus. Original magnification ×400.
51
2.2.4. Immunoblotting
Immunoblotting was performed on cultured cell extracts with antibodies in the following
concentrations: nephrin (1:1000; R&D Systems), JAK2 (1:1000; Cell Signaling Technology,
Danvers, MA), -tubulin (1:1000; Sigma-Aldrich, Oakville, ON, Canada), LC3 (1:1000; Cell
Signaling Technology), p62 (1:1000; BD Biosciences), LAMP2 (1:1000; Abcam, Cambridge,
MA), ß-actin (1:10,000; Sigma-Aldrich), TFEB (1:500; Abcam), and GFP (1:1000; Santa Cruz
Biotechnology, Dallas, TX). Densitometry was performed using ImageJ 1.46r software (National
Institutes of Health, Bethesda, MD).
2.2.5. Immunofluorescence staining
Immunofluorescence microscopy was performed on formalin-fixed, paraffin-embedded kidney
sections and cultured cells with antibodies in the following concentrations: JAK2 (1:50; Cell
Signaling Technology), secondary antibody Alexa Fluor 488 donkey anti-rabbit (1:100;
ThermoFisher Scientific), p62 (1:100; Cell Signaling Technology), secondary antibody Alexa
Fluor 555 donkey anti-rabbit (1:100; ThermoFisher Scientific), LAMP2 (1:100; Abcam),
secondary antibody Alexa Fluor 488 donkey anti-rat (1:100; ThermoFisher Scientific), TFEB
(1:100; Abcam), nephrin (1:100; R&D Systems), and secondary antibody Alexa Fluor 647
donkey anti-goat (1:100; ThermoFisher Scientific). DAPI was from Cell Signaling Technology
and used at a concentration of 1:10,000. Slides were visualized on a Zeiss LSM 700 confocal
microscope (Carl Zeiss Canada, Toronto, ON, Canada). For p62, p62-positive puncta were
counted in six glomeruli from six mice per group. For LAMP2, mean fluorescence intensity was
determined in six glomeruli from six mice per group using ImageJ and represented as the fold
change relative to control. In cultured cells, LAMP2 was calculated as the mean fluorescence
intensity from four samples per condition, and nuclear TFEB was calculated as the proportion of
positively immunostaining nuclear pixels (red) in five fields (x6300 magnification) from nine
samples per condition using Adobe Photoshop 7.0 (San Jose, CA), with both represented as the
fold change relative to control (scramble).
52
2.2.6. Transmission electron microscopy
Transmission electron microscopy was performed with a Philips CM100 transmission electron
microscope (Electron Microscope Research Services, Newcastle University, Newcastle upon
Tyne, United Kingdom). Kidney cortical tissue was examined in each mouse as well as JAK2
siRNA and scramble-transfected podocytes (n=6 per condition). The volume fraction of
autophagosomes (or lysosomes) was calculated on 10–20 representative electron micrographs
(x7900 magnification) from each mouse or each experimental replicate with a masked
quantitative point counting method using ImageJ (Advani, Huang et al. 2011).
2.2.7. Conditionally immortalized mouse podocytes
Differentiated conditionally immortalized mouse podocytes were cultured as previously
described (Endlich, Kress et al. 2001). For knockdown of JAK2, cells were transfected with
sequence-specific siRNA or scrambled siRNA (ThermoFisher Scientific) at a concentration of 75
nM for 24 hours. For experiments with EBSS, RPMI medium (Sigma-Aldrich) was replaced by
EBSS (Sigma-Aldrich) 5 hours after the addition of siRNA (or scrambled siRNA), and cells were
maintained for another 19 hours. Bafilomycin A1 (Sigma-Aldrich) was used at a concentration of
100 nM for 4 hours (Lenoir, Jasiek et al. 2015). TFEB overexpression was achieved by
transfecting cells with a p-EGFP-N1-TFEB construct (Roczniak-Ferguson, Petit et al. 2012) (gift
from Shawn Ferguson; Addgene plasmid 38119; Addgene, Cambridge, MA) for 24 hours.
Cathepsin D activity was determined with a commercial kit (Abcam).
2.2.8. Real-Time PCR
RNA was isolated from cell extracts using TRIzol Reagent (ThermoFisher Scientific), and cDNA
was reverse transcribed from 1 g RNA using SuperScript III Reverse Transcriptase
(ThermoFisher Scientific). Primers were designed and validated using Primer-BLAST
(http://www.ncbi.nlm.nih.gov/tools/primer-blast/), and they were synthesized by Integrated DNA
Technologies (Coralville, IA). Primer sequences are provided in the appendix. Measurement of
gene expression was performed using SYBR green on a ViiA 7 Real-Time PCR System
53
(ThermoFisher Scientific). For experiments in primary cells, mRNA levels were determined in
podocytes from four JAK2Ctrl mice and four JAK2podKO mice. Experiments were performed in
triplicate, and data analyses were conducted using the Applied Biosystems Comparative CT
method.
2.2.9. Promoter Reporter Assay
Podocytes were transfected with a luciferase reporter under the control of the TFEB promoter
(Tsunemi, Ashe et al. 2012) (gift from Albert La Spada; Addgene plasmid 66801; Addgene).
Cells were transfected with JAK2 siRNA or scramble for 24 hours before determination of
luciferase activity with a reporter assay system (Promega, Madison, MA).
2.2.10. Chromatin Immunoprecipitation
Chromatin immunoprecipitation was performed using the Magna ChIP Kit (EMD Millipore,
Etobicoke, ON, Canada). Briefly, mouse podocytes were transfected with scramble or JAK2
siRNA for 24 hours. After crosslinking and sonication, sheared chromatin was
immunoprecipitated with an antibody directed against STAT1 (1:100; Cell Signaling
Technology) or an equal concentration of normal rabbit IgG (Santa Cruz Biotechnology).
Samples were then washed, reverse crosslinked, and proteinase K treated to obtain purified DNA
fragments. Quantitative real-time PCR was performed using primers specific for a sequence of
the mouse TFEB promoter. Primer sequences are provided in the appendix. The promoter region
of TFEB and the putative binding sites for STAT1 within the mouse TFEB promoter (Figure
2.10) were determined by Ensembl genome browser (https://useast.ensembl.org/) and ALGGEN
PROMO (http://alggen.lsi.upc.es) online tools.
2.2.11. Albumin Permeability Assay
An albumin permeability assay was adapted from a previously described method (Nooteboom,
Hendriks et al. 2000). Mouse podocytes were grown to confluent monolayers on transwell plates
54
and transfected with p-EGFP-N1-TFEB, JAK2 siRNA, or scramble for 24 hours. A tracer
solution of 250 g/ml FITC-albumin (Sigma-Aldrich) in RPMI medium was applied to the upper
compartment, and the ratio of fluorescence of samples drawn from the lower compartment at 2
and 24 hours (excitation/emission wavelengths, 495/520 nm) was determined using a SpectraMax
M5 Microplate Reader (Molecular Devices, Sunnyvale, CA).
2.2.12. Statistical Analyses
Data are expressed as means ± SEMs. Statistical significance was determined by one-way
ANOVA with a Fisher least significant difference test for comparison of multiple groups and
unpaired t test for comparison between two groups (or Mann–Whitney test for nonparametric
data). Skew distributed data were log transformed before statistical comparison. Statistical
analyses were performed using GraphPad Prism 6 for Mac OS X (GraphPad Software Inc., San
Diego, CA).
2.3. RESULTS
2.3.1. Knockout of JAK2 from podocytes impairs autophagy completion in mice
To examine the normal actions of JAK2-dependent signaling in podocytes, we generated
podocyte-specific JAK2 knockout mice. First, to confirm that Cre recombinase expression was
limited to the glomerulus, we bred Podocin-cre+ mice (Moeller, Sanden et al. 2003) with
ROSA26 reporter mice (R26Rfl/fl) (Soriano 1999). Histologic staining of kidney sections from
Podocin-cre- mice showed no expression of -galactosidase, whereas -galactosidase was
strongly expressed in the kidneys of Podocin-cre+R26Rfl/fl mice, where it was constrained to the
glomeruli (Figure 2.3A). To examine whether the presence of the cre transgene affects podocyte
permselectivity, we followed Podocin-cre- and Podocin-cre+ mice for 6 months, observing no
difference in the rate of urinary albumin excretion between the two groups (Figure 2.3B).
55
Figure 2.2: Characterization of Podocin-cre+ R26Rfl/fl mice. (A) Enzymatic X-gal staining of
kidney sections from a Podocin-cre− mouse and a Podocin-cre+R26Rfl/fl mouse showing
glomerular β-galactosidase expression in the Podocin-cre+R26Rfl/fl mouse. Original
magnification, ×400. (B) Urine albumin excretion in Podocin-cre- (n=11) and Podocin-cre+
(n=6) mice aged six months. Data are mean ± SEMs.
Second, to generate podocyte-specific JAK2 knockout animals, we bred Podocin-cre+ mice with
Jak2fl/fl mice in which loxP sites had been placed around the promoter and first coding exon of
Jak2 (Krempler, Qi et al. 2004). We studied two groups of mice: Podocin-cre+Jak2+/+ mice and
Podocin-cre+Jak2fl/fl mice, henceforth referred to as JAK2Ctrl and JAK2podKO, respectively. Both
groups of mice were born in the expected Mendelian frequency. To determine the efficiency of
JAK2 deletion, we isolated primary cultured podocytes from JAK2Ctrl and JAK2podKO mice.
Primary cultured podocytes were recognizable by their arborized morphology and the expression
of the podocyte protein nephrin on immunoblotting (Figure 2.4A). JAK2 deletion from
podocytes in JAK2podKO mice was confirmed by (1) immunoblotting (Figure 2.4B) and (2)
immunofluorescence microscopy (Figure 2.4C). In adult mice (age 10 weeks old), the magnitude
of urine albumin excretion in JAK2podKO mice was almost double that of their littermate controls
(Figure 2.4D, Table 2.2). Albuminuria in Podocin-cre+Jak2fl/+ heterozygous mice fell midway
between the levels seen in JAK2Ctrl and JAK2podKO mice (urine albumin excretion, 22±4 µg/day;
56
n=13; P=0.83 vs. JAKCtrl). By 6 months of age, urine albumin excretion was increased threefold
in JAK2podKO mice (Figure 2.4D).
Figure 2.3: Characterization of JAK2 deletion from podocytes in mice. (A) Phase-contrast
microscopy (original magnification, ×100) and immunoblotting for nephrin in primary cultured
mouse podocytes. Lysates from 3T3 cells are provided as a comparator. (B) Immunoblotting for
JAK2 in lysates of primary podocytes isolated from JAK2Ctrl and JAK2podKO mice. (C)
Immunofluorescence dual staining for nephrin and JAK2 in glomerular sections from JAK2Ctrl
and JAK2podKO mice. The merged image shows colocalization of JAK2 and nephrin (yellow-
orange color) in JAK2Ctrl but not in JAK2podKO. Blue is 4',6-diamidino-2-phenylindole (DAPI).
(D) Urine albumin excretion in JAK2Ctrl and JAK2podKO mice ages 10 weeks old (n=10-12 per
group) and 6 months old (n=4 per group). AU, arbitrary units. Values are mean ± SEMs. *P<0.05
by unpaired t test.
57
Table 2.1: Body weight, kidney weight and systolic blood pressure (SBP) in JAK2Ctrl and
JAK2podKO mice.
Body weight (g) Kidney weight
(g)
Kidney weight:
body weight (%)
SBP (mmHg)
JAK2Ctrl (n=10) 23.50.4 0.190.01 0.820.03 892
JAK2podK (n=12) 23.70.4 0.180.01 0.790.02 883
Values are mean ± SEMs. No statistically significant difference observed between all groups.
58
In subsequent experiments, we focused our analyses on the structural changes that occurred in
mice at the earlier (10 weeks) time point, which we speculated were more likely to be causatively
implicated in the development of albuminuria. At this stage, glomerular morphology in
JAK2podKO mice was unremarkable when assessed by light microscopy (Figure 2.5).
Figure 2.4: Representative periodic acid-Schiff (A and B, original magnification ×400) and
hematoxylin and eosin (C and D, original magnification ×100) stained kidney sections from
JAK2Ctrl (A and C) and JAK2podKO mice (B and D) aged 10 weeks.
59
In contrast, when we examined the ultrastructure of podocytes by transmission electron
microscopy, we observed an approximately 80% increase in autophagosome fractional volume in
JAK2podKO mice (Figure 2.6A). Similarly, in primary podocytes from JAK2podKO mice, there was
an increase in abundance of LC3-II, the autophagosome-associated phosphatidylethanolamine-
conjugated form of the protein microtubule-associated protein 1A/1B–light chain 3 (LC3)
(Kabeya, Mizushima et al. 2000) (Figure 2.6B). We considered that increased autophagosome
fractional volume and LC3-II levels could be due to either enhanced induction of autophagy or
impaired completion of autophagy. To help us distinguish between these two scenarios, we
probed for the autophagy substrate, p62 (also called sequestosome 1), that accumulates in the
cytosol when autophagy is impaired (Bjørkøy, Lamark et al. 2005). In comparison with JAK2Ctrl
mice and suggestive of impaired autophagy completion, there was an increase in podocyte p62 in
JAK2podKO mice (Figure 2.6, C and D). This impairment in autophagy completion was
accompanied by an increase in lysosome accumulation as assessed by immunostaining and
immunoblotting for the lysosome marker lysosome-associated membrane protein 2 (LAMP2)
(Figure 2.6, E and F).
60
Figure 2.5: JAK2 deletion impairs podocyte autophagy completion in vivo. (A) Transmission
electron micrographs of podocytes from JAK2Ctrl and JAK2podKO mice and autophagosome
volume fraction (n=10-12 per group). The transmission electron micrographs illustrate
autophagosomes (thick black arrows) and lysosomes (thin black arrows) in the podocyte from the
JAK2podKO mouse. Insets are a higher magnification. Original magnification, ×25,000. (B)
Immunoblotting primary cultured podocytes from JAK2Ctrl (n=4) and JAK2podKO mice (n=4) for
LC3. (C) Immunofluorescence dual staining for nephrin and p62 in glomerular sections of
JAK2Ctrl (n=6) and JAK2podKO (n=6) mice. Insets represent zoomed-in images of the dashed
61
areas. The white arrows point to p62 puncta in podocytes (nephrin positive) from the JAK2podKO
mouse. (D) Immunoblotting primary cultured podocytes from JAK2Ctrl (n=5) and JAK2podKO
mice (n=4) for p62. (E) Immunofluorescence staining for nephrin and LAMP2 in glomerular
sections of JAK2Ctrl (n=6) and JAK2podKO (n=6) mice. (F) Immunoblotting primary cultured
podocytes from JAK2Ctrl (n=4) and JAK2podKO mice (n=4) for LAMP2. AU, arbitrary units.
Values are mean ± SEMs. *P<0.05; †P<0.01 by unpaired t test (or Mann-Whitney test or unpaired
t test of log transformed values for Figure 2.6A).
2.3.2. JAK2 knockdown impairs autophagy completion in differentiated immortalized podocytes
To better understand the causes of autophagosome-lysosome accumulation in JAK2-deficient
podocytes, we turned to an immortalized cell culture system and transfected conditionally
immortalized differentiated mouse podocytes (Endlich, Kress et al. 2001) with either sequence-
specific short interference RNA (siRNA) directed against JAK2 or scramble control (Figure
2.7A). Immunoblotting cell lysates revealed that JAK2 knockdown in these cells similarly led to
an increase in the abundance of LC3-II and p62 (Figure 2.7B), suggestive of impaired autophagy
completion. The increase in LC3-II after JAK2 knockdown was comparable with that observed
when autophagic flux was blocked with Earle’s Balanced Salt Solution (EBSS; autophagy
induction) and bafilomycin A1 (an inhibitor of autophagy completion), with no additive effect of
the combination of JAK2 siRNA, EBSS, and bafilomycin A1 (Figure 2.7C). In contrast, LC3-I
levels appeared lower in podocytes exposed to EBSS and bafilomycin A1 in the presence or
absence of JAK2 siRNA, likely indicative of autophagy induction with the former conditions that
was unaffected by JAK2 knockdown (Figure 2.7C). Stereometric evaluation of transmission
electron micrographs revealed an increase in autophagosome and lysosome volume fraction in
JAK2 siRNA-transfected podocytes compared with scramble-transfected cells (Figure 2.7D).
Likewise, LAMP2 expression was increased in the setting of JAK2 knockdown when assessed by
either immunoblotting (Figure 2.7E) or immunostaining (Figure 2.7F).
62
Figure 2.6: JAK2 knockdown with siRNA causes autophagosome and lysosome
accumulation in cultured immortalized mouse podocytes. (A) JAK2 knockdown with siRNA.
(B) Immunoblotting for LC3 (n=6 per condition) and p62 (n=5 per condition). (C)
Immunoblotting for LC3 in JAK2 siRNA-transfected podocytes (or scramble-transfected cells)
incubated in EBSS for 19 hours (5 hours post-transfection), with bafilomycin A1 (100 nM) added
for the final 4 hours ( n=7-10 per condition). (D) Transmission electron micrographs of mouse
63
podocytes transfected with scramble or JAK2 siRNA and autophagosome and lysosome volume
fraction (n=6 per condition). Insets are higher magnification (original magnification, ×25,000).
The thick arrow labels an autophagosome, and the thin arrow labels a lysosome. (E)
Immunoblotting for LAMP2 (n=8 per condition). (F) Immunofluorescence staining for LAMP2
(red) and 4',6-diamidino-2-phenylindole (DAPI) (blue) (n=4 per condition). GAPDH,
glyceraldehyde 3-phosphate dehydrogenase; AU, arbitrary units. Values are mean ± SEMs.
*P<0.05 versus scramble; †P<0.01 versus scramble by one-way ANOVA with a Fisher least
significant difference test for comparison of multiple groups and unpaired t test for comparison
between two groups.
Although the regulation of autophagic processes can differ between primary cells and cell lines
(Puleston, Phadwal et al. 2015) and although the primary culture was an enriched but not pure
podocyte cell population (>85% nephrin positive) (Figure 2.8), JAK2 knockout/knockdown
consistently impaired late-phase autophagy. We speculated that this impairment could be due to
either improper fusion of autophagosomes with lysosomes or impairment of lysosome function
itself.
Figure 2.7: Representative flow cytometry histograms from primary cultured cells (n=4) stained
for nephrin.
64
Because the JAK/STAT pathway is a major regulator of gene transcription, we focused our next
discovery experiments on mRNA changes of genes linked to autophagy pathways in podocytes
transfected with JAK2 siRNA. To explore the regulation of autophagosome-lysosome fusion, we
reviewed the biomedical literature and compiled a list of 16 genes previously linked to this
process. Using RT-qPCR, we found little change in the expression of any of these genes with
JAK2 knockdown (Table 2.2). A difference in mRNA levels encoding four proteins achieved
statistical significance (histone deacetylase 6, Huntingtin associated protein 1, sorting nexin 14,
and vesicle-associated membrane protein 8). However, whereas each was increased in its
expression, none were upregulated >1.25-fold (Table 2.2).
65
Table 2.2: Relative mRNA levels of genes involved in the fusion of autophagosomes with
lysosomes (n=4 per condition).
Scramble
(AU)
JAK2 siRNA
(AU) ATP6AP2 1.000.04 1.050.02
Autophagy related 14 1.000.05 1.080.05
Caveolin-1 1.000.02 0.960.01
CD38 1.000.05 1.060.10
DNA damage regulated autophagy modulator 1 1.020.10 0.910.10
FAM176A 1.090.07 0.950.04
Histone deacetylase 6 1.010.07 1.220.04*
Huntingtin-associated protein 1 1.000.03 1.190.07*
Niemann-Pick C1 1.000.02 1.080.03
Pleckstrin homology domain-containing family M
member 1
1.010.06 1.020.05
SNAP-associated protein 1.000.05 1.120.01
Sorting nexin 14 1.000.04 1.130.02*
Syntaxin 17 1.000.05 1.060.01
Tectonin ß-propeller repeat containing 1 1.010.08 1.010.04
Vesicle-associated membrane protein 7 1.000.05 1.110.06
Vesicle-associated membrane protein 8 1.000.02 1.150.03†
Values are normalized to RPL13a. AU = arbitrary units. Values are mean ± SEMs. *P<0.05,
†P<0.01 by unpaired t test.
66
2.3.3. JAK2 knockdown downregulates the transcription factor TFEB
In the context of minimal change in expression of genes involved in autophagosome-lysosome
fusion, we hypothesized that the impairment in autophagy completion in JAK2-deficient
podocytes was a consequence of lysosome dysfunction. Consistent with the presence of
lysosome dysfunction, JAK2 knockdown caused a decrease in the activity of cathepsin D (Figure
2.9A), a lysosomal aspartic proteinase, the deficiency of which was recently implicated in
impaired podocyte autophagy (Yamamoto-Nonaka, Koike et al. 2016). Because the transcription
factor TFEB has been linked to lysosome function (Sardiello, Palmieri et al. 2009), autophagy
(Settembre, Di Malta et al. 2011), and cathepsin D activity (Ivankovic, Chau et al. 2016), we
performed a second RT-qPCR–based screen for mRNA changes of 13 genes drawn from a list of
the most likely lysosomal direct targets of TFEB (Palmieri, Impey et al. 2011). Six of the 13
likely TFEB targets were significantly downregulated with JAK2 siRNA (including cathepsin D)
(Table 2.3). Of these six transcripts, five were also downregulated in podocytes from JAK2podKO
mice, with statistically significant reductions seen in mRNA levels of beclin-1, cathepsin D, and
cystinosin (Figure 2.9B). Having discovered a downregulation in the expression of several
putatively TFEB-regulated genes with JAK2 knockout or knockdown, we queried whether TFEB
itself is affected by JAK2 knockdown. Supportive of this assertion, TFEB promoter activity
(Figure 2.9C), mRNA levels (Figure 2.9D), protein levels (Figure 2.9E), and nuclear localization
(Figure 2.9F) were each reduced in mouse podocytes transfected with JAK2 siRNA compared
with scramble-transfected cells. In determining how JAK2 may regulate the expression of TFEB,
we performed in silico analysis of the mouse TFEB promoter and identified six putative binding
sites for the JAK2-dependent transcription factor, STAT1 (Figure 2.10). By chromatin
immunoprecipitation, we found that STAT1 was enriched at the TFEB promoter and that its
enrichment was negated with JAK2 siRNA (Figure 2.9G). We immunoblotted podocytes
isolated from JAK2podKO mice, and in doing this, we also observed a reduction in TFEB
expression with JAK2 knockout (Figure 2.9H).
67
Table 2.3: Relative mRNA levels of likely direct targets of TFEB with a known role in
lysosome function (Palmieri, Impey et al. 2011) in mouse podocytes transfected with JAK2
siRNA or scramble (n=4 per condition).
Scramble (AU) JAK2 siRNA (AU)
-Galactosidase 1.030.15 0.860.05
ATPase H+ transporting accessory protein 1 1.030.15 0.830.01
ATPase H+ transporting lysosomal V0 subunit C 1.060.23 1.060.08
Beclin 1 1.040.18 0.720.03*
Cathepsin B 1.040.19 1.420.13
Cathepsin D 1.030.15 0.680.04*
Cystinosin 1.060.22 0.720.02*
Lysosomal -glucosidase 1.050.21 1.010.10
Mucopilin-1 1.040.17 0.700.03*
Nuclear receptor binding factor-2 1.060.20 1.010.08
Ras-related GTP binding C 1.040.18 0.610.03*
Serine/threonine kinase 4 1.040.19 0.720.04*
Vacuolar protein sorting-associated protein 18 1.060.22 0.840.02
Values normalized to RPL13a. AU = arbitrary units; RPL13a, ribosomal protein L13a. Values
are mean ± SEMs. *P<0.05 by unpaired t test.
68
Figure 2.8: JAK2 knockdown or knockout impairs lysosome function and decreases TFEB
expression in mouse podocytes. (A) Cathepsin D activity in immortalized podocytes transfected
with scramble or JAK2 siRNA for 24 hours (n=9 per condition). (B) Relative mRNA levels of
TFEB targets in primary podocytes from JAK2Ctrl (n=4) and JAK2podKO (n=4) mice. BECN1,
beclin 1; CTSD, cathepsin D; CTNS, cystinosin; MCOLN1, mucopilin-1; RRGAC, Ras-related
GTP binding C; STK4, serine/threonine kinase 4. (C–G) Regulation of TFEB expression by
JAK2 in immortalized podocytes transfected with scramble or JAK2 siRNA for 24 hours. (C)
TFEB promoter activity (n=5-6 per condition). (D) TFEB mRNA levels (n=4 per condition). (E)
TFEB protein levels. (F) TFEB nuclear levels (n=9 per condition). (G) Chromatin
69
immunoprecipitation of the TFEB promoter after STAT1 enrichment (n=3-4 per condition). (H)
TFEB protein levels in primary podocytes from JAK2Ctrl (n=6) and JAK2podKO (n=5) mice. AU,
arbitrary units. Values are mean ± SEMs. *P<0.05 versus scramble; †P<0.05 versus JAK2Ctrl;
‡P<0.01 versus scramble; §P<0.01 versus IgG by one-way ANOVA with a Fisher least significant
difference test for comparison of multiple groups and unpaired t test for comparison between two
groups.
70
Figure 2.9: Putative binding sites for STAT1 within the mouse TFEB promoter.
71
2.3.4. TFEB overexpression restores podocyte function after JAK2 knockdown
In our final series of experiments, we investigated whether the podocyte dysfunction, induced by
JAK2 knockdown, could be reversed by TFEB overexpression. We transfected cells with a
plasmid encoding EGFP-tagged TFEB (Roczniak-Ferguson, Petit et al. 2012) (Figure 2.11A) that
negated both the downregulation in cathepsin D gene expression (Figure 2.11B) and the
reduction in cathepsin D activity (Figure 2.11C) with JAK2 siRNA. By immunoblotting, we
observed an increase in LC3-II with TFEB overexpression and an augmentation in this increase
with the inhibitor of late-phase autophagy bafilomycin A1 (Figure 2.11D), indicative of increased
autophagic flux with TFEB overexpression that was blocked by bafilomycin A1. Unlike
bafilomycin A1, however, JAK2 siRNA did not augment the increase in LC3-II with TFEB
overexpression (Figure 10D), suggesting that JAK2 is upstream of TFEB in autophagy
regulation. Lastly, to assess whether the enhancement of autophagic flux with TFEB
overexpression improved podocyte function, we assessed the passage of fluorescently labeled
albumin across podocyte monolayers. Whereas JAK2 knockdown increased albumin transport
across monolayers, this increase was negated by TFEB overexpression (Figure 2.11E).
72
Figure 2.10: TFEB overexpression restores lysosome function and albumin permselectivity
in JAK2-deficient mouse podocytes. (A) Immunoblotting for GFP in control mouse podocytes
or podocytes transfected with EGFP-tagged TFEB. (B) Cathepsin D mRNA levels under control
conditions (scramble) or transfected with JAK2 siRNA, EGFP-tagged TFEB, or JAK2 siRNA
and EGFP-tagged TFEB (n= 4-6 per condition). (C) Cathepsin D activity in podocytes under
control conditions (scramble) or transfected with JAK2 siRNA, EGFP-tagged TFEB, or JAK2
siRNA and EGFP-tagged TFEB (n=3-8 per condition). (D) Immunoblotting for LC3 in podocytes
transfected with EGFP-tagged TFEB in the presence or absence of 100 nM bafilomycin A1 for 4
hours or JAK2 siRNA for 24 hours (n=3-6 per condition). (E) Albumin permeability in podocytes
under control conditions (scramble) or transfected with JAK2 siRNA, EGFP-tagged TFEB, or
JAK2 siRNA and EGFP-tagged TFEB (n=3-5 per condition). EGFP, enhanced green fluorescent
protein; GFP, green fluorescent protein; RPLP0, large ribosomal protein P0; AU, arbitrary units.
Values are mean ± SEMs. *P<0.05 versus control; †P<0.05 versus all other groups; ‡P<0.001
versus all other groups by one-way ANOVA with a Fisher least significant difference test.
73
2.4. DISCUSSION
The autophagy-lysosome pathway is a highly regulated and evolutionarily conserved catabolic
process that enables cells to remove and recycle intracytoplasmic material during times of stress
or starvation. It seems to be particularly important to the maintenance of the health of nonmitotic
cells, such as the neurons of the central nervous system (reviewed in Rubinsztein, DiFiglia et al.
2005) and the podocytes of the renal glomerulus (Hartleben, Gödel et al. 2010). Here, we found
that genetic removal of the kinase JAK2 impairs autophagy completion and podocyte function.
JAK/STAT signaling facilitates podocyte autophagy by promoting expression of the transcription
factor TFEB that coordinates a network of genes that regulate autophagic-lysosomal function.
Collectively, these findings (1) highlight the importance of JAK2-dependent autophagic
processes to podocyte homeostasis, (2) uncover the significance of TFEB to the maintenance of
podocyte function, and (3) show that TFEB is itself transcriptionally regulated by JAK2/STAT1
in podocytes.
Since an original report described the importance of autophagy to podocyte homeostasis in aging
mice just years ago (Hartleben, Gödel et al. 2010), there has been a rapid recognition that
autophagic disturbance causes podocyte dysfunction in a range of disease settings (Yamahara,
Kume et al. 2013, Kawakami, Gomez et al. 2015, Lenoir, Jasiek et al. 2015, Tagawa, Yasuda et
al. 2015). There are three forms of autophagy: microautophagy (the direct sequestration of
cytoplasmic material into lysosomes), chaperone-mediated autophagy (the transport of cargo
proteins to lysosomes for degradation), and macroautophagy (the best studied form; herein
termed autophagy) (reviewed in Lapierre, Kumsta et al. 2015). (Macro)autophagy can be
conceptualized as taking place through two consecutive phases: (1) the induction of autophagy,
formation of double-membraned autophagosomes, and sequestration of cytoplasmic debris; and
(2) the fusion of autophagosomes with lysosomes and the degradation of the sequestered debris
(reviewed in Shen and Mizushima 2014, reviewed in Lapierre, Kumsta et al. 2015). Historically,
efforts to understand the mechanisms by which autophagic processes are regulated have tended to
focus on its induction. Indeed, the factors that promote autophagy induction (e.g., nutrient
deprivation, 5’ AMP-activated protein kinase, and inhibition of the mammalian target of
rapamycin complex 1) are generally well understood. It is only in the past few years that
attentions have shifted to the strategies used by the cell to ensure autophagy completion. These
74
attentions have been focused (at least in part) by the discovery of TFEB, initially as a master
regulator of lysosomal biogenesis and function (Sardiello, Palmieri et al. 2009) and subsequently
as a regulator of broader autophagic-lysosomal processes (Settembre, Di Malta et al. 2011). In
this study, we examined the effects of knockout of JAK2 in podocytes of otherwise healthy mice
and knockdown of JAK2 with siRNA in cultured podocytes under conditions of serum starvation.
In each case, JAK2 deficiency resulted in an increase in autophagosome volume fraction and the
accumulation of the autophagy cargo receptor of ubiquitinated proteins p62, which are together
indicative of autophagy initiation but failed completion. Impairment in podocyte function was
accompanied by an increase in urine albumin excretion in mice and an increase in albumin
passage across podocyte monolayers. These findings are generally congruent with the previous
descriptions of the phenotype of mice in which autophagy-related genes were selectively
removed from podocytes (Hartleben, Gödel et al. 2010, Riediger, Quack et al. 2011) and the
phenotype of mice when the lysosomal protein cathepsin D was deleted (Yamamoto-Nonaka,
Koike et al. 2016). Whereas both basal autophagy and autophagy induction in response to
nutrient deprivation are of use for cellular survival, under certain circumstances, autophagy can
be detrimental, both initiating and executing cell death (reviewed in Eskelinen 2005). To help us
distinguish between cause and consequence, we elected to study JAK2podKO mice at a young,
albeit adult, age (10 weeks). The largely unremarkable glomerular appearance under light
microscopy at this age suggests that the impairment in autophagy completion with JAK2
knockdown was a de novo event and was not a response to generalized cellular injury.
We considered two possibilities for the impairment of autophagy completion with JAK2
knockdown: (1) a block in the fusion of autophagosomes and lysosomes and (2) impairment in
lysosome function itself. We found that few genes encoding proteins involved in
autophagosome-lysosome fusion were altered in their expression with JAK2 knockdown and that
those that were altered were all marginally increased in their expression. We speculate that this
increase reflects a compensatory response to a downstream impediment. Reflective of lysosome
enzymatic dysfunction, we found that JAK2 deficiency was accompanied by an increase in
lysosome number, a decrease in the expression of lysosomal genes, and a reduction in the activity
of the lysosomal aspartic proteinase, cathepsin D. We went on to discover that this dysfunction
was due to the downregulation of the transcriptional regulator of lysosomal biogenesis and
function, TFEB. TFEB is a member of the basic helix-loop-helix leucine zipper family of
75
transcription factors that was first identified as a regulator of coordinated lysosomal biogenesis
and function in 2009 (Sardiello, Palmieri et al. 2009). In its phosphorylated, inactive form, TFEB
resides in the cytoplasm (reviewed in Shen and Mizushima 2014). On activation, it shuttles to
the nucleus, where it binds to specific E-box sites at the promoters of several lysosomal genes
that have been collectively termed the Coordinated Lysosomal Expression And Regulation gene
network (Sardiello, Palmieri et al. 2009). Subsequent to the initial discovery of the role of TFEB
in the coordinated regulation of lysosomal genes, it has now become apparent that the
transcription factor also drives the expression of a network of autophagy-related genes (Palmieri,
Impey et al. 2011, Settembre, Di Malta et al. 2011). Although TFEB is known to be regulated
post-translationally (reviewed in Shen and Mizushima 2014), this study also highlights the
importance of its transcriptional regulation. Specifically, the JAK2-activated transcription factor
STAT1 binds to the TFEB promoter, and knockdown of JAK2 decreases TFEB promoter
activity, mRNA and protein levels, and nuclear localization. A functional role for TFEB
downregulation in impaired autophagy completion with JAK2 knockdown is implied by the
coincident downregulation in TFEB-regulated genes and a restoration of autophagic flux and
podocyte permselectivity by TFEB overexpression.
The autophagosomal-lysosomal clearance of accumulated proteins and damaged organelles is a
complex process. One of the nuances of this complexity is its temporal regulation. As an
illustration, the LC3-phosphatidylethanolamine conjugate, LC3-II, is recruited to
autophagosomal membranes and degraded in the autolysosomal lumen during autophagy. In
HeLa cells, TFEB overexpression caused an increase in LC3-II abundance, and siRNA-mediated
knockdown of TFEB downregulated LC3-II (Settembre, Di Malta et al. 2011). In podocytes, we
similarly observed an increase in LC3-II with TFEB overexpression, and we observed an
augmentation of this increase with the inhibitor of late-phase autophagy, bafilomycin A1,
indicative of heightened autophagic flux. In contrast, downregulation of TFEB with JAK2
knockdown also caused LC3-II accumulation. This is likely to be a consequence of lysosomal
dysfunction. Indeed, specific knockdown of the lysosomal enzyme and TFEB target cathepsin D
was recently shown to lead to LC3-II accumulation in podocytes (Yamamoto-Nonaka, Koike et
al. 2016). In this respect, it is noteworthy that, whereas TFEB expression was decreased with
JAK2 knockout/knockdown in podocytes, it was not abolished; also, TFEB-dependent
autophagosomal-lysosomal genes were not uniformly reduced in their expression. Thus, with
76
persistent, albeit reduced, TFEB expression, autophagy completion was impaired but was not
negated, causing a phenotype characterized by the accumulation of autophagosomes and
lysosomes and an increase in albuminuria without florid glomerular damage. The discovery that,
under normal circumstances, JAK2 preserves podocyte functionality by promoting autophagy
completion warrants consideration in the context of JAK/STAT pathway activation in human
diabetic kidney disease (Berthier, Zhang et al. 2009, Hodgin, Nair et al. 2013) and the
preliminary benefits of the JAK1/2 inhibitor baricitinib in a 24-week, phase 2 study of
participants with type 2 diabetes and kidney disease (Tuttle, Brosius et al. 2018). Although the
findings herein described would seem to sound a cautionary note as to the possibility of adverse
renal effects of JAK2 inhibition, several distinctions should be considered. First, in an effort to
unravel the normal actions of JAK2, we examined the effects of the kinase in one particular cell
type (the podocyte), whereas systemic JAK inhibition affects multiple cell types, not even those
limited to the kidney. Second, whereas we examined the consequences of JAK2
knockout/knockdown, baricitinib is an enzyme inhibitor and equally efficacious in blocking the
activity of both JAK1 and JAK2 (IC50=5.9 and 5.7 nM, respectively)(Fridman, Scherle et al.
2010). Third, although JAK2 functions in a homeostatic capacity in normal podocytes, the
JAK/STAT signaling pathway also plays an important role in the development of inflammation
(reviewed in Kaplan 2013), one of the principal drivers of the progression of diabetic kidney
disease (reviewed in Heerspink and De Zeeuw 2016). Thus, the extent to which JAK inhibition
may affect JAK2-regulated podocyte autophagy completion in patients and the extent to which
these effects may temper the potentially renoprotective anti-inflammatory properties of JAK
inhibitors remain to be determined.
In summary, JAK2 functions in a homeostatic capacity in podocytes by facilitating autophagy. It
does this by regulating the expression of the transcription factor TFEB that is necessary for
normal autophagic-lysosomal function (Figure 2.12). These actions should be borne in mind in
considering the long-term implications of therapies that interfere with the JAK/STAT signaling
pathway. They also raise the intriguing possibility that therapeutically modulating TFEB activity
(reviewed in Rubinsztein, Codogno et al. 2012) may improve podocyte health in glomerular
disease.
77
Figure 2.11: JAK2 regulates autophagy completion in podocytes. (A) Under normal
conditions (wildtype), signaling through JAK2 induces translocation of STAT1 to the nucleus,
where STAT1 binds to the promoter region of the gene encoding the transcription factor TFEB.
TFEB, in turn, facilitates the transcription of genes involved in lysosome and autophagosome
function, including cathepsin D. Autophagosomes are recognized by the presence of LC3-II and
contain proteins bound to p62 and targeted for degradation. Autophagy completion involves the
fusion of double-membrane–bound autophagosomes with lysosomes (recognized by the presence
of LAMP2) and subsequent degradation of the contents of the resultant autolysosome. (B) When
JAK2 is absent (JAK2podKO), TFEB expression is diminished, leading to decreased expression of
lysosomal genes (including cathepsin D) and lysosomal dysfunction, impairing autophagy
completion, and leading to podocyte dysfunction, diminished podocyte permselectivity, and
consequent albuminuria.
78
CHAPTER 3: Podocyte-specific JAK2 deletion and JAK inhibition
Have an Anti-inflammatory Effect in the Diabetic Kidney
A portion of this work (Table 3.2) has been adapted with permission from Alghamdi, T.A.,
Batchu, S.N., Hadden, M.J., Yerra, V.G., Liu, Y., Bowskill, B.B., Advani, S.L., Geldenhuys, L.,
Siddiqi, F.S., Majumder, S., Advani, A. (2018). Histone H3 serine 10 phosphorylation facilitates
endothelial activation in diabetic kidney disease. Diabetes. 67(12):2668–2681.
Contribution of authors:
T.A.A. designed and performed the experiments, analyzed the data, and wrote this chapter.
S.N.B. contributed to the data presented in Table 3.2, B.B.B. assisted with the animal studies,
S.L.A. assisted with the immunohistological experiments. A.A. designed the experiments,
supervised the study, and revised and edited this chapter.
79
3.1. INTRODUCTION
Global deletion of JAK2 in mice leads to embryonic lethality due to impaired hematopoiesis
(Neubauer, Cumano et al. 1998) and in my studies presented in Chapter 2, its deletion from
podocytes resulted in impaired autophagy completion and a 3-fold increase in albuminuria in
mice (Alghamdi, Majumder et al. 2017). However, it is worth noting that while gene ablation of
JAK2 under normal conditions may have detrimental effects, modulation of JAK2 activity under
abnormal conditions may be advantageous. As reviewed in Chapter 1, the discovery of the
activating JAK2 mutation (JAK2V617F) in certain hematopoietic stem-cell disorders raised a
strong interest amongst the pharmaceutical industry in developing selective JAK2 inhibitors
(Kralovics, Passamonti et al. 2005). The first JAK inhibitor ruxolitinib (INCB018424, Jakafi,
Incyte Corporation) received FDA approval in 2011 for the treatment of polycythemia vera and
myelofibrosis (Verstovsek, Kantarjian et al. 2010), and development of other JAK inhibitors has
evolved apace (reviewed in Moran 2012). For instance, Eli Lilly and Incyte Corporation have
developed an orally administrated JAK1/2 inhibitor, baricitinib (INCB028050), which has been
shown to be effective in the treatment of rheumatoid arthritis (Keystone, Taylor et al. 2013,
Genovese, Kremer et al. 2016). At the time of conducting my experiments, baricitinib was being
evaluated in a phase 2 clinical trial in patients with type 2 diabetes at high-risk for progressive
diabetic kidney disease (NCT01683409) (Tuttle, Brosius et al. 2018). The data from the clinical
trial were recently published and they demonstrated that baricitinib reduced albuminuria by 41%
in these patients in comparison to placebo treated individuals and this reduction was associated
with a decrease in renal inflammation markers with no change in glomerular filtration rate
(Tuttle, Brosius et al. 2018). Elsewhere, cumulative evidence demonstrates that JAK/STAT
activation plays a role in the pathogenetic response of resident renal cells including mesangial
cells and fibroblasts (Nahman, Leonhart et al. 1992, Han, Isono et al. 1999). However,
comparatively, little has been known about the role of the JAK/STAT pathway in glomerular
podocytes in the diabetic kidney.
Having identified the homeostatic actions of JAK2 in podocytes in the normal setting and given
that JAK inhibition has been proposed as a potential therapeutic approach for the treatment of
DKD, we set out to: i) investigate the effect of JAK inhibition in an experimental model of DKD,
and ii) examine the effects of JAK2 absence in podocytes under diabetic conditions. We
80
hypothesized that systemic JAK inhibition would attenuate kidney injury in an experimental
model of diabetes and, based upon our results shown in Chapter 2, that deletion of JAK2 from
podocytes may exacerbate the increase in albuminuria in a mouse model of DKD.
3.2. RESEARCH DESIGN AND METHODS
3.2.1. Animal studies
3.2.1.1. JAK inhibition study in streptozotocin (STZ)-diabetic eNOS-/- mice
The effects of AZD1480 (MedChemExpress, Monmouth Junction, NJ), an ATP-competitive JAK
inhibitor (IC50, JAK2 0.26 nM, JAK1 1.3nM) (Derenzini, Lemoine et al. 2011), on kidney
function were assessed in streptozotocin (STZ)-diabetic endothelial nitric oxide synthase
knockout (eNOS-/-) mice. Male nondiabetic and diabetic, C57BL/6 wildtype (WT) and eNOS-/-
mice were studied at eight weeks of age (n=7-12/group) (The Jackson Laboratory, Bar Harbor,
ME). Diabetes was induced in WT and eNOS-/- mice by five daily intraperitoneal injections of
STZ (55mg/kg) in 0.1M citrate buffer, pH 4.5, for five days (or citrate buffer alone for controls)
after a 4-hour fast. STZ-diabetic eNOS-/- mice were treated with either AZD1480 (50 mg/kg) in
0.5% hypromellose, 0.1% Tween 80 (Xin, Herrmann et al. 2011) or vehicle by once daily gavage,
beginning with the first STZ injection for three weeks.
3.2.1.2. Generation of STZ-diabetic podocyte-specific JAK2 knockout mice
JAK2podKO mice were generated and characterized as previously described in Chapter 2
(Alghamdi, Majumder et al. 2017). Male JAK2Ctrl or JAK2podKO mice aged eight weeks were
randomized to receive a daily intraperitoneal injection of STZ (55 mg/kg) in 0.1M citrate buffer,
pH 4.5, for five days (or citrate buffer alone for controls) after a 4-hour fast. We studied four
groups of mice: JAK2Ctrl (n=9), JAK2podKO (n=7), STZ-diabetic JAK2Ctrl (n=8), and STZ-diabetic
JAK2podKO (n=6). Two weeks after the first STZ injection, diabetes was confirmed by fasting
blood glucose testing (One Touch UltraMini, LifeScan Canada Ltd., Burnaby, BC, Canada) and
mice were followed for a total of 14 weeks from the first STZ injection.
81
Urine samples were collected after animals were housed individually in metabolic cages for 24
hours. Urine albumin or CCL2 excretion was determined by mouse albumin ELISA (Assaypro,
Charles, MO) and Mouse/Rat CCL2/JE/MCP-1 Quantikine ELISA Kit (R & D Systems,
Minneapolis, MN), respectively. At sacrifice, kidney tissues were immersed in 10% neutral
buffered formalin, routinely processed, and embedded in paraffin. All experimental procedures
adhered to the guidelines of the Canadian Council on Animal Care and were approved by the St.
Michael’s Hospital Animal Care Committee.
3.2.2. Mesangial matrix index
Paraffin-embedded kidney sections were stained with periodic acid-Schiff (PAS). Briefly, slides
were de-waxed twice in xylene for 3 minutes each, followed by twice immersion in 100% ethanol
for 3 minutes each, one time in 70% ethanol for 3 minutes, and then washed thrice with distilled
water for 5 minutes each. Kidney tissue sections were then oxidized by adding 2-4 drops of
periodic acid and incubated at room temperature for 30 mins. After washing the slides three times
with distilled water for 5 minutes each, 2-4 drops of Shiff’s reagent were placed on the tissue
sections, followed by incubation at room temperature for 30 minutes. The slides were then
washed under warm tap water for a minimum of 10 minutes. For counterstain and dehydration,
slides were dipped twice in haematoxylin, and washed with running tap water until clear. Slides
were then dipped in Scott’s tap water, washed with running tap water for 2 minutes, immersed
sequentially in 70% ethanol for 1 minute, twice in 100% ethanol for 1 minute each, once in 100%
ethanol for 2 minutes each, and twice in xylene for 2 minutes each. Finally, mounting media and
coverslips were placed on tissue sections and the slides were left to dry. For each mouse from the
STZ-diabetic eNOS-/- study, 30 glomeruli per PAS-stained kidney section were assessed for
mesangial matrix accumulation using a semi-quantitative scoring method (Advani, Connelly et
al. 2011, Batchu, Majumder et al. 2016). Briefly, depending on the magnitude of mesangial
matrix deposition, each glomerulus was assigned a score using the following scale: (0= normal
appearance; 1= mesangial matrix deposition up to 25% of the glomerulus; 2= 25 to 50% of the
glomerulus; 3= 50 to 75%; and 4= 75 to 100% of the glomerulus). The total number of glomeruli
was multiplied by the assigned score. Mesangial matrix index was calculated using the following
formula:
82
Where Fi is the per cent of glomeruli in the mouse with a given score (i) (Kelly, Hepper et al.
2003).
3.2.3. Cell culture studies
Conditionally immortalized human podocytes were provided by Dr. Moin Saleem, University of
Bristol, UK (Saleem, O'Hare et al. 2002). Cells were seeded on type I collagen-coated culture
plates in RPMI-1640 medium with L-glutamine and sodium bicarbonate (Sigma Aldrich, St.
Louis, MO, USA) supplemented with 10% fetal bovine serum (FBS) (Wisent Inc., St. Bruno,
QC, Canada), recombinant mouse interferon-γ (IFN-γ, final concentration 0.02 µg/ml) (Sigma
Aldrich, St. Louis, MO, USA), 100 U/ml penicillin, and 0.1 mg/ml streptomycin (ThermoFisher
Scientific, Rockford, IL, USA). The cells were grown at 33°C (permissive conditions) to reach
80-90% confluence, and then cultured without IFN-γ at 37°C (non-permissive conditions) for 14
days to differentiate. Cultured differentiated human podocytes were treated with 19.4 mM
glucose (final concentration 25 mM, high glucose) or mannitol (final concentration 25 mM,
osmotic control), or maintained under normal (5.6 mM) glucose conditions for 48 hours. After 48
hours, the conditioned media were collected for an array of 41 cytokines and chemokines using
the Human Cytokine/Chemokine Array 41-Plex performed by Eve Technologies Corp. (Calgary,
Alberta, Canada).
3.2.4. Statistical analysis
Data are expressed as mean ± S.E.M. Statistical significance was determined by 1-way ANOVA
followed by Fisher least significant difference post hoc test for more than two groups and 2-tailed
Student t test for two group comparisons. Statistical analyses were performed using GraphPad
Prism for Mac OS X (GraphPad Software Inc., San Diego, CA).
83
3.3. RESULTS
3.3.1. JAK2 inhibition attenuates albuminuria in STZ-diabetic eNOS knockout mice
In our first series of experiments, we set out to examine the effects of systemic JAK inhibition
using the JAK inhibitor AZD1480 in STZ-diabetic eNOS-/- mice, a model of DKD that has been
previously characterized in our lab (Yuen, Stead et al. 2012). We selected these mice as a model
of DKD because the kidney injury in STZ-diabetic eNOS-/- mice is characterized by glomerular
endothelial dysfunction and podocyte injury, and because these mice develop massive
albuminuria soon after the induction of diabetes (Yuen, Stead et al. 2012). This allows for a
relatively short-term assessment of compounds with potential antialbuminuric effect (Batchu,
Majumder et al. 2016, Thieme, Majumder et al. 2017). To investigate the effects of JAK
inhibition on renal function in DKD, STZ-diabetic eNOS-/- mice were treated with either vehicle
or AZD1480 for three weeks. Age-matched WT, eNOS-/-, STZ-diabetic WT, and STZ-diabetic
eNOS-/- mice were studied as controls. As expected, body weight was reduced and kidney:body
weight ratio was increased in STZ-diabetic mice in comparison to their non-diabetic counterparts.
Blood glucose was marginally higher in STZ-diabetic eNOS-/- mice in comparison to STZ-
diabetic WT mice, whereas urine albumin excretion was increased approximately 10-fold (Table
3.1). Treatment with the JAK inhibitor AZD1480 was associated with a small but statistically
significant reduction in blood glucose in STZ-diabetic eNOS-/- mice in comparison to vehicle
treated animals, whereas urine albumin excretion was reduced by approximately 50% (Table 3.1).
84
Table 3.1: Functional characteristics of control and streptozotocin-diabetic (STZ) wildtype
(WT) and endothelial nitric oxide synthase knockout (eNOS-/-) mice treated with vehicle or
AZD1480 (50 mg/kg).
WT STZ-WT eNOS-/- STZ-eNOS-/- STZ-eNOS-/-
+AZD1480
N 12 14 11 9 7
Body weight (g) 250 210a 240b 191acd 201ad
Kidney weight (g) 0.160.01 0.160.00 0.130.00e 0.150.00g 0.140.00cf
Kidney weight:body
weight (%) 0.650.02 0.760.04df 0.540.01h 0.800.02de 0.700.04ij
Blood glucose
(mmol/L) 9.00.6 22.61.6ad 9.90.6 27.61.7acd 24.21.9ad
Urine albumin
excretion (µg/24h) 121 6616 4512 66563k 30069k
Values are mean S.E.Ms. aP< 0.0001 vs. WT, bP<0.001 vs. STZ-WT, cP<0.05 vs. STZ-WT,
dP< 0.0001 vs. eNOS-/-, eP<0.001 vs. WT, fP<0.01 vs. WT, gP<0.05 vs. eNOS-/-, hP<0.05 vs.
WT, iP< 0.01 vs. eNOS-/-, jP< 0.05 vs. STZ-eNOS-/-, kP<0.0001 vs. all other groups, by one-
way ANOVA with a Fisher least significant difference test.
85
3.3.2. JAK inhibition attenuates urine CCL2 excretion and mesangial matrix accumulation in STZ-diabetic eNOS knockout mice
Given the established role of JAK2 in inflammation (reviewed in Hanada and Yoshimura 2002,
reviewed in O'shea and Plenge 2012) and that its activation has been reported in kidney biopsies
from patients with diabetic kidney disease (Berthier, Zhang et al. 2009, Woroniecka, Park et al.
2011), we queried whether systemic JAK inhibition affects mediators of inflammation in the
diabetic kidney. To do this, we looked at urine excretion of the chemokine CCL2 (also known
MCP-1), a pro-inflammatory chemokine that mediates leukocyte infiltration and that has been
extensively studied in the context of DKD (Saitoh, Sekizuka et al. 1998, Matsukawa, Hogaboam
et al. 1999, Tashiro, Koyanagi et al. 2002, Nam, Paeng et al. 2012). Elevated levels of urine
CCL2 excretion have been shown to be associated with renal decline in diabetic mice (Chow,
Nikolic-Paterson et al. 2006), in microalbuminuric patients with type 1 diabetes (Wolkow,
Niewczas et al. 2008), and in patients with type 2 diabetes (Takebayashi, Matsumoto et al. 2006).
In this study, we observed a marked increase in urine CCL2 excretion in STZ-diabetic eNOS-/-
mice in comparison to non-diabetic control groups (Figure 3.1A). After three weeks, AZD1480
treatment was associated with a significant reduction in urine CCL2 excretion in STZ-diabetic
eNOS-/- mice (Figure 3.1A). To examine whether JAK inhibition affects glomerular injury in
STZ-diabetic eNOS-/- mice, we evaluated mesangial matrix accumulation in periodic acid-Schiff-
stained glomerular kidney sections obtained from the studied mice. Whereas the extent of
mesangial matrix was increased in the glomeruli of STZ-diabetic eNOS-/- mice in comparison to
control groups, this was significantly reduced with AZD1480 treatment (Figure 3.2B-G).
86
Figure 3.1: Effect of JAK2 inhibition with AZD1480 on urine CCL2 excretion and
mesangial matrix accumulation in the glomeruli of STZ-diabetic eNOS-/- mice. (A) Urine
CCL2 excretion (WT, n=6; STZ-WT, n=7; eNOS-/-, n=5; STZ-eNOS-/-, n=5, STZ-eNOS-/- +
AZD1480, n=6). (B-G) Representative periodic acid-Schiff-stained kidney sections from WT
(B), STZ-WT (C), eNOS-/- (D), STZ-eNOS-/- (E), and STZ-eNOS-/- + AZD1480 (F). Original
magnification ×400. (G) Mesangial matrix index (WT, n=7; STZ-WT, n=10; eNOS-/-, n=8; STZ-
eNOS-/-, n=9, STZ-eNOS-/- + AZD1480, n=8). AU, arbitrary units. Values are mean S.E.Ms. *P
< 0.001 vs. nondiabetic groups, †P<0.05 vs. diabetic groups, ‡P < 0.001 vs. all other groups, by
one-way ANOVA with a Fisher least significant difference test.
87
3.3.3. Podocyte-specific JAK2 deletion does not influence urine albumin excretion in STZ-diabetic mice
Having found that JAK inhibition attenuated albuminuria in STZ-diabetic eNOS-/- mice, whereas
deletion of JAK2 from podocytes under non-diabetic conditions conversely contributes to the
development of albuminuria, we went on to examine the effect of JAK2 deletion from podocytes
in diabetic mice. To do this, JAK2Ctrl and JAK2podKO mice were made diabetic with STZ and
were followed for 14 weeks. High blood glucose levels were confirmed in STZ-diabetic animals
(Figure 3.2A). Although no change was observed in kidney weight (Figure 3.2B), STZ-diabetic
mice exhibited significantly lower body weight and increased kidney weight:body weight ratio
compared to their respective non-diabetic control groups (Figure 3.2 C and D). Consistent with
our earlier findings, non-diabetic JAK2podKO mice exhibited almost a 3-fold increase in
albuminuria in comparison to JAK2Ctrl mice and this increase was augmented with STZ-induced
diabetes (Figure 3.2E). Whereas albuminuria was increased in STZ-diabetic mice, there was no
difference in 24-hour urine albumin excretion between STZ-diabetic JAKCtrl and STZ-diabetic
JAK2podKO animals (Figure 3.2E).
88
Figure 3.2: Effect of podocyte-specific JAK2 deletion on kidney function in
streptozotocin (STZ)-diabetic mice followed for 14 weeks. A) Blood glucose. B) Body
weight. C) Kidney weight. D) Kidney weight:body weight ratio. E) Urine albumin excretion.
Values are mean S.E.Ms. *P<0.0001 vs. nondiabetic groups, †P<0.001 vs. nondiabetic
groups, ‡P<0.05 vs. nondiabetic groups, §P<0.01 vs. nondiabetic groups, ¶P< 0.05 vs.
JAK2Ctrl, by one-way ANOVA with a Fisher least significant difference test.
89
3.3.4. Podocyte-specific JAK2 deletion attenuates urine CCL2 excretion
Next, because we had found that JAK inhibition attenuates urine CCL2 excretion in STZ-diabetic
eNOS-/- mice, and because CCL2 expression has been shown to be under the regulatory control of
JAK2 in other cell-types (Tanimoto, Murata et al. 2008), we queried whether deletion of JAK2
from podocytes would attenuate urine CCL2 excretion. As expected, there was a marked increase
in urine CCL2 excretion in STZ-diabetic mice in comparison to their nondiabetic control groups
(Figure 3.3). In contrast, JAK2 deletion from podocytes resulted in a marked diminution in urine
CCL2 excretion under diabetic conditions with no change under non-diabetic conditions (Figure
3.3). Collectively, these data suggest that although podocyte-specific JAK2 deletion does not
alter urine albumin excretion, its absence in podocytes does attenuate urine CCL2 excretion.
Figure 3.3: Effect of JAK2 knockout from podocytes on urine CCL2 excretion in STZ-
diabetic mice. Urine CCL2 excretion in JAK2Ctrl (n=6), JAK2podKO (n=3), STZ-diabetic JAK2Ctrl
(n=4), and STZ-diabetic JAK2podKO (n=5). Values are mean S.E.Ms. *P<0.0001 vs. nondiabetic
control groups, †P<0.001 vs. nondiabetic control groups, ‡P<0.0001 vs. STZ-diabetic JAK2Ctrl,
by one-way ANOVA with a Fisher least significant difference test.
90
3.3.5. The chemokine CCL2 is enriched in culture media conditioned by podocytes exposed to high glucose
Increased urine CCL2 excretion in STZ-diabetic mice and diminished urine CCL2 excretion by
deletion of JAK2 from podocytes led us to conclude that podocytes are a major source of CCL2
in the setting of diabetes. To explore this possibility further, we exposed cultured human
podocytes to high glucose concentration for 48 hours and we used a multiplex array to measure
the concentration of 41 chemokines and cytokines in the culture media (Table 3.1). The most
abundant cytokines/chemokines present in the culture media of podocytes under normal
conditions were C-X-C motif ligand 1 (CXCL1)/CXCL2/CXCL3 (pan-GRO), interleukin-6 (IL-
6), IL-8, CCL2, and vascular endothelial growth factor A. Interestingly, out of all 41
cytokines/chemokines surveyed, CCL2 was the only one to be significantly upregulated with the
addition of high glucose to the culture medium (Table 3.2). In Chapter 4, I will discuss how we
built on these initial observations to explore the role of CCL2 in controlling the glomerular cell
phenotype in diabetes.
91
Table 3.2: Chemokine and cytokine content of culture medium of human podocytes under
control conditions or after incubation with high (25 mM) glucose or mannitol for 48 h.
Data are mean ± SD and expressed in pg/mL. Boldface type highlights CCL2 levels. CSF,
colony-stimulating factor; EGF, epidermal growth factor; FGF, fibroblast growth factor; IFN,
interferon; Pan-GRO, CXCL1/CXCL2/CXCL3; PDGF, platelet-derived growth factor; TGF,
transforming growth factor; TNF, tumor necrosis factor; VEGF, vascular endothelial growth
factor. aP , 0.01 vs. control; bP , 0.001 vs. control; cP , 0.05 vs. control by one-way ANOVA
followed by Fisher least significant difference post hoc test.
92
3.4. DISCUSSION
Anti-inflammatory agents represent some of the most promising future therapies for the treatment
of DKD, with inhibitors of both JAK1/2 (reviewed in Brosius, Tuttle et al. 2016, Tuttle, Brosius
et al. 2018) and the CCL2 receptor (CCR2) (de Zeeuw, Bekker et al. 2015), recently reporting
favorable results in phase 2 study. These agents may confer their benefits through actions on
leukocytes and/or on resident renal cells. In the present study, we found that systemic inhibition
of JAK with the pharmacological JAK inhibitor AZD1480 attenuated albuminuria, urine CCL2
excretion, and mesangial matrix accumulation in a mouse model of DKD. Without affecting
albuminuria, removal of the kinase JAK2 from podocytes reduced excretion of the inflammatory
protein CCL2 in the urine of STZ-diabetic mice. In cultured human podocytes, we observed a
significant enrichment of the chemokine CCL2 in the culture media of podocytes exposed to high
glucose conditions.
The results of these experiments emphasize the importance of urine CCL2 excretion as a
biomarker for kidney injury in diabetes and they demonstrate the limited value of the
measurement of albuminuria in detecting inflammatory renal changes in experimental diabetes.
High levels of urine CCL2 excretion have been shown to be a predictor of early decline in kidney
function independent of or before the development of albuminuria in some cases (Verhave,
Bouchard et al. 2013, Fufaa, Weil et al. 2015). This is not surprising considering that relying
solely on albuminuria as a central measure of renal function has been questioned for more than a
decade, especially given that several studies have reported the absence of albuminuria in many
patients with DKD (Kramer, Nguyen et al. 2003, Perkins, Ficociello et al. 2003). These studies
have led to a search for additional biomarkers such as measures of inflammation, which have
emerged as new diagnostic and prognostic tools in DKD studies (reviewed in Winter, Wong et al.
2018).
Our findings also highlight the multifaceted function of JAK2 in health and disease. JAK2 is a
ubiquitously expressed cytoplasmic tyrosine kinase that mediates cytokine-dependent signal
transduction. Of the four members of the JAK family, disruption of JAK2 gene is the only one
that causes embryonic death (Neubauer, Cumano et al. 1998, Parganas, Wang et al. 1998,
reviewed in Sandberg, Wallace et al. 2004), and its deletion from podocytes resulted in impaired
autophagy and lysosomal dysfunction under non-diabetic conditions (Chapter 2) (Alghamdi,
93
Majumder et al. 2017). However, under pathological conditions, activation of JAK2 has been
implicated in inflammatory diseases and it has been reported to be upregulated in patients with
early stage DKD (Berthier, Zhang et al. 2009, Hodgin, Nair et al. 2013). In this study, we
observed a decrease in urine CCL2 excretion with JAK inhibition in STZ-diabetic eNOS-/- mice
and podocyte-specific JAK2 deletion in diabetic mice, suggesting that podocyte JAK2 may
regulate inflammatory processes and that its modulation may attenuate kidney dysfunction in
diabetes. These findings are in line with data from a recent phase 2 clinical trail of the JAK1/2
inhibitor baricitinib in patients with DKD (Tuttle, Brosius et al. 2018). Treatment with baricitinib
in these patients not only reduced albuminuria, but it also resulted in a dose-dependent decrease
in inflammatory biomarkers implicated in DKD including plasma soluble tumor necrosis factor
receptors 1 and 2 (sTNFR1 and sTNFR2), serum amyloid A (SAA), VCAM1 and ICAM1.
Moreover, there was a reduction in urinary CCL2 and CXCL10 in patients treated with
baricitinib, indicative of their correlation with local inflammation in the kidney rather than
systemic inflammation (Wolkow, Niewczas et al. 2008). Although urine CXCL10 excretion was
not assessed in our rodent models of DKD, we observed no change in the levels of CXCL10 in
cultured human podocytes exposed to high glucose. In contrast, CCL2 was the only chemokine
that was significantly upregulated. The observation that deletion of JAK2 from podocytes
attenuated urine CCL2 excretion in diabetic mice suggests that podocyte JAK2 may in part
contribute to the elevated levels of urine CCL2 excretion in experimental models of diabetes.
The critical role of the chemokine CCL2 and its receptor CCR2 in DKD has been described in
animal models of diabetes. For instance, the CCL2/CCR2 axis has been suggested to exacerbate
the progression of DKD by increasing podocyte motility and albumin permeability (Lee, Chung
et al. 2009). Moreover, blockade of CCL2 and its receptor CCR2 was shown to prevent the
development of DKD in experimental models of type 1 and type 2 diabetes (Kanamori,
Matsubara et al. 2007, Sayyed, Hägele et al. 2009). Indeed, clinical trials have already been
initiated to examine the efficacy of CCL2 and CCR2 inhibitors for the treatment of DKD
(NCT01547897, NCT01447147, NCT01109212). Although these agents have shown promising
results in patients with DKD, the precise pathomechanisms of how the CCL2/CCR2 signaling
pathway contributes to the development of DKD remain to be fully explored.
94
This study has several limitations that need to be acknowledged. First, the discordance of the
phenotype between STZ-diabetic JAK2podKO mice (no change in albuminuria) and STZ-diabetic
eNOS-/- mice treated with AZD1480 (reduction in albuminuria) could be the confounding effect
of eNOS absence. Indeed, several studies have shown that reduced expression of eNOS in
glomerular endothelial cells results in glomerular dysfunction and accelerates DKD in
experimental models of diabetes, demonstrating its protective role in the glomerulus (Zhao,
Wang et al. 2006, Kanetsuna, Takahashi et al. 2007, Mohan, Reddick et al. 2008, Yuen, Stead et
al. 2012). Second, the in vivo experiments were conducted in STZ-induced diabetic mouse
models; therefore, the toxic effect of STZ cannot be ruled out. Third, the effects of systemic JAK
inhibition are not limited to those on podocytes and actions on other resident renal cells may be
implicated. For instance, mesangial cells are likely to be implicated in the reduction of mesangial
matrix accumulation observed in the glomeruli of STZ-diabetic eNOS-/- mice treated with
AZD1480. Further discussion and expansion on these limitations is covered in Chapter 5. Finally,
I chose to study AZD1480 as a JAK inhibitor because of its preferential selectivity for JAK2
versus JAK1 (5-fold). However, the IC50 of AZD1480 for JAK1 is still in the low nanomolar
range (1.3 nM) and thus, a role for JAK1 in regulating urine albumin excretion in diabetes cannot
be excluded in these studies.
In summary, this study was undertaken to determine the effects of JAK2 absence in glomerular
podocytes in the diabetes setting. Whereas JAK2 absence in podocytes did not attenuate urine
albumin excretion in the diabetic kidney, its deletion from podocytes was accompanied by a
reduction in urine excretion of the pro-inflammatory chemokine CCL2. Although inhibition of
JAK2 has proven benefits in a number of diseases ranging from cancer (reviewed in LaFave and
Levine 2012) to inflammatory diseases including DKD (reviewed in Brosius, Tuttle et al. 2016),
JAK inhibition has been shown to be associated with adverse effects including anemia,
hypoglycemia, and a small increase in serum creatinine (Tuttle, Brosius et al. 2018). Owing to
the multifaceted actions of podocyte JAK2 in the kidney and given that JAK inhibitors are
regarded as promising treatment of DKD, further studies are required to fully understand the
impact of JAK2 modulation in the kidney and whether other candidates implicated in activation
of inflammatory pathways could be more suitable therapeutic targets for DKD.
95
CHAPTER 4: Histone H3 Serine 10 Phosphorylation Facilitates
Endothelial Activation in Diabetic Kidney Disease
Adapted with permission from Alghamdi, T.A., Batchu, S.N., Hadden, M.J., Yerra, V.G., Liu,
Y., Bowskill, B.B., Advani, S.L., Geldenhuys, L., Siddiqi, F.S., Majumder, S., Advani, A.
(2018). Histone H3 serine 10 phosphorylation facilitates endothelial activation in diabetic kidney
disease. Diabetes. 67(12):2668–2681.
Contribution of authors:
T.A.A. designed and performed the experiments, analyzed the data, and wrote the manuscript.
S.N.B. contributed to the experiments, generation and analysis of the data presented in Figure
4.1B-D, Figure 4.3, and Figure 4.7. M.J.H. contributed to the immunohistochemical image
analysis presented in Figure 4.4B. V.G.Y. contributed to the experiments, generation and analysis
of the data presented in Figure 4.2. Y.L. assisted with in vitro experiments. B.B.B. assisted with
animal studies, S.L.A. contributed to the experiments and generation of data presented in Figure
4.5, 4.10D, and 4.11. L.G. and F.S.S. contributed to the human data presented in Figure 4.11.
S.M. contributed to data analysis and revised the manuscript. A.A. designed the experiments,
supervised the study, and wrote the manuscript.
96
4.1. INTRODUCTION
Post-translational histone modifications have emerged as pivotal mediators of diabetes
complications, either permitting or preventing cellular injury. Most of the evidence associating
histone modifications with the development and progression of diabetes complications comes
from the study of histone (de)methylation or histone (de)acetylation (reviewed in Keating, van
Diepen et al. 2018). However, several other modifications can also affect histone proteins
including phosphorylation, ubiquitination, O-Glc-NAcylation, ADP-ribosylation and sumoylation
(reviewed in Keating, van Diepen et al. 2018). Whereas these alternative modifications have
important biological functions, their potential contribution to the development of diabetes
complications has largely been overlooked.
Diabetes is an inflammatory disease. Release of inflammatory cytokines by resident cells within
the diabetic kidney, for instance, facilitates the recruitment of leukocytes that in turn contribute to
the progressive fibrosis that characterizes later stage nephropathy. Diabetes is also an endothelial
disease and the enhanced expression of endothelial adhesion molecules that facilitate leukocyte
recruitment has long been linked to the development of diabetes complications (reviewed in
Navarro-Gonzalez, Mora-Fernandez et al. 2011). The endothelial expression of cell-surface
adhesion molecules that facilitate leukocyte recruitment is termed endothelial activation
(reviewed in Liao 2013). One of the archetypical endothelial adhesion molecules indicative of
endothelial activation is vascular cell adhesion molecule-1 (VCAM-1) (reviewed in Liao 2013).
VCAM-1 primarily functions as the ligand for the ß1-integrin sub-family member very late
antigen-4 (VLA-4, 41) present on the leukocyte plasma membrane and its upregulation has
been reported to occur in the kidneys of both diabetic mice (Ina, Kitamura et al. 1999) and
humans with diabetes (Seron, Cameron et al. 1991).
In the present study, we set out to explore the mechanisms that control endothelial activation
within the kidney glomerulus in diabetes. We started from the premise that the ordinary
functioning of the kidney glomerulus depends upon the orchestrated interaction of its cellular
constituents. In particular, paracrine communication between podocytes lining the urinary space
and endothelial cells lining the glomerular capillary walls maintains the permselective integrity of
the glomerular filtration barrier (reviewed in Siddiqi and Advani 2013). Having found that the
chemokine CCL2 is significantly enriched in the media of cultured human podocytes under high
97
glucose conditions (Chapter 3), in this study, we set out to determine the paracrine effect of
podocyte-derived CCL2 on glomerular endothelial cell activation under high glucose conditions.
We hypothesized that CCL2 secreted by glomerular podocytes under conditions of high glucose
may promote glomerular endothelial cell activation characterized by VCAM-1 upregulation.
Beginning by testing this hypothesis, we discovered a pivotal role for the phosphorylation of
histone protein H3 on serine residue 10 (phospho-histone H3Ser10) in facilitating glomerular
endothelial activation in diabetic kidney disease.
4.2. RESEARCH DESIGN AND METHODS
4.2.1. Cell culture
Experiments were conducted in conditionally immortalized human podocytes (provided by Dr.
Moin Saleem, University of Bristol, UK) (Saleem, O'Hare et al. 2002) and in primary cultured
human renal glomerular endothelial cells (hGECs) (ScienCell Research Laboratories, Carlsbad,
CA) (Yuen, Stead et al. 2012, Batchu, Majumder et al. 2016). hGECs were cultured under
control conditions (5.6mM glucose) or with the addition of 19.4mM glucose (final concentration
25mM, high glucose, HG) or 19.4mM mannitol for 16h. To generate human podocyte
conditioned medium, differentiated human podocytes were incubated under control conditions
(5.6mM glucose, hpod_CM) or high (25mM) glucose conditions (hpod_HGCM) for 48h.
Neutralizing antibody experiments were performed by incubating hGECs for 16h in high glucose
or hpod_HGCM that had been pre-incubated with an anti-CCL2 neutralizing antibody (Thermo
Fisher Scientific, Rockford, IL) at a concentration of 20µg/ml (Shah, Hinkle et al. 2011) for 1h.
Recombinant angiopoietin-1, angiopoietin-2 or endothelin-1 were applied to hGECs for 16h at
the following concentrations: angiopoietin-1 100ng/ml (Satchell, Anderson et al. 2004) (R & D
Systems, Minneapolis, MN); angiopoietin-2 100ng/ml (R & D Systems) and endothelin-1 10nM
(Collino, Bussolati et al. 2008) (Tocris Bioscience, Bristol, UK). Recombinant human CCL2
(Cloud-Clone Corp., Katy, TX) was applied to hGECs at a concentration of 0.5ng/ml (Salcedo,
Ponce et al. 2000, Gibson, Greaves et al. 2015) for 16h. For CCR2 antagonism, hGECs were
incubated with RS504393 (IC50 <100nM (Mirzadegan, Diehl et al. 2000); Tocris Bioscience) at a
concentration of 10µM (Simonson and Ismail-Beigi 2011). For inhibition of p38 mitogen-
98
activated protein kinase (MAPK), hGECs were incubated with SB203580 (IC50 0.6µM (Cuenda,
Rouse et al. 1995); Tocris Bioscience) at a concentration of 10µM (Clerk, Michael et al. 1998).
For inhibition of mitogen- and stress-activated protein kinase 1/2 (MSK1/2), hGECs were
incubated with SB-747651A (IC50 11nM (Naqvi, Macdonald et al. 2012); Tocris Bioscience) at a
concentration of 5µM (Naqvi, Macdonald et al. 2012).
4.2.2. Immunoblotting
Immunoblotting was performed with antibodies in the following concentrations: VCAM-1
1:1000 (Santa Cruz Biotechnology, Dallas, TX), -actin 1:10,000 (Sigma-Aldrich, Oakville,
Ontario, Canada), CCL2 1:1000 (Novus Biologicals, Littleton, CO), CCR2 1:1000 (Novus
Biologicals), ICAM-1 1:1000 (Cell Signaling Technology, Danvers, MA), E-selectin 1:1000
(Abcam, Cambridge, MA), P-selectin 1:1000 (Abcam), phospho-p38 MAPK (Thr180/Tyr182)
1:1000 (Cell Signaling Technology), total p38 MAPK 1:1000 (Cell Signaling Technology),
phospho-histone H3 serine 10 (phospho-histone H3Ser10) 1:1000 (Abcam), total histone H3
1:1000 (Cell Signaling Technology).
4.2.3. Animal Studies
In study one, male C57BL/6 mice (wildtype (WT); The Jackson Laboratory, Bar Harbor, ME)
and CCR2 knockout mice (CCR2-/-; The Jackson Laboratory) aged eight weeks were made
diabetic by administration of a daily intraperitoneal injection of streptozotocin (STZ) (55mg/kg)
in 0.1mol/L citrate buffer (pH 4.5) (or citrate buffer control) after a 4h fast for five consecutive
days. Mice were followed for 14 weeks from the first intraperitoneal injection of STZ (WT n=9;
CCR2-/-, n=6; STZ-WT, n=8; STZ-CCR2-/-, n=7). Blood glucose was determined using One
Touch UltraMini (LifeScan Canada Ltd., Burnaby, BC, Canada). Glomerular VCAM-1 was
determined in frozen kidney sections after immunostaining with a VCAM-1 antibody 1:50
dilution (BD Biosciences, San Jose, CA) and HRP-conjugated donkey anti-rat IgG (H&L) 1:100
dilution (Cedarlane, Burlington, ON, Canada). Glomerular VCAM-1 immunostaining was
quantified using ImageScope 11.1 software (Leica Microsystems, Concord, Ontario, Canada) in
99
an average of 7 glomerular profiles per mouse kidney and is represented as fold change relative
to WT. In study two, diabetes was induced in male WT and endothelial nitric oxide synthase
knockout (eNOS-/-) mice (The Jackson Laboratory) aged eight weeks, by five daily
intraperitoneal injections of STZ (55mg/kg) (or citrate buffer) as described in Chapter 3. Mice
were followed for three weeks from the first injection of STZ (WT, n=12; STZ-WT, n=14;
eNOS-/-, n=11, STZ-eNOS-/-, n=9). Urine CCL2 excretion was determined by ELISA (R & D
Systems) after 24h metabolic caging. All experimental procedures adhered to the guidelines of
the Canadian Council on Animal Care and were approved by the St. Michael’s Hospital Animal
Care Committee.
4.2.4. Chromatin Immunoprecipitation
For chromatin immunoprecipitation (ChIP), hGECs were incubated in the presence or absence of
5µM SB-747651A for 1h. ChIP was performed using a Magna ChIP kit (EMD Millipore,
Etobicoke, Ontario, Canada) with an antibody against phospho-histone H3Ser10 (1:50 dilution;
Abcam) or an equal concentration of normal rabbit IgG (Santa Cruz Biotechnology), as
previously described in Chapter 2 (see section 2.2.10). Quantitative real-time PCR was
performed using primers specific for the human VCAM-1 promoter in hGECs or for the mouse
Vcam-1 promoter in the kidneys of male WT and CCR2-/- mice aged 22 weeks (n=4/group).
Primer sequences are provided in the appendix.
4.2.5. Quantitative reverse transcriptase PCR
RNA was isolated from snap frozen kidney tissue or cell lysates using TRIzol Reagent (Thermo
Fisher Scientific) and cDNA was reverse transcribed from 1µg RNA using SuperScript III
Reverse Transcriptase (Thermo Fisher Scientific). Primer sequences are provided in the
appendix and were obtained from Integrated DNA Technologies (Coralville, IA). For
determination of miR-93 levels, RNA isolation was performed using TRIzol Reagent, poly(A)
tailing was performed using Poly(A) Polymerase, Yeast (Applied Biological Materials, Inc.,
Richmond, BC) and cDNA was synthesized using a miRNA cDNA Synthesis Kit (Applied
100
Biological Materials Inc.). Primers for has-miR-93 and U6 snRNA were from Applied
Biological Materials Inc. SYBR green based quantitative reverse transcriptase PCR (qRT-PCR)
was conducted using a ViiA7 Real-Time PCR System (Thermo Fisher Scientific) and data
analysis was performed using the Applied Biosystems Comparative CT method.
4.2.6. Human tissue study
Archived kidney tissue was examined from 8 individuals without diabetes (controls) and 9
individuals with diabetic kidney disease (Majumder, Thieme et al. 2018). Tissue had been
obtained at the time of nephrectomy for conventional renal carcinoma and was examined from
regions of the kidney unaffected by tumor. Immunohistochemistry was performed with an
antibody against phospho-histone H3Ser10 (1:200 dilution; Abcam) and the ratio of positively
immunostaining glomerular nuclei to total glomerular nuclei was calculated in 10 glomeruli per
kidney section. All histological analyses were performed by an investigator masked to the study
groups. The study was approved by the Nova Scotia Health Authority Research Ethics Board
and the Research Ethics Board of St. Michael’s Hospital, and was conducted in accordance with
the Declaration of Helsinki. A waiver of consent was provided by the Nova Scotia Health
Authority Research Ethics Board based on impracticability criteria.
4.2.7. In situ hybridization
In situ hybridization for VCAM-1 was performed with RNAscope (Advanced Cell Diagnostics,
Hayward, CA) according to the manufacturer’s instructions and using custom software as
previously described (Wang, Flanagan et al. 2012). Briefly, sections of formalin-fixed paraffin-
embedded mouse or human kidney tissue were baked for 1h at 60oC prior to deparaffinization,
dehydration and air drying. Slides were treated with a peroxidase blocker before boiling in target
retrieval solution for 15min. Protease plus was applied for 30min at 40oC and target probes were
hybridized for 2h at 40oC before signal amplification and washing. Hybridization signals were
detected using Fast Red and RNA staining was identified as red puncta on light microscopy. For
immunofluorescence microscopy, in situ hybridization was followed by immunostaining for
101
nephrin, CD31 or phospho-histone H3Ser10 using the following antibodies: mouse nephrin 1:200
(R & D Systems), secondary antibody Alexa Fluor 647 donkey anti-goat 1:100 (Thermo Fisher
Scientific); mouse CD31 1:100 (Abcam), secondary antibody Alexa Fluor 488 donkey anti-rabbit
1:100 (Thermo Fisher Scientific); human nephrin 1:100 (Abcam), secondary antibody Alexa
Fluor 488 donkey anti-rabbit 1:100 (Thermo Fisher Scientific); human CD31 1:100 (Cell
Signaling Technology), secondary antibody Alexa Fluor 647 donkey anti-mouse 1:100 (Thermo
Fisher Scientific); human phospho-histone H3Ser10 1:200 (Abcam), secondary antibody Alexa
Fluor 488 donkey anti-rabbit 1:100 (Thermo Fisher Scientific). DAPI was from Cell Signaling
and was used at a concentration of 1:10,000. Slides were viewed using a Zeiss LSM700 confocal
microscope (Carl Zeiss Canada, Toronto, ON, Canada) with a x63 optic.
4.2.8. Statistical Analysis
Data are expressed as mean ± S.D.. Statistical significance was determined by 1-way ANOVA
followed by Fisher least significant difference post hoc test for more than two groups and 2-tailed
Student t test for two group comparisons. Statistical analyses were performed using GraphPad
Prism for Mac OS X (GraphPad Software Inc., San Diego, CA).
102
4.3. RESULTS
4.3.1. Podocyte-derived CCL2 promotes VCAM-1 upregulation in human glomerular endothelial cells and knockout of the CCL2 receptor, CCR2 decreases glomerular VCAM-1 upregulation in diabetic mice
In our first series of experiments, we set out to determine which, if any, podocyte-derived
cytokines or chemokines promote the expression of VCAM-1 by glomerular endothelial cells
under high glucose conditions. By immunoblotting, we observed that VCAM-1 is expressed by
cultured human glomerular endothelial cells (hGECs) and that the magnitude of VCAM-1
expression is unaffected by exposure of hGECs to high (25mM) glucose or mannitol (osmotic
control) alone (Figure 4.1A). Likewise, when we exposed hGECs to culture medium that had
been conditioned by differentiated human podocytes (hpod_CM), we similarly observed no
change in hGEC VCAM-1 expression (Figures 4.2B). In contrast, VCAM-1 expression was
significantly increased when hGECs were incubated in the presence of culture medium that had
been conditioned by human podocytes that themselves had been exposed to high (25mM) glucose
(Figures 14B). Based on the 41 cytokines/chemokines we surveyed in Chapter 3 (Table 3.2), we
queried whether CCL2 was the causative factor responsible for VCAM-1 upregulation.
Confirming that CCL2 contributes to VCAM-1 upregulation, incubation of hGECs in
hpod_HGCM together with an anti-CCL2 neutralizing antibody resulted in a significant lowering
of VCAM-1 mRNA (Figure 4.1C) and protein (Figure 4.1D) levels.
103
Figure 4.1: Anti-CCL2 neutralizing antibody diminishes VCAM-1 upregulation induced by
exposure of human glomerular endothelial cells (hGECs) to culture media conditioned by
high glucose-exposed podocytes. (A) Immunoblotting for VCAM-1 in hGECs incubated for 16h
under control conditions (5.6mM glucose) or in the presence of high glucose (25mM, HG) or
104
mannitol (osmotic control) (n=3/condition). (B) Immunoblotting for VCAM-1 in hGECs
incubated for 16h under control or HG conditions or in the presence of culture medium
conditioned by human podocytes (hpod_CM) or culture medium conditioned by human
podocytes exposed to high glucose (25mM) for 48h (hpod_HGCM) (control, n=5; HG, n=5;
hpod_CM, n=6; hpod_HGCM, n=7). (C) qRT-PCR for VCAM-1 in hGECs incubated for 16h
with high glucose or hpod_HGCM that had been pre-incubated with an anti-CCL2 neutralizing
antibody (20µg/ml) for 1h (control, n=5; HG, n=6; hpod_HGCM, n=6; hpod_HGCM + anti-
CCL2 antibody (Ab), n=6). (D) Immunoblotting for VCAM-1 in hGECs under control
conditions or incubated for 16h with HG or hpod_HGCM preincubated with an anti-CCL2
neutralizing antibody (20µg/ml) for 1h (n=5/condition). AU = arbitrary units. Values are mean ±
S.D.. *p<0.05, **p<0.01, ****p<0.0001 by 1-way ANOVA followed by Fisher least significant
difference post hoc test.
105
We recognized that podocytes secrete other factors that were not included in our
cytokine/chemokine multiplex array (e.g. angiopoietin-1, angiopoietin-2 and endothelin-1) and
that some of these factors have been implicated in podocyte-endothelial communication
(reviewed in Siddiqi and Advani 2013, Daehn, Casalena et al. 2014). However, when we
exposed hGECs to recombinant angiopoietin-1, angiopoietin-2 or endothelin-1 we observed that
each of these recombinant proteins actually downregulated VCAM-1 expression (Figure 4.2).
Figure 4.2: Immunoblotting hGECs for VCAM-1 under control conditions or following
incubation with recombinant angiopoietin-1 (Ang-1; 100ng/ml), angiopoietin-2 (Ang-2;
100ng/ml) or endothelin-1 10nM for 16h (ET-1; n=5/condition). AU = arbitrary units. Values
are mean ± S.D.. **p<0.01, ***p<0.001 by 1-way ANOVA followed by Fisher least significant
difference post hoc test.
106
By immunoblotting we observed that hGECs express the principal receptor for CCL2, CCR2 (as
well as CCL2 itself) and that neither CCR2 nor CCL2 were altered in their expression by high
glucose in hGECs (Figures 4.3A and B).
Figure 4.3. Effect of high glucose on CCR2 and CCL2 expression in cultured hGECs. (A
and B) Immunoblotting hGECs for CCR2 (A) or CCL2 (B) under control conditions or following
incubation with HG or mannitol (osmotic control) for 48h (n=4/condition). AU = arbitrary units.
Values are mean ± S.D.
To determine whether CCR2 regulates glomerular VCAM-1 expression in vivo, we examined the
kidneys of non-diabetic and diabetic wildtype (WT) and CCR2-/- mice 14 weeks after the initial
induction of diabetes with streptozotocin (STZ). Whereas elevated blood glucose levels were
unaffected by CCR2 knockout (Figure 4.4A), glomerular VCAM-1 upregulation was
significantly attenuated in diabetic CCR2-/- mice (Figure 4.4B).
107
Figure 4.4: Knockout of the CCL2 receptor, CCR2 decreases glomerular VCAM-1
upregulation in diabetic mice. (A and B) Wildtype (WT) and CCR2 knockout (CCR2-/-) mice
14 weeks after diabetes induction with STZ. (A) Blood glucose and (B) immunohistochemistry
for VCAM-1 and quantification of glomerular VCAM-1 immunostaining (WT, n=9; CCR2-/-,
n=6; STZ-WT, n=8; STZ-CCR2-/-, n=7). Original magnification x400. AU = arbitrary units.
Values are mean ± S.D.. **p<0.01, ***p<0.001, ****p<0.0001 by 1-way ANOVA followed by
Fisher least significant difference post hoc test.
By immunofluorescence microscopy we observed VCAM-1 to be expressed by CD31-positive
glomerular endothelial cells in the kidneys of both mice and humans (Figure 4.5). However,
glomerular endothelial cells were not the only cells to express the adhesion molecule, VCAM-1
transcript levels also being detectable in nephrin-positive podocytes (Figure 4.5).
108
Figure 4.5: In situ hybridization for VCAM-1 (blue) and immunostaining for nephrin (red) and
CD31 (green) in mouse (A) and human (B) kidneys. Original images taken with a x63 optic.
The zoomed images are enlargements of the boxed areas. The arrows label VCAM-1 transcript
signals (blue puncta) in CD31-positive cells (thick arrows) and nephrin-positive cells (thin
arrows).
109
4.3.2. CCL2/CCR2 signaling controls glomerular endothelial cell VCAM-1 expression through p38 MAPK and MSK1/2 dependent pathways
Having discovered that CCL2 regulates VCAM-1 expression in cultured hGECs and that
knockout of the CCL2 receptor, CCR2 diminishes glomerular VCAM-1 upregulation in diabetic
mice, we next set out to determine the pathways through which CCL2/CCR2 signaling control
VCAM-1. We observed that exposing hGECs to recombinant CCL2 caused a greater than
doubling in VCAM-1 protein levels and that this increase was negated by antagonism of CCR2
(Figure 4.6A). We recognized the importance of p38 MAPK as a downstream regulator of CCR2
signaling (Werle, Schmal et al. 2002) and we found that recombinant CCL2 increased hGEC p38
MAPK threonine 180/tyrosine 182 (Thr180/Tyr182) phosphorylation (Figure 4.6B), indicative of
p38 MAPK activation. As expected, pre-treatment of hGECs with the CCR2 antagonist
RS504393 negated the increase in p38 MAPK phosphorylation induced by CCL2 (Figure 4.6C).
Confirming that p38 MAPK activation is required for hGEC VCAM-1 expression, we observed
that the p38 MAPK inhibitor, SB203580 (Cuenda, Rouse et al. 1995) prevented hGEC VCAM-1
upregulation induced by CCL2 (Figure 4.6D). Next, we considered how p38 MAPK induces
VCAM-1 upregulation. Two downstream kinases that are activated by p38 MAPK are MSK1
and MSK2. We pre-incubated cells with the MSK1/2 inhibitor, SB-747651A (Naqvi, Macdonald
et al. 2012) and we observed that, like p38 MAPK inhibition, MSK1/2 inhibition also prevented
the upregulation in hGEC VCAM-1 induced by CCL2 (Figure 4.6E).
110
Figure 4.6: CCL2 increases human glomerular endothelial cell (hGEC) VCAM-1 levels
through CCR2, p38 MAPK, MSK1/2 regulated mechanisms. (A) Immunoblotting for
VCAM-1 in hGECs incubated with or without the CCR2 antagonist RS504393 (10µM) for 1h
before exposure to recombinant CCL2 (0.5ng/ml) for 16h (control, n=5; RS504393, n=5; CCL2,
n=3; CCL2 + RS504393, n=3). (B) Immunoblotting for p38 MAPK threonine 180/tyrosine 182
(Thr180/Tyr182) phosphorylation (phospho-p38 MAPK) in hGECs incubated in the presence or
absence of CCL2 (0.5ng/ml) for 16h (n=7/condition). (C) Immunoblotting for phospho-p38
MAPK in hGECs incubated in the presence or absence of the CCR2 antagonist RS504393
(10µM) for 1h before exposure to recombinant CCL2 (0.5ng/ml) for 16h (n=4/condition). (D)
Immunoblotting for VCAM-1 in hGECs incubated with or without the p38 MAPK inhibitor
111
SB203580 (10µM) for 1h before exposure to recombinant CCL2 (0.5ng/ml) for 16h (control,
n=7; SB203580, n=6; CCL2, n=7; CCL2 + SB203580, n=6). (E) Immunoblotting for VCAM-1
in hGECs incubated with or without the MSK1/2 inhibitor SB-747651A (5µM) for 1h before
exposure to recombinant CCL2 (0.5ng/ml) for 16h (control, n=5; SB-747651A, n=4; CCL2, n=5;
CCL2 + SB-747651A, n=5). AU = arbitrary units. Values are mean ± S.D.. *p<0.05, **p<0.01,
****p<0.0001 by 1-way ANOVA followed by Fisher least significant difference post hoc test (A,
C, D, E) and 2-tailed Student t test (B).
Supporting a relative specificity for the regulation in the expression of VCAM-1 by CCL2, we
found that the expression of other adhesion molecules (i.e. ICAM-1, E-selectin and P-selectin)
was unaffected by treatment of hGECs with recombinant CCL2 (Figure 4.7).
Figure 4.7: Immunoblotting for ICAM-1, E-selectin and P-selectin in hGECs under control
conditions or following incubation with recombinant CCL2 (0.5ng/ml) for 16h (ICAM-1 and E-
selectin, n=6/condition; P-selectin, n=4/condition). AU = arbitrary units. Values are mean ±
S.D..
112
4.3.3. CCL2 induces histone H3 serine 10 phosphorylation, which is enriched at the VCAM-1 promoter in human glomerular endothelial cells and the Vcam-1 promoter in mouse kidneys
MSK1/2 is known to regulate gene expression by directly phosphorylating histone protein H3,
including phosphorylating histone H3 on serine residue 10, which is a mark of active gene
transcription. Accordingly, we next probed to see whether phospho-histone H3Ser10 levels are
altered by CCL2 in hGECs. Aligned with this hypothesis, CCL2 induced an increase in H3Ser10
phosphorylation levels in hGECs and this effect was negated by antagonism of CCR2 (Figure
4.8A) or inhibition of either p38 MAPK (Figure 4.8B) or MSK1/2 (Figure 4.8C). Furthermore,
using chromatin immunoprecipitation (ChIP), we observed enrichment of H3Ser10
phosphorylation at the promoter region of VCAM-1 in hGECs, whereas this enrichment was
diminished (although not negated) by MSK1/2 inhibition (Figure 4.8D). To determine whether
H3Ser10 phosphorylation is also enriched at the Vcam-1 promoter in vivo and whether this is
affected by upstream CCR2-regulated signaling, we performed ChIP experiments in the kidneys
of WT and CCR2-/- mice. Whereas H3Ser10 phosphorylation was enriched at the Vcam-1
promoter in WT mouse kidneys, enrichment was approximately two-thirds lower in the kidneys
of CCR2-/- mice (Figure 4.8E).
113
Figure 4.8: CCL2 increases hGEC histone H3 serine 10 (H3Ser10) phosphorylation and
phospho-histone H3Ser10 is enriched at the VCAM-1 promoter in hGECs and mouse
kidneys. (A) Immunoblotting hGECs for histone H3Ser10 phosphorylation (phospho-histone
H3Ser10) incubated with or without the CCR2 antagonist RS504393 (10µM) for 1h before
exposure to recombinant CCL2 (0.5ng/ml) for 16h (n=5/condition). (B) Immunoblotting hGECs
for phospho-histone H3Ser10 incubated with or without the p38 MAPK inhibitor SB203580
(10µM) for 1h before exposure to recombinant CCL2 (0.5ng/ml) for 16h (n=5/condition). (C)
Immunoblotting hGECs for phospho-histone H3Ser10 incubated with or without the MSK1/2
inhibitor SB-747651A (5µM) for 1h before exposure to recombinant CCL2 (0.5ng/ml) for 16h
(control, n=6; SB-747651A, n=5; CCL2, n=6; CCL2 + SB=747651A, n=5). (D) Chromatin
immunoprecipitation (ChIP) for the presence of phospho-histone H3Ser10 at the VCAM-1
promoter in hGECs in the presence or absence of SB-747651A (5µM) for 1h (n=7/condition).
114
(E) ChIP for phospho-histone H3Ser10 at the Vcam-1 promoter in wildtype (WT) and CCR2
knockout (CCR2-/-) mouse kidneys (n=4/group). ChIP data were determined by quantitative real-
time PCR. AU = arbitrary units. Values are mean ± S.D.. *p<0.05, **p<0.01, ***p<0.001,
****p<0.0001 by 1-way ANOVA followed by Fisher least significant difference post hoc test.
miR-93 has recently been implicated in regulating podocyte MSK mediated H3Ser10
phosphorylation in diabetic kidney disease (Badal, Wang et al. 2016). However, we saw no
change in miR-93 levels in hGECs following CCL2 treatment (Figure 4.9).
Figure 4.9: qRT-PCR for miR-93 in hGECs under control conditions or following incubation
with recombinant CCL2 (0.5ng/ml) for 16h (control, n=6; CCL2, n=5).
4.3.4. Histone H3 serine 10 phosphorylation is increased in murine and human diabetic kidney disease
Having identified a role for H3Ser10 phosphorylation in facilitating CCL2/CCR2 mediated
VCAM-1 upregulation, we set out to determine whether H3Ser10 phosphorylation levels are
altered in diabetic kidney disease. For these experiments, we chose to study both a mouse model
of diabetic kidney disease that is characterized by endothelial dysfunction and podocytopathy
(STZ-diabetic eNOS-/- mice) (Yuen, Stead et al. 2012) and the glomeruli of humans with diabetic
kidney disease (Majumder, Thieme et al. 2018). In comparison to non-diabetic mice, three weeks
115
after the first intraperitoneal STZ injection, STZ-eNOS-/- mice exhibited renal enlargement and
heavy albuminuria (functional data presented in Table 3.1, Chapter 3) that were accompanied by
increased urinary excretion of CCL2 (Figure 4.10A,), increased renal H3Ser10 phosphorylation
(Figure 4.10B) and increased renal VCAM-1 mRNA (Figure 4.10C and D) and protein (Figure
4.10E) levels.
Figure 4.10: Urine CCL2 excretion and renal histone H3 serine 10 phosphorylation and
VCAM-1 expression are increased in streptozotocin (STZ)-diabetic endothelial nitric oxide
synthase (eNOS) knockout (eNOS-/-) mice. Wildtype (WT) and eNOS-/- mice three weeks after
the initiation of diabetes induction with STZ. (A) Urine CCL2 excretion (these data are re-
116
presented from from Table 3.1 in Chapter 3 and they are shown again here to aid the
interpretability of the findings). (WT, n=6; STZ-WT, n=7; eNOS-/-, n=5; STZ-eNOS-/-, n=5). (B)
Renal histone H3Ser10 phosphorylation (phospho-histone H3Ser10) (WT, n=7; STZ-WT, n=7;
eNOS-/-, n=6; STZ-eNOS-/-, n=6). (C) Renal VCAM-1 mRNA levels (WT, n=10; STZ-WT,
n=11; eNOS-/-, n=9; STZ-eNOS-/-, n=9). (D) In situ hybridization for VCAM-1. Original
magnification x400. (E) Immunoblotting kidney homogenates for VCAM-1 (n=4/group). AU =
arbitrary units. Values are mean ± S.D.. *p<0.05, **p<0.01, by 1-way ANOVA followed by
Fisher least significant difference post hoc test.
To explore the relationship between H3Ser10 phosphorylation and VCAM-1 expression in
human diabetic kidney disease, we studied kidney tissue from individuals with
histopathologically confirmed diabetic glomerulosclerosis and we compared it to kidney tissue
from individuals without diabetes. The clinical characteristics of the individuals from whom
kidney tissue was obtained have been reported before (Majumder, Thieme et al. 2018). In brief,
we examined kidney tissue from 8 controls (5 male, 3 female; age 69±11 years, serum creatinine
85±11 µmol/L, eGFR 74±11 ml/min/1.73m2) and 9 individuals with diabetic kidney disease (5
male, 4 female; age 67±10 years, serum creatinine 107±39 µmol/L, eGFR 61±25
ml/min/1.73m2). Five of the individuals with diabetic kidney disease had stage 3 chronic kidney
disease or worse. We observed that in the kidney sections from humans with diabetic
glomerulosclerosis there was an approximate 3-fold increase in the proportion of glomerular
nuclei positively immunostaining for histone H3Ser10 phosphorylation (Figure 4.11A) including
H3Ser10 phosphorylation in VCAM-1 expressing glomerular cells (Fiure 4.11B).
117
Figure 4.11: Histone H3 serine 10 phosphorylation is increased in human diabetic kidney
disease. (A) Immunohistochemistry for histone H3Ser10 phosphorylation (phospho-histone
H3Ser10) in kidney sections from controls (h_Control; n=8) and individuals with diabetic kidney
disease (h_Diabetes; n=9) and quantification of the proportion of phospho-histone H3Ser10
positive glomerular nuclei. Original magnification x400. (B) In situ hybridization for VCAM-1
(blue puncta) and immunostaining for phospho-histone H3Ser10 (green) in kidney sections from
a control and from an individual with diabetic glomerulosclerosis. Original images taken with a
x63 optic. The zoomed images are enlargements of the boxed areas. Values are mean ± S.D..
****p<0.0001 by 2-tailed Student t test.
118
4.4. DISCUSSION
Every cell that lies within the kidney glomerulus is affected by diabetes and every cell that lies
within the kidney glomerulus is affected by the actions of its neighbours. In the present study,
we unearthed a signaling cascade that regulates expression of the adhesion molecule VCAM-1 by
glomerular endothelial cells. Specifically, ligand-binding by the receptor, CCR2 expressed by
glomerular endothelial cells induces VCAM-1 upregulation through a pathway that is regulated
by the MSK1/2-dependent phosphorylation of histone protein H3 on serine residue 10.
Heightened phospho-histone H3Ser10 levels in experimental and human diabetic kidney disease
and recent improvements in MSK1/2 inhibitor specificity (Naqvi, Macdonald et al. 2012) should
galvanize efforts to explore the modulation of histone phosphorylation as a means of attenuating
kidney disease in diabetes.
As a marker of endothelial activation, we focused on the regulation of expression of VCAM-1, an
immunoglobulin superfamily member that is expressed on the surface of endothelial cells in
response to pro-inflammatory cytokines. VCAM-1 promotes the firm adhesion and spreading of
leukocytes on the endothelium enabling their transmigration across the endothelial barrier.
Several studies have linked circulating VCAM-1 levels to diabetic kidney disease or mortality
risk (Stehouwer, Gall et al. 2002, Rubio-Guerra, Vargas-Robles et al. 2009, Liu, Yeoh et al.
2015) and likewise a number of reports have described an association between renal expression
or urinary excretion of the CCR2 ligand, CCL2 and the extent of diabetic kidney disease (Wada,
Furuichi et al. 2000, Tashiro, Koyanagi et al. 2002, Har, Scholey et al. 2013). However, even
though CCL2, CCR2 and VCAM-1 are often considered together in the same context of
inflammation, this is to our knowledge the first description that CCL2/CCR2 binding can directly
trigger glomerular endothelial VCAM-1 upregulation.
CCL2 (also called monocyte chemoattractant protein-1, MCP-1) is a member of the CC
chemokine family. Although CCL2 is best known for its function as the ligand for the receptor
CCR2 which is expressed on the surface of monocytes and macrophages, the actions of CCL2
and CCR2 are not limited to inflammatory cells and the relationship between CCL2 and CCR2 is
not monogamous. For instance, podocytes themselves are known to express both CCL2 and
CCR2 (Lee, Chung et al. 2009, Tarabra, Giunti et al. 2009) and we observed that hGECs also
express both ligand and receptor. In terms of ligand-receptor specificity, CCL2 also binds to
119
CCR4 (Power, Meyer et al. 1995) and CCR2 may also be bound by CCL7, CCL8, CCL12
(mouse only), CCL13 and CCL16 (human only) (reviewed in Chu, Arumugam et al. 2014). In a
similar non-reductionist context, although we focused on VCAM-1 upregulation as a marker of
endothelial activation (reviewed in Liao 2013), it is noteworthy that other glomerular cells,
including both podocytes (Visweswaran, Gholizadeh et al. 2015) and mesangial cells (Ishibashi,
Matsui et al. 2014) are also capable of expressing VCAM-1. In the present study, we observed
that: i) VCAM-1 levels were increased in hGECs incubated in culture medium that had been
conditioned by podocytes exposed to high glucose; ii) that secretion of CCL2 by podocytes into
the culture medium was upregulated by high glucose; iii) that an anti-CCL2 neutralizing antibody
diminished hGEC VCAM-1 expression; and iv) that recombinant CCL2 induced hGEC VCAM-1
upregulation in a CCR2-dependent manner. Thus, whereas CCL2/CCR2 signaling to hGECs
could be paracrine in origin, autocrine in origin or both and whereas the relationship between
CCL2 and CCR2 is not exclusive, the evidence herein presented demonstrates that CCR2
signaling regulates glomerular VCAM-1 expression, including CCL2-induced VCAM-1
upregulation by human glomerular endothelial cells.
In unravelling the cascade by which signaling through CCR2 induces VCAM-1 upregulation in
hGECs, we discovered important roles for p38 MAPK and MSK1/2 and an associated enrichment
of the histone H3Ser10 phosphorylation mark at the VCAM-1 promoter. Chromatin
modifications, such as histone H3Ser10 phosphorylation rarely control gene activation or
repression in isolation. Rather an interplay exists whereby histone marks function alongside
other epigenetic regulators, alongside other histone marks and alongside canonical transcription
factors to coordinate gene expression in an integrated manner (reviewed in Yerra and Advani
2018). For instance, H3Ser10 phosphorylation (like histone acetylation) can facilitate gene
activation by affecting the electrostatic charge relationship between histone proteins and DNA,
associating with open chromatin during interphase and allowing access to DNA by the
transcriptional machinery. Separately, H3Ser10 phosphorylation may also promote gene
transcription by virtue of its proximity to other histone marks. For instance, the histone
acetyltransferase Gcn5 can acetylate lysine residue 14 (K14) on histone H3 more effectively
when H3Ser10 is phosphorylated, H3K14ac being found at actively transcribed promoters (Lo,
Trievel et al. 2000). A number of kinases have been reported to phosphorylate histone H3 on
serine residue 10, but the best characterized of these is MSK1/2 which is a substrate for p38
120
MAPK (Thomson, Clayton et al. 1999), itself activated by CCR2 (Werle, Schmal et al. 2002).
The observation that MSK1/2 inhibition reduced but did not negate H3Ser10 phosphorylation at
the VCAM-1 promoter may suggest an additional role for other kinases (e.g. calcium/calmodulin-
dependent protein kinase II (CaMKII) (Smedlund, Tano et al. 2010, Awad, Kunhi et al. 2013).
Similarly, H3Ser10 is not the only substrate of MSK1/2, the transcription factor, cAMP response-
element binding protein (CREB) also being phosphorylated by the kinase (Arthur and Cohen
2000). Indeed, VCAM-1 expression induced by tumor necrosis factor- in endothelial cells has
been reported to involve p38 MAPK-mediated CREB phosphorylation (Ono, Ichiki et al. 2006).
Moreover, transcription factor binding at specific sites on the genome is itself dependent on
histone modifications and is both histone modification-specific and protein family-specific (Xin
and Rohs 2018). Thus, aligned with the current perspective of coordinated interplay between
epigenetic modifications and canonical transcription factors, CCR2-regulated VCAM-1
expression by the glomerular endothelium likely involves both effects that are mediated through
histone protein post-translational modifications and effects that are regulated by associated
transcription factor responses. Nonetheless, a role for H3Ser10 phosphorylation in regulating
endothelial activation in diabetes is supported by increased H3Ser10 phosphorylation at the
VCAM-1 promoter and a reduction with MSK1/2 inhibition that coincided with a decrease in
VCAM-1 protein levels in hGECs. H3Ser10 phosphorylation could regulate VCAM-1
expression by directly affecting CCR2 mediated signaling or it could have parallel effects,
decreased H3Ser10 phosphorylation functioning as an epigenetic brake to canonical transcription
factor mediated gene transcription (Figure 4.12).
121
Figure 4.12: Schematic illustration of the role that histone H3 serine 10 (H3Ser10)
phosphorylation plays in regulating glomerular endothelial VCAM-1 expression and
endothelial activation in diabetes. High glucose causes increased secretion of the chemokine,
CCL2 by podocytes. CCL2 may function in a paracrine fashion (e.g. arising from podocytes) or
autocrine fashion (arising from the glomerular endothelium) and binds to its cognate receptor,
CCR2 on glomerular endothelial cells. CCR2 can induce signaling that leads to canonical
122
transcription factor effects and it can induce signaling that results in epigenetic effects, each of
which may promote VCAM-1 expression. CCR2 signaling can induce epigenetic effects through
a pathway that involves the sequential activation of p38 MAPK, the nuclear kinases mitogen- and
stress-activated protein kinases 1/2 (MSK1/2) and histone H3Ser10 phosphorylation.
Antagonizing CCR2 or inhibiting p38 MAPK or MSK1/2 (numbered circles) limits both
H3Ser10 phosphorylation and VCAM-1 expression by glomerular endothelial cells. H3Ser10
may also be phosphorylated by other kinases and MSK1/2 can also phosphorylate other
transcription factors.
Consistent with its contributory role to the development of diabetic kidney disease, we observed
increased levels of H3Ser10 phosphorylation both in the kidneys of STZ-eNOS-/- mice (a model
considered to more closely mimic human disease (Fu, Wei et al. 2018) and in the glomeruli of
humans with diabetic kidney disease. We studied STZ-eNOS-/- mice soon after the induction of
diabetes because we have previously found that the heavy albuminuria that these mice develops
coincides with the onset of hyperglycemia (Yuen, Stead et al. 2012). Even at this early
timepoint, we observed increased urine CCL2 excretion in STZ-eNOS-/- mice that coincided with
increases in both renal H3Ser10 phosphorylation and VCAM-1 expression. It should be noted
however that, distinct from its role in transcriptional activation, H3Ser10 phosphorylation also
marks highly condensed chromatin during mitosis. Thus, it is unclear whether the increased
kidney cell H3Ser10 phosphorylation in diabetes is indicative of mitotic cell division, a
generalized shift in the epigenomic landscape that supports transcriptional activation, or a
combination of the two. Interestingly though, the findings are aligned with a recent study that
reported increased global H3Ser10 phosphorylation levels in podocytes exposed to high glucose
and in glomerular cells of Type 2 diabetic db/db mice (Badal, Wang et al. 2016).
As already highlighted, our study has limitations. Notably paracrine podocyte-derived CCL2
may not be the only activator of hGEC CCR2 signaling; H3Ser10 phosphorylation by MSK1/2
may not be the sole means through which CCR2 signaling regulates VCAM-1 expression; and
increases in kidney cell H3Ser10 phosphorylation in experimental and human diabetic kidney
disease will not solely reflect the changes occurring at the VCAM-1 promoter. Looking back at
our initial experiments, it is also noteworthy that despite containing appreciable levels of CCL2,
123
media of podocytes grown under normal glucose conditions did not induce hGEC VCAM-1
upregulation. This suggests the presence of other non-quantified factor(s) in the culture media.
For instance, we observed a reduction in VCAM-1 expression by exposure of hGECs to
recombinant angiopoietin-1, which is constitutively expressed by podocytes and which is
downregulated in diabetes (reviewed in Gnudi 2016). Thus, overall effects of podocyte
conditioned medium likely reflect the overall balance of its constituents, which are not limited to
proteins but may also involve bioactive lipids, nucleic acids and microparticles (reviewed in
Siddiqi and Advani 2013).
Despite their limitations, the experiments herein reported do provide important new insights.
Firstly, they demonstrate how pro-inflammatory cytokines/chemokines can have direct effects on
the glomerular endothelium. This could have implications for the interpretation of the
mechanism of action of anti-inflammatory therapies recently trialed in the treatment of diabetic
kidney disease (de Zeeuw, Bekker et al. 2015, Tuttle, Brosius et al. 2018). Secondly, they
highlight the emerging role for H3Ser10 phosphorylation and its regulatory kinases, MSK1/2 in
facilitating the activation of genes important to the development of kidney disease in diabetes,
specifically here the expression of VCAM-1 by glomerular endothelial cells. Moreover, the
elucidation of these actions in cultured cells of human origin and the observation of heightened
glomerular cell H3Ser10 phosphorylation in human diabetic kidney disease lend weight to the
significance of the findings in an era when the value of rodent models is under scrutiny.
In summary, ligand-binding by CCR2 initiates an intracellular signalling cascade in glomerular
endothelial cells that involves the p38 MAPK, MSK1/2 regulated phosphorylation of serine
residue 10 on histone H3 facilitating the expression of the inducible pro-inflammatory adhesion
molecule VCAM-1, a marker of endothelial activation. Histone protein phosphorylation should
be placed alongside previously better studied histone modifications when considering potentially
druggable candidates suitable for targeted intervention in diabetic kidney disease.
124
CHAPTER 5: SUMMARY AND LIMITATIONS
125
5.1. Summary of results
CKD is a serious complication of diabetes that is expected to increase in the prevalence over the
next decade (reviewed in Webster, Nagler et al. 2017). Current treatments include intensive
glycemic control, blood pressure control, blockade of the RAAS, and in some patients inhibition
of SGLT2. Although these therapeutic interventions have shown significant benefits, progression
to ESKD still occurs in many patients, creating a substantial burden on patients, their families,
and health care systems. The work described in this doctoral dissertation seeks to advance our
understanding of glomerular cell (patho)biology at the fundamental level as a means of paving
the way for the development of new treatments for CKD.
In the first study described in Chapter 2, we described the homeostatic effects of JAK2 in
glomerular podocytes under normal conditions. Deletion of JAK2 from podocytes in mice
contributed to the development of albuminuria, which was accompanied by lysosomal
dysfunction and impaired autophagy completion. Likewise, JAK2 knockdown in cultured mouse
podocytes resulted in downregulation of lysosomal genes including the aspartic proteinase
cathepsin D, and it impaired autophagy completion. Having found that JAK2 knockdown caused
downregulation of several lysosomal genes at the transcriptional level, we examined whether this
was mediated by dysregulation of the master regulator of lysosomal biogenesis and autophagy,
TFEB. We found that JAK2 knockdown in cultured mouse podocytes caused a significant
reduction in TFEB promoter activity, mRNA levels, and protein levels, suggesting that JAK2 acts
upstream of TFEB. We went on to discover that the transcription factor STAT1 that acts
downstream of JAK2, was enriched at the TFEB promoter, and this enrichment was diminished
by JAK2 knockdown. In a rescue experiment, we examined whether TFEB overexpression could
restore podocyte dysfunction in a cell culture system. TFEB overexpression in cultured mouse
podocytes improved autophagic flux, increased the expression and the activity of cathepsin D,
and reduced albumin permeability induced by JAK2 knockdown. Taken together, these data
demonstrate that JAK2 plays an important role in podocyte autophagy through regulation of the
transcription factor, TFEB. The study also hints at the possibility of enhancing TFEB activity as a
potential therapeutic strategy to maintain podocyte health.
The second study presented in Chapter 3 unraveled the effects of systemic JAK2 inhibition and
of JAK2 deletion from podocytes on kidney function in the disease setting. We selected diabetes
126
as the disease setting as it is the leading cause of CKD. Systemic inhibition of JAK2 with the
pharmacological inhibitor AZD1480 reduced albuminuria in a mouse model of DKD. Although
JAK2 deletion from podocytes under normal conditions led to the development of albuminuria,
JAK2 absence in podocytes neither increased nor decreased albuminuria in diabetic mice.
Recognizing that the JAK/STAT pathway is implicated in inflammation, we queried whether
JAK2 inhibition has an anti-inflammatory effect in diabetic mice. By assessing urine excretion of
the proinflammatory chemokine CCL2, we found that JAK2 inhibition by AZD1480 treatment
resulted in a significant decrease in urine CCL2 excretion in diabetic mice. Because JAK2 acts
upstream of CCL2 and because podocytes are the major source of glomerular CCL2
(Prodjosudjadi, Gerritsma et al. 1995, Chow, Ozols et al. 2004, Hartner, Veelken et al. 2005), we
examined whether deletion of JAK2 from podocytes would decrease urine CCL2 excretion. We
discovered that podocyte-specific JAK2 knockout attenuated urine CCL2 excretion in diabetic
mice, suggesting that podocyte JAK2 play different roles in the context of normoglycemia and of
diabetes. By performing an array for 41 inflammatory cytokines and chemokines, we identified
that CCL2 was significantly enriched in the culture media derived from podocytes under high
glucose conditions. Without undermining the homeostatic action of podocyte JAK2 under normal
conditions, these data highlight the inflammatory effect of podocyte JAK2 in diabetes, and they
demonstrate that modulation of JAK2 activity may have a protective role in the kidney in
diabetes. The findings emphasize the importance of the metabolic milieu in influencing the
beneficial and the detrimental effects of JAK2 in podocytes.
Having found that CCL2 is enriched in the culture media derived from podocytes in the presence
of high glucose, in the third study described in Chapter 4, we built on these observations and
unraveled the effects of CCL2 signaling on glomerular endothelial cells. By exploring the actions
of podocyte-secreted CCL2, we discovered a role for CCL2 in glomerular endothelial activation,
characterized by VCAM-1 upregulation. Incubation of cultured human glomerular endothelial
cells with culture media derived from podocytes exposed to high glucose conditions caused a
marked increase in VCAM-1 mRNA and protein levels, which was prevented by blocking CCL2
signaling. Moreover, recombinant CCL2 alone was sufficient to upregulate VCAM-1 in cultured
human glomerular endothelial cells and this effect was negated with an antagonist of the CCL2
receptor, CCR2. Similarly, CCR2 knockout attenuated glomerular VCAM-1 upregulation in
STZ-diabetic mice. By performing a series of pharmacological inhibition studies, we discovered
127
that CCL2 signals through its cognate receptor CCR2 to induce an intracellular signaling cascade
that involves p38 MAPK, MSK1/2, and histone H3Ser10 phosphorylation resulting in VCAM-1
upregulation in glomerular endothelial cells. In STZ-diabetic eNOS-/- mice, we observed a
significant upregulation in renal VCAM-1 mRNA levels and protein levels and this upregulation
was associated with an increase in phospho-histone H3Ser10 protein levels, and urine CCL2
excretion. Likewise, in humans with DKD, glomerular phospho-histone H3Ser10 levels were
increased and this increase was associated with an increase in glomerular VCAM-1 transcript
levels. Collectively, the data from this study identified a new molecular mechanism that controls
glomerular endothelial activation in diabetes characterized by VCAM-1 expression. The findings
also point to the importance of histone phosphorylation in facilitating gene expression in DKD.
Figure 5.1. Summary of key findings. (Created by BioRender).
128
5.2. Limitations
Although each of the studies described in this dissertation provides new mechanistic insights into
glomerular cell (patho)biology in health and in diabetes, there are several limitations to the
findings that warrant discussion.
The study described in Chapter 2 reported a fundamental role of JAK2 in autophagy completion
and lysosomal function in podocytes through regulation of TFEB expression. We showed that
dysregulation of TFEB induced by JAK2 knockdown caused downregulation of multiple genes
essential for lysosomal function. However, these genes were compiled from the literature
according to their identified roles in the lysosome and their direct interaction with TFEB. A more
comprehensive approach could be achieved by performing transcriptome analysis using a
powerful tool of transcriptome profiling such as RNA sequencing technology to identify
dysregulated gene expression profiles implicated in the autophagy-lysosomal pathway with JAK2
knockdown. Moreover, we showed that six out of the 13 TFEB targets were downregulated with
JAK2 knockdown i.e. beclin 1, cathepsin D, cystinosin, mucolipin-1, ras-related GTP binding C,
and serine/threonine kinase 4. We speculated that the expression of these genes was not
uniformly reduced because TFEB expression, although significantly reduced with JAK2
knockdown, was not abolished. However, it is still not clear why these six transcripts were
exclusively downregulated out of all the TFEB targets we studied. Moreover, although each of
the downregulated TFEB targets plays an important role in the autophagy-lysosomal pathway and
five of the six TFEB targets were also downregulated in cultured primary podocytes isolated
from JAK2podKO mice, we only focused on cathepsin D in our rescue experiments. For instance,
serine/threonine kinase 4 (STK4) regulates autophagy by phosphorylation of the autophagic
membrane-specific protein LC3 at threonine 50, and loss of phosphorylation at this site in STK4
deficient cells has been reported to block autophagy by impairing fusion of autophagosomes with
lysosomes (Wilkinson and Hansen 2015, Wilkinson, Jariwala et al. 2015). Accordingly, whereas
JAK2 knockdown in cultured mouse podocytes did not alter the expression of most of the
surveyed genes involved in fusion of autophagosomes with lysosomes, reduction of STK4
expression with JAK2 knockdown may suggest otherwise. It remains possible that the reduction
in STK4 expression caused a defect in fusion of autophagosomes with lysosomes and this may
partly explain the impaired autophagy completion in JAK2 deficient podocytes and the improved
129
autophagic flux observed with TFEB overexpression. Furthermore, although cathepsin D was
previously shown to play a central role in autophagy and podocyte homeostasis (Yamamoto-
Nonaka, Koike et al. 2016), the effects of JAK2 knockdown and TFEB overexpression on
cathepsin D expression and activity in cultured podocytes were marginal albeit statistically
significant (Figure 2.11B and C). Nonetheless, the observation that cathepsin D mRNA levels
were also significantly reduced in primary podocytes isolated from JAK2podKO mice lends further
weight to the supposition that JAK2 regulates cathepsin D expression. Of note, whereas our
findings demonstrated that regulation of JAK2 by TFEB is STAT1-dependant, we did not
demonstrate a direct interaction between the TFEB promoter region and STAT1. To support our
findings, a mutated version for STAT1 predicted binding sites could have been included in our
ChIP experiments.
Dysregulation of the autophagy-lysosomal pathway has been shown to contribute to the
development of albuminuria in a range of kidney diseases (reviewed in Hartleben, Wanner et al.
2014). In our study, JAK2podKO mice developed albuminuria with dysregulated autophagy
completion and lysosomal dysfunction. Despite the development of albuminuria in JAK2podKO
mice at 10 weeks of age, we observed neither overt morphological defects in the glomeruli of
these mice (Figure 2.5) nor overt changes in podocyte morphology other than accumulation of
autophagosomes and lysosomes (Figure 2.6). Several studies have demonstrated that albuminuria
can occur without apparent morphological changes in podocytes and/or without classical
pathologic glomerular lesions (Branten, Van Den Born et al. 2001, Good, O'Brien et al. 2004, van
den Bergh Weerman, Assmann et al. 2004). Moreover, the unremarkable glomerular morphology
by light microscopy was observed in JAK2podKO mice at 10 weeks of age, which may explain the
benign glomerular phenotype. However, as explained in the Discussion (section 2.4), we
explicitly elected to study these mice at a young age (10 weeks) to demonstrate that the
impairment in autophagy completion was a consequence of podocyte-specific JAK2 knockout
rather than a response to generalized cellular injury. Because the mild increase in albuminuria
observed in JAK2podKO mice at 10 weeks of age progressed to almost 3-fold at 6 months of age,
and because the implication of podocyte autophagy in glomerular deterioration has been shown to
be age-dependent (Hartleben, Gödel et al. 2010), these mice could be followed up for longer (e.g.
up to two years) to further examine the impact of JAK2 deletion from podocytes on glomerular
structure and function. More importantly, TFEB overexpression was shown to rescue impaired
130
autophagy completion and lysosomal dysfunction, and restore albumin permselectivity in
cultured mouse podocytes with JAK2 knockdown. While we tried to mimic podocyte barrier
function in a cell culture system, these findings do not necessarily reflect what may occur in vivo.
A key question that therefore remains to be explored is whether TFEB overexpression would
restore albumin permeability in JAK2podKO mice. In addition, it is not clear how TFEB
overexpression improved podocyte function. To identify the protective mechanism of action of
TFEB in podocytes, key proteins essential for podocyte structure and function (e.g. nephrin)
could be assessed with TFEB overexpression in JAK2 deficient podocytes. Furthermore, while
our findings hinted at the possibility of modulation of TFEB as a therapeutic target, our studies
focused only on TFEB expression and the impact of JAK2 knockdown on TFEB activity remains
to be investigated. Lastly, because JAK2 inhibition has been evaluated as a treatment for DKD,
questions thus remain about the long-term effects of JAK2 inhibitors on the autophagy-lysosomal
pathway in podocytes and other resident cells, and whether TFEB modulation would be an
effective therapeutic strategy to maintain podocyte health and glomerular function.
The studies presented in Chapter 3 focused on the effect of systemic JAK2 inhibition and of
JAK2 deletion from podocytes in experimental models of DKD. Our data showed that JAK2
inhibition by AZD1480 reduced albuminuria, urine CCL2 excretion, and mesangial expansion in
STZ-diabetic eNOS-/- mice. We demonstrated that urine CCL2 excretion was also reduced in
STZ-diabetic JAK2podKO mice whereas albuminuria was unaffected. Our array data of 41
cytokines and chemokines further revealed that CCL2 was significantly increased in the culture
media of podocytes exposed to high glucose. Although these findings support the notion that
lowering JAK2 activity plays a protective role in DKD and that podocyte JAK2 is implicated in
renal inflammation, they are rather descriptive. Firstly, we focused only on urine CCL2 excretion
as a pro-inflammatory biomarker and the effects of both JAK2 inhibition and podocyte-specific
JAK2 deletion on other inflammatory markers were not explored. Second, because CCL2 is a key
mediator in macrophage infiltration and having observed a marked diminution in urine CCL2
excretion, it would be reasonable to perform histological examination of inflammatory cell
infiltration in the kidneys of our experimental models of DKD. This could be achieved by
immunohistological staining of kidney sections obtained from these mice with a macrophage
marker (e.g. F4/80) followed by a quantitative image analysis of macrophage-positive cells.
Another limitation worth emphasizing is that treatment of STZ-diabetic eNOS-/- mice with
131
AZD1480 was initiated on the first day of inducing diabetes prior to the onset of albuminuria.
Recognizing that previous studies of STZ-diabetic eNOS-/- mice have reported that these mice
develop massive albuminuria soon after inducing diabetes (Kanetsuna, Takahashi et al. 2007,
Yuen, Stead et al. 2012), we elected to start the treatment with the beginning of the first STZ
injection. Although we demonstrated that JAK2 inhibition with AZD1480 reduced albuminuria
and urine CCL2 excretion in STZ-diabetic eNOS-/- mice, these observations were based on a
short-term study and they do not demonstrate whether JAK2 inhibition could reverse kidney
damage in DKD. To assess the reversibility of kidney damage with JAK2 inhibition, STZ-
diabetic eNOS-/- mice could be followed for a longer period of time and AZD1480 treatment
could be initiated after the establishment of DKD. While STZ-diabetic mice have been
extensively used as experimental models in DKD research, the potential nephrotoxic effects of
STZ in our mouse models cannot be excluded (reviewed in Rerup 1970, reviewed in Weiss
1982). To exclude the off target effects of STZ, our in vivo experiments could be recapitulated in
other experimental models of diabetes such as Ins2Akita, a mouse model of type 1 diabetes caused
by a spontaneous mutation in the insulin 2 (Ins2) gene (Yoshioka, Kayo et al. 1997).
The neutral effect of podocyte-specific JAK2 deletion under diabetic conditions on albuminuria
with a decrease in urine CCL2 excretion points to the functional plurality of podocyte JAK2. In
other words, the deleterious effects of podocyte JAK2 absence may have been counterbalanced
by attenuation in inflammatory processes in diabetic JAK2podKO mice, collectively resulting in
neither a decrease nor an increase in albuminuria. Nonetheless, urine CCL2 excretion was
consistently reduced with JAK2 inhibition and podocyte-specific JAK2 deletion under diabetic
conditions, supporting the assertion that albuminuria may not be the best surrogate marker of
kidney injury in diabetes. Whereas we demonstrated that podocyte-specific JAK2 deletion
attenuated urine CCL2 excretion in vivo, how podocyte JAK2 dysregulated CCL2 and whether
podocyte JAK2 is implicated in dysregulation of other inflammatory factors under high glucose
conditions were not investigated. To further explore the role of podocyte JAK2 in inflammatory
processes, the multiplex array of 41 cytokines and chemokines could be performed after
knocking down JAK2 in cultured human podocytes exposed to either high glucose or control
conditions.
132
The lack of florid phenotype in diabetic JAK2podKO mice and the insights we gained from our
findings in Chapter 3 prompted us to pursue an additional line of investigation in which we
explored the effect of podocyte-secreted CCL2 on glomerular endothelial cells in diabetes
(Chapter 4). Beginning by exploring the role of podocyte-secreted CCL2 in abnormal podocyte-
endothelial crosstalk under high glucose conditions, we identified a critical role for CCL2/CCR2
signaling in glomerular endothelial activation characterized by VCAM-1 upregulation. Through
our work described in Chapter 4, we discovered that CCL2/CCR2 signaling initiates an
intracellular signaling cascade that involves p38-MAPK and MSK1/2, which results in an
increase in H3Ser10 phosphorylation levels and VCAM-1 upregulation in glomerular endothelial
cells. Although our findings focused on H3Ser10 phosphorylation, histone protein
phosphorylation can occur on a number of different serine, threonine, and tyrosine residues
(reviewed in Rossetto, Avvakumov et al. 2012). However, the best-studied modification is
phosphorylation of histone H3 on serine residue 10, which facilitates gene transcriptional
activation and marks highly condensed chromatin during mitosis, indicative of its dual
functionality (reviewed in Sawicka and Seiser 2012). Therefore, while we showed that increased
levels of H3Ser10 phosphorylation were associated with an increase in glomerular VCAM-1
transcript levels in diabetic mice and humans with DKD, H3Ser10 phosphorylation levels could
also reflect an increase in glomerular cell proliferation. Moreover, we showed that CCL2
signaling through CCR2 increased the levels of H3Ser10 phosphorylation in glomerular
endothelial cells through its downstream mediators p38-MAPK and MSK1/2. However, this may
not be the sole means by which H3Ser10 phosphorylation, induced by CCL2/CCR2 signaling,
regulates glomerular endothelial activation, and other histone marks may be implicated in
transcriptional VCAM-1 upregulation. For instance, phosphorylation of histone H3 has been
shown to facilitate acetylation of histone H3 at lysine 14 (H3K14), which has been shown to
promote oxidative stress in diabetes (Bock, Shahzad et al. 2013). Moreover, there remains the
question of which regions of the genome are enriched by phospho-histone H3Ser10 in response
to CCL2/CCR2 binding in glomerular endothelial cells as the VCAM-1 promoter will not be the
sole region affected. This could be probed for by ChIP-sequencing for H3Ser10 phosphorylation
enriched genomic regions.
Although CCR2 knockout attenuated glomerular VCAM-1 upregulation in diabetic mice, the
renoprotective effect of CCR2 deletion in diabetic mice may extend beyond glomerular
133
endothelial cells and VCAM-1 upregulation. For instance, impaired monocyte migration is one of
the first reported characteristic features of CCR2 knockout mice (Boring, Gosling et al. 1997).
However, because blockade of CCR2 either pharmacologically or genetically has been previously
reported to reduce leukocyte infiltration in the kidney of experimental models of diabetes
(Kanamori, Matsubara et al. 2007, Seok, Lee et al. 2013) and recognizing that VCAM-1 is also
implicated in leukocyte recruitment (reviewed in Liao 2013), we chose VCAM-1 upregulation as
the end-point of our study. Whereas our study focused on the delineation of a novel epigenetic
signalling pathway whereby ligand-binding by CCR2 induces VCAM-1 expression by
glomerular endothelial cells, it is worth noting that VCAM-1 has previously been reported to be
expressed in mesangial cells (Ishibashi, Matsui et al. 2014), tubule epithelial cells (Seron,
Cameron et al. 1991), and we reported its expression in podocytes in mice and humans (Figure
4.5). Therefore, it is unclear whether CCL2/CCR2 signalling has similar effects on other VCAM-
1-expressing cells in the kidney. Furthermore, in cultured glomerular endothelial cells, we
showed that recombinant CCL2 does not affect other adhesion molecules such as P-selectin, E-
selectin and ICAM-1 (Figure 4.7). However, these findings were based on in vitro studies and
upregulation of these adhesion molecules has been reported in DKD (Hirata, Shikata et al. 1998,
Gu, Ma et al. 2013). Thus, the effect of CCR2 knockout on other adhesion molecules could have
been examined in diabetic mice.
One limitation of our in vivo studies is the lack of GFR measurement. GFR is a key metric of
kidney function and important readout of translational drug discovery in experimental models of
kidney diseases. In our animal studies, GFR measurement was not performed for several reasons.
First, GFR is commonly measured in humans based on endogenous tracers commonly creatinine,
a byproduct of muscle metabolism produced and filtered by the kidney glomerulus at a relatively
constant rate (reviewed in Breyer and Qi, 2010). However, creatinine-based measurements of
GFR is not recommended in mice due to increased urinary secretion of creatinine attributable to
the renal tubule (Eisner, Faulhaber-Walter et al., 2010) and high concentrations of non-creatinine
chromagens in plasma and urine, resulting in an overestimation of GFR with commercially
available creatinine assays (Meyer, Meyer et al., 1985; Dunn, Qi, 2004; Palm and Lunblad,
2005). Moreover, in comparison to humans, the handling of creatinine by the mouse kidney is
poorly characterized (reviewed in Breyer and Qi, 2010). Therefore, in mouse models, the gold
standard for GFR measurement is based on clearance of exogenous tracers such as inulin, a
134
fructose polysaccharide that is freely filtered by the glomerulus and neither reabsorbed nor
secreted by the renal tubule (reviewed in Breyer and Qi, 2010). Whereas inulin-based GFR
measurement in our mouse models may provide more accurate assessment of kidney function,
based on previous experience in our lab, this method is technically demanding and performed as
an end study procedure requiring additional animals. Because our in vivo studies were designed
to explore the molecular and cellular causes of kidney dysfunction in diabetes, to adhere to the
Russell and Burch principle of reduction, refinement, and replacement, we chose not to measure
GFR. Accordingly, in the absence of experimental evidence, no inference on effects on kidney
function in mice or humans should be made.
Another fundamental limitation is the lack of female mice in our animal studies. In 1993, the
National Institutes of Health (NIH) Revitalization Act mandated to account for the role of sex-
specific factors in health and disease, which has led to a requirement to include females in
clinical studies (reviewed in Clayton and Collins 2014). However, preclinical studies that involve
both male and female animals remain low in number (reviewed in Zucker and Beery 2010),
compromising the translational success of these studies to the female population. Between 1997
and 2000, eight out of ten withdrawn drugs from the market by the US Food and Drug
Administration due to severe adverse events had higher health risks for women than men
(available at https://www.gao.gov/new.items/d01286r.pdf), and this was mainly attributed to
male biases in basic, preclinical, and clinical research. Although several challenges may have
hindered the integration of both sexes in preclinical studies including hormonal variability
(reviewed in Wald and Wu 2010), cost and practicality (reviewed in Fields 2014), recent efforts
by funding organizations and scientific journals have been made to ensure reporting and
accounting for sex as a critical biological variable in biomedical research to improve
experimental outcomes and the likelihood of translating these studies in clinical practice
(reviewed in Lee 2018). A focus of our studies was on diabetes and one of the features of female
mice is that they are relatively resistant to the development of diabetes by chemical induction or
genetic means (Maclaren, Neufeld et al. 1980, Haseyama, Fujita et al. 2002). Thus, as with most
preclinical studies of diabetic kidney disease, we restricted ourselves to the study of male mice.
Accordingly, caution should be taken in extrapolating our in vivo findings to the female
population.
135
Finally, as the reader may have noted, the statistical parameters and the display of the datasets in
Chapter 2 and 3 (bar graphs with SEM) differ from Chapter 4 (scatter graphs with SD). This
difference reflects an evolution of journal data reporting requirements during the course of my
doctoral studies. I have elected to present the data in this way to recapitulate the manner in which
they were published.
136
CHAPTER 6: GENERAL DISCUSSION AND FUTURE
DIRECTIONS
137
6.1. TFEB and the autophagy-lysosomal pathway as potential therapeutic
targets in kidney disease
Autophagy has gained attention over the past few years as a crucial cellular process necessary for
maintaining cellular homeostasis. This self-repair mechanism is particularly important for
terminally differentiated cells and, being terminally differentiated, podocytes have high basal
levels of autophagy (Sato, Kitamura et al. 2006, Hartleben, Gödel et al. 2010). Under
physiological conditions, podocyte-specific knockout of the autophagy gene ATG5 has been
shown to sensitize aged mice to glomerular disease and result in podocyte loss, proteinuria, and
glomerulosclerosis (Hartleben, Gödel et al. 2010). Lysosomes, being the final destination for
degraded proteins and damaged organelles in the autophagy process, also play crucial roles in
podocyte homeostasis.
Lysosomal dysfunction has been shown to cause a defect in autophagy completion, and
contribute to the development of proteinuria and severe glomerulosclerosis (Oshima, Kinouchi et
al. 2011, Chen, Chen et al. 2013, Yamamoto-Nonaka, Koike et al. 2016). Deletion of the
lysosomal enzyme cathepsin D from podocytes in mice contributed to impaired autophagy
completion, and the development of proteinuria in mice at 5 months of age that progressed to
ESKD by 20-22 months of age (Yamamoto-Nonaka, Koike et al. 2016). Dysregulated autophagy
has been implicated in the pathogenesis of DKD in several cell types in the kidney including
mesangial cells (Fiorentino, Cavalera et al. 2013, Lu, Fan et al. 2015), glomerular endothelial
cells (Lenoir, Jasiek et al. 2015), proximal tubule epithelial cells (Liu, Shen et al. 2015,
Brijmohan, Batchu et al. 2018), and podocytes (Fang, Zhou et al. 2013, Wang, Liu et al. 2014,
Tagawa, Yasuda et al. 2015). In line with our findings from Chapter 2, in each of these studies,
autophagy was reported as a protective process and its dysregulation in these cells contributed to
kidney dysfunction. However, out of all these cells, podocytes are the only cell type that is
postmitotic in nature. Podocytes lack the capacity to regenerate, and thus, they rely on autophagy
to maintain their health. Because podocyte loss contributes to the development and progression of
CKD, protecting podocyte health has emerged as an attractive therapeutic strategy to preserve
glomerular function (reviewed in Lal and Patrakka 2018). One of the promising therapeutic
strategies aimed at protecting podocyte health is through the enhancement of homeostatic
mechanisms such as autophagy (reviewed in Liu, Xu et al. 2017).
138
Several studies have investigated the effect of inducing autophagy as a therapeutic strategy in
kidney diseases, and efforts have been made to test the effects of pharmacological drugs that
enhance autophagic activity in experimental models of CKD. For instance, the nutrient-sensing
signal mTORC1, which is known to inhibit autophagy, has been investigated as a therapeutic
target for CKD (Kim, Kundu et al. 2011). The mTORC1 inhibitor rapamycin was shown to
suppress podocyte apoptosis in adriamycin-induced nephropathy (Yi, Zhang et al. 2017), a
classic model of CKD characterized by podocyte injury followed by glomerulosclerosis,
tubulointerstitial inflammation and fibrosis (reviewed in Lee and Harris 2011). Moreover,
inducing autophagy by rapamycin was also shown to protect against proximal tubule epithelial
cell damage in transgenic mice with nephron-specific overexpression of kidney injury molecule 1
(KIM-1), a mouse model of CKD characterized by tubular damage, reduced nephron number, and
fibrosis (Yin, Naini et al. 2016). Separately, several studies have shown that mTORC1 inhibition
attenuates cyst growth in rodent models of polycystic kidney disease (PKD), a genetic disorder
characterized by the presence of cysts in the kidney that can lead to ESKD (Tao, Kim et al. 2005,
Shillingford, Murcia et al. 2006, Wu, Wahl et al. 2007, Shillingford, Piontek et al. 2010, Zafar,
Ravichandran et al. 2010, Ravichandran, Zafar et al. 2014). However, the findings from
preclinical studies in models of PKD have failed to be recapitulated in humans. For instance, in a
phase 3 clinical trial, treatment with the mTORC1 inhibitor rapamycin for 18 months in patients
with autosomal dominant PKD showed no effects on renal volume or eGFR (Serra, Poster et al.
2010). The investigators speculated that the absence of effect may be due to the suboptimal dose
of rapamycin used in the study intended to limit the side effects such as proteinuria. Indeed, in a
separate study in which higher doses of rapamycin were found to halt cyst growth in patients with
autosomal dominant PKD, there was also a significant increase in albuminuria and proteinuria
(Perico, Antiga et al. 2010). Moreover, a subsequent study showed that treatment with low or
high doses of rapamycin in patients with autosomal dominant PKD had no effects on cyst
volume, or kidney function across treatment groups (Stallone, Infante et al. 2012).
Although mTORC1 inhibition by rapamycin or its derivatives is clinically approved as an
immunosuppressant following organ transplantation (Lim, Eris et al. 2014), and as a treatment for
specific types of cancer (reviewed in Benjamin, Colombi et al. 2011), it has been shown to be
associated with serious adverse effects, notably proteinuria (Straathof Galema, Wetzels et al.
2006, Perico, Antiga et al. 2010). In the context of podocyte health, although genetic reduction of
139
podocyte-specific mTORC1 prevented the development of DKD in diabetic animals, complete
inhibition of mTORC1 in podocytes under normal conditions was shown to worsen podocyte
dysfunction and lead to glomerulosclerosis (Inoki, Mori et al. 2011). These findings may in part
explain the lack of current clinical trials for mTORC1 inhibitors as a treatment for CKD.
Moreover, rapamycin has been shown to result in partial activation of autophagy (reviewed in
Thoreen and Sabatini 2009) and is unable to directly induce autophagy at the transcription level,
which is mainly controlled by the transcription factor TFEB (Settembre, Di Malta et al. 2011).
The discovery of the transcription factor TFEB as a master regulator of lysosomal biogenesis
(Sardiello, Palmieri et al. 2009), lysosomal exocytosis (Medina, Fraldi et al. 2011), and
autophagy (Settembre, Di Malta et al. 2011) provided new insights into the regulatory processes
that control autophagy and lysosomal function. TFEB promotes autophagy by directly binding to
a network of genes that contains the CLEAR motif in the promoter region of lysosomal and
autophagy genes to facilitate their expression (Sardiello, Palmieri et al. 2009, Palmieri, Impey et
al. 2011, Settembre, Di Malta et al. 2011). Complete knockout of TFEB in mice is embryonic
lethal (Steingrímsson, Tessarollo et al. 1998), and gain- and loss-of-function studies in mice
identified its important role in liver metabolism (Settembre, De Cegli et al. 2013), immunity
(Huan, Kelly et al. 2006, Visvikis, Ihuegbu et al. 2014, Samie and Cresswell 2015), bone
resorption (Ferron, Settembre et al. 2013), glucose homeostasis and skeletal muscle energy
balance (Mansueto, Armani et al. 2017). The activity of TFEB is tightly regulated by post-
translational modifications. Under basal conditions, phosphorylated TFEB is bound to the 14-3-3
protein complex and retained in the cytosol in its inactive state. However, under starvation or
stress conditions, activated (dephosphorylated) TFEB translocates to the nucleus to facilitate the
transcription of its target genes. Phosphorylation of TFEB is mediated by at least two kinases,
including mTORC1 (Peña Llopis, Vega Rubin de Celis et al. 2011, Martina, Chen et al. 2012,
Roczniak-Ferguson, Petit et al. 2012, Settembre, Zoncu et al. 2012), and extracellular signal-
regulated kinase 2 (ERK2) (Settembre, Di Malta et al. 2011). TFEB nuclear translocation is
regulated by the phosphatase calcineurin, which binds and dephosphorylates TFEB and is itself
activated by lysosomal Ca2+ release through mucolipin 1 (MCOLN1) (Medina, Di Paola et al.
2015). In addition to (de)phosphorylation, (de)acetylation of TFEB also regulates its nuclear-
cytoplasmic shuttling (Bao, Zheng et al. 2016).
140
Dysregulation of TFEB has been shown to contribute to impaired autophagy and lysosomal
dysfunction in neurodegenerative diseases (Decressac, Mattsson et al. 2013, reviewed in Martini-
Stoica, Xu et al. 2016), and enhancing the expression and the activity of TFEB has shown
benefits in several disease models of neurodegenerative diseases. For instance, TFEB activation
in a mouse model of Alzheimer’s disease (AD) was shown to increase lysosomal uptake of
accumulated amyloid β peptides in astrocytes, one of the underlying mechanisms causing
neuronal damage in AD (Xiao, Yan et al. 2014). Several studies have highlighted similarities
between podocytes and neurons, both cell types being postmitotic and the importance of
autophagy in neuronal homeostasis (Rastaldi, Armelloni et al. 2003, Rastaldi, Armelloni et al.
2006, Saito, Miyauchi et al. 2010, reviewed in Wong and Cuervo 2010, Soda, Balkin et al. 2012,
Sun, Zhang et al. 2014), supporting the potential role of TFEB as a promising therapeutic target
to maintain podocyte health in kidney diseases. This assertion has been supported by a few
published studies including the ones conducted in our lab examining the role of TFEB in the
kidney. In proximal tubule epithelial cells, Rega et al. showed that either activation or
overexpression of TFEB rescued cystinosis, a lysosomal storage disease caused by accumulation
of cysteine (Rega, Polishchuk et al. 2016). Consistent with these findings, a study from our lab
also reported that enhancing TFEB activity by inhibition of the cytosolic histone deacetylase 6
(HDAC6) in a rat model of CKD reduced proteinuria, prevented the accumulation of misfolded
protein aggregates in tubule epithelial cells, limited tubule cell death, and diminished
tubulointerstitial collagenous matrix deposition (Brijmohan, Batchu et al. 2018). In podocytes,
we demonstrated that TFEB overexpression restored podocyte dysfunction and impaired
autophagy completion induced by JAK2 knockdown in vitro as described in Chapter 2
(Alghamdi, Majumder et al. 2017). Although these data have identified a hitherto unrecognized
role for JAK2 in regulating TFEB and podocyte autophagy, recapitulating these findings in vivo
would strengthen the interpretability of their importance. Moreover, it would be interesting to
explore the direct role of TFEB in podocytes by generation and characterization of podocyte-
specific TFEB knockout mice. Furthermore, it would be intriguing to test the effect of podocyte-
specific TFEB overexpression and TFEB activation in models of DKD. Small molecule TFEB
activators have recently been developed and shown to ameliorate metabolic syndrome in mice
and extend lifespan in C. elegans (Wang, Niederstrasser et al. 2017). Although it is generally
acknowledged that autophagy plays a protective role in kidney diseases, the potential long-term
141
effects of enhancing autophagy by increasing TFEB activity need further investigation, especially
given that increased TFEB activity has been shown to drive tumorigenesis in the kidney and
other tissues (Argani, Laé et al. 2005, Argani 2015, Giatromanolaki, Kalamida et al. 2015).
6.2. Targeting inflammatory mediators for treatment of diabetic kidney disease
The number of successful clinical trials for treatment of DKD has not kept pace with the growing
prevalence of DKD. This is in part due to the lack of animal models that precisely recapitulate the
DKD manifestations observed in humans, which remains an ongoing challenge in DKD research
(reviewed in Azushima, Gurley et al. 2018). However, major advances in scientific research have
provided mounting evidence demonstrating the critical role of inflammatory pathways in the
pathogenesis and progression of DKD (reviewed in Tuttle 2005). Among these inflammatory
pathways are the JAK/STAT pathway and the CCL2/CCR2 pathway, which are among the
promising therapeutic targets for treatment of DKD (reviewed in Brosius, Tuttle et al. 2016,
reviewed in Alicic, Johnson et al. 2018). In this section, I will discuss the findings from my thesis
work in the context of the translational progress of developed agents targeting these pathways,
and future challenges that may impede these agents from reaching the clinic.
6.2.1. JAK2 as a therapeutic target for DKD
The role of JAK/STAT activation in the development of DKD was demonstrated in several cell
types in the kidney (Marrero, Schieffer et al. 1995, Amiri, Shaw et al. 2002, Wang, Shaw et al.
2002, Banes-Berceli, Shaw et al. 2006, reviewed in Marrero, Banes-Berceli et al. 2006).
Moreover, transcriptome analysis of kidney samples from patients with early and progressive
DKD revealed a substantial increase in the expression of members of the JAK/STAT pathway
(Berthier, Zhang et al. 2009, Hodgin, Nair et al. 2013). These studies have shed light on the role
of the JAK/STAT pathway in the development of DKD (Berthier, Zhang et al. 2009). Of note,
JAK1 and JAK2 expression were observed to be upregulated in the glomeruli of patients with
early stage DKD (Berthier, Zhang et al. 2009). Based on findings in cultured cells, experimental
142
animals, and human biopsies, modulation of the JAK/STAT activity has been proposed as a new
therapeutic approach for the treatment of DKD (reviewed in Brosius, Tuttle et al. 2016). Indeed,
the JAK inhibitor baricitinib, which has been effective in treatment of rheumatoid arthritis
(Keystone, Taylor et al. 2013, Genovese, Kremer et al. 2016), was recently repurposed for
treatment of DKD. A year before I started my PhD studies, a phase 2 clinical trial was initiated to
test the efficacy of the JAK1/2 inhibitor baricitinib in patients with type 2 diabetes with
progressive kidney disease (ClinicalTrials.gov identifier NCT01683409).
Cognizant of the growing interest in modulating JAK2 activity as a treatment for DKD and the
lack of studies demonstrating the fundamental role of JAK2 in podocytes, in my thesis work, we
examined the effect of podocyte-specific JAK2 deletion in podocytes in the normal setting
(Chapter 2), and the effect of systemic JAK2 inhibition and its deletion from podocytes in the
diabetes setting (Chapter 3). We published our findings on the role of JAK2 in regulating
podocyte autophagy a month after Zhang et al. reported that podocyte-specific overexpression of
JAK2 in podocytes in mice resulted in a modest increase in albuminuria in the normal setting
based on UACR (Zhang, Nair et al. 2017). However, under normal conditions, JAK2
overexpression in podocytes did not have any effects on podocyte structure, glomerular volume,
and glomerular fibronectin levels with only modest effect on mesangial expansion in nondiabetic
mice (Zhang, Nair et al. 2017). In contrast, in the diabetes setting, the investigators showed that
podocyte-specific JAK2 overexpression worsened kidney function, whereas lowering JAK2
activity using the JAK1/2 inhibitor baricitinib caused a significant reduction in UACR (Zhang,
Nair et al. 2017). However, it is not clear whether the renoprotective effect of baricitinib in
diabetic mice was JAK1- or JAK2- specific. By using the selective JAK2 inhibitor AZD1480
(Chapter 3), we found that JAK2 inhibition resulted in a marked reduction in albuminuria,
mesangial expansion, and urine CCL2 excretion in STZ-diabetic eNOS-/- mice. Likewise, urine
CCL2 excretion was significantly reduced in diabetic podocyte-specific JAK2 knockout mice
although albuminuria was not affected. The data from these studies support the notion that
podocyte JAK2 plays different roles under physiological and pathological conditions. In the
normal setting, deletion of JAK2 from podocytes contributes to the development of albuminuria
and podocyte dysfunction (Alghamdi, Majumder et al. 2017) and its overexpression does not
seem to worsen kidney function (Zhang, Nair et al. 2017). In the diabetes setting, however,
143
podocyte-specific JAK2 deletion has an anti-inflammatory effect and its overexpression in
podocytes exacerbates kidney damage (Zhang, Nair et al. 2017).
The baricitinib phase 2 trial in patients at high risk for DKD progression defined by persistent
macroalbuminuria showed significant benefits of JAK1/2 inhibition on the primary outcome of
albuminuria in these patients (Tuttle, Brosius et al. 2018). Although the study met its primary
endpoint, baricitinib seems to influence creatinine-derived eGFR measurement, which was
among the secondary outcomes in this trial. There was a small albeit statistically significant
reduction in creatinine-based eGFR in two baricitinib treatment groups (1.5 mg and 4 mg daily
doses) at Week 24 compared to placebo. Although baricitinib did not affect eGFR derived by
cystatin C, creatinine-derived eGFR has been traditionally regarded as the standard surrogate end
point for assessing kidney function in clinical practice and in trials (ref). Moreover, the
observation that there was a decrease in creatinine-derived eGFR in the baricitinib treatment
group even at the middle-range dose (1.5 mg daily), which was recommended as an optimal dose
by the investigators, raises safety concerns for patients with advanced stages of kidney disease in
future clinical trials. In fact, the recent Briefing Document by the FDA Advisory Committee
explicitly stated that “baricitinib is not recommended for use in patients with severe renal
impairment or end-stage renal disease”
(https://www.fda.gov/downloads/AdvisoryCommittees/CommitteesMeetingMaterials/Drugs/Arth
ritisAdvisoryCommittee/UCM605062).
However, thus far, a phase 3 clinical trial for baricitinib has not been initiated and several
challenges may hinder the approval of JAK inhibitors for use in DKD. First, most early clinical
trials focus on albuminuria as a primary outcome. Choosing albuminuria as a primary endpoint in
renal trials especially in patients already receiving ARBs or ACEis limits the determination as to
whether the drug may have benefits in a wider range of patients with DKD. For instance, GFR
has been shown to severely decline in some patients with type 2 diabetes in the absence of
albuminuria (Kramer, Nguyen et al. 2003, Ekinci, Jerums et al. 2013). Classical hard renal
endpoints are death, dialysis, and doubling of serum creatinine in clinical trials of CKD
(reviewed in Weldegiorgis, de Zeeuw et al. 2015). However, phase 3 studies are costly and
sponsors will typically look at surrogate renal endpoints such as albuminuria before committing
resources to later phase clinical evaluation. In our experiments discussed in Chapter 3, we saw
144
that JAK2 knockout from podocytes or systemic JAK2 inhibition decreased urine CCL2
excretion under diabetic conditions without affecting albuminuria in the case of podocyte-specific
JAK2 knockout. Concerted efforts are being made to look for alternative biomarkers or
biomarkers that could enrich a study population at higher risk of renal events. For instance, one
recent study showed measuring a combination of serum KIM-1 and β2-microglobulin predicted
renal decline in individuals with type 2 diabetes similar to that shown by a larger and more
expansive panel of biomarkers (Colombo, Looker et al. 2019). KIM-1 is a transmembrane protein
expressed in proximal tubule cells, and has been identified as a biomarker of kidney injury in
mice, rats, and humans (Sabbisetti, Walkar et al., 2014). Elevated levels of serum KIM-1 have
been shown to be associated with acute and chronic kidney injury and to predict progression to
ESKD in type 1 diabetes (Sabbisetti, Walkar et al., 2014). Moreover, upregulation of glomerular
KIM-1 has been reported in animal models of diabetes (Zhao, Zhang et al., 2011). B2M is a low
molecular weight protein that plays a role in antigen presentation by interacting with major
histocompatibility complex class I (MHC-1) (Güssow, Rein et al., 1987). B2M is mainly filtered
by the glomerulus followed by complete reabsorption by the proximal tubule (Peterson, Evrin et
al., 1969). Several studies have identified the role of B2M as a potential biomarker for DKD
(Kim, Yun et al., 2014), ESKD (Astor, Shafi et al., 2012), CVD (Kim, Yun et al., 2014; Astor,
Shafi et al., 2012), and mortality (Foster, Inker et al., 2015). Using a biomarker for glomerular
filtration (i.e. B2M) in combination with a tubular biomarker (i.e. KIM-1), which has been shown
to predict progression of kidney dysfunction in type 2 diabetes from three different clinical
studies (Colombo, Looker et al. 2019), is a novel and feasible approach to enrich clinical trials
and identify patients at high risk of kidney disease progression. However, given that DKD is a
multifactorial disease with complex pathophysiology, it is important to validate whether this
approach will reflect kidney disease progression or drug efficacy in large clinical trials and
whether it can be generalized to a larger patient population. Therefore, continuing to explore
appropriate endpoints suited for prediction of rapid renal decline and the risk of progression to
ESKD in early clinical trials is imperative, especially for a complex and heterogeneous disease
such as DKD. Second, relying on single biomarker such as albuminuria in early clinical trials is
unlikely to circumvent the recruitment challenge of patients with DKD. For instance, in the
baricitinib trial, out of 376 patients assessed for eligibility, only 129 participants were ultimately
enrolled in the study because of lower than anticipated rate of macroalbuminuria, which was an
145
inclusions criteria for the study (Tuttle, Brosius et al. 2018). In recent years, an increasing
proportion of DKD is being observed in patients who have a low eGFR with minimal or low
levels of albuminuria (Afkarian, Zelnick et al. 2016). This represents an evolution in our
understanding of the natural history of DKD. Historically, phase 2 clinical studies have focused
on albuminuria as a surrogate endpoint, but if albuminuria becomes less prevalent, these trials
will continue to be harder to conduct. Third, early clinical trials for DKD including the baricitinib
trial are mostly in patients with type 2 diabetes, overlooking the potential effects of JAK
inhibitors on kidney dysfunction in patients with type 1 diabetes. In addition, although baricitinib
was approved for other indications and despite the short duration of the baricitinib trial for DKD,
adverse effects were reported including a slight increase in serum creatinine levels,
hypoglycemia, and anemia (Tuttle, Brosius et al. 2018). Whereas the tolerability profile of JAK
inhibitors may be acceptable in the setting of malignancies or chronic inflammatory
arthropathies, it may be unacceptable for the treatment of complex CKD such as DKD, in which
patients may be otherwise asymptomatic.
6.2.2. CCL2/CCR2 signaling as a therapeutic target for DKD
Cytokines and adhesion molecules play crucial roles in orchestrating inflammatory responses,
and are known to be upregulated in diabetes (reviewed in Navarro-González, Mora-Fernández et
al. 2011). The chemokine CCL2 signals through its major receptor CCR2 to promote recruitment
of monocytes into sites of inflammation (Banba, Nakamura et al. 2000). High levels of urinary
CCL2 (Banba, Nakamura et al. 2000, Tesch 2008, Verhave, Bouchard et al. 2013) and CCR2
overexpression was reported in glomerular podocytes of patients with diabetes and overt
nephropathy (Tarabra, Giunti et al. 2009). Moreover, loss of CCL2 was found to prevent
downregulation of nephrin and albuminuria in diabetic mice, suggesting that CCL2 signaling in
the kidney contributes to the development of albuminuria in DKD and leukocyte recruitment
does not appear to be the sole mechanism by which CCL2 contributes to kidney damage in
diabetes (Tarabra, Giunti et al. 2009). In experimental models of DKD, modulation of the
CCL2/CCR2 axis either by genetic manipulation or using pharmacological compounds that block
CCL2 signaling or its receptor CCR2 have shown benefits in preclinical studies (Chow, Ozols et
al. 2004, Chow, Nikolic-Paterson et al. 2006, Chow, Nikolic-Paterson et al. 2007, Lee, Chung et
146
al. 2009). Currently, some of the pharmacological compounds targeting CCL2 and its receptor
CCR2 have shown promising effects in early clinical trials for the treatment of DKD (de Zeeuw,
Bekker et al. 2015, Menne, Eulberg et al. 2016). Treatment with CCX140-B, a selective CCR2
inhibitor, in 332 patients with DKD for over a year reduced UACR (de Zeeuw, Bekker et al.
2015). Likewise, in a phase 2 trial, three month treatment with emapticap pegol (NOX-E36), an
L-RNA optamer that specifically binds and inhibits CCL2, showed favorable effects on UACR
and glycemia in type 2 diabetes patients with albuminuria, persisting for two months after
cessation of therapy (Menne, Eulberg et al. 2016). However, in both of these trials, no changes
were observed on eGFR or blood pressure, suggesting that the renoprotective effects of
CCL2/CCR2 blockade could be independent of hemodynamic changes. Although delineation of
the mechanisms mediating the renoprotective effects of these agents remains under investigation,
several studies in rodent models provided mechanistic insights into their anti-inflammatory mode
of action. For instance, blockade of CCL2 in db/db mice, an experimental model of type 2
diabetes, reduced glomerular macrophage infiltration, which was associated with improvement in
GFR and glomerulosclerosis (Ninichuk, Clauss et al., 2008). In another recent study by Boels and
colleagues, CCL2 inhibition by emapticap pegol treatment for four weeks in STZ-diabetic
apolipoprotein E (ApoE) knockout mice attenuated albuminuria and restored glomerular
endothelial glyocalyx without any effect on absolute number of kidney macrophages or systemic
hemodynamics (Boels, Koudijs et al. 2017). These data are in line with the findings presented in
Chapter 4 in which we provided insights into the role of CCL2/CCR2 signaling in DKD
development beyond macrophage infiltration. In my thesis work (Chapter 4), we showed that in
experimental models of DKD, CCL2 contributes to glomerular VCAM-1 upregulation, indicative
of glomerular endothelial activation, and this increase was attenuated in diabetic CCR2 knockout
mice (Alghamdi, Batchu et al. 2018). Moreover, we showed that signaling through CCR2
induced an epigenetic change, specifically phosphorylation of histone protein H3 on serine
residue 10 (H3Ser10), through p38-MAPK and MSK1/2, which resulted in VCAM-1
upregulation in glomerular endothelial cells. These findings unraveled a previously unrecognized
pathogenetic function for CCL2/CCR2 signaling in glomerular endothelial activation in diabetes,
further underscoring the detrimental effects of CCL2/CCR2 signaling in the context of DKD.
From a therapeutic perspective, our studies shed light on the renoprotective mechanisms of
CCL2/CCR2 blockade, specifically through modulation of glomerular VCAM-1 expression.
147
VCAM-1 promotes endothelial activation and its interaction with VLA-4 mediates inflammatory
leukocyte recruitment induced by cytokine activation (Alon, Kassner et al. 1995, reviewed in
Pober 2002). Elevated levels of circulating VCAM-1 have been implicated in DKD and shown to
correlate with albuminuria (Clausen, Jacobsen et al. 2000, Nelson, Karschimkus et al. 2005,
Rubio-Guerra, Vargas-Robles et al. 2009). In a separate study, high levels of circulating VCAM-
1 and albuminuria in patients with type 2 diabetes followed for nine years, were associated with
increased risk of death, which was independent of high blood pressure and poor glycemic control
(Stehouwer, Gall et al. 2002). Despite the accumulating evidence implicating VCAM-1 in the
development of DKD, thus far, no clinical trial has investigated targeting VCAM-1 as a
therapeutic intervention for patients with DKD. This is partly due to the lack of humanized
antibodies that specifically block VCAM-1 (reviewed in Kong, Kim et al. 2018). However,
blocking VCAM-1 by neutralizing antibodies has shown benefits in experimental models of
inflammatory diseases such as rheumatoid arthritis (Carter, Campbell et al. 2002, Silverman,
Haas et al. 2007), and asthma (Nakajima, Sano et al. 1994, Fukuda, Fukushima et al. 1996). In
contrast, a few studies explored the effect of modulation of glomerular VCAM-1 in animal
models of kidney diseases (Allen, McHale et al. 1999, Khan, Allen et al. 2003). In an
experimental model of glomerulonephritis, treatment with an anti-VL4 antibody, but not with an
anti-VCAM-1 antibody, attenuated albuminuria and renal injury with a paradoxical increase in
markers of macrophage activation and no effect on glomerular leukocyte number (Allen, McHale
et al. 1999, Khan, Allen et al. 2003). Although modulation of VCAM-1 has not been explored in
DKD, targeting other adhesion molecules has been evaluated in early clinical trials for treatment
of DKD including vascular adhesion protein 1 (VAP-1) (de Zeeuw, Renfurm et al. 2018),
galectin-3 (Kikuchi, Kobayashi et al. 2004, Dang, MacKinnon et al. 2012, Calvier, Martinez-
Martinez et al. 2015), and αVβ3 integrin (Yoon, Gingras et al. 2001, Maile, Busby et al. 2014).
Out of these therapeutic targets, inhibition of VAP-1 by ASP8232 proved to be safe and effective
when added to the current standard of care for patients with DKD (de Zeeuw, Renfurm et al.
2018).
Although numerous excellent preclinical and early clinical studies point to the potential utility of
agents targeting inflammatory pathways, specifically the CCL2/CCR2 pathway and the
148
JAK/STAT pathway in DKD, the safety and the efficacy of these agents for the treatment of
DKD in patients are still under investigation. From a mechanistic perspective, there remain
several unresolved questions that require additional studies. For instance, most of the studies in
kidney diseases focused on the roles of JAK2 and its downstream mediator STAT3 (reviewed in
Brosius Iii and He 2015). However, the cell-specific role of other members of the JAK/STAT
pathway in the kidney is not completely understood. Second, although targeting the CCL2/CCR2
pathway and the JAK/STAT pathway in early clinical trials for treatment of DKD seem
promising, systemic inhibition of these pathways may have opposing effects. For instance, low
pancreatic islet expression of CCL2 may actually contribute to the development of type 1
diabetes in nonobese diabetic mice (Kriegel, Rathinam et al. 2012), and low levels of CCL2 have
been reported in humans with type 1 diabetes in comparison to healthy individuals (Guan,
Purohit et al. 2011). Similarly, several studies reported that activation of the JAK/STAT pathway
plays a protective role in experimental models of acute kidney injury (Nechemia-Arbely, Barkan
et al. 2008, Arany, Reed et al. 2011, Correa-Costa, Azevedo et al. 2012, Susnik, Sörensen-Zender
et al. 2014), suggesting that the role of JAK/STAT pathway in the kidney is context-dependent.
Thus, while the developed agents targeting the CCL2/CCR2 pathway and the JAK/STAT
pathway are being evaluated, elucidating the mechanisms of actions and the tissue-specific role
of these pathways will be crucial in informing the interpretation of any future trial results.
6.3. Histone phosphorylation in DKD
Posttranslational histone modifications play important roles in controlling transcriptional gene
activation generally by modification of chromatin compaction activity and recruitment of effector
complexes (reviewed in Kouzarides 2007, reviewed in Bannister and Kouzarides 2011, reviewed
in Lawrence, Daujat et al. 2016). Among these modifications, histone (de)acetylation and
(de)methylation have been extensively studied in DKD, and only recently have studies begun to
explore the actions of other histone modifications in DKD pathogenesis, particularly histone
phosphorylation (Badal, Wang et al. 2016). Through our work described in Chapter 4, we
discovered that CCL2/CCR2 signaling initiates an intracellular signaling cascade that involves
p38-MAPK and MSK1/2, which results in upregulation of histone H3Ser10 phosphorylation and
glomerular endothelial activation. Several kinases have been identified to phosphorylate histone
149
H3 on serine 10 including IκB kinase α (IKK-α), c-Jun N-terminal kinase (JNK), protein kinase
A, Akt, Cancer Osaka Thyroid (Cot) kinase, proto-oncogene serine/threonine-protein kinase 1
(PIM1), cyclin-dependent kinase 8 (CDK8), calcium/calmodulin-dependent protein kinase IIδ
(CaMKIIδ) and MSK1/2 (reviewed in Sawicka and Seiser 2012). However, MSK1/2 is the best-
characterized kinase (reviewed in Arthur 2008), which has been recently implicated in chromatin
remodeling in DKD (Badal, Wang et al. 2016). In our in vitro experiments described in Chapter
4, we reported that MSK1/2 inhibition reduced the expression of VCAM-1 and H3Ser10
phosphorylation induced by CCL2 signalling, and attenuated the enrichment of phospho-histone
H3Ser10 at the VCAM-1 promoter in glomerular endothelial cells. These observations raise the
question of whether inhibition of MSK1/2 may exert renoprotective effects in DKD.
MSK1 and MSK2 are members of the Ribosomal S6 Kinase (RSK) family of serine/threonine
kinases that have overlapping function (Wiggin, Soloaga et al. 2002, Soloaga, Thomson et al.
2003). A number of MSK substrates have been identified, which include transcription factors
cAMP-responsive element binding protein (CREB), activating transcription factor (ATF) 1 and
NF-κB, as well as histone H3 (reviewed in Arthur 2008). While MSK1/2 has been best studied in
the brain and in innate immunity, its role in the kidney remains unexplored. A recent study by
Badal et. al. showed that in vivo depletion of MSK2 prevented podocyte loss and ameliorated
kidney dysfunction in diabetic mice, and this was linked to modulation of its substrate histone
H3Ser10, first implicating MSK2/H3Ser10 in DKD pathogenesis. Although MSK1/2 double
knockout mice lack an overt phenotype under physiological conditions (Wiggin, Soloaga et al.
2002), the investigators showed that MSK2 knockout caused a significant reduction in
albuminuria in mice when challenged with diabetes (Badal, Wang et al. 2016). With the
availability of the highly selective pharmacological MSK1/2 inhibitor SB-747651A employed in
our studies in Chapter 4, it would be particularly interesting to examine the effects of MSK1/2
inhibition as well as MSK1/2 knockout in experimental models of DKD. Although inhibition of
MSK1/2 has not been explored in DKD, a recent study demonstrated the effects of the
pharmacological MSK1/2 inhibitor SB-747651A and MSK1/2 knockout in the context of
pancreatic development (Bhat, Park et al. 2016). The investigators showed that MSK1/2
inhibition, using SB-747651A, in embryonic mouse pancreatic explants caused induction of
endocrine fates including the beta cells lineage, and suppression of acinar differentiation (Bhat,
150
Park et al. 2016). Interestingly, they observed similar effects in germline knockout of MSK1 and
MSK2, which resulted in enhanced production of pancreatic alpha cells and suppressed
differentiation towards the acinar lineage. The investigators went on to determine that the effect
of MSK proteins on pancreatic development was mediated by phospho-histone H3Ser28, another
phosphorylation site on histone H3 controlled by MSK1/2 (Bhat, Park et al. 2016). These data
support the potential beneficial effect of MSK1/2 inhibition/knockout and highlight the role of
MSK1/2 in controlling gene expression by means independent of histone H3Ser10
phosphorylation. Because the double knockout of MSK1/2 in mice did not cause an overt
phenotype (Wiggin, Soloaga et al. 2002), modulation of MSK1/2 activity will unlikely have
serious adverse consequences. Recognizing that drug safety is one of the major challenges that
prevent progression of clinical trials of new developed compounds, MSK1/2 serves as an
attractive therapeutic target for treatment of CKD that is worth investigating in preclinical
studies.
151
6.4. Conclusion
The research studies described in my doctoral dissertation present new findings that provide
mechanistic insights into the (patho)biology of glomerular cells in health and in diabetes. In
health, we discovered a homeostatic role for podocyte JAK2 in autophagy completion by
regulating TFEB, which itself may serve as a therapeutic target to maintain podocyte
homeostasis. In diabetes, podocyte JAK2 plays a separate role in inflammation and JAK2
inhibition attenuates kidney dysfunction in an experimental model of diabetic kidney disease. By
exploring how podocytes communicate with glomerular endothelial cells under diabetic
conditions, we identified a role for CCL2/CCR2 signaling in epigenetically promoting glomerular
endothelial cell activation through histone H3 phosphorylation. Delineating the molecular
mechanisms implicated in glomerular cell biology in health and disease will continue to provide
new avenues for discovering biological targets and could be crucial in informing future
therapeutic development.
152
Appendices
List of primer sequences used in the studies.
Sequences (5’ 3’)
Forward mouse -galactosidase TGGGATCAAACACCTCGCAA
Reverse mouse -galactosidase CCAGTCAGCAAATGTCTGCG
Forward mouse ATP6AP2 TCTCTCCGAACTGCAAGTGCAACA
Reverse mouse ATP6AP2 CCAAACCTGCCAGCTCCAATGAAT
Forward mouse ATPase H+ transporting accessory protein 1 TACACCGCAGCTCTTACTGC
Reverse mouse ATPase H+ transporting accessory protein 1 AGGAGATGCCACCTGAGTCT
Forward mouse ATPase H+ transporting lysosomal VO subunit C TGCTGGTATTTAGAGCGCAG
Reverse mouse ATPase H+ transporting lysosomal VO subunit C GCCTCATGACTGACATGGCT
Forward mouse Autophagy related 14 GTGGCGAAAACCTCAGCAAG
Reverse mouse Autophagy related 14 GAACCAAGAGGTCACCGAGG
Forward mouse Beclin 1 AGGCATGGAGGGGTCTAAGG
Reverse mouse Beclin 1 GCCTGGGCTGTGGTAAGTAAT
Forward mouse ß-actin AGAGGGAAATCGTGCGTGAC
Reverse mouse ß-actin CAATAGTGATGACCTGGCCGT
Forward mouse Cathepsin B ATGTGGTGGTCCTTGATCCTT
Reverse mouse Cathepsin B CTTCCTGGCAGTTTGGGTCC
Forward mouse Cathepsin D CTATAAGCCGGCGACCTCTG
Reverse mouse Cathepsin D TGAACTTGCGCAGAGGGATT
Forward mouse Caveolin-1 AAAAGTTGTAGCGCCAGGCT
Reverse mouse Caveolin-1 GACCACGTCGTCGTTGAGAT
Forward mouse CD38 GATGCTCAATGGGTCCCTCC
Reverse mouse CD38 GGAAGCTCCTTCGATGTCGT
Forward mouse Cystinosin CAAGTCCTGGGGGCTTAGAG
Reverse mouse Cystinosin GGCTGGGTAGGCATCTTGAA
153
Forward mouse DNA damage regulated autophagy modulator 1 GCTTCTTGGTCCGACGAG
Reverse mouse DNA damage regulated autophagy modulator 1 AGTGTCGTTGGTGCTATCCA
Forward mouse FAM176A GAAGTACGCGCCAGTCGT
Reverse mouse FAM176A TCAGCACCTTTCCAAGGC
Forward mouse Histone deacetylase 6 AGCCTGGTTAAACGGTAGGC
Reverse mouse Histone deacetylase 6 AAGGCTCTCTAATCTGCGCC
Forward mouse Huntingtin-associated protein 1 TCCCTCTGAGGAGCTGTCTG
Reverse mouse Huntingtin-associated protein 1 GGGGCATCAGAACGACTGAA
Forward mouse Lysosomal -glucosidase AGCGAGTTCCTGCTTTGGAG
Reverse mouse Lysosomal -glucosidase CCGAAGCATGAGATGACCCA
Forward mouse Mucopilin-1 GGCGCCTATGACACCATCAA
Reverse mouse Mucopilin-1 CAGTTCACCAGCAGCGAATG
Forward mouse Niemann-Pick C1 CCTACCCCACATGCTGTCTC
Reverse mouse Niemann-Pick C1 CTGTCTTCCCGGGCCATAAC
Forward mouse Nuclear receptor binding factor-2 TGTCGCTCTTGGGCTCTCA
Reverse mouse Nuclear receptor binding factor-2 CCAGCAGCTAACAAACGGTC
Forward mouse Pleckstrin homology domain-containing family M member 1 TCGAAGTCCAACACTCAGGC
Reverse mouse Pleckstrin homology domain-containing family M member 1 CTCAAAGTGCAGGTGTGTGC
Forward mouse Ras-related GTP binding C AAGTTTTTGTGCGGCATCGG
Reverse mouse Ras-related GTP binding C GGTCATGATCAGGCGAGGAG
Forward mouse Ribosomal protein large p0 GCGTCCTGGCATTGTCTGT
Reverse mouse Ribosomal protein large p0 GAAGGCCTTGACCTTTTCAGTAAG
Forward mouse Ribosomal protein L13a GCTCTCAAGGTTGTTCGGCTGA
Reverse mouse Ribosomal protein L13a AGATCTGCTTCTTCTTCCGATA
Forward human Ribosomal protein L13a AGCTCATGAGGCTACGGAAA
Reverse human Ribosomal protein L13a CTTGCTCCCAGCTTCCTATG
Forward mouse Serine/threonine kinase 4 TGTGTGGCAGACATCTGGTC
154
Reverse mouse Serine/threonine kinase 4 ACAAACGGGTGCTGTAGGAG
Forward mouse SNAP-associated protein GCTACAGAACTGTGCCGGAT
Reverse mouse SNAP-associated protein AACCGCCTTAGTCGTTCCTG
Forward mouse Sorting nexin 14 CCAAATTCAACAGAAGCACACA
Reverse mouse Sorting nexin 14 TGTCCAACTGCTCGTCTGTC
Forward mouse Syntaxin 17 CTAGGCGGGAGGTGTTTCTG
Reverse mouse Syntaxin 17 AGCCTGCGTAACTTCACCTT
Forward mouse Tectonin ß-propeller repeat containing 1 GAATTTTGGAGGGGAGCCCA
Reverse mouse Tectonin ß-propeller repeat containing 1 TGGCTGACATCCTCTCGGTA
Forward mouse Transcription factor EB CTCTTGCAGAAGACCCCTCT
Reverse mouse Transcription factor EB AGGGTGGTGGGATAGTGCAA
Forward mouse Transcription factor EB promoter GCTACACCCCAGGAAACGTC
Reverse mouse Transcription factor EB promoter TTGTTTTGGTGAGTCCCGCA
Forward mouse Vacuolar protein sorting 18 TGGGCGAGGTTGTGATTACC
Reverse mouse Vacuolar protein sorting 18 AAGGACGAGACGATCGAGGA
Forward human Vascular cell adhesion molecule 1 ATTTCACTCCGCGGTATCTG
Reverse human Vascular cell adhesion molecule 1 CCAAGGATCACGACCATCTT
Forward mouse Vascular cell adhesion molecule 1 CCCAAGGATCCAGAGATTCA
Reverse mouse Vascular cell adhesion molecule 1 TAAGGTGAGGGTGGCATTTC
Reverse human Vascular cell adhesion molecule 1 promoter CCTTCAAGGGGAAACCCAGG
Forward mouse Vascular cell adhesion molecule 1 promoter ATCTCTGTCTTTGCTGTCAC
Reverse mouse Vascular cell adhesion molecule 1 promoter CTCTCCTGAAAAGATGATTG
Forward mouse Vesicle-associated membrane protein 7 CAGACGGTACTCGGTCAGATT
Reverse mouse Vesicle-associated membrane protein 7 CTTAGCCAGAATCTGCTCTGTC
Forward mouse Vesicle-associated membrane protein 8 AACCTGCAGTTACGTGTGTG
Reverse mouse Vesicle-associated membrane protein 8 TGTTCAGACGTGGCTTCCAA
155
Copyright Acknowledgments
Chapter 1
Figure 1.1: The prevalence rate of chronic kidney disease (CKD) per 100,000 of the global
population across age groups and by sociodemographic index (SDI) quintiles. Adapted from
(Xie, Bowe et al. 2018) with no copyrights permission required under the terms of the Creative
Commons Attribution-NonCommercial-No Derivatives License (CC BY NC ND). [original
article link: https://doi.org/10.1016/j.kint.2018.04.011]
Figure 1.2: Chronic kidney disease classification based on glomerular filtration rate (GFR) and
albuminuria. Permission for the reuse of this figure was obtained from Springer Nature and
Copyright Clearance Center. The license number for the permission is 4497241332400.
Figure 1.5: JAK2 structure. Permission for the reuse of this figure was obtained from Springer
Nature and Copyright Clearance Center. The license number for the permission is
4497230979056.
Figure 1.6: The intricate beauty of podocytes. Permission for the reuse of this figure was obtained
from Spring Nature and Copyright Clearance Center. The license number for the permission is
4476890749834
Chapter 2
Permission for the reuse of the published manuscript was obtained from the American Society of
Nephrology and Copyright Clearance Center. The license number for the permission is
4278341363568.
Chapter 3 and 4
Permission for the reuse of the published manuscript was obtained from the American Diabetes
Association and Copyright Clearance Center. The license number for the permission is
4491451306362
156
CHAPTER 7: REFERENCES
157
Abrahamson, D. R. (2012). "Role of the podocyte (and glomerular endothelium) in building the
GBM". Seminars in nephrology, Elsevier 32(4):342–349.
Abrahamson, D. R., B. G. Hudson, L. Stroganova, D.-B. Borza and P. L. S. John (2009).
"Cellular origins of type IV collagen networks in developing glomeruli." Journal of the American
Society of Nephrology 20(7): 1471-1479.
Advani, A. (2014). "VEGF and the kidney: something of the marvelous." Current Opinion in
Nephrology and Hypertension 23(1): 87-92.
Advani, A., K. A. Connelly, D. A. Yuen, Y. Zhang, S. L. Advani, J. Trogadis, M. G. Kabir, E.
Shachar, M. A. Kuliszewski and H. Leong-Poi (2011). "Fluorescent microangiography is a novel
and widely applicable technique for delineating the renal microvasculature." PLoS One 6(10):
e24695.
Advani, A. and R. E. Gilbert (2012). "The endothelium in diabetic nephropathy". Seminars in
nephrology, Elsevier 32(2): 199-207.
Advani, A., Q. Huang, K. Thai, S. L. Advani, K. E. White, D. J. Kelly, D. A. Yuen, K. A.
Connelly, P. A. Marsden and R. E. Gilbert (2011). "Long-term administration of the histone
deacetylase inhibitor vorinostat attenuates renal injury in experimental diabetes through an
endothelial nitric oxide synthase-dependent mechanism." The American journal of pathology
178(5): 2205-2214.
Afkarian, M., L. R. Zelnick, Y. N. Hall, P. J. Heagerty, K. Tuttle, N. S. Weiss and I. H. De Boer
(2016). "Clinical manifestations of kidney disease among US adults with diabetes, 1988-2014."
Jama 316(6): 602-610.
Alghamdi, T. A., S. N. Batchu, M. J. Hadden, V. G. Yerra, Y. Liu, B. B. Bowskill, S. L. Advani,
L. Geldenhuys, F. S. Siddiqi and S. Majumder (2018). "Histone H3 Serine 10 Phosphorylation
Facilitates Endothelial Activation in Diabetic Kidney Disease." Diabetes 67(12): 2668-2681.
158
Alghamdi, T. A., S. Majumder, K. Thieme, S. N. Batchu, K. E. White, Y. Liu, A. S. Brijmohan,
B. B. Bowskill, S. L. Advani and M. Woo (2017). "Janus Kinase 2 Regulates Transcription
Factor EB Expression and Autophagy Completion in Glomerular Podocytes." Journal of the
American Society of Nephrology 28(9): 2641-2653.
Alicic, R. Z., E. J. Johnson and K. R. Tuttle (2018). "Inflammatory Mechanisms as New
Biomarkers and Therapeutic Targets for Diabetic Kidney Disease." Advances in chronic kidney
disease 25(2): 181-191.
Allen, A. R., J. McHale, J. Smith, H. T. Cook, A. Karkar, D. O. Haskard, R. R. Lobb and C. D.
Pusey (1999). "Endothelial expression of VCAM-1 in experimental crescentic nephritis and
effect of antibodies to very late antigen-4 or VCAM-1 on glomerular injury." The Journal of
Immunology 162(9): 5519-5527.
Alon, R., P. D. Kassner, M. W. Carr, E. B. Finger, M. E. Hemler and T. A. Springer (1995). "The
integrin VLA-4 supports tethering and rolling in flow on VCAM-1." J Cell Biol 128(6): 1243-
1253.
Amiri, F., S. Shaw, X. Wang, J. Tang, J. L. Waller, D. C. Eaton and M. B. Marrero (2002).
"Angiotensin II activation of the JAK/STAT pathway in mesangial cells is altered by high
glucose." Kidney Int 61(5): 1605-1616.
Amiri, F., V. J. Venema, X. Wang, H. Ju, R. C. Venema and M. B. Marrero (1999).
"Hyperglycemia enhances angiotensin II-induced janus-activated kinase/STAT signaling in
vascular smooth muscle cells." J Biol Chem 274(45): 32382-32386.
Arany, I., D. K. Reed, S. C. Grifoni, K. Chandrashekar, G. W. Booz and L. A. Juncos (2011). "A
novel U-STAT3-dependent mechanism mediates the deleterious effects of chronic nicotine
exposure on renal injury." American Journal of Physiology-Renal Physiology 302(6): F722-F729.
159
Argani, P. (2015). "MiT family translocation renal cell carcinoma". Seminars in diagnostic
pathology, Elsevier 32(2): 103-113.
Argani, P., M. Laé, B. Hutchinson, V. E. Reuter, M. H. Collins, J. Perentesis, J. E. Tomaszewski,
J. S. Brooks, G. Acs and J. A. Bridge (2005). "Renal carcinomas with the t (6; 11)(p21; q12):
clinicopathologic features and demonstration of the specific alpha-TFEB gene fusion by
immunohistochemistry, RT-PCR, and DNA PCR." The American journal of surgical pathology
29(2): 230-240.
Arthur, J. (2008). "MSK activation and physiological roles." Frontiers in bioscience: a journal
and virtual library 13: 5866-5879.
Arthur, J. S. and P. Cohen (2000). "MSK1 is required for CREB phosphorylation in response to
mitogens in mouse embryonic stem cells." FEBS Lett 482(1-2): 44-48.
Asanuma, K., I. Tanida, I. Shirato, T. Ueno, H. Takahara, T. Nishitani, E. Kominami and Y.
Tomino (2003). "MAP-LC3, a promising autophagosomal marker, is processed during the
differentiation and recovery of podocytes from PAN nephrosis." The FASEB journal 17(9):
1165-1167.
Astor, B.C., T. Shafi, R.C. Hoogeveen, K. Matsushita, C.M. Ballantyne, L.A. Inker, J. Coresh
(2012). “Novel markers of kidney function as predictors of ESRD, cardiovascular disease, and
mortality in the general population.” American Journal of Kidney Diseases 59(5): 653-662.
Awad, A. S., G. R. Kinsey, K. Khutsishvili, T. Gao, W. K. Bolton and M. D. Okusa (2011).
"Monocyte/macrophage chemokine receptor CCR2 mediates diabetic renal injury." American
Journal of Physiology-Renal Physiology 301(6): F1358-F1366.
Awad, S., M. Kunhi, G. H. Little, Y. Bai, W. An, D. Bers, L. Kedes and C. Poizat (2013).
"Nuclear CaMKII enhances histone H3 phosphorylation and remodels chromatin during cardiac
hypertrophy." Nucleic Acids Res 41(16): 7656-7672.
160
Awata, T., K. Inoue, S. Kurihara, T. Ohkubo, M. Watanabe, K. Inukai, I. Inoue and S. Katayama
(2002). "A common polymorphism in the 5′-untranslated region of the VEGF gene is associated
with diabetic retinopathy in type 2 diabetes." Diabetes 51(5): 1635-1639.
Azushima, K., S. B. Gurley and T. M. Coffman (2018). "Modelling diabetic nephropathy in
mice." Nature Reviews Nephrology 14(1): 48-56.
Badal, S. S., Y. Wang, J. Long, D. L. Corcoran, B. H. Chang, L. D. Truong, Y. S. Kanwar, P. A.
Overbeek and F. R. Danesh (2016). "miR-93 regulates Msk2-mediated chromatin remodelling in
diabetic nephropathy." Nat Commun 7: 12076.
Baker, R. G., M. S. Hayden and S. Ghosh (2011). "NF-κB, inflammation, and metabolic disease."
Cell metabolism 13(1): 11-22.
Banba, N., T. Nakamura, M. Matsumura, H. Kuroda, Y. Hattori and K. Kasai (2000). "Possible
relationship of monocyte chemoattractant protein-1 with diabetic nephropathy." Kidney
international 58(2): 684-690.
Banes, A. K., S. Shaw, J. Jenkins, H. Redd, F. Amiri, D. M. Pollock and M. B. Marrero (2004).
"Angiotensin II blockade prevents hyperglycemia-induced activation of JAK and STAT proteins
in diabetic rat kidney glomeruli." Am J Physiol Renal Physiol 286(4): F653-659.
Banes-Berceli, A. K., S. Shaw, G. Ma, M. Brands, D. C. Eaton, D. M. Stern, D. Fulton, R. W.
Caldwell and M. B. Marrero (2006). "Effect of simvastatin on high glucose- and angiotensin II-
induced activation of the JAK/STAT pathway in mesangial cells." Am J Physiol Renal Physiol
291(1): F116-F121.
Bannister, A. J. and T. Kouzarides (2011). "Regulation of chromatin by histone modifications."
Cell research 21(3): 381.
161
Bao, J., L. Zheng, Q. Zhang, X. Li, X. Zhang, Z. Li, X. Bai, Z. Zhang, W. Huo and X. Zhao
(2016). "Deacetylation of TFEB promotes fibrillar Aβ degradation by upregulating lysosomal
biogenesis in microglia." Protein & cell 7(6): 417-433.
Barker, D. F., S. L. Hostikka, J. Zhou, L. T. Chow, A. R. Oliphant, S. C. Gerken, M. C. Gregory,
M. H. Skolnick, C. L. Atkin and K. Tryggvason (1990). "Identification of mutations in the
COL4A5 collagen gene in Alport syndrome." Science 248(4960): 1224-1227.
Bartlett, C. S., M. Jeansson and S. E. Quaggin (2016). "Vascular growth factors and glomerular
disease." Annual review of physiology 78: 437-461.
Batchu, S. N., S. Majumder, B. B. Bowskill, K. E. White, S. L. Advani, A. S. Brijmohan, Y. Liu,
K. Thai, P. M. Azizi and W. L. Lee (2016). "Prostaglandin I2 Receptor Agonism Preserves β-
Cell Function and Attenuates Albuminuria Through Nephrin-Dependent Mechanisms." Diabetes
65(5): 1398-1409.
Batchu, S. N., S. Majumder, B. B. Bowskill, K. E. White, S. L. Advani, A. S. Brijmohan, Y. Liu,
K. Thai, P. M. Azizi, W. L. Lee and A. Advani (2016). "Prostaglandin I2 Receptor Agonism
Preserves beta-Cell Function and Attenuates Albuminuria Through Nephrin-Dependent
Mechanisms." Diabetes 65(5): 1398-1409.
Baxter, E. J., L. M. Scott, P. J. Campbell, C. East, N. Fourouclas, S. Swanton, G. S. Vassiliou, A.
J. Bench, E. M. Boyd and N. Curtin (2005). "Acquired mutation of the tyrosine kinase JAK2 in
human myeloproliferative disorders." The Lancet 365(9464): 1054-1061.
Benjamin, D., M. Colombi, C. Moroni and M. N. Hall (2011). "Rapamycin passes the torch: a
new generation of mTOR inhibitors." Nature reviews Drug discovery 10(11): 868.
Berthier, C. C., H. Zhang, M. Schin, A. Henger, R. G. Nelson, B. Yee, A. Boucherot, M. A.
Neusser, C. D. Cohen and C. Carter-Su (2009). "Enhanced expression of janus kinase–signal
162
transducer and activator of transcription pathway members in human diabetic nephropathy."
Diabetes 58(2): 469-477.
Berthier, C. C., H. Zhang, M. Schin, A. Henger, R. G. Nelson, B. Yee, A. Boucherot, M. A.
Neusser, C. D. Cohen, C. Carter-Su, L. S. Argetsinger, M. P. Rastaldi, F. C. Brosius and M.
Kretzler (2009). "Enhanced expression of Janus kinase-signal transducer and activator of
transcription pathway members in human diabetic nephropathy." Diabetes 58(2): 469-477.
Bhat, N., J. Park, H. Y. Zoghbi, J. S. C. Arthur and K. S. Zaret (2016). "The chromatin modifier
MSK1/2 suppresses endocrine cell fates during mouse pancreatic development." PloS one 11(12):
e0166703.
Bierzynska, A., K. Soderquest and A. Koziell (2015). "Genes and podocytes–new insights into
mechanisms of podocytopathy." Frontiers in endocrinology 5: 226.
Bjørkøy, G., T. Lamark, A. Brech, H. Outzen, M. Perander, A. Øvervatn, H. Stenmark and T.
Johansen (2005). "p62/SQSTM1 forms protein aggregates degraded by autophagy and has a
protective effect on huntingtin-induced cell death." The Journal of cell biology 171(4): 603-614.
Bock, F., K. Shahzad, H. Wang, S. Stoyanov, J. Wolter, W. Dong, P. G. Pelicci, M. Kashif, S.
Ranjan and S. Schmidt (2013). "Activated protein C ameliorates diabetic nephropathy by
epigenetically inhibiting the redox enzyme p66Shc." Proceedings of the National Academy of
Sciences 110(2): 648-653.
Boels, M. G., M. C. Avramut, A. Koudijs, M. J. Dane, D. H. Lee, J. van der Vlag, A. J. Koster,
A. J. van Zonneveld, E. van Faassen and H.-J. Gröne (2016). "Atrasentan reduces albuminuria by
restoring the glomerular endothelial glycocalyx barrier in diabetic nephropathy." Diabetes 65(8):
2429–2439.
163
Boels, M.G.S., A. Koudijs, M.C. Avramut, W.M.P.J. Sol, G. Wang, A.M. van Oeveren-Rietdijk,
A.J. van Zonneveld, H.C. de Boer, J. van der Vlag, C. van Kooten, D. Eulberg, B.M. van den
Berg, D.H.T. IJpelaar, T.J. Rabelink (2017). “Systemic monocyte chemotactic protein-1
inhibition modifies renal macrophages and restores glomerular endothelial glycocalyx and barrier
function in diabetic nephropathy.” The American Journal of Pathology 187(11):2430-2440.
Branten, A. J., J. Van Den Born, J. L. Jansen, K. J. Assmann and J. F. Wetzels (2001). "Familial
nephropathy differing from minimal change nephropathy and focal glomerulosclerosis." Kidney
international 59(2): 693-701.
Brasacchio, D., J. Okabe, C. Tikellis, A. Balcerczyk, P. George, E. K. Baker, A. C. Calkin, M.
Brownlee, M. E. Cooper and A. El-Osta (2009). "Hyperglycemia induces a dynamic
cooperativity of histone methylase and demethylase enzymes associated with gene-activating
epigenetic marks that co-exist on the lysine tail." Diabetes 58(5): 1229 –1236.
Braun, F., J. U. Becker and P. T. Brinkkoetter (2016). "Live or Let Die: Is There any Cell Death
in Podocytes?." Seminars in nephrology, Elsevier 36(3): 208-219.
Braun, L., T. Kardon, Z. Reisz-Porszasz, G. Banhegyi and J. Mandl (2001). "The regulation of
the induction of vascular endothelial growth factor at the onset of diabetes in spontaneously
diabetic rats." Life sciences 69(21): 2533-2542.
Breier, G., U. Albrecht, S. Sterrer and W. Risau (1992). "Expression of vascular endothelial
growth factor during embryonic angiogenesis and endothelial cell differentiation." Development
114(2): 521-532.
Brenner, B. M., M. E. Cooper, D. De Zeeuw, W. F. Keane, W. E. Mitch, H.-H. Parving, G.
Remuzzi, S. M. Snapinn, Z. Zhang and S. Shahinfar (2001). "Effects of losartan on renal and
cardiovascular outcomes in patients with type 2 diabetes and nephropathy." New England Journal
of Medicine 345(12): 861-869.
164
Brenner, B. M., D. L. Garcia and S. Anderson (1988). "Glomeruli and blood pressure: less of
one, more the other?" American journal of hypertension 1(4_Pt_1): 335-347.
Brewster, U. C. and M. A. Perazella (2004). "The renin-angiotensin-aldosterone system and the
kidney: effects on kidney disease." The American journal of medicine 116(4): 263-272.
Breyer, M. D. and K. Susztak (2016). "Developing treatments for chronic kidney disease in the
21st century." Seminars in nephrology, Elsevier 36(6): 436-447.
Breyer M.D., Z. Qi (2010). “Better nephrology for mice--and man.” Kidney International 77(6):
487-489.
Brijmohan, A. S., S. N. Batchu, S. Majumder, T. A. Alghamdi, K. Thieme, S. McGaugh, Y. Liu,
S. L. Advani, B. B. Bowskill and M. G. Kabir (2018). "HDAC6 inhibition promotes transcription
factor EB activation and is protective in experimental kidney disease." Frontiers in pharmacology
9: 34.
Brinkkoetter, P. T., C. Ising and T. Benzing (2013). "The role of the podocyte in albumin
filtration." Nature Reviews Nephrology 9(6): 328.
Broekhuizen, L. N., B. A. Lemkes, H. L. Mooij, M. C. Meuwese, H. Verberne, F. Holleman, R.
O. Schlingemann, M. Nieuwdorp, E. S. Stroes and H. Vink (2010). "Effect of sulodexide on
endothelial glycocalyx and vascular permeability in patients with type 2 diabetes mellitus."
Diabetologia 53(12): 2646-2655.
Brosius, F. C., 3rd, C. E. Alpers, E. P. Bottinger, M. D. Breyer, T. M. Coffman, S. B. Gurley, R.
C. Harris, M. Kakoki, M. Kretzler, E. H. Leiter, M. Levi, R. A. McIndoe, K. Sharma, O.
Smithies, K. Susztak, N. Takahashi and T. Takahashi (2009). "Mouse models of diabetic
nephropathy." J Am Soc Nephrol 20(12): 2503-2512.
165
Brosius, F. C., K. R. Tuttle and M. Kretzler (2016). "JAK inhibition in the treatment of diabetic
kidney disease." Diabetologia 59(8): 1624-1627.
Brosius Iii, F. C. and J. C. He (2015). "JAK inhibition and progressive kidney disease." Current
opinion in nephrology and hypertension 24(1): 88-95.
Brownlee, M. (2001). "Biochemistry and molecular cell biology of diabetic complications."
Nature 414(6865): 813.
Burt, D., G. Salvidio, E. Tarabra, F. Barutta, S. Pinach, P. Dentelli, G. Camussi, P. C. Perin and
G. Gruden (2007). "The monocyte chemoattractant protein-1/cognate CC chemokine receptor 2
system affects cell motility in cultured human podocytes." The American journal of pathology
171(6): 1789-1799.
Calvier, L., E. Martinez-Martinez, M. Miana, V. Cachofeiro, E. Rousseau, J. R. Sádaba, F.
Zannad, P. Rossignol and N. López-Andrés (2015). "The impact of galectin-3 inhibition on
aldosterone-induced cardiac and renal injuries." JACC: Heart Failure 3(1): 59-67.
Canadian Organ Replacement Register Annual Statistics, t. (2016). from
www.cihi.ca/en/canadian-organ-replacement-register-corr.
Carter, R., I. Campbell, K. O’donnel and I. Wicks (2002). "Vascular cell adhesion molecule‐1
(VCAM‐1) blockade in collagen‐induced arthritis reduces joint involvement and alters B cell
trafficking." Clinical & Experimental Immunology 128(1): 44-51.
Chang, A. S., C. K. Hathaway, O. Smithies and M. Kakoki (2015). "Transforming growth factor-
β1 and diabetic nephropathy." American Journal of Physiology-Renal Physiology 310(8): F689-
F696.
166
Chen, J., M. X. Chen, A. B. Fogo, R. C. Harris and J.-K. Chen (2013). "mVps34 deletion in
podocytes causes glomerulosclerosis by disrupting intracellular vesicle trafficking." Journal of
the American Society of Nephrology 24 (2): 198-207.
Chen, Y., X. Zhao, J. Li, L. Zhang, R. Li, H. Zhang, R. Liao, S. Liu, W. Shi and X. Liang (2018).
"Amino acid starvation promotes podocyte autophagy through mammalian target of rapamycin
inhibition and transcription factor EB activation." Molecular medicine reports 18(5): 4342-4348.
Cheng, H.-F., C. J. Wang, G. W. Moeckel, M.-Z. Zhang, J. A. Mckanna and R. C. Harris (2002).
"Cyclooxygenase-2 inhibitor blocks expression of mediators of renal injury in a model of
diabetes and hypertension1." Kidney international 62(3): 929-939.
Cherney, D. Z., B. A. Perkins, N. Soleymanlou, M. Maione, V. Lai, A. Lee, N. M. Fagan, H. J.
Woerle, O. E. Johansen and U. C. Broedl (2013). "The renal hemodynamic effect of SGLT2
inhibition in patients with type 1 diabetes." Circulation 129(5): 587-597.
Choi, M. E., Y. Ding and S. I. Kim (2012). "TGF-β signaling via TAK1 pathway: role in kidney
fibrosis". Seminars in nephrology, Elsevier 32(3): 244-252.
Chow, F., D. Nikolic-Paterson, F. Ma, E. Ozols, B. Rollins and G. Tesch (2007). "Monocyte
chemoattractant protein-1-induced tissue inflammation is critical for the development of renal
injury but not type 2 diabetes in obese db/db mice." Diabetologia 50(2): 471-480.
Chow, F., D. Nikolic-Paterson, E. Ozols, R. Atkins, B. Rollin and G. Tesch (2006). "Monocyte
chemoattractant protein-1 promotes the development of diabetic renal injury in streptozotocin-
treated mice." Kidney international 69(1): 73-80.
Chow, F., E. Ozols, D. J. Nikolic-Paterson, R. C. Atkins and G. H. Tesch (2004). "Macrophages
in mouse type 2 diabetic nephropathy: correlation with diabetic state and progressive renal
injury." Kidney international 65(1): 116-128.
167
Chu, H. X., T. V. Arumugam, M. Gelderblom, T. Magnus, G. R. Drummond and C. G. Sobey
(2014). "Role of CCR2 in inflammatory conditions of the central nervous system." J Cereb Blood
Flow Metab 34(9): 1425-1429.
Chuang, P. Y. and J. C. He (2010). "JAK/STAT signaling in renal diseases." Kidney Int 78(3):
231-234.
Cinà, D. P., T. Onay, A. Paltoo, C. Li, Y. Maezawa, J. De Arteaga, A. Jurisicova and S. E.
Quaggin (2012). "Inhibition of MTOR disrupts autophagic flux in podocytes." Journal of the
American Society of Nephrology 23(3): 412-420.
Clausen, P., P. Jacobsen, K. Rossing, J. Jensen, H. H. Parving and B. Feldt‐Rasmussen (2000).
"Plasma concentrations of VCAM‐1 and ICAM‐1 are elevated in patients with Type 1 diabetes
mellitus with microalbuminuria and overt nephropathy." Diabetic Medicine 17(9): 644-649.
Clayton, J. A. and F. S. Collins (2014). "Policy: NIH to balance sex in cell and animal studies."
Nature News 509(7500): 282-283.
Clerk, A., A. Michael and P. H. Sugden (1998). "Stimulation of the p38 mitogen-activated
protein kinase pathway in neonatal rat ventricular myocytes by the G protein-coupled receptor
agonists, endothelin-1 and phenylephrine: a role in cardiac myocyte hypertrophy?" J Cell Biol
142(2): 523-535.
Collino, F., B. Bussolati, E. Gerbaudo, L. Marozio, S. Pelissetto, C. Benedetto and G. Camussi
(2008). "Preeclamptic sera induce nephrin shedding from podocytes through endothelin-1 release
by endothelial glomerular cells." Am J Physiol Renal Physiol 294(5): F1185-1194.
Colombo, M., H. C. Looker, B. Farran, S. Hess, L. Groop, C. N. Palmer, M. J. Brosnan, R. N.
Dalton, M. Wong and C. Turner (2019). "Serum kidney injury molecule 1 and β 2-microglobulin
perform as well as larger biomarker panels for prediction of rapid decline in renal function in
type 2 diabetes." Diabetologia 62(1): 156-168.
168
Cooper, M. E., D. Vranes, S. Youssef, S. A. Stacker, A. J. Cox, B. Rizkalla, D. J. Casley, L. A.
Bach, D. J. Kelly and R. E. Gilbert (1999). "Increased renal expression of vascular endothelial
growth factor (VEGF) and its receptor VEGFR-2 in experimental diabetes." Diabetes 48(11):
2229-2239.
Corapi, K. M., J. L. Chen, E. M. Balk and C. E. Gordon (2012). "Bleeding complications of
native kidney biopsy: a systematic review and meta-analysis." American Journal of Kidney
Diseases 60(1): 62-73.
Correa-Costa, M., H. Azevedo, M. T. Amano, G. M. Gonçalves, M. I. Hyane, M. A. Cenedeze, P.
G. Renesto, A. Pacheco-Silva, C. A. Moreira-Filho and N. O. S. Câmara (2012). "Transcriptome
analysis of renal ischemia/reperfusion injury and its modulation by ischemic pre-conditioning or
hemin treatment." PLoS One 7(11): e49569.
Coughlan, M. T., T.-V. Nguyen, S. A. Penfold, G. C. Higgins, V. Thallas-Bonke, S. M. Tan, N. J.
Van Bergen, K. C. Sourris, B. E. Harcourt and D. R. Thorburn (2016). "Mapping time-course
mitochondrial adaptations in the kidney in experimental diabetes." Clinical science 130(9):711-
720.
Cuenda, A., J. Rouse, Y. N. Doza, R. Meier, P. Cohen, T. F. Gallagher, P. R. Young and J. C.
Lee (1995). "SB 203580 is a specific inhibitor of a MAP kinase homologue which is stimulated
by cellular stresses and interleukin-1." FEBS Lett 364(2): 229-233.
Daehn, I., G. Casalena, T. Zhang, S. Shi, F. Fenninger, N. Barasch, L. Yu, V. D'Agati, D.
Schlondorff, W. Kriz, B. Haraldsson and E. P. Bottinger (2014). "Endothelial mitochondrial
oxidative stress determines podocyte depletion in segmental glomerulosclerosis." J Clin Invest
124(4): 1608-1621.
169
Dalrymple, L. S., R. Katz, B. Kestenbaum, M. G. Shlipak, M. J. Sarnak, C. Stehman-Breen, S.
Seliger, D. Siscovick, A. B. Newman and L. Fried (2011). "Chronic kidney disease and the risk
of end-stage renal disease versus death." Journal of general internal medicine 26(4): 379-385.
Dang, Z., A. MacKinnon, L. P. Marson and T. Sethi (2012). "Tubular atrophy and interstitial
fibrosis after renal transplantation is dependent on galectin-3." Transplantation 93(5): 477-484.
Darnell, J. E., Jr., I. M. Kerr and G. R. Stark (1994). "Jak-STAT pathways and transcriptional
activation in response to IFNs and other extracellular signaling proteins." Science 264(5164):
1415-1421.
Davis, B., A. Dei Cas, D. A. Long, K. E. White, A. Hayward, C.-H. Ku, A. S. Woolf, R. Bilous,
G. Viberti and L. Gnudi (2007). "Podocyte-specific expression of angiopoietin-2 causes
proteinuria and apoptosis of glomerular endothelia." Journal of the American Society of
Nephrology 18(8): 2320-2329.
DCCT, D. C. C. T. R. G. (1993). "The effect of intensive treatment of diabetes on the
development and progression of long-term complications in insulin-dependent diabetes mellitus."
New England journal of medicine 329(14): 977-986.
DCCT/EDIC (2011). "Intensive diabetes therapy and glomerular filtration rate in type 1
diabetes." New England Journal of Medicine 365(25): 2366-2376.
DCCT/EDIC and D. C. C. T. E. o. D. I. C. R. Group (2000). "Retinopathy and nephropathy in
patients with type 1 diabetes four years after a trial of intensive therapy." New England Journal of
Medicine 342(6): 381-389.
De Boer, I. H., T. C. Rue, P. A. Cleary, J. M. Lachin, M. E. Molitch, M. W. Steffes, W. Sun, B.
Zinman and J. D. Brunzell (2011). "Long-term renal outcomes of patients with type 1 diabetes
mellitus and microalbuminuria: an analysis of the Diabetes Control and Complications
170
Trial/Epidemiology of Diabetes Interventions and Complications cohort." Archives of internal
medicine 171(5): 412-420.
de Boer, I. H., T. C. Rue, Y. N. Hall, P. J. Heagerty, N. S. Weiss and J. Himmelfarb (2011).
"Temporal trends in the prevalence of diabetic kidney disease in the United States." Jama
305(24): 2532-2539.
De Vriese, A. S., R. G. TILTON, M. ELGER, C. C. STEPHAN, W. KRIZ and N. H. LAMEIRE
(2001). "Antibodies against vascular endothelial growth factor improve early renal dysfunction in
experimental diabetes." Journal of the American Society of Nephrology 12(5): 993-1000.
De Zeeuw, D., T. Akizawa, P. Audhya, G. L. Bakris, M. Chin, H. Christ-Schmidt, A. Goldsberry,
M. Houser, M. Krauth and H. J. Lambers Heerspink (2013). "Bardoxolone methyl in type 2
diabetes and stage 4 chronic kidney disease." New England Journal of Medicine 369(26): 2492-
2503.
de Zeeuw, D., P. Bekker, E. Henkel, C. Hasslacher, I. Gouni-Berthold, H. Mehling, A. Potarca,
V. Tesar, H. J. Heerspink, T. J. Schall and C. B. D. N. S. Group (2015). "The effect of CCR2
inhibitor CCX140-B on residual albuminuria in patients with type 2 diabetes and nephropathy: a
randomised trial." Lancet Diabetes Endocrinol 3(9): 687-696.
de Zeeuw, D., P. Bekker, E. Henkel, C. Hasslacher, I. Gouni-Berthold, H. Mehling, A. Potarca,
V. Tesar, H. J. L. Heerspink and T. J. Schall (2015). "The effect of CCR2 inhibitor CCX140-B
on residual albuminuria in patients with type 2 diabetes and nephropathy: a randomised trial."
The Lancet Diabetes & Endocrinology 3(9): 687-696.
de Zeeuw, D., R. W. Renfurm, G. Bakris, P. Rossing, V. Perkovic, F. F. Hou, M. Nangaku, K.
Sharma, H. J. Heerspink and A. Garcia-Hernandez (2018). "Efficacy of a novel inhibitor of
vascular adhesion protein-1 in reducing albuminuria in patients with diabetic kidney disease
(ALBUM): a randomised, placebo-controlled, phase 2 trial." The Lancet Diabetes &
Endocrinology 6(12): 925-933.
171
Deanfield, J. E., J. P. Halcox and T. J. Rabelink (2007). "Endothelial function and dysfunction:
testing and clinical relevance." Circulation 115(10): 1285-1295.
Deckert, T., B. Feldt-Rasmussen, K. Borch-Johnsen, T. Jensen and A. Kofoed-Enevoldsen
(1989). "Albuminuria reflects widespread vascular damage. The Steno hypothesis." Diabetologia
32(4): 219-226.
Decressac, M., B. Mattsson, P. Weikop, M. Lundblad, J. Jakobsson and A. Björklund (2013).
"TFEB-mediated autophagy rescues midbrain dopamine neurons from α-synuclein toxicity."
Proceedings of the National Academy of Sciences 110(19):E1817- E1826.
Derenzini, E., M. Lemoine, D. Buglio, H. Katayama, Y. Ji, R. E. Davis, S. Sen and A. Younes
(2011). "The JAK inhibitor AZD1480 regulates proliferation and immunity in Hodgkin
lymphoma." Blood Cancer J 1(12): e46.
Ding, Y. and M. E. Choi (2015). "Autophagy in diabetic nephropathy." Journal of Endocrinology
224(1): R15-R30.
Donate-Correa, J., E. Martín-Núñez, M. Muros-de-Fuentes, C. Mora-Fernández and J. F.
Navarro-González (2015). "Inflammatory cytokines in diabetic nephropathy." Journal of diabetes
research 2015: ID 948417, 9 pages.
Doublier, S., G. Salvidio, E. Lupia, V. Ruotsalainen, D. Verzola, G. Deferrari and G. Camussi
(2003). "Nephrin expression is reduced in human diabetic nephropathy: evidence for a distinct
role for glycated albumin and angiotensin II." Diabetes 52(4): 1023-1030.
Dugan, L. L., Y.-H. You, S. S. Ali, M. Diamond-Stanic, S. Miyamoto, A.-E. DeCleves, A.
Andreyev, T. Quach, S. Ly and G. Shekhtman (2013). "AMPK dysregulation promotes diabetes-
related reduction of superoxide and mitochondrial function." The Journal of clinical investigation
123(11): 4888-4899.
172
Dunn, S.R., Z.Qi, E.P. Bottinger, M.D. Breyer, K. Sharma (2004). “Utility of endogenous
creatinine clearance as a measure of renal function in mice.” Kidney International 65(5): 1959-
1967.
Edeling, M., G. Ragi, S. Huang, H. Pavenstädt and K. Susztak (2016). "Developmental signalling
pathways in renal fibrosis: the roles of Notch, Wnt and Hedgehog." Nature Reviews Nephrology
12(7): 426-439.
Eisner, C., R. Faulhaber-Walter, Y. Wang, A. Leelahavanichkul, P.S. Yuen, D. Mizel, R.A. Star,
J.P. Briggs, M. Levine, J. Schnermann. (2010). “Major contribution of tubular secretion to
creatinine clearance in mice.” Kidney International 77(6): 519-526.
Ekinci, E. I., G. Jerums, A. Skene, P. Crammer, D. Power, K. Y. Cheong, S. Panagiotopoulos, K.
McNeil, S. T. Baker and P. Fioretto (2013). "Renal structure in normoalbuminuric and
albuminuric patients with type 2 diabetes and impaired renal function." Diabetes care
36(11):3620-3626.
El-Osta, A., D. Brasacchio, D. Yao, A. Pocai, P. L. Jones, R. G. Roeder, M. E. Cooper and M.
Brownlee (2008). "Transient high glucose causes persistent epigenetic changes and altered gene
expression during subsequent normoglycemia." Journal of Experimental Medicine 205(10):
2409-2417.
Endlich, N., K. R. Kress, J. Reiser, D. Uttenweiler, W. Kriz, P. Mundel and K. Endlich (2001).
"Podocytes respond to mechanical stress in vitro." Journal of the American Society of
Nephrology 12(3): 413-422.
Eremina, V., S. Cui, H. Gerber, N. Ferrara, J. Haigh, A. Nagy, M. Ema, J. Rossant, S. Jothy and
J. H. Miner (2006). "Vascular endothelial growth factor a signaling in the podocyte-endothelial
compartment is required for mesangial cell migration and survival." Journal of the American
Society of Nephrology 17(3): 724-735.
173
Eremina, V., J. A. Jefferson, J. Kowalewska, H. Hochster, M. Haas, J. Weisstuch, C. Richardson,
J. B. Kopp, M. G. Kabir and P. H. Backx (2008). "VEGF inhibition and renal thrombotic
microangiopathy." New England Journal of Medicine 358(11): 1129-1136.
Eremina, V. and S. E. Quaggin (2004). "The role of VEGF-A in glomerular development and
function." Current opinion in nephrology and hypertension 13(1): 9-15.
Eremina, V., M. Sood, J. Haigh, A. Nagy, G. Lajoie, N. Ferrara, H.-P. Gerber, Y. Kikkawa, J. H.
Miner and S. E. Quaggin (2003). "Glomerular-specific alterations of VEGF-A expression lead to
distinct congenital and acquired renal diseases." The Journal of clinical investigation 111(5): 707-
716.
Eskelinen, E. (2005). "Doctor Jekyll and Mister Hyde: autophagy can promote both cell survival
and cell death." Cell death and differentiation 12(S2): 1468-1472.
Esmon, C. T. (2001)."The normal role of activated protein C in maintaining homeostasis and its
relevance to critical illness." Critical Care, BioMed Central 5(2):S7-12.
Esser, S., M. G. Lampugnani, M. Corada, E. Dejana and W. Risau (1998). "Vascular endothelial
growth factor induces VE-cadherin tyrosine phosphorylation in endothelial cells." Journal of cell
science 111(13): 1853-1865.
Fang, L., Y. Zhou, H. Cao, P. Wen, L. Jiang, W. He, C. Dai and J. Yang (2013). "Autophagy
attenuates diabetic glomerular damage through protection of hyperglycemia-induced podocyte
injury." PloS one 8(4): e60546.
Ferrara, N. (2002). "VEGF and the quest for tumour angiogenesis factors." Nature Reviews
Cancer 2(10): 795-803.
174
Ferron, M., C. Settembre, J. Shimazu, J. Lacombe, S. Kato, D. J. Rawlings, A. Ballabio and G.
Karsenty (2013). "A RANKL–PKCβ–TFEB signaling cascade is necessary for lysosomal
biogenesis in osteoclasts." Genes & development 27(8):955-969.
Fields, R. D. (2014). "NIH policy: mandate goes too far." Nature 510(7505): 340.
Fiorentino, L., M. Cavalera, S. Menini, V. Marchetti, M. Mavilio, M. Fabrizi, F. Conserva, V.
Casagrande, R. Menghini and P. Pontrelli (2013). "Loss of TIMP3 underlies diabetic nephropathy
via FoxO1/STAT1 interplay." EMBO molecular medicine 5(3): 441-455.
Fioretto, P., I. Barzon and M. Mauer (2014). "Is diabetic nephropathy reversible?" Diabetes
research and clinical practice 104(3): 323-328.
Floege, J., F. Eitner and C. E. Alpers (2008). "A new look at platelet-derived growth factor in
renal disease." Journal of the American Society of Nephrology 19(1): 12-23.
Flyvbjerg, A., F. Dagnæs-Hansen, A. S. De Vriese, B. F. Schrijvers, R. G. Tilton and R. Rasch
(2002). "Amelioration of long-term renal changes in obese type 2 diabetic mice by a neutralizing
vascular endothelial growth factor antibody." Diabetes 51(10): 3090-3094.
Forbes, J. M., M. T. Coughlan and M. E. Cooper (2008). "Oxidative stress as a major culprit in
kidney disease in diabetes." Diabetes 57(6): 1446-1454.
Foster, M.C., L.A. Inker, C.Y. Hsu, J.H. Eckfeldt, A.S. Levey, M.E. Pavkov, B.D. Myers, P.H.
Bennett, P.L. Kimmel, R.S. Vasan, J. Coresh, R.G. Nelson on behalf of the CKD Biomarkers
Consortium (2015). “Filtration markers as predictors of ESRD and mortality in Southwestern
American Indians with type 2 diabetes.” American Journal of Kidney Diseases 66(1): 75-83.
Fridman, J. S., P. A. Scherle, R. Collins, T. C. Burn, Y. Li, J. Li, M. B. Covington, B. Thomas, P.
Collier and M. F. Favata (2010). "Selective inhibition of JAK1 and JAK2 is efficacious in rodent
models of arthritis: preclinical characterization of INCB028050." The Journal of Immunology
184(9): 5298-5307.
175
Fried, L. F., N. Emanuele, J. H. Zhang, M. Brophy, T. A. Conner, W. Duckworth, D. J. Leehey,
P. A. McCullough, T. O'connor and P. M. Palevsky (2013). "Combined angiotensin inhibition for
the treatment of diabetic nephropathy." New England Journal of Medicine 369(20): 1892-1903.
Fu, J., C. Wei, W. Zhang, D. Schlondorff, J. Wu, M. Cai, W. He, M. H. Baron, P. Y. Chuang, Z.
Liu, J. C. He and K. Lee (2018). "Gene expression profiles of glomerular endothelial cells
support their role in the glomerulopathy of diabetic mice." Kidney Int 94(2):326-345.
Fufaa, G. D., E. J. Weil, R. G. Nelson, R. L. Hanson, W. C. Knowler, B. H. Rovin, H. Wu, J. B.
Klein, T. E. Mifflin and H. I. Feldman (2015). "Urinary monocyte chemoattractant protein-1 and
hepcidin and early diabetic nephropathy lesions in type 1 diabetes mellitus." Nephrology Dialysis
Transplantation 30(4): 599-606.
Fujimoto, M., Y. Maezawa, K. Yokote, K. Joh, K. Kobayashi, H. Kawamura, M. Nishimura, A.
B. Roberts, Y. Saito and S. Mori (2003). "Mice lacking Smad3 are protected against
streptozotocin-induced diabetic glomerulopathy." Biochemical and biophysical research
communications 305(4): 1002-1007.
Fukuda, T., Y. Fukushima, T. Numao, N. Ando, M. Arima, H. Nakajima, H. Sagara, T. Adachi,
S. Motojima and S. Makino (1996). "Role of interleukin-4 and vascular cell adhesion molecule-1
in selective eosinophil migration into the airways in allergic asthma." American journal of
respiratory cell and molecular biology 14(1): 84-94.
Gagliardini, E., C. Zoja and A. Benigni (2015). Et and diabetic nephropathy: preclinical and
clinical studies. Seminars in nephrology, Elsevier 35(2):188-96.
Galkina, E. and K. Ley (2006). "Leukocyte recruitment and vascular injury in diabetic
nephropathy." Journal of the American Society of Nephrology 17(2): 368-377.
176
García-García, P. M., M. A. Getino-Melián, V. Domínguez-Pimentel and J. F. Navarro-González
(2014). "Inflammation in diabetic kidney disease." World journal of diabetes 5(4): 431-443.
Genovese, M. C., J. Kremer, O. Zamani, C. Ludivico, M. Krogulec, L. Xie, S. D. Beattie, A. E.
Koch, T. E. Cardillo and T. P. Rooney (2016). "Baricitinib in patients with refractory rheumatoid
arthritis." New England Journal of Medicine 374(13): 1243-1252.
Giacco, F. and M. Brownlee (2010). "Oxidative stress and diabetic complications." Circulation
research 107(9): 1058-1070.
Giatromanolaki, A., D. Kalamida, E. Sivridis, I. V. Karagounis, K. C. Gatter, A. L. Harris and M.
I. Koukourakis (2015). "Increased expression of transcription factor EB (TFEB) is associated
with autophagy, migratory phenotype and poor prognosis in non-small cell lung cancer." Lung
Cancer 90(1): 98-105.
Gibson, D. A., E. Greaves, H. O. Critchley and P. T. Saunders (2015). "Estrogen-dependent
regulation of human uterine natural killer cells promotes vascular remodelling via secretion of
CCL2." Hum Reprod 30(6): 1290-1301.
Gilbert, R. E., Q. Huang, K. Thai, S. L. Advani, K. Lee, D. A. Yuen, K. A. Connelly and A.
Advani (2011). "Histone deacetylase inhibition attenuates diabetes-associated kidney growth:
potential role for epigenetic modification of the epidermal growth factor receptor." Kidney Int 79:
1312-1321.
Giunti, S., S. Pinach, L. Arnaldi, G. Viberti, P. Perin, G. Camussi and G. Gruden (2006). "The
MCP-1/CCR2 system has direct proinflammatory effects in human mesangial cells." Kidney
international 69(5): 856-863.
Giunti, S., G. Tesch, S. Pinach, D. Burt, M. Cooper, P. Cavallo-Perin, G. Camussi and G. Gruden
(2008). "Monocyte chemoattractant protein-1 has prosclerotic effects both in a mouse model of
experimental diabetes and in vitro in human mesangial cells." Diabetologia 51(1): 198-207.
177
Gnudi, L. (2016). "Angiopoietins and diabetic nephropathy." Diabetologia 59(8): 1616-1620.
Go, A. S., G. M. Chertow, D. Fan, C. E. McCulloch and C.-y. Hsu (2004). "Chronic kidney
disease and the risks of death, cardiovascular events, and hospitalization." New England Journal
of Medicine 351(13): 1296-1305.
Goldberg, A. D., C. D. Allis and E. Bernstein (2007). "Epigenetics: a landscape takes shape."
Cell 128(4): 635-638.
Good, K. S., K. O'Brien, G. Schulman, D. Kerjaschki and A. B. Fogo (2004). "Unexplained
nephrotic-range proteinuria in a 38-year-old man: a case of “no change disease”." American
journal of kidney diseases 43(5): 933-938.
Gödel M., B. Hartleben, N. Herbach, S. Liu, S. Zschiedrich, S. Lu, A. Debreczeni-Mór, M.T.
Lindenmeyer, M.P. Rastaldi, G. Hartleben, T. Wiech, A. Fornoni, R.G. Nelson, M. Kretzler, R.
Wanke, H. Pavenstädt, D. Kerjaschki, C.D. Cohen, M.N. Hall, M.A. Rüegg, K. Inoki, G. Walz,
T.B. Huber (2011). “Role of mTOR in podocyte function and diabetic nephropathy in humans
and mice.” Journal of Clinical Investigation 121(6): 2197–2209.
Gruden, G., G. Setti, A. Hayward, D. Sugden, S. Duggan, D. Burt, R. E. Buckingham, L. Gnudi
and G. Viberti (2005). "Mechanical stretch induces monocyte chemoattractant activity via an NF-
κB-dependent monocyte chemoattractant protein-1-mediated pathway in human mesangial cells:
inhibition by rosiglitazone." Journal of the American Society of Nephrology 16(3): 688-696.
Gu, H. F., J. Ma, K. T. Gu and K. Brismar (2013). "Association of intercellular adhesion
molecule 1 (ICAM1) with diabetes and diabetic nephropathy." Frontiers in endocrinology 3: 179.
Gu, L., S. Hagiwara, Q. Fan, M. Tanimoto, M. Kobata, M. Yamashita, T. Nishitani, T. Gohda, Z.
Ni and J. Qian (2005). "Role of receptor for advanced glycation end-products and signalling
events in advanced glycation end-product-induced monocyte chemoattractant protein-1
expression in differentiated mouse podocytes." Nephrology Dialysis Transplantation 21(2): 299-
313.
178
Guan, R., S. Purohit, H. Wang, B. Bode, J. C. Reed, R. D. Steed, S. W. Anderson, L. Steed, D.
Hopkins and C. Xia (2011). "Chemokine (CC motif) ligand 2 (CCL2) in sera of patients with
type 1 diabetes and diabetic complications." PLoS One 6(4): e17822.
Guh, J. Y., J. S. Huang, H. C. Chen, W. C. Hung, Y. H. Lai and L. Y. Chuang (2001). "Advanced
glycation end product-induced proliferation in NRK-49F cells is dependent on the JAK2/STAT5
pathway and cyclin D1." Am J Kidney Dis 38(5): 1096-1104.
Güssow D., R. Rein, I. Ginjaar, F. Hochstenbach, G. Seemann, A. Kottman, H.L. Ploegh (1987).
“The human beta 2-microglobulin gene. Primary structure and definition of the transcriptional
unit.” Journal of Immunology 139 (9) 3132-3138.
Ha, M., D. Ng, W.-H. Li and Z. J. Chen (2011). "Coordinated histone modifications are
associated with gene expression variation within and between species." Genome research
21(4):590-598.
Han, D. C., M. Isono, B. B. Hoffman and F. N. Ziyadeh (1999). "High glucose stimulates
proliferation and collagen type I synthesis in renal cortical fibroblasts: mediation by autocrine
activation of TGF-beta." J Am Soc Nephrol 10(9): 1891-1899.
Hanada, T. and A. Yoshimura (2002). "Regulation of cytokine signaling and inflammation."
Cytokine & growth factor reviews 13(4-5): 413-421.
Har, R., J. W. Scholey, D. Daneman, F. H. Mahmud, R. Dekker, V. Lai, Y. Elia, M. L. Fritzler,
E. B. Sochett, H. N. Reich and D. Z. Cherney (2013). "The effect of renal hyperfiltration on
urinary inflammatory cytokines/chemokines in patients with uncomplicated type 1 diabetes
mellitus." Diabetologia 56(5): 1166-1173.
179
Hara, M., T. Yamamoto, T. Yanagihara, T. Takada, M. Itoh, Y. Adachi, A. Yoshizumi, K.
Kawasaki and I. Kihara (1995). "Urinary excretion of podocalyxin indicates glomerular epithelial
cell injuries in glomerulonephritis." Nephron 69(4): 397-403.
Hara, M., T. Yanagihara, T. Takada, M. Itoh, M. Matsuno, T. Yamamoto and I. Kihara (1998).
"Urinary excretion of podocytes reflects disease activity in children with glomerulonephritis."
American journal of nephrology 18(1): 35-41.
Harpur, A., A. Andres, A. Ziemiecki, R. Aston and A. Wilks (1992). "JAK2, a third member of
the JAK family of protein tyrosine kinases." Oncogene 7(7): 1347-1353.
Hartleben, B., M. Gödel, C. Meyer-Schwesinger, S. Liu, T. Ulrich, S. Köbler, T. Wiech, F.
Grahammer, S. J. Arnold and M. T. Lindenmeyer (2010). "Autophagy influences glomerular
disease susceptibility and maintains podocyte homeostasis in aging mice." The Journal of clinical
investigation 120(4): 1084-1096.
Hartleben, B., N. Wanner and T. B. Huber (2014). "Autophagy in glomerular health and disease."
Seminars in nephrology, Elsevier 34(1):42-52.
Hartner, A., R. Veelken, M. Wittmann, N. Cordasic and K. F. Hilgers (2005). "Effects of diabetes
and hypertension on macrophage infiltration and matrix expansion in the rat kidney." BMC
nephrology 6(1): 6.
Hasegawa, G., K. Nakano, M. Sawada, K. Uno, Y. Shibayama, K. Ienaga and M. Kondo (1991).
"Possible role of tumor necrosis factor and interleukin-1 in the development of diabetic
nephropathy." Kidney international 40(6): 1007-1012.
Haseyama, T., T. Fujita, F. Hirasawa, M. Tsukada, H. Wakui, A. Komatsuda, H. Ohtani, A. B.
MIURA, H. Imai and A. Koizumi (2002). "Complications of IgA nephropathy in a non-insulin-
dependent diabetes model, the Akita mouse." The Tohoku journal of experimental medicine
198(4): 233-244.
180
Hathaway, C. K., A. M. Gasim, R. Grant, A. S. Chang, H.-S. Kim, V. J. Madden, C. R. Bagnell,
J. C. Jennette, O. Smithies and M. Kakoki (2015). "Low TGFβ1 expression prevents and high
expression exacerbates diabetic nephropathy in mice." Proceedings of the National Academy of
Sciences 112(18): 5815-5820.
Haynes, R., P. K. Judge, N. Staplin, W. G. Herrington, B. C. Storey, A. Bethel, L. Bowman, N.
Brunskill, P. Cockwell and M. Hill (2018). "Effects of Sacubitril/Valsartan Versus Irbesartan in
Patients With Chronic Kidney Disease: A Randomized Double-Blind Trial." Circulation 138(15):
1505-1514.
Hedvat, M., D. Huszar, A. Herrmann, J. M. Gozgit, A. Schroeder, A. Sheehy, R. Buettner, D.
Proia, C. M. Kowolik, H. Xin, B. Armstrong, G. Bebernitz, S. Weng, L. Wang, M. Ye, K.
McEachern, H. Chen, D. Morosini, K. Bell, M. Alimzhanov, S. Ioannidis, P. McCoon, Z. A. Cao,
H. Yu, R. Jove and M. Zinda (2009). "The JAK2 inhibitor AZD1480 potently blocks Stat3
signaling and oncogenesis in solid tumors." Cancer Cell 16(6): 487-497.
Heerspink, H. J. and D. De Zeeuw (2016). "Novel anti-inflammatory drugs for the treatment of
diabetic kidney disease." Diabetologia 59(8): 1621-1623.
Heier, J. S., D. M. Brown, V. Chong, J.-F. Korobelnik, P. K. Kaiser, Q. D. Nguyen, B. Kirchhof,
A. Ho, Y. Ogura and G. D. Yancopoulos (2012). "Intravitreal aflibercept (VEGF trap-eye) in wet
age-related macular degeneration." Ophthalmology 119(12): 2537-2548.
Heijmans, B. T., E. W. Tobi, A. D. Stein, H. Putter, G. J. Blauw, E. S. Susser, P. E. Slagboom
and L. Lumey (2008). "Persistent epigenetic differences associated with prenatal exposure to
famine in humans." Proceedings of the National Academy of Sciences 105(44): 17046-17049.
Heilig, C. W., L. A. Concepcion, B. L. Riser, S. O. Freytag, M. Zhu and P. Cortes (1995).
"Overexpression of glucose transporters in rat mesangial cells cultured in a normal glucose
milieu mimics the diabetic phenotype." The Journal of clinical investigation 96(4): 1802-1814.
181
Hill, N. R., S. T. Fatoba, J. L. Oke, J. A. Hirst, C. A. O’Callaghan, D. S. Lasserson and F. R.
Hobbs (2016). "Global prevalence of chronic kidney disease–a systematic review and meta-
analysis." PloS one 11(7): e0158765.
Hinchliffe, S., P. Sargent, C. Howard and Y. Chan (1991). "Human intrauterine renal growth
expressed in absolute number of glomeruli assessed by the disector method and Cavalieri
principle." Laboratory investigation; a journal of technical methods and pathology 64(6): 777-
784.
Hirata, K., K. Shikata, M. Matsuda, K. Akiyama, H. Sugimoto, M. Kushiro and H. Makino
(1998). "Increased expression of selectins in kidneys of patients with diabetic nephropathy."
Diabetologia 41(2): 185-192.
Hodgin, J. B., V. Nair, H. Zhang, A. Randolph, R. C. Harris, R. G. Nelson, E. J. Weil, J. D.
Cavalcoli, J. M. Patel, F. C. Brosius, 3rd and M. Kretzler (2013). "Identification of cross-species
shared transcriptional networks of diabetic nephropathy in human and mouse glomeruli."
Diabetes 62(1): 299-308.
Holderied, A., S. Romoli, J. Eberhard, L. A. Konrad, S. K. Devarapu, J. A. Marschner, S. Müller
and H.-J. Anders (2015). "Glomerular parietal epithelial cell activation induces collagen secretion
and thickening of Bowman’s capsule in diabetes." Laboratory investigation 95(3): 273.
Holman, R. R., S. K. Paul, M. A. Bethel, D. R. Matthews and H. A. W. Neil (2008). "10-year
follow-up of intensive glucose control in type 2 diabetes." New England Journal of Medicine
359(15): 1577-1589.
Hostetter, T., J. Olson, H. Rennke, M. Venkatachalam and B. Brenner (1981). "Hyperfiltration in
remnant nephrons: a potentially adverse response to renal ablation." American Journal of
Physiology-Renal Physiology 241(1): F85-F93.
182
Hostetter, T. H., J. L. Troy and B. M. Brenner (1981). "Glomerular hemodynamics in
experimental diabetes mellitus." Kidney international 19(3): 410-415.
Huan, C., M. L. Kelly, R. Steele, I. Shapira, S. R. Gottesman and C. A. Roman (2006).
"Transcription factors TFE3 and TFEB are critical for CD40 ligand expression and thymus-
dependent humoral immunity." Nature immunology 7(10): 1082-1091.
Huang, J. S., J. Y. Guh, H. C. Chen, W. C. Hung, Y. H. Lai and L. Y. Chuang (2001). "Role of
receptor for advanced glycation end-product (RAGE) and the JAK/STAT-signaling pathway in
AGE-induced collagen production in NRK-49F cells." J Cell Biochem 81(1): 102-113.
Huang, J. S., J. Y. Guh, W. C. Hung, M. L. Yang, Y. H. Lai, H. C. Chen and L. Y. Chuang
(1999). "Role of the Janus kinase (JAK)/signal transducters and activators of transcription
(STAT) cascade in advanced glycation end-product-induced cellular mitogenesis in NRK-49F
cells." Biochem J 342 ( Pt 1): 231-238.
Huang, W., Y. Gallois, N. Bouby, P. Bruneval, D. Heudes, M.-F. Belair, J. H. Krege, P.
Meneton, M. Marre and O. Smithies (2001). "Genetically increased angiotensin I-converting
enzyme level and renal complications in the diabetic mouse." Proceedings of the National
Academy of Sciences 98(23): 13330-13334.
Ina, K., H. Kitamura, T. Okeda, K. Nagai, Z. Y. Liu, M. Matsuda and Y. Fujikura (1999).
"Vascular cell adhesion molecule-1 expression in the renal interstitium of diabetic KKAy mice."
Diabetes Res Clin Pract 44(1): 1-8.
Inoki, K., H. Mori, J. Wang, T. Suzuki, S. Hong, S. Yoshida, S. M. Blattner, T. Ikenoue, M. A.
Rüegg and M. N. Hall (2011). "mTORC1 activation in podocytes is a critical step in the
development of diabetic nephropathy in mice." The Journal of clinical investigation 121(6):
2181-2196.
183
Isermann, B., I. A. Vinnikov, T. Madhusudhan, S. Herzog, M. Kashif, J. Blautzik, M. A. Corat,
M. Zeier, E. Blessing and J. Oh (2007). "Activated protein C protects against diabetic
nephropathy by inhibiting endothelial and podocyte apoptosis." Nature medicine 13(11): 1349-
1358.
Ishibashi, Y., T. Matsui and S. Yamagishi (2014). "Olmesartan blocks advanced glycation end
products-induced vcam-1 gene expression in mesangial cells by restoring Angiotensin-converting
enzyme 2 level." Horm Metab Res 46(6): 379-383.
Ismail-Beigi, F., T. E. Craven, P. J. O'connor, D. Karl, J. Calles-Escandon, I. Hramiak, S.
Genuth, W. C. Cushman, H. C. Gerstein and J. L. Probstfield (2012). "Combined intensive blood
pressure and glycemic control does not produce an additive benefit on microvascular outcomes in
type 2 diabetic patients." Kidney international 81(6): 586-594.
Ivankovic, D., K. Y. Chau, A. H. Schapira and M. E. Gegg (2016). "Mitochondrial and lysosomal
biogenesis are activated following PINK1/parkin‐mediated mitophagy." Journal of
neurochemistry 136(2): 388-402.
Iwamoto, M., S. Mizuiri, M. Arita and H. Hemmi (2005). "Nuclear factor-κB activation in
diabetic rat kidney: evidence for involvement of P-selectin in diabetic nephropathy." The Tohoku
journal of experimental medicine 206(2): 163-171.
Jager, K. J. and S. D. Fraser (2017). "The ascending rank of chronic kidney disease in the global
burden of disease study." Nephrology Dialysis Transplantation 32(suppl_2): ii121-ii128.
James, C., V. Ugo, J.-P. Le Couédic, J. Staerk, F. Delhommeau, C. Lacout, L. Garçon, H.
Raslova, R. Berger and A. Bennaceur-Griscelli (2005). "A unique clonal JAK2 mutation leading
to constitutive signalling causes polycythaemia vera." Nature 434(7037): 1144-1148.
184
Jeansson, M., A. Gawlik, G. Anderson, C. Li, D. Kerjaschki, M. Henkelman and S. E. Quaggin
(2011). "Angiopoietin-1 is essential in mouse vasculature during development and in response to
injury." The Journal of clinical investigation 121(6): 2278-2289.
Jopling, C., S. Boue and J. C. I. Belmonte (2011). "Dedifferentiation, transdifferentiation and
reprogramming: three routes to regeneration." Nature reviews Molecular cell biology 12(2): 79.
Kabeya, Y., N. Mizushima, T. Ueno, A. Yamamoto, T. Kirisako, T. Noda, E. Kominami, Y.
Ohsumi and T. Yoshimori (2000). "LC3, a mammalian homologue of yeast Apg8p, is localized in
autophagosome membranes after processing." The EMBO journal 19(21): 5720-5728.
Kaiser, N., S. Sasson, E. P. Feener, N. Boukobza-Vardi, S. Higashi, D. E. Moller, S. Davidheiser,
R. J. Przybylski and G. L. King (1993). "Differential regulation of glucose transport and
transporters by glucose in vascular endothelial and smooth muscle cells." Diabetes 42(1): 80-89.
Kakizaki, Y., S. Waga, K. Sugimoto, H. Tanaka, K. Nukii, M. Takeya, T. Yoshimura and M.
Yokoyama (1995). "Production of monocyte chemoattractant protein-1 by bovine glomerular
endothelial cells." Kidney international 48(6): 1866-1874.
Kanamori, H., T. Matsubara, A. Mima, E. Sumi, K. Nagai, T. Takahashi, H. Abe, N. Iehara, A.
Fukatsu and H. Okamoto (2007). "Inhibition of MCP-1/CCR2 pathway ameliorates the
development of diabetic nephropathy." Biochemical and biophysical research communications
360(4): 772-777.
Kanetsuna, Y., K. Takahashi, M. Nagata, M. A. Gannon, M. D. Breyer, R. C. Harris and T.
Takahashi (2007). "Deficiency of endothelial nitric-oxide synthase confers susceptibility to
diabetic nephropathy in nephropathy-resistant inbred mice." Am J Pathol 170(5): 1473-1484.
Kaplan, J. M., S. H. Kim, K. N. North, H. Rennke, L. A. Correia, H.-Q. Tong, B. J. Mathis, J.-C.
Rodríguez-Pérez, P. G. Allen and A. H. Beggs (2000). "Mutations in ACTN4, encoding α-
actinin-4, cause familial focal segmental glomerulosclerosis." Nature genetics 24(3): 251.
185
Kaplan, M. H. (2013). "STAT signaling in inflammation." JAK/STAT 2(1):e24198.
Kassebaum, N. J., M. Arora, R. M. Barber, Z. A. Bhutta, J. Brown, A. Carter, D. C. Casey, F. J.
Charlson, M. M. Coates and M. Coggeshall (2016). "Global, regional, and national disability-
adjusted life-years (DALYs) for 315 diseases and injuries and healthy life expectancy (HALE),
1990–2015: a systematic analysis for the Global Burden of Disease Study 2015." The Lancet
388(10053): 1603-1658.
Katsuya, K., E. Yaoita, Y. Yoshida, Y. Yamamoto and T. Yamamoto (2006). "An improved
method for primary culture of rat podocytes." Kidney Int 69(11): 2101-2106.
Kauffman, E. C., C. J. Ricketts, S. Rais-Bahrami, Y. Yang, M. J. Merino, D. P. Bottaro, R.
Srinivasan and W. M. Linehan (2014). "Molecular genetics and cellular features of TFE3 and
TFEB fusion kidney cancers." Nature Reviews Urology 11(8): 465-475.
Kawakami, T., I. G. Gomez, S. Ren, K. Hudkins, A. Roach, C. E. Alpers, S. J. Shankland, V. D.
D’Agati and J. S. Duffield (2015). "Deficient autophagy results in mitochondrial dysfunction and
FSGS." Journal of the American Society of Nephrology 26(5): 1040-1052.
Keating, S. and A. El‐Osta (2013). "Epigenetic changes in diabetes." Clinical genetics 84(1): 1-
10.
Keating, S. T., J. A. van Diepen, N. P. Riksen and A. El-Osta (2018). "Epigenetics in diabetic
nephropathy, immunity and metabolism." Diabetologia 61(1): 6-20.
Kelly, D. J., P. Aaltonen, A. J. Cox, J. R. Rumble, R. Langham, S. Panagiotopoulos, G. Jerums,
H. Holthofer and R. E. Gilbert (2002). "Expression of the slit-diaphragm protein, nephrin, in
experimental diabetic nephropathy: differing effects of anti-proteinuric therapies." Nephrol Dial
Transplant 17(7): 1327-1332.
186
Kelly, D. J., C. Hepper, L. L. Wu, A. J. Cox and R. E. Gilbert (2003). "Vascular endothelial
growth factor expression and glomerular endothelial cell loss in the remnant kidney model."
Nephrology Dialysis Transplantation 18(7): 1286-1292.
Kerjaschki, D. (2001). "Caught flat-footed: podocyte damage and the molecular bases of focal
glomerulosclerosis." The Journal of clinical investigation 108(11): 1583-1587.
Kestilä, M., U. Lenkkeri, M. Männikkö, J. Lamerdin, P. McCready, H. Putaala, V. Ruotsalainen,
T. Morita, M. Nissinen, R. Herva, C.E. Kashtan, L. C. Peltonen, Holmberg, A. Olsen, K.
Tryggvason (1998).“Positionally cloned gene for a novel glomerular protein- nephrin-is mutated
in congenital nephrotic syndrome.” Molecular Cell 1(4):575-82.
Ketteler, M., N. A. Noble and W. A. Border (1994). "Increased expression of transforming
growth factor-beta in renal disease." Current opinion in nephrology and hypertension 3(4): 446-
452.
Keystone, E., P. Taylor, M. Genovese, D. Schlichting, S. Beattie, C. Gaich, R. F. Gort, M. Luchi
and W. Macias (2013). "LB0005 12-week results of a phase 2B dose-ranging study of
LY3009104 (INCB028050), an oral JAK1/JAK2 inhibitor, in combination with traditional
dmards in patients with rheumatoid arthritis." Annals of the Rheumatic Diseases 71(Suppl 3):
152-153.
Keystone, E. C., P. C. Taylor, E. Drescher, D. E. Schlichting, S. D. Beattie, P.-Y. Berclaz, C. H.
Lee, R. K. Fidelus-Gort, M. E. Luchi and T. P. Rooney (2015). "Safety and efficacy of baricitinib
at 24 weeks in patients with rheumatoid arthritis who have had an inadequate response to
methotrexate." Annals of the rheumatic diseases 74(2): 333-340.
Khan, S. B., A. R. Allen, G. Bhangal, J. Smith, R. R. Lobb, H. T. Cook and C. D. Pusey (2003).
"Blocking VLA-4 prevents progression of experimental crescentic glomerulonephritis." Nephron
Experimental Nephrology 95(3): e100-e110.
187
Kikuchi, Y., S. Kobayashi, N. Hemmi, R. Ikee, N. Hyodo, T. Saigusa, T. Namikoshi, M.
Yamada, S. Suzuki and S. Miura (2004). "Galectin-3-positive cell infiltration in human diabetic
nephropathy." Nephrology Dialysis Transplantation 19(3): 602-607.
Kim, J., M. Kundu, B. Viollet and K.-L. Guan (2011). "AMPK and mTOR regulate autophagy
through direct phosphorylation of Ulk1." Nature cell biology 13(2): 132-141.
Kim, S. S., S. H. Song, I. J. Kim, J. Y. Yang, J. G. Lee, I. S. Kwak and Y. K. Kim (2012).
"Clinical implication of urinary tubular markers in the early stage of nephropathy with type 2
diabetic patients." Diabetes research and clinical practice 97(2): 251-257.
Kim M.K., K.J. Yun, H.J. Chun, E.H. Jang, K.D. Han, Y.M. Park, K.H. Baek, K.H. Song, B.Y.
Cha, C.S. Park, H.S. Kwon (2014). “Clinical utility of serum beta-2-microglobulin as a predictor
of diabetic complications in patients with type 2 diabetes without renal impairment.” Diabetes
and Metabolism 40(6):459-465.
Kimura, T., Y. Takabatake, A. Takahashi, J.-y. Kaimori, I. Matsui, T. Namba, H. Kitamura, F.
Niimura, T. Matsusaka and T. Soga (2011). "Autophagy protects the proximal tubule from
degeneration and acute ischemic injury." Journal of the American Society of Nephrology 22(5):
902-913.
Kitada, M., S. Kume, N. Imaizumi and D. Koya (2011). "Resveratrol improves oxidative stress
and protects against diabetic nephropathy through normalization of Mn-SOD dysfunction in
AMPK/SIRT1-independent pathway." Diabetes 60(2): 634-643.
Klintmalm, G. B. (2004). "The history of organ transplantation in the Baylor Health Care
System." Baylor University Medical Center Proceedings, Taylor & Francis 17(1):23-34.
Klionsky, D. J. (2005). "The molecular machinery of autophagy: unanswered questions." Journal
of cell science 118(1): 7-18.
188
Klionsky, D. J. (2008). "Autophagy revisited: a conversation with Christian de Duve."
Autophagy 4(6): 740-743.
Ko, Y.-A., D. Mohtat, M. Suzuki, A. S. D. Park, M. C. Izquierdo, S. Y. Han, H. M. Kang, H. Si,
T. Hostetter and J. M. Pullman (2013). "Cytosine methylation changes in enhancer regions of
core pro-fibrotic genes characterize kidney fibrosis development." Genome biology 14(10):
R108.
Kobayashi, N., S.-y. Gao, J. Chen, K. Saito, K. Miyawaki, C.-y. Li, L. Pan, S. Saito, T. Terashita
and S. Matsuda (2004). "Process formation of the renal glomerular podocyte: is there common
molecular machinery for processes of podocytes and neurons?" Anatomical science international
79(1): 1-10.
Kohan, D. E., P. Fioretto, W. Tang and J. F. List (2014). "Long-term study of patients with type 2
diabetes and moderate renal impairment shows that dapagliflozin reduces weight and blood
pressure but does not improve glycemic control." Kidney international 85(4): 962-971.
Kok, H. M., L. L. Falke, R. Goldschmeding and T. Q. Nguyen (2014). "Targeting CTGF, EGF
and PDGF pathways to prevent progression of kidney disease." Nature Reviews Nephrology
10(12): 700-711.
Kong, D.-H., Y. Kim, M. Kim, J. Jang and S. Lee (2018). "Emerging Roles of Vascular Cell
Adhesion Molecule-1 (VCAM-1) in Immunological Disorders and Cancer." International journal
of molecular sciences 19(4): 1057.
Kouzarides, T. (2007). "Chromatin modifications and their function." Cell 128(4): 693-705.
Kralovics, R., F. Passamonti, A. S. Buser, S. S. Teo, R. Tiedt, J. R. Passweg, A. Tichelli, M.
Cazzola and R. C. Skoda (2005). "A gain-of-function mutation of JAK2 in myeloproliferative
disorders." N Engl J Med 352(17): 1779-1790.
189
Kramer, H. J., Q. D. Nguyen, G. Curhan and C.-y. Hsu (2003). "Renal insufficiency in the
absence of albuminuria and retinopathy among adults with type 2 diabetes mellitus." Jama
289(24): 3273-3277.
Krempler, A., Y. Qi, A. A. Triplett, J. Zhu, H. Rui and K. U. Wagner (2004). "Generation of a
conditional knockout allele for the Janus kinase 2 (Jak2) gene in mice." Genesis 40(1): 52-57.
Kretzschmar, A. K., M. C. Dinger, C. Henze, K. Brocke-Heidrich and F. Horn (2004). "Analysis
of Stat3 (signal transducer and activator of transcription 3) dimerization by fluorescence
resonance energy transfer in living cells." Biochem J 377(Pt 2): 289-297.
Kriegel, M. A., C. Rathinam and R. A. Flavell (2012). "Pancreatic islet expression of chemokine
CCL2 suppresses autoimmune diabetes via tolerogenic CD11c+ CD11b+ dendritic cells."
Proceedings of the National Academy of Sciences 109(9): 3457-3462.
Kriz, W., N. Gretz and K. V. Lemley (1998). "Progression of glomerular diseases: is the
podocyte the culprit?" Kidney international 54(3): 687-697.
Kriz, W., N. Kobayashi and M. Elger (1998). "New aspects of podocyte structure, function, and
pathology." Clinical and Experimental Nephrology 2(2): 85-99.
Kriz, W. and K. V. Lemley (2015). "A potential role for mechanical forces in the detachment of
podocytes and the progression of CKD." Journal of the American Society of Nephrology 26(2):
258-269.
Krolewski, A. S., M. A. Niewczas, J. Skupien, T. Gohda, A. Smiles, J. H. Eckfeldt, A. Doria and
J. H. Warram (2014). "Early progressive renal decline precedes the onset of microalbuminuria
and its progression to macroalbuminuria." Diabetes care 37(1): 226-234.
Krumholz, H., K. Wang and Z. Lin (2017). "Correspondence Jun 08, 2017 Risk of Diabetic
Ketoacidosis after Initiation of an SGLT2 Inhibitor." N Engl J Med 376: 2300-2302.
190
Kume, S., M. C. Thomas and D. Koya (2012). "Nutrient sensing, autophagy, and diabetic
nephropathy." Diabetes 61(1): 23-29.
Kurdi, M. and G. W. Booz (2009). "JAK redux: a second look at the regulation and role of JAKs
in the heart." Am J Physiol Heart Circ Physiol 297(5): H1545-1556.
Kuwabara, A., M. Satoh, N. Tomita, T. Sasaki and N. Kashihara (2010). "Deterioration of
glomerular endothelial surface layer induced by oxidative stress is implicated in altered
permeability of macromolecules in Zucker fatty rats." Diabetologia 53(9): 2056-2065.
LaFave, L. M. and R. L. Levine (2012). "JAK2 the future: therapeutic strategies for JAK-
dependent malignancies." Trends in pharmacological sciences 33(11): 574-582.
Lal, M. A. and J. Patrakka (2018). "Understanding podocyte biology to develop novel kidney
therapeutics." Frontiers in endocrinology 9, 409.
Langham, R. G., D. J. Kelly, A. J. Cox, N. M. Thomson, H. Holthofer, P. Zaoui, N. Pinel, D. J.
Cordonnier and R. E. Gilbert (2002). "Proteinuria and the expression of the podocyte slit
diaphragm protein, nephrin, in diabetic nephropathy: effects of angiotensin converting enzyme
inhibition." Diabetologia 45(11): 1572-1576.
Lapierre, L. R., C. Kumsta, M. Sandri, A. Ballabio and M. Hansen (2015). "Transcriptional and
epigenetic regulation of autophagy in aging." Autophagy 11(6): 867-880.
Lawrence, M., S. Daujat and R. Schneider (2016). "Lateral thinking: how histone modifications
regulate gene expression." Trends in Genetics 32(1): 42-56.
Lee, E. Y., C. H. Chung, C. C. Khoury, T. K. Yeo, P. E. Pyagay, A. Wang and S. Chen (2009).
"The monocyte chemoattractant protein-1/CCR2 loop, inducible by TGF-beta, increases
podocyte motility and albumin permeability." Am J Physiol Renal Physiol 297(1): F85-94.
191
Lee, E. Y., C. H. Chung, C. C. Khoury, T. K. Yeo, P. E. Pyagay, A. Wang and S. Chen (2009).
"The monocyte chemoattractant protein-1/CCR2 loop, inducible by TGF-β, increases podocyte
motility and albumin permeability." American Journal of Physiology-Renal Physiology 297(1):
F85-F94.
Lee, S. K. (2018). "Sex as an important biological variable in biomedical research." BMB reports
51(4): 167-173.
Lee, V. W. and D. C. Harris (2011). "Adriamycin nephropathy: a model of focal segmental
glomerulosclerosis." Nephrology 16(1): 30-38.
Leehey, D. J., A. K. Singh, N. Alavi and R. Singh (2000). "Role of angiotensin II in diabetic
nephropathy." Kidney International 58: S93-S98.
Lemley, K. V., R. A. Lafayette, M. Safai, G. Derby, K. Blouch, A. Squarer and B. D. Myers
(2002). "Podocytopenia and disease severity in IgA nephropathy." Kidney international 61(4):
1475-1485.
Lenoir, O., M. Jasiek, C. Hénique, L. Guyonnet, B. Hartleben, T. Bork, A. Chipont, K. Flosseau,
I. Bensaada and A. Schmitt (2015). "Endothelial cell and podocyte autophagy synergistically
protect from diabetes-induced glomerulosclerosis." Autophagy 11(7): 1130-1145.
Lenoir, O., M. Milon, A. Virsolvy, C. Hénique, A. Schmitt, J.-M. Massé, Y. Kotelevtsev, M.
Yanagisawa, D. J. Webb and S. Richard (2014). "Direct action of endothelin-1 on podocytes
promotes diabetic glomerulosclerosis." Journal of the American Society of Nephrology 25(5):
1050-1062.
Letavernier, E., P. Bruneval, C. Mandet, J.P. Duong Van Huyen, M.N. Péraldi, I. Helal, L.H.
Noël, and C. Legendre (2007). “High sirolimus levels may induce focal segmental
glomerulosclerosis de novo.” Clinical Journal of American Society of Nephrology 2(2) 326-333.
192
Leveen, P., M. Pekny, S. Gebre-Medhin, B. Swolin, E. Larsson and C. Betsholtz (1994). "Mice
deficient for PDGF B show renal, cardiovascular, and hematological abnormalities." Genes &
development 8(16): 1875-1887.
Levin, A., M. Tonelli, J. Bonventre, J. Coresh, J.-A. Donner, A. B. Fogo, C. S. Fox, R. T.
Gansevoort, H. J. Heerspink and M. Jardine (2017). "Global kidney health 2017 and beyond: a
roadmap for closing gaps in care, research, and policy." The Lancet 390(10105):1888-1917.
Lewin, B. (1998). "The mystique of epigenetics." Cell 93(3): 301-303.
Lewis, E. J., L. G. Hunsicker, R. P. Bain and R. D. Rohde (1993). "The effect of angiotensin-
converting-enzyme inhibition on diabetic nephropathy. The Collaborative Study Group." N Engl
J Med 329(20): 1456-1462.
Lewis, E. J., L. G. Hunsicker, W. R. Clarke, T. Berl, M. A. Pohl, J. B. Lewis, E. Ritz, R. C.
Atkins, R. Rohde and I. Raz (2001). "Renoprotective effect of the angiotensin-receptor antagonist
irbesartan in patients with nephropathy due to type 2 diabetes." N Engl J Med 345(12): 851-860.
Li, Y., Y. S. Kang, C. Dai, L. P. Kiss, X. Wen and Y. Liu (2008). "Epithelial-to-mesenchymal
transition is a potential pathway leading to podocyte dysfunction and proteinuria." The American
journal of pathology 172(2): 299-308.
Liao, J. K. (2013). "Linking endothelial dysfunction with endothelial cell activation." J Clin
Invest 123(2): 540-541.
Lim, C. P., T. T. Phan, I. J. Lim and X. Cao (2009). "Cytokine profiling and Stat3
phosphorylation in epithelial-mesenchymal interactions between keloid keratinocytes and
fibroblasts." J Invest Dermatol 129(4): 851-861.
Lim, W., J. Eris, J. Kanellis, B. Pussell, Z. Wiid, D. Witcombe and G. Russ (2014). "A
systematic review of conversion from calcineurin inhibitor to mammalian target of rapamycin
193
inhibitors for maintenance immunosuppression in kidney transplant recipients." American
Journal of Transplantation 14(9): 2106-2119.
Liu, E., M. Morimoto, S. Kitajima, T. Koike, Y. Yu, H. Shiiki, M. Nagata, T. Watanabe and J.
Fan (2007). "Increased expression of vascular endothelial growth factor in kidney leads to
progressive impairment of glomerular functions." Journal of the American Society of Nephrology
18(7): 2094-2104.
Liu, J. J., L. Y. Yeoh, C. F. Sum, S. Tavintharan, X. W. Ng, S. Liu, S. B. Lee, W. E. Tang, S. C.
Lim and S. D. study (2015). "Vascular cell adhesion molecule-1, but not intercellular adhesion
molecule-1, is associated with diabetic kidney disease in Asians with type 2 diabetes." J Diabetes
Complications 29(5): 707-712.
Liu, N., L. Xu, Y. Shi and S. Zhuang (2017). "Podocyte autophagy: a potential therapeutic target
to prevent the progression of diabetic nephropathy." Journal of diabetes research 2017, ID
3560238, 6 pages.
Liu, W. J., T. T. Shen, R. H. Chen, H.-L. Wu, Y. J. Wang, J. K. Deng, Q. H. Chen, Q. Pan, C. H.
Fu and J.-l. Tao (2015). "Autophagy-lysosome pathway in renal tubular epithelial cells is
disrupted by advanced glycation end products in diabetic nephropathy." Journal of Biological
Chemistry 290(33):20499-2510.
Liyanage, T., T. Ninomiya, V. Jha, B. Neal, H. M. Patrice, I. Okpechi, M.-h. Zhao, J. Lv, A. X.
Garg and J. Knight (2015). "Worldwide access to treatment for end-stage kidney disease: a
systematic review." The Lancet 385(9981): 1975-1982.
Lloberas, N., J. M. Cruzado, M. Franquesa, I. Herrero-Fresneda, J. Torras, G. Alperovich, I.
Rama, A. Vidal and J. M. Grinyó (2006). "Mammalian target of rapamycin pathway blockade
slows progression of diabetic kidney disease in rats." Journal of the American Society of
Nephrology 17(5): 1395-1404.
194
Lo, W. S., R. C. Trievel, J. R. Rojas, L. Duggan, J. Y. Hsu, C. D. Allis, R. Marmorstein and S. L.
Berger (2000). "Phosphorylation of serine 10 in histone H3 is functionally linked in vitro and in
vivo to Gcn5-mediated acetylation at lysine 14." Mol Cell 5(6): 917-926.
Logar, C. M., P. T. Brinkkoetter, R. D. Krofft, J. W. Pippin and S. J. Shankland (2007).
"Darbepoetin alfa protects podocytes from apoptosis in vitro and in vivo." Kidney Int 72(4): 489-
498.
Lu, X., Q. Fan, L. Xu, L. Li, Y. Yue, Y. Xu, Y. Su, D. Zhang and L. Wang (2015). "Ursolic acid
attenuates diabetic mesangial cell injury through the up-regulation of autophagy via miRNA-
21/PTEN/Akt/mTOR suppression." PLoS One 10(2): e0117400.
Maclaren, N. K., M. Neufeld, J. V. McLaughlin and G. Taylor (1980). "Androgen sensitization of
streptozotocin-induced diabetes in mice." Diabetes 29(9): 710-716.
Maile, L. A., W. H. Busby, K. A. Gollahon, W. Flowers, N. Garbacik, S. Garbacik, K. Stewart,
T. Nichols, D. Bellinger and A. Patel (2014). "Blocking ligand occupancy of the αVβ3 integrin
inhibits the development of nephropathy in diabetic pigs." Endocrinology 155(12): 4665-4675.
Maisonpierre, P. C., C. Suri, P. F. Jones, S. Bartunkova, S. J. Wiegand, C. Radziejewski, D.
Compton, J. McClain, T. H. Aldrich and N. Papadopoulos (1997). "Angiopoietin-2, a natural
antagonist for Tie2 that disrupts in vivo angiogenesis." Science 277(5322): 55-60.
Majumder, S. and A. Advani (2017). "VEGF and the diabetic kidney: More than too much of a
good thing." Journal of diabetes and its complications 31(1): 273-279.
Majumder, S., K. Thieme, S. N. Batchu, T. A. Alghamdi, B. B. Bowskill, M. G. Kabir, Y. Liu, S.
L. Advani, K. E. White and L. Geldenhuys (2018). "Shifts in podocyte histone H3K27me3
regulate mouse and human glomerular disease." The Journal of clinical investigation 128(1): 483-
499.
195
Majumder, S., K. Thieme, S. N. Batchu, T. A. Alghamdi, B. B. Bowskill, M. G. Kabir, Y. Liu, S.
L. Advani, K. E. White, L. Geldenhuys, K. K. Tennankore, P. Poyah, F. S. Siddiqi and A. Advani
(2018). "Shifts in podocyte histone H3K27me3 regulate mouse and human glomerular disease." J
Clin Invest 128(1): 483-499.
Mallipattu, S. K. and J. C. He (2016). "The podocyte as a direct target for treatment of glomerular
disease?" American Journal of Physiology-Renal Physiology 311(1): F46-F51.
Mann, J. F., D. Green, K. Jamerson, L. M. Ruilope, S. J. Kuranoff, T. Littke, G. Viberti and A. S.
Group (2010). "Avosentan for overt diabetic nephropathy." Journal of the American Society of
Nephrology 21(3): 527-535.
Mansueto, G., A. Armani, C. Viscomi, L. D’Orsi, R. De Cegli, E. V. Polishchuk, C. Lamperti, I.
Di Meo, V. Romanello and S. Marchet (2017). "Transcription factor EB controls metabolic
flexibility during exercise." Cell metabolism 25(1): 182-196.
Marrero, M. B., A. K. Banes-Berceli, D. M. Stern and D. C. Eaton (2006). "Role of the
JAK/STAT signaling pathway in diabetic nephropathy." Am J Physiol Renal Physiol 290(4):
F762-768.
Marrero, M. B., B. Schieffer, W. G. Paxton, L. Heerdt, B. C. Berk, P. Delafontaine and K. E.
Bernstein (1995). "Direct stimulation of Jak/STAT pathway by the angiotensin II AT1 receptor."
Nature 375(6528): 247-250.
Martina, J. A., Y. Chen, M. Gucek and R. Puertollano (2012). "MTORC1 functions as a
transcriptional regulator of autophagy by preventing nuclear transport of TFEB." Autophagy
8(6): 903-914.
Martini-Stoica, H., Y. Xu, A. Ballabio and H. Zheng (2016). "The autophagy–lysosomal pathway
in neurodegeneration: a TFEB perspective." Trends in neurosciences 39(4): 221-234.
196
Massague, J. (1990). "The transforming growth factor-beta family." Annual review of cell
biology 6(1): 597-641.
Mather, A. and C. Pollock (2011). "Glucose handling by the kidney." Kidney international 79:
S1-S6.
Matsukawa, A., C. M. Hogaboam, N. W. Lukacs, P. M. Lincoln, R. M. Strieter and S. L. Kunkel
(1999). "Endogenous monocyte chemoattractant protein-1 (MCP-1) protects mice in a model of
acute septic peritonitis: cross-talk between MCP-1 and leukotriene B4." The Journal of
Immunology 163(11): 6148-6154.
May, C. J., M. Saleem and G. I. Welsh (2014). "Podocyte dedifferentiation: a specialized process
for a specialized cell." Frontiers in endocrinology 5: 148.
Medina, D. L., S. Di Paola, I. Peluso, A. Armani, D. De Stefani, R. Venditti, S. Montefusco, A.
Scotto-Rosato, C. Prezioso and A. Forrester (2015). "Lysosomal calcium signalling regulates
autophagy through calcineurin and TFEB." Nature cell biology 17(3): 288-299.
Medina, D. L., A. Fraldi, V. Bouche, F. Annunziata, G. Mansueto, C. Spampanato, C. Puri, A.
Pignata, J. A. Martina and M. Sardiello (2011). "Transcriptional activation of lysosomal
exocytosis promotes cellular clearance." Developmental cell 21(3): 421-430.
Medzhitov, R. (2008). "Origin and physiological roles of inflammation." Nature 454(7203): 428.
Menne, J., D. Eulberg, D. Beyer, M. Baumann, F. Saudek, Z. Valkusz, A. Więcek, H. Haller and
E. S. Group (2016). "CC motif-ligand 2 inhibition with emapticap pegol (NOX-E36) in type 2
diabetic patients with albuminuria." Nephrology Dialysis Transplantation 32(2): 307-315.
Menon, M. C., P. Y. Chuang and C. J. He (2012). "The glomerular filtration barrier: components
and crosstalk." International journal of nephrology 2012, ID749010, 9 pages.
197
Mezzano, S., C. Aros, A. Droguett, M. E. Burgos, L. Ardiles, C. Flores, H. Schneider, M. Ruiz-
Ortega and J. Egido (2004). "NF-κB activation and overexpression of regulated genes in human
diabetic nephropathy." Nephrology Dialysis Transplantation 19(10): 2505-2512.
Mills, K. T., Y. Xu, W. Zhang, J. D. Bundy, C.-S. Chen, T. N. Kelly, J. Chen and J. He (2015).
"A systematic analysis of worldwide population-based data on the global burden of chronic
kidney disease in 2010." Kidney international 88(5): 950-957.
Miner, J. H. (2012). "The glomerular basement membrane." Experimental cell research 318(9):
973-978.
Mirzadegan, T., F. Diehl, B. Ebi, S. Bhakta, I. Polsky, D. McCarley, M. Mulkins, G. S.
Weatherhead, J. M. Lapierre, J. Dankwardt, D. Morgans, Jr., R. Wilhelm and K. Jarnagin (2000).
"Identification of the binding site for a novel class of CCR2b chemokine receptor antagonists:
binding to a common chemokine receptor motif within the helical bundle." J Biol Chem 275(33):
25562-25571.
Mizushima, N. and M. Komatsu (2011). "Autophagy: renovation of cells and tissues." Cell
147(4): 728-741.
Mizushima, N., A. Yamamoto, M. Matsui, T. Yoshimori and Y. Ohsumi (2004). "In vivo analysis
of autophagy in response to nutrient starvation using transgenic mice expressing a fluorescent
autophagosome marker." Molecular biology of the cell 15(3): 1101-1111.
Moeller, M. J., S. K. Sanden, A. Soofi, R. C. Wiggins and L. B. Holzman (2003). "Podocyte-
specific expression of cre recombinase in transgenic mice." Genesis 35(1): 39-42.
Mogensen, C., C. Christensen and E. Vittinghus (1983). "The stages in diabetic renal disease:
with emphasis on the stage of incipient diabetic nephropathy." Diabetes 32(Supplement 2): 64-
78.
198
Mohan, S., R. L. Reddick, N. Musi, D. A. Horn, B. Yan, T. J. Prihoda, M. Natarajan and S. L.
Abboud-Werner (2008). "Diabetic eNOS knockout mice develop distinct macro-and
microvascular complications." Laboratory Investigation 88(5): 515-528.
Moran, N. (2012). "Incyte comes of age with JAK inhibitor approval." Nat Biotechnol 30(1): 3-5.
Morii, T., H. Fujita, T. Narita, J. Koshimura, T. Shimotomai, H. Fujishima, N. Yoshioka, H.
Imai, M. Kakei and S. Ito (2003). "Increased urinary excretion of monocyte chemoattractant
protein-1 in proteinuric renal diseases." Renal failure 25(3): 439-444.
Mundel, P. and W. Kriz (1995). "Structure and function of podocytes: an update." Anatomy and
embryology 192(5): 385-397.
Mundel, P. and S. J. Shankland (2002). "Podocyte biology and response to injury." Journal of the
American Society of Nephrology 13(12): 3005-3015.
Munivenkatappa, R., A. Haririan, J.C. Papadimitriou, C.B. Drachenberg, M. Dinits-Pensy, D.K.
Klassen (2010). “Tubular epithelial cell and podocyte apoptosis with de novo sirolimus based
immunosuppression in renal allograft recipients with DGF.” Histology and Histopathology
25(2):189-96.
Naghavi, M., A. A. Abajobir, C. Abbafati, K. M. Abbas, F. Abd-Allah, S. F. Abera, V. Aboyans,
O. Adetokunboh, A. Afshin and A. Agrawal (2017). "Global, regional, and national age-sex
specific mortality for 264 causes of death, 1980–2016: a systematic analysis for the Global
Burden of Disease Study 2016." The Lancet 390(10100): 1151-1210.
Nahman, N. S., Jr., K. L. Leonhart, F. G. Cosio and C. L. Hebert (1992). "Effects of high glucose
on cellular proliferation and fibronectin production by cultured human mesangial cells." Kidney
Int 41(2): 396-402.
199
Nakagawa, T. (2007). "Uncoupling of the VEGF-endothelial nitric oxide axis in diabetic
nephropathy: an explanation for the paradoxical effects of VEGF in renal disease." American
Journal of Physiology-Renal Physiology 292(6): F1665-F1672.
Nakajima, H., H. Sano, T. Nishimura, S. Yoshida and I. Iwamoto (1994). "Role of vascular cell
adhesion molecule 1/very late activation antigen 4 and intercellular adhesion molecule
1/lymphocyte function-associated antigen 1 interactions in antigen-induced eosinophil and T cell
recruitment into the tissue." Journal of Experimental Medicine 179(4): 1145-1154.
Nakamura, T., C. Ushiyama, S. Suzuki, M. Hara, N. Shimada, I. Ebihara and H. Koide (2000).
"Urinary excretion of podocytes in patients with diabetic nephropathy." Nephrology Dialysis
Transplantation 15(9): 1379-1383.
Nakamura, T., C. Ushiyama, S. Suzuki, M. Hara, N. Shimada, K. Sekizuka, I. Ebihara and H.
Koide (2000). "Effects of angiotensin-converting enzyme inhibitor, angiotensin II receptor
antagonist and calcium antagonist on urinary podocytes in patients with IgA nephropathy."
American journal of nephrology 20(5): 373-379.
Nakamura, T., C. Ushiyama, S. Suzuki, M. Hara, N. Shimada, K. Sekizuka, I. Ebihara and H.
Koide (2000). "Urinary podocytes for the assessment of disease activity in lupus nephritis." The
American journal of the medical sciences 320(2): 112-116.
Nam, B. Y., J. Paeng, S. H. Kim, S. H. Lee, D. H. Kim, H.-Y. Kang, J. J. Li, S.-J. Kwak, J. T.
Park and T.-H. Yoo (2012). "The MCP-1/CCR2 axis in podocytes is involved in apoptosis
induced by diabetic conditions." Apoptosis 17(1): 1-13.
Naqvi, S., A. Macdonald, C. E. McCoy, J. Darragh, A. D. Reith and J. S. Arthur (2012).
"Characterization of the cellular action of the MSK inhibitor SB-747651A." Biochem J 441(1):
347-357.
200
Navarro-Gonzalez, J. F. and C. Mora-Fernández (2008). "The role of inflammatory cytokines in
diabetic nephropathy." Journal of the American Society of Nephrology 19(3): 433-442.
Navarro-Gonzalez, J. F., C. Mora-Fernandez, M. Muros de Fuentes and J. Garcia-Perez (2011).
"Inflammatory molecules and pathways in the pathogenesis of diabetic nephropathy." Nat Rev
Nephrol 7(6): 327-340.
Neal, B., V. Perkovic, K. W. Mahaffey, D. De Zeeuw, G. Fulcher, N. Erondu, W. Shaw, G. Law,
M. Desai and D. R. Matthews (2017). "Canagliflozin and cardiovascular and renal events in type
2 diabetes." New England Journal of Medicine 377(7): 644-657.
Nechemia-Arbely, Y., D. Barkan, G. Pizov, A. Shriki, S. Rose-John, E. Galun and J. H. Axelrod
(2008). "IL-6/IL-6R axis plays a critical role in acute kidney injury." Journal of the American
Society of Nephrology 19(6): 1106-1115.
Nelson, C. L., C. S. Karschimkus, G. Dragicevic, D. K. Packham, A. M. Wilson, D. O'neal, G. J.
Becker, J. D. Best and A. J. Jenkins (2005). "Systemic and vascular inflammation is elevated in
early IgA and type 1 diabetic nephropathies and relates to vascular disease risk factors and renal
function." Nephrology Dialysis Transplantation 20(11): 2420-2426.
Neubauer, H., A. Cumano, M. Muller, H. Wu, U. Huffstadt and K. Pfeffer (1998). "Jak2
deficiency defines an essential developmental checkpoint in definitive hematopoiesis." Cell
93(3): 397-409.
Nieuwdorp, M., H. L. Mooij, J. Kroon, B. Atasever, J. A. Spaan, C. Ince, F. Holleman, M.
Diamant, R. J. Heine and J. B. Hoekstra (2006). "Endothelial glycocalyx damage coincides with
microalbuminuria in type 1 diabetes." Diabetes 55(4): 1127-1132.
Niilo-Pekka Huttunen. (1976). “Congenital nephrotic syndrome of Finnish type. Study of 75
patients.” Archives of Disease in Childhood 51(5):344-348.
201
Nissen, N. N., P. Polverini, A. E. Koch, M. V. Volin, R. L. Gamelli and L. A. DiPietro (1998).
"Vascular endothelial growth factor mediates angiogenic activity during the proliferative phase of
wound healing." The American journal of pathology 152(6): 1445-1452.
Ninichuk V., S. Clauss, O. Kulkarni, H. Schmid, S. Segerer, E. Radomska, D. Eulberg, K.
Buchner, N. Selve, S. Klussmann, H.J. Anders (2008). “Late onset of Ccl2 blockade with the
Spiegelmer mNOX-E36-3'PEG prevents glomerulosclerosis and improves glomerular filtration
rate in db/db mice.” The American Journal of Pathology 172(3): 628-637.
Nooteboom, A., T. Hendriks, I. Ottehöller and C. Van Der Linden (2000). "Permeability
characteristics of human endothelial monolayers seeded on different extracellular matrix
proteins." Mediators of inflammation 9(5): 235-241.
O'shea, J. J. and R. Plenge (2012). "JAK and STAT signaling molecules in immunoregulation
and immune-mediated disease." Immunity 36(4): 542-550.
O'Sullivan, L. A., C. Liongue, R. S. Lewis, S. E. Stephenson and A. C. Ward (2007). "Cytokine
receptor signaling through the Jak-Stat-Socs pathway in disease." Mol Immunol 44(10): 2497-
2506.
Ogurtsova, K., J. da Rocha Fernandes, Y. Huang, U. Linnenkamp, L. Guariguata, N. Cho, D.
Cavan, J. Shaw and L. Makaroff (2017). "IDF Diabetes Atlas: Global estimates for the
prevalence of diabetes for 2015 and 2040." Diabetes research and clinical practice 128: 40-50.
Olsen, A. S., M. P. Sarras, A. Leontovich and R. V. Intine (2012). "Heritable transmission of
diabetic metabolic memory in zebrafish correlates with DNA hypomethylation and aberrant gene
expression." Diabetes 61(2): 485–491.
Ono, H., T. Ichiki, H. Ohtsubo, K. Fukuyama, I. Imayama, N. Iino, S. Masuda, Y. Hashiguchi, A.
Takeshita and K. Sunagawa (2006). "CAMP-response element-binding protein mediates tumor
202
necrosis factor-alpha-induced vascular cell adhesion molecule-1 expression in endothelial cells."
Hypertens Res 29(1): 39-47.
Ortiz-Munoz, G., V. Lopez-Parra, O. Lopez-Franco, P. Fernandez-Vizarra, B. Mallavia, C.
Flores, A. Sanz, J. Blanco, S. Mezzano, A. Ortiz, J. Egido and C. Gomez-Guerrero (2010).
"Suppressors of cytokine signaling abrogate diabetic nephropathy." J Am Soc Nephrol 21(5):
763-772.
Oshima, Y., K. Kinouchi, A. Ichihara, M. Sakoda, A. Kurauchi-Mito, K. Bokuda, T. Narita, H.
Kurosawa, G. H. Sun-Wada, Y. Wada, T. Yamada, M. Takemoto, M. A. Saleem, S. E. Quaggin
and H. Itoh (2011). "Prorenin receptor is essential for normal podocyte structure and function." J
Am Soc Nephrol 22(12): 2203-2212.
Pagtalunan, M. E., P. L. Miller, S. Jumping-Eagle, R. G. Nelson, B. D. Myers, H. G. Rennke, N.
S. Coplon, L. Sun and T. W. Meyer (1997). "Podocyte loss and progressive glomerular injury in
type II diabetes." The Journal of clinical investigation 99(2): 342-348.
Palm, M., A. Lundblad (2005). “Creatinine concentration in plasma from dog, rat, and mouse: a
comparison of 3 different methods.” Veterinary Clinical Pathology 34(3): 232-236.
Palmieri, M., S. Impey, H. Kang, A. di Ronza, C. Pelz, M. Sardiello and A. Ballabio (2011).
"Characterization of the CLEAR network reveals an integrated control of cellular clearance
pathways." Hum Mol Genet 20(19): 3852-3866.
Palmieri, M., S. Impey, H. Kang, A. di Ronza, C. Pelz, M. Sardiello and A. Ballabio (2011).
"Characterization of the CLEAR network reveals an integrated control of cellular clearance
pathways." Human molecular genetics 20(19): 3852-3866.
Pang, M., L. Ma, R. Gong, E. Tolbert, H. Mao, M. Ponnusamy, Y. E. Chin, H. Yan, L. D.
Dworkin and S. Zhuang (2010). "A novel STAT3 inhibitor, S3I-201, attenuates renal interstitial
203
fibroblast activation and interstitial fibrosis in obstructive nephropathy." Kidney Int 78(3): 257-
268.
Pannu, N. (2013). "Bidirectional relationships between acute kidney injury and chronic kidney
disease." Current opinion in nephrology and hypertension 22(3): 351-356.
Panzer, U., O. M. Steinmetz, R. A. Stahl and G. Wolf (2006). "Kidney diseases and chemokines."
Current drug targets 7(1): 65-80.
Parganas, E., D. Wang, D. Stravopodis, D. J. Topham, J. C. Marine, S. Teglund, E. F. Vanin, S.
Bodner, O. R. Colamonici, J. M. van Deursen, G. Grosveld and J. N. Ihle (1998). "Jak2 is
essential for signaling through a variety of cytokine receptors." Cell 93(3): 385-395.
Parving, H.-H., B. M. Brenner, J. J. McMurray, D. de Zeeuw, S. M. Haffner, S. D. Solomon, N.
Chaturvedi, F. Persson, A. S. Desai and M. Nicolaides (2012). "Cardiorenal end points in a trial
of aliskiren for type 2 diabetes." New England Journal of Medicine 367(23): 2204-2213.
Pavenstadt, H., W. Kriz and M. Kretzler (2003). "Cell biology of the glomerular podocyte."
Physiological reviews 83(1): 253-307.
Peña‐Llopis, S., S. Vega‐Rubin‐de‐Celis, J. C. Schwartz, N. C. Wolff, T. A. T. Tran, L. Zou, X.
J. Xie, D. R. Corey and J. Brugarolas (2011). "Regulation of TFEB and V‐ATPases by
mTORC1." The EMBO journal 30(16): 3242-3258.
Pergola, P. E., P. Raskin, R. D. Toto, C. J. Meyer, J. W. Huff, E. B. Grossman, M. Krauth, S.
Ruiz, P. Audhya, H. Christ-Schmidt, J. Wittes and D. G. Warnock (2011). "Bardoxolone methyl
and kidney function in CKD with type 2 diabetes." N Engl J Med 365(4): 327-336.
Perico, N., L. Antiga, A. Caroli, P. Ruggenenti, G. Fasolini, M. Cafaro, P. Ondei, N. Rubis, O.
Diadei and G. Gherardi (2010). "Sirolimus therapy to halt the progression of ADPKD." Journal
of the American Society of Nephrology 21(6): 1031–1040.
204
Periyasamy-Thandavan, S., M. Jiang, Q. Wei, R. Smith, X.-M. Yin and Z. Dong (2008).
"Autophagy is cytoprotective during cisplatin injury of renal proximal tubular cells." Kidney
international 74(5): 631-640.
Perkins, B. A., L. H. Ficociello, K. H. Silva, D. M. Finkelstein, J. H. Warram and A. S.
Krolewski (2003). "Regression of microalbuminuria in type 1 diabetes." New England Journal of
Medicine 348(23): 2285-2293.
Persson, F. and P. Rossing (2018). "Diagnosis of diabetic kidney disease: state of the art and
future perspective." Kidney International Supplements 8(1): 2-7.
Peterson, P.A., P.E. Evrin, I. Berggård. (1969). “Differentiation of glomerular, tubular, and
normal proteinuria: determinations of urinary excretion of β2-microglobulin, albumin, and total
protein.” Journal of Clinical Investigation 48(7):1189-1198.
Pfeffer, M. A., E. A. Burdmann, C.-Y. Chen, M. E. Cooper, D. De Zeeuw, K.-U. Eckardt, J. M.
Feyzi, P. Ivanovich, R. Kewalramani and A. S. Levey (2009). "A trial of darbepoetin alfa in type
2 diabetes and chronic kidney disease." New England Journal of Medicine 361(21): 2019-2032.
Pober, J. S. (2002). "Endothelial activation: intracellular signaling pathways." Arthritis Research
& Therapy 4(3): S109- S116.
Pollak, M. R. (2002). "Inherited podocytopathies: FSGS and nephrotic syndrome from a genetic
viewpoint." Journal of the American Society of Nephrology 13(12): 3016-3023.
Portela, A. and M. Esteller (2010). "Epigenetic modifications and human disease." Nature
biotechnology 28(10): 1057-1068.
205
Power, C. A., A. Meyer, K. Nemeth, K. B. Bacon, A. J. Hoogewerf, A. E. Proudfoot and T. N.
Wells (1995). "Molecular cloning and functional expression of a novel CC chemokine receptor
cDNA from a human basophilic cell line." J Biol Chem 270(33): 19495-19500.
Pries, A., T. Secomb and P. Gaehtgens (2000). "The endothelial surface layer." Pflügers Archiv
440(5): 653-666.
Prodjosudjadi, W., J. Gerritsma, M. Daha and J. Bruijn (1995). "Monocyte chemoattractant
protein-1 in normal and diseased human kidneys: an immunohistochemical analysis." Clinical
nephrology 44(3): 148-155.
Puleston, D., K. Phadwal, A. S. Watson, E. J. Soilleux, S. Chittaranjan, S. Bortnik, S. M. Gorski,
N. Ktistakis and A. K. Simon (2015). "Techniques for the detection of autophagy in primary
mammalian cells." Cold Spring Harbor Protocols 2015(9): pdb. top070391.
Quaggin, S. E. and J. A. Kreidberg (2008). "Development of the renal glomerulus: good
neighbors and good fences." Development 135(4): 609-620.
Rahmoune, H., P. W. Thompson, J. M. Ward, C. D. Smith, G. Hong and J. Brown (2005).
"Glucose transporters in human renal proximal tubular cells isolated from the urine of patients
with non–insulin-dependent diabetes." Diabetes 54(12): 3427-3434.
Rajasekeran, H., H. N. Reich, M. A. Hladunewich, D. Cattran, J. A. Lovshin, Y. Lytvyn, P.
Bjornstad, V. Lai, J. Tse and L. Cham (2017). "Dapagliflozin in focal segmental
glomerulosclerosis: a combined human-rodent pilot study." American Journal of Physiology-
Renal Physiology 314(3): F412-F422.
Rakesh, K. and D. K. Agrawal (2005). "Controlling cytokine signaling by constitutive
inhibitors." Biochem Pharmacol 70(5): 649-657.
206
Rastaldi, M. P., S. Armelloni, S. Berra, N. Calvaresi, A. Corbelli, L. A. Giardino, M. Li, G. Q.
Wang, A. Fornasieri and A. Villa (2006). "Glomerular podocytes contain neuron-like functional
synaptic vesicles." The FASEB journal 20(7): 976-978.
Rastaldi, M. P., S. Armelloni, S. Berra, M. Li, M. Pesaresi, H. Poczewski, B. Langer, D.
Kerjaschki, A. Henger and S. M. Blattner (2003). "Glomerular podocytes possess the synaptic
vesicle molecule Rab3A and its specific effector rabphilin-3a." The American journal of
pathology 163(3): 889-899.
Ravichandran, K., I. Zafar, A. Ozkok and C. L. Edelstein (2014). "An mTOR kinase inhibitor
slows disease progression in a rat model of polycystic kidney disease." Nephrology Dialysis
Transplantation 30(1): 45-53.
Rawlings, J. S., K. M. Rosler and D. A. Harrison (2004). "The JAK/STAT signaling pathway."
Journal of cell science 117(8): 1281-1283.
Reddy, M. A., E. Zhang and R. Natarajan (2015). "Epigenetic mechanisms in diabetic
complications and metabolic memory." Diabetologia 58(3): 443-455.
Rega, L. R., E. Polishchuk, S. Montefusco, G. Napolitano, G. Tozzi, J. Zhang, F. Bellomo, A.
Taranta, A. Pastore and R. Polishchuk (2016). "Activation of the transcription factor EB rescues
lysosomal abnormalities in cystinotic kidney cells." Kidney international 89(4): 862-873.
Reidy, K., H. M. Kang, T. Hostetter and K. Susztak (2014). "Molecular mechanisms of diabetic
kidney disease." The Journal of clinical investigation 124(6): 2333-2340.
Reidy, K. J., P. K. Aggarwal, J. J. Jimenez, D. B. Thomas, D. Veron and A. Tufro (2013).
"Excess podocyte semaphorin-3A leads to glomerular disease involving plexinA1–nephrin
interaction." The American journal of pathology 183(4): 1156-1168.
207
Reidy, K. J., G. Villegas, J. Teichman, D. Veron, W. Shen, J. Jimenez, D. Thomas and A. Tufro
(2009). "Semaphorin3a regulates endothelial cell number and podocyte differentiation during
glomerular development." Development 136(23): 3979-3989.
Reitsma, S., D. W. Slaaf, H. Vink, M. A. Van Zandvoort and M. G. Oude Egbrink (2007). "The
endothelial glycocalyx: composition, functions, and visualization." Pflügers Archiv-European
Journal of Physiology 454(3): 345-359.
Rerup, C. C. (1970). "Drugs producing diabetes through damage of the insulin secreting cells."
Pharmacological reviews 22(4): 485-518.
Riediger, F., I. Quack, F. Qadri, B. Hartleben, J.-K. Park, S. A. Potthoff, D. Sohn, G. Sihn, A.
Rousselle and V. Fokuhl (2011). "Prorenin receptor is essential for podocyte autophagy and
survival." Journal of the American Society of Nephrology 22(12): 2193-2202.
Rocco, M. V. and J. S. Berns (2012). "KDOQI clinical practice guideline for diabetes and CKD:
2012 update." American Journal of Kidney Diseases 60(5): 850-886.
Roczniak-Ferguson, A., C. S. Petit, F. Froehlich, S. Qian, J. Ky, B. Angarola, T. C. Walther and
S. M. Ferguson (2012). "The transcription factor TFEB links mTORC1 signaling to
transcriptional control of lysosome homeostasis." Sci. Signal. 5(228): ra42-ra42.
Romagnani, P., G. Remuzzi, R. Glassock, A. Levin, K. J. Jager, M. Tonelli, Z. Massy, C. Wanner
and H.-J. Anders (2017). "Chronic kidney disease." Nature Reviews Disease Primers 3: 17088.
Rosenstock, J., J. Marquard, L. Laffel, D. Neubacher, S. Kaspers, D. Cherney, B. Zinman, J.
Skyler, J. George and N. Soleymanlou (2018). "Empagliflozin as Adjunctive to Insulin Therapy
in Type 1 Diabetes: The EASE Trials." Diabetes care 41(12):2560-2569.
Rossetto, D., N. Avvakumov and J. Côté (2012). "Histone phosphorylation: a chromatin
modification involved in diverse nuclear events." Epigenetics 7(10): 1098-1108.
208
Roy, S., R. Sala, E. Cagliero and M. Lorenzi (1990). "Overexpression of fibronectin induced by
diabetes or high glucose: phenomenon with a memory." Proceedings of the National Academy of
Sciences 87(1): 404-408.
Rubinsztein, D. C., P. Codogno and B. Levine (2012). "Autophagy modulation as a potential
therapeutic target for diverse diseases." Nature reviews Drug discovery 11(9): 709-730.
Rubinsztein, D. C., M. DiFiglia, N. Heintz, R. A. Nixon, Z.-H. Qin, B. Ravikumar, L. Stefanis
and A. Tolkovsky (2005). "Autophagy and its possible roles in nervous system diseases, damage
and repair." Autophagy 1(1): 11-22.
Rubio-Guerra, A. F., H. Vargas-Robles, J. J. Lozano Nuevo and B. A. Escalante-Acosta (2009).
"Correlation between circulating adhesion molecule levels and albuminuria in type-2 diabetic
hypertensive patients." Kidney Blood Press Res 32(2): 106-109.
Rubio-Guerra, A. F., H. Vargas-Robles, J. J. L. Nuevo and B. A. Escalante-Acosta (2009).
"Correlation between circulating adhesion molecule levels and albuminuria in type-2 diabetic
hypertensive patients." Kidney and Blood Pressure Research 32(2): 106-109.
Rudberg, S., L. M. Rasmussen, H.-j. Bangstad and R. Osterby (2000). "Influence of
insertion/deletion polymorphism in the ACE-I gene on the progression of diabetic
glomerulopathy in type 1 diabetic patients with microalbuminuria." Diabetes care 23(4): 544-548.
Ruff-Jamison, S., Z. Zhong, Z. Wen, K. Chen, J. E. Darnell, Jr. and S. Cohen (1994). "Epidermal
growth factor and lipopolysaccharide activate Stat3 transcription factor in mouse liver." J Biol
Chem 269(35): 21933-21935.
Ruggenenti, P., P. Cravedi and G. Remuzzi (2010). "The RAAS in the pathogenesis and
treatment of diabetic nephropathy." Nature Reviews Nephrology 6(6): 319-330.
209
Ruggenenti, P., L. Mosconi, F. Sangalli, F. Casiraghi, V. Gambara, G. Remuzzi and A. Remuzzi
(1999). "Glomerular size-selective dysfunction in NIDDM is not ameliorated by ACE inhibition
or by calcium channel blockade." Kidney international 55(3): 984-994.
Sabbisetti V.S., S.S. Waikar, D.J. Antoine, A. Smiles, C. Wang, A. Ravisankar, K. Ito, S.
Sharma, S. Ramadesikan, M. Lee, R. Briskin, P.L. De Jager, T.T. Ngo, M. Radlinski, J.W. Dear,
K.B. Park, R. Betensky, A.S. Krolewski, J.V. Bonventre (2014). “Blood kidney injury molecule-
1 is a biomarker of acute and chronic kidney injury and predicts progression to ESRD in type I
diabetes.” Journal of American Society of Nephrology 25(10):2177–2186.
Saito, A., N. Miyauchi, T. Hashimoto, T. Karasawa, G. D. Han, M. Kayaba, T. Sumi, M. Tomita,
Y. Ikezumi and K. Suzuki (2010). "Neurexin-1, a presynaptic adhesion molecule, localizes at the
slit diaphragm of the glomerular podocytes in kidneys." American Journal of Physiology-
Regulatory, Integrative and Comparative Physiology 300(2): R340-R348.
Saitoh, A., K. Sekizuka, T. Hayashi, S. Kaneko, Y. Suzuki and Y. Tomino (1998). "Detection of
Urinary MCP-1 in Patients withDiabetic Nephropathy." Nephron 80(1): 99-99.
Sakaguchi, M., M. Isono, K. Isshiki, T. Sugimoto, D. Koya and A. Kashiwagi (2006). "Inhibition
of mTOR signaling with rapamycin attenuates renal hypertrophy in the early diabetic mice."
Biochemical and biophysical research communications 340(1): 296-301.
Salcedo, R., M. L. Ponce, H. A. Young, K. Wasserman, J. M. Ward, H. K. Kleinman, J. J.
Oppenheim and W. J. Murphy (2000). "Human endothelial cells express CCR2 and respond to
MCP-1: direct role of MCP-1 in angiogenesis and tumor progression." Blood 96(1): 34-40.
Saleem, M. A., M. J. O'Hare, J. Reiser, R. J. Coward, C. D. Inward, T. Farren, C. Y. Xing, L. Ni,
P. W. Mathieson and P. Mundel (2002). "A conditionally immortalized human podocyte cell line
demonstrating nephrin and podocin expression." J Am Soc Nephrol 13(3): 630-638.
Samie, M. and P. Cresswell (2015). "The transcription factor TFEB acts as a molecular switch
that regulates exogenous antigen-presentation pathways." Nature immunology 16(7): 729-736.
210
Sandberg, E. M., T. A. Wallace, M. D. Godeny, D. V. Linden and P. P. Sayeski (2004). "Jak2
tyrosine kinase." Cell biochemistry and biophysics 41(2): 207-231.
Sanz, A. B., M. D. Sanchez-Niño, A. M. Ramos, J. A. Moreno, B. Santamaria, M. Ruiz-Ortega, J.
Egido and A. Ortiz (2010). "NF-κB in renal inflammation." Journal of the American Society of
Nephrology 21(8) 1254-1262.
Sarafidis, P. A. and L. M. Ruilope (2014). "Aggressive blood pressure reduction and renin–
angiotensin system blockade in chronic kidney disease: time for re-evaluation?" Kidney
international 85(3): 536-546.
Sardiello, M., M. Palmieri, A. di Ronza, D. L. Medina, M. Valenza, V. A. Gennarino, C. Di
Malta, F. Donaudy, V. Embrione and R. S. Polishchuk (2009). "A gene network regulating
lysosomal biogenesis and function." Science 325(5939): 473-477.
Satchell, S. C., K. L. Anderson and P. W. Mathieson (2004). "Angiopoietin 1 and vascular
endothelial growth factor modulate human glomerular endothelial cell barrier properties." J Am
Soc Nephrol 15(3): 566-574.
Satchell, S. C. and F. Braet (2009). "Glomerular endothelial cell fenestrations: an integral
component of the glomerular filtration barrier." American Journal of Physiology-Renal
Physiology 296(5): F947-F956.
Sato, S., H. Kitamura, A. Adachi, Y. Sasaki and M. Ghazizadeh (2005). "Two types of autophagy
in the podocytes in renal biopsy specimens: ultrastructural study." Journal of submicroscopic
cytology and pathology 38(2-3): 167-174.
Sato, S., H. Kitamura, A. Adachi, Y. Sasaki and M. Ghazizadeh (2006). "Two types of autophagy
in the podocytes in renal biopsy specimens: ultrastructural study." Journal of submicroscopic
cytology and pathology 38(2-3): 167-174.
211
Sawicka, A. and C. Seiser (2012). "Histone H3 phosphorylation–a versatile chromatin
modification for different occasions." Biochimie 94(11): 2193-2201.
Sayyed, S., H. Hägele, O. Kulkarni, K. Endlich, S. Segerer, D. Eulberg, S. Klussmann and H.-J.
Anders (2009). "Podocytes produce homeostatic chemokine stromal cell-derived factor-
1/CXCL12, which contributes to glomerulosclerosis, podocyte loss and albuminuria in a mouse
model of type 2 diabetes." Diabetologia 52(11): 2445-2454.
Schiffer, M., J. K. Park, I. Tossidou, J. Bartels, N. Shushakova, J. Menne and D. Fliser (2008).
"Erythropoietin prevents diabetes-induced podocyte damage." Kidney Blood Press Res 31(6):
411-415.
Schindler, C. and J. E. Darnell, Jr. (1995). "Transcriptional responses to polypeptide ligands: the
JAK-STAT pathway." Annu Rev Biochem 64: 621-651.
Schwarz, M., M. Wahl, K. Resch and H. Radeke (2002). "IFNγ induces functional chemokine
receptor expression in human mesangial cells." Clinical & Experimental Immunology 128(2):
285-294.
Scott, R. P. and S. E. Quaggin (2015). "The cell biology of renal filtration." J Cell Biol 209(2):
199-210.
Seok, S. J., E. S. Lee, G. T. Kim, M. Hyun, J.-H. Lee, S. Chen, R. Choi, H. M. Kim, E. Y. Lee
and C. H. Chung (2013). "Blockade of CCL2/CCR2 signalling ameliorates diabetic nephropathy
in db/db mice." Nephrology Dialysis Transplantation 28(7): 1700-1710.
Seron, D., J. S. Cameron and D. O. Haskard (1991). "Expression of VCAM-1 in the normal and
diseased kidney." Nephrol Dial Transplant 6(12): 917-922.
212
Serra, A. L., D. Poster, A. D. Kistler, F. Krauer, S. Raina, J. Young, K. M. Rentsch, K. S.
Spanaus, O. Senn and P. Kristanto (2010). "Sirolimus and kidney growth in autosomal dominant
polycystic kidney disease." New England Journal of Medicine 363(9): 820-829.
Settembre, C., R. De Cegli, G. Mansueto, P. K. Saha, F. Vetrini, O. Visvikis, T. Huynh, A.
Carissimo, D. Palmer and T. J. Klisch (2013). "TFEB controls cellular lipid metabolism through
a starvation-induced autoregulatory loop." Nature cell biology 15(6): 647-658.
Settembre, C., C. Di Malta, V. A. Polito, M. G. Arencibia, F. Vetrini, S. Erdin, S. U. Erdin, T.
Huynh, D. Medina and P. Colella (2011). "TFEB links autophagy to lysosomal biogenesis."
science 332(6036): 1429-1433.
Settembre, C., R. Zoncu, D. L. Medina, F. Vetrini, S. Erdin, S. Erdin, T. Huynh, M. Ferron, G.
Karsenty and M. C. Vellard (2012). "A lysosome‐to‐nucleus signalling mechanism senses and
regulates the lysosome via mTOR and TFEB." The EMBO journal 31(5): 1095-1108.
Shah, R., C. C. Hinkle, J. F. Ferguson, N. N. Mehta, M. Li, L. Qu, Y. Lu, M. E. Putt, R. S. Ahima
and M. P. Reilly (2011). "Fractalkine is a novel human adipochemokine associated with type 2
diabetes." Diabetes 60(5): 1512-1518.
Shankland, S. J. (2006). "The podocyte's response to injury: role in proteinuria and
glomerulosclerosis." Kidney Int 69(12): 2131-2147.
Shankland, S. J., B. S. Freedman and J. W. Pippin (2017). "Can podocytes be regenerated in
adults?" Current opinion in nephrology and hypertension 26(3): 154-164.
Shankland, S. J., J. W. Pippin and W. G. Couser (1999). "Complement (C5b-9) induces
glomerular epithelial cell DNA synthesis but not proliferation in vitro." Kidney international
56(2): 538-548.
213
Shankland, S. J., B. Smeets, J. W. Pippin and M. J. Moeller (2014). "The emergence of the
glomerular parietal epithelial cell." Nature Reviews Nephrology 10(3): 158-173.
Sharma, K., Y. Jin, J. Guo and F. N. Ziyadeh (1996). "Neutralization of TGF-β by anti-TGF-β
antibody attenuates kidney hypertrophy and the enhanced extracellular matrix gene expression in
STZ-induced diabetic mice." Diabetes 45(4): 522-530.
Shen, H.-M. and N. Mizushima (2014). "At the end of the autophagic road: an emerging
understanding of lysosomal functions in autophagy." Trends in biochemical sciences 39(2): 61-
71.
Shillingford, J. M., N. S. Murcia, C. H. Larson, S. H. Low, R. Hedgepeth, N. Brown, C. A. Flask,
A. C. Novick, D. A. Goldfarb and A. Kramer-Zucker (2006). "The mTOR pathway is regulated
by polycystin-1, and its inhibition reverses renal cystogenesis in polycystic kidney disease."
Proceedings of the National Academy of Sciences 103(14): 5466-5471.
Shillingford, J. M., K. B. Piontek, G. G. Germino and T. Weimbs (2010). "Rapamycin
ameliorates PKD resulting from conditional inactivation of Pkd1." Journal of the American
Society of Nephrology 21(3) 489-497.
Siddiqi, F. S. and A. Advani (2013). "Endothelial-podocyte crosstalk: the missing link between
endothelial dysfunction and albuminuria in diabetes." Diabetes 62(11): 3647-3655.
Siddiqi, F. S. and A. Advani (2013). "Endothelial-Podocyte Crosstalk: The Missing Link
Between Endothelial Dysfunction and Albuminuria in Diabetes." Diabetes 62(11): 3647-3655.
Siddiqi, F. S., S. Majumder, K. Thai, M. Abdalla, P. Hu, S. L. Advani, K. E. White, B. B.
Bowskill, G. Guarna and C. C. dos Santos (2016). "The histone methyltransferase enzyme
enhancer of zeste homolog 2 protects against podocyte oxidative stress and renal injury in
diabetes." Journal of the American Society of Nephrology 27(7): 2021-2034.
214
Silverman, M. D., C. S. Haas, A. M. Rad, A. S. Arbab and A. E. Koch (2007). "The role of
vascular cell adhesion molecule 1/very late activation antigen 4 in endothelial progenitor cell
recruitment to rheumatoid arthritis synovium." Arthritis & Rheumatism 56(6): 1817-1826.
Simonson, M. S. and F. Ismail-Beigi (2011). "Endothelin-1 increases collagen accumulation in
renal mesangial cells by stimulating a chemokine and cytokine autocrine signaling loop." J Biol
Chem 286(13): 11003-11008.
Singh, A., S. C. Satchell, C. R. Neal, E. A. McKenzie, J. E. Tooke and P. W. Mathieson (2007).
"Glomerular endothelial glycocalyx constitutes a barrier to protein permeability." Journal of the
American Society of Nephrology 18(11): 2885-2893.
Smedlund, K., J. Y. Tano and G. Vazquez (2010). "The constitutive function of native TRPC3
channels modulates vascular cell adhesion molecule-1 expression in coronary endothelial cells
through nuclear factor kappaB signaling." Circ Res 106(9): 1479-1488.
Soda, K., D. M. Balkin, S. M. Ferguson, S. Paradise, I. Milosevic, S. Giovedi, L. Volpicelli-
Daley, X. Tian, Y. Wu and H. Ma (2012). "Role of dynamin, synaptojanin, and endophilin in
podocyte foot processes." The Journal of clinical investigation 122(12): 4401-4411.
Solini, A., C. Rossi, C. M. Mazzanti, A. Proietti, H. Koepsell and E. Ferrannini (2017).
"Sodium‐glucose co‐transporter (SGLT) 2 and SGLT1 renal expression in patients with type 2
diabetes." Diabetes, Obesity and Metabolism 19(9): 1289-1294.
Soloaga, A., S. Thomson, G. R. Wiggin, N. Rampersaud, M. H. Dyson, C. A. Hazzalin, L. C.
Mahadevan and J. S. C. Arthur (2003). "MSK2 and MSK1 mediate the mitogen‐and
stress‐induced phosphorylation of histone H3 and HMG‐14." The EMBO journal 22(11): 2788-
2797.
Soriano, P. (1994). "Abnormal kidney development and hematological disorders in PDGF beta-
receptor mutant mice." Genes & development 8(16): 1888-1896.
215
Soriano, P. (1999). "Generalized lacZ expression with the ROSA26 Cre reporter strain." Nature
genetics 21(1): 70-71.
Stallone, G., B. Infante, G. Grandaliano, C. Bristogiannis, L. Macarini, D. Mezzopane, F. Bruno,
E. Montemurno, A. Schirinzi and M. Sabbatini (2012). "Rapamycin for treatment of type I
autosomal dominant polycystic kidney disease (RAPYD-study): a randomized, controlled study."
Nephrology Dialysis Transplantation 27(9): 3560-3567.
Stehouwer, C. D. (2004). "Endothelial dysfunction in diabetic nephropathy: state of the art and
potential significance for non-diabetic renal disease." Nephrology Dialysis Transplantation 19(4):
778-781.
Stehouwer, C. D., M.-A. Gall, J. W. Twisk, E. Knudsen, J. J. Emeis and H.-H. Parving (2002).
"Increased urinary albumin excretion, endothelial dysfunction, and chronic low-grade
inflammation in type 2 diabetes: progressive, interrelated, and independently associated with risk
of death." Diabetes 51(4): 1157-1165.
Stehouwer, C. D., M. A. Gall, J. W. Twisk, E. Knudsen, J. J. Emeis and H. H. Parving (2002).
"Increased urinary albumin excretion, endothelial dysfunction, and chronic low-grade
inflammation in type 2 diabetes: progressive, interrelated, and independently associated with risk
of death." Diabetes 51(4): 1157-1165.
Steingrímsson, E., N. G. Copeland and N. A. Jenkins (2004). "Melanocytes and the
microphthalmia transcription factor network." Annu. Rev. Genet. 38: 365-411.
Steingrímsson, E., L. Tessarollo, S. W. Reid, N. A. Jenkins and N. G. Copeland (1998). "The
bHLH-Zip transcription factor Tfeb is essential for placental vascularization." Development
125(23): 4607-4616.
Stenvinkel, P., M. Karimi, S. Johansson, J. Axelsson, M. Suliman, B. Lindholm, O. Heimbürger,
P. Barany, A. Alvestrand and L. Nordfors (2007). "Impact of inflammation on epigenetic DNA
216
methylation–a novel risk factor for cardiovascular disease?" Journal of internal medicine 261(5):
488-499.
Stitt-Cavanagh, E. M., W. H. Faour, K. Takami, A. Carter, B. Vanderhyden, Y. Guan, A.
Schneider, M. D. Breyer and C. R. Kennedy (2010). "A maladaptive role for EP4 receptors in
podocytes." Journal of the American Society of Nephrology 21(10): 1678-1690.
Straathof‐Galema, L., J. Wetzels, H. Dijkman, E. Steenbergen and L. Hilbrands (2006).
"Sirolimus‐associated heavy proteinuria in a renal transplant recipient: Evidence for a tubular
mechanism." American journal of transplantation 6(2): 429-433.
Strahl, B. D. and C. D. Allis (2000). "The language of covalent histone modifications." Nature
403(6765): 41-45.
Subramanian, S. and I. B. Hirsch (2018). "Diabetic Kidney Disease: Is There a Role for Glycemic
Variability?" Current diabetes reports 18(3): 13.
Suh, J. H., G. Jarad, R. G. VanDeVoorde and J. H. Miner (2011). "Forced expression of laminin
β1 in podocytes prevents nephrotic syndrome in mice lacking laminin β2, a model for Pierson
syndrome." Proceedings of the National Academy of Sciences 108(37): 15348-15353.
Sun, H., J.-m. Zheng, S. Chen, C.-h. Zeng, Z.-h. Liu and L.-s. Li (2007). "Enhanced expression of
ANGPTL2 in the microvascular lesions of diabetic glomerulopathy." Nephron Experimental
Nephrology 105(4): e117-e123.
Sun, Y., H. Zhang, R. Hu, J. Sun, X. Mao, Z. Zhao, Q. Chen and Z. Zhang (2014). "The
expression and significance of neuronal iconic proteins in podocytes." PloS one 9(4): e93999.
Susnik, N., I. Sörensen-Zender, S. Rong, S. Von Vietinghoff, X. Lu, I. Rubera, M. Tauc, C. S.
Falk, W. S. Alexander and A. Melk (2014). "Ablation of proximal tubular suppressor of cytokine
217
signaling 3 enhances tubular cell cycling and modifies macrophage phenotype during acute
kidney injury." Kidney international 85(6): 1357-1368.
Tagawa, A., M. Yasuda, S. Kume, K. Yamahara, J. Nakazawa, M. Chin-Kanasaki, H. Araki, S.-i.
Araki, D. Koya and K. Asanuma (2015). "Impaired podocyte autophagy exacerbates proteinuria
in diabetic nephropathy." Diabetes 65(3): 755-767.
Takabatake, Y., T. Sugiyama, H. Kohara, T. Matsusaka, H. Kurihara, P. A. Koni, Y. Nagasawa,
T. Hamano, I. Matsui and N. Kawada (2009). "The CXCL12 (SDF-1)/CXCR4 axis is essential
for the development of renal vasculature." Journal of the American Society of Nephrology 20(8):
1714-1723.
Takahashi, T. and R. C. Harris (2014). "Role of endothelial nitric oxide synthase in diabetic
nephropathy: lessons from diabetic eNOS knockout mice." Journal of diabetes research 2014,
ID590541, 17 pages.
Takebayashi, K., S. Matsumoto, Y. Aso and T. Inukai (2006). "Association between circulating
monocyte chemoattractant protein-1 and urinary albumin excretion in nonobese Type 2 diabetic
patients." Journal of Diabetes and its Complications 20(2): 98-104.
Tanimoto, A., Y. Murata, K.-Y. Wang, M. Tsutsui, K. Kohno and Y. Sasaguri (2008). "Monocyte
chemoattractant protein-1 expression is enhanced by granulocyte-macrophage colony-stimulating
factor via Jak2-Stat5 signaling and inhibited by atorvastatin in human monocytic U937 cells."
Journal of Biological Chemistry 283(8): 4643-4651.
Tao, Y., J. Kim, R. W. Schrier and C. L. Edelstein (2005). "Rapamycin markedly slows disease
progression in a rat model of polycystic kidney disease." Journal of the American Society of
Nephrology 16(1): 46-51.
Tarabra, E., S. Giunti, F. Barutta, G. Salvidio, D. Burt, G. Deferrari, R. Gambino, D. Vergola, S.
Pinach and P. C. Perin (2009). "Effect of the monocyte chemoattractant protein-1/CC chemokine
218
receptor 2 system on nephrin expression in streptozotocin-treated mice and human cultured
podocytes." diabetes 58(9): 2109-2118.
Tarabra, E., S. Giunti, F. Barutta, G. Salvidio, D. Burt, G. Deferrari, R. Gambino, D. Vergola, S.
Pinach, P. C. Perin, G. Camussi and G. Gruden (2009). "Effect of the monocyte chemoattractant
protein-1/CC chemokine receptor 2 system on nephrin expression in streptozotocin-treated mice
and human cultured podocytes." Diabetes 58(9): 2109-2118.
Tashiro, K., I. Koyanagi, A. Saitoh, A. Shimizu, T. Shike, C. Ishiguro, M. Koizumi, K. Funabiki,
S. Horikoshi and I. Shirato (2002). "Urinary levels of monocyte chemoattractant protein‐1
(MCP‐1) and interleukin‐8 (IL‐8), and renal injuries in patients with type 2 diabetic
nephropathy." Journal of clinical laboratory analysis 16(1): 1-4.
Tashiro, K., I. Koyanagi, A. Saitoh, A. Shimizu, T. Shike, C. Ishiguro, M. Koizumi, K. Funabiki,
S. Horikoshi, I. Shirato and Y. Tomino (2002). "Urinary levels of monocyte chemoattractant
protein-1 (MCP-1) and interleukin-8 (IL-8), and renal injuries in patients with type 2 diabetic
nephropathy." J Clin Lab Anal 16(1): 1-4.
Tesch, G. H. (2008). "MCP-1/CCL2: a new diagnostic marker and therapeutic target for
progressive renal injury in diabetic nephropathy." American Journal of Physiology-Renal
Physiology 294(4): F697-F701.
Tharaux, P.-L. and T. B. Huber (2012). "How many ways can a podocyte die?." Seminars in
nephrology, Elsevier 32(4):394-404.
Thieme, K., S. Majumder, A. S. Brijmohan, S. N. Batchu, B. B. Bowskill, T. A. Alghamdi, S. L.
Advani, M. G. Kabir, Y. Liu and A. Advani (2017). "EP4 inhibition attenuates the development
of diabetic and non-diabetic experimental kidney disease." Scientific Reports 7(1): 3442.
219
Thomas, M. C., M. Brownlee, K. Susztak, K. Sharma, K. A. Jandeleit-Dahm, S. Zoungas, P.
Rossing, P.-H. Groop and M. E. Cooper (2015). "Diabetic kidney disease." Nature Reviews
Disease Primers 1: 15018.
Thomson, S., A. L. Clayton, C. A. Hazzalin, S. Rose, M. J. Barratt and L. C. Mahadevan (1999).
"The nucleosomal response associated with immediate-early gene induction is mediated via
alternative MAP kinase cascades: MSK1 as a potential histone H3/HMG-14 kinase." EMBO J
18(17): 4779-4793.
Thoreen, C. C. and D. M. Sabatini (2009). "Rapamycin inhibits mTORC1, but not completely."
Autophagy 5(5): 725-726.
Tonelli, M., N. Wiebe, B. Culleton, A. House, C. Rabbat, M. Fok, F. McAlister and A. X. Garg
(2006). "Chronic kidney disease and mortality risk: a systematic review." Journal of the
American Society of Nephrology 17(7): 2034-2047.
Torras, J., I. Herrero-Fresneda, O. Gulias, M. Flaquer, A. Vidal, J.M. Cruzado, N. Lloberas, M.I.
Franquesa, J.M. Grinyó, (2009). “Rapamycin has dual opposing effects on proteinuric
experimental nephropathies: is it a matter of podocyte damage?” Nephrology Dialysis
Transplantation 24(12): 3632–3640.
Trepels, T., A. M. Zeiher and S. Fichtlscherer (2006). "The endothelium and inflammation."
Endothelium 13(6): 423-429.
Tsunemi, T., T. D. Ashe, B. E. Morrison, K. R. Soriano, J. Au, R. A. V. Roque, E. R.
Lazarowski, V. A. Damian, E. Masliah and A. R. La Spada (2012). "PGC-1α rescues
Huntington’s disease proteotoxicity by preventing oxidative stress and promoting TFEB
function." Science translational medicine 4(142): 142ra197-142ra197.
Turner, C. M., N. Arulkumaran, M. Singer, R. J. Unwin and F. W. Tam (2014). "Is the
inflammasome a potential therapeutic target in renal disease?" BMC nephrology 15(1): 21.
220
Tuttle K, B. F., Adler SG, KretzlerM, Mehta RL, Tumlin JA, Liu J, SilkME, Cardillo TE, Duffin
KL, Haas JV, Macias WL, Janes JM: [abstract] (2015). "Baricitinib in diabetic kidney disease:
Results from a phase 2, multicenter randomized, double-blind, placebo-controlled study."
Available at http://app.core-
apps.com/tristar_ada15/abstract/1678f29f2a56ce35baedcc25f3994ccb.
Tuttle, K. R. (2005). "Linking metabolism and immunology: diabetic nephropathy is an
inflammatory disease." Journal of the American Society of Nephrology 16(6): 1537-1538.
Tuttle, K. R., G. L. Bakris, R. W. Bilous, J. L. Chiang, I. H. De Boer, J. Goldstein-Fuchs, I. B.
Hirsch, K. Kalantar-Zadeh, A. S. Narva and S. D. Navaneethan (2014). "Diabetic kidney disease:
a report from an ADA Consensus Conference." American journal of kidney diseases 64(4): 510-
533.
Tuttle, K. R., F. C. Brosius, S. G. Adler, M. Kretzler, R. L. Mehta, J. A. Tumlin, Y. Tanaka, M.
Haneda, J. Liu and M. E. Silk (2018). "JAK1/JAK2 inhibition by baricitinib in diabetic kidney
disease: results from a Phase 2 randomized controlled clinical trial." Nephrology Dialysis
Transplantation 33(11):1950-1959.
UKPDS, U. P. D. S. G. (1998). "Effect of intensive blood-glucose control with metformin on
complications in overweight patients with type 2 diabetes (UKPDS 34)." The Lancet 352(9131):
854-865.
Umanath, K. and J. B. Lewis (2018). "Update on diabetic nephropathy: core curriculum 2018."
American Journal of Kidney Diseases 71(6): 884-895.
Valentino, L. and J. Pierre (2006). "JAK/STAT signal transduction: regulators and implication in
hematological malignancies." Biochem Pharmacol 71(6): 713-721.
Vallon, V., M. Rose, M. Gerasimova, J. Satriano, K. A. Platt, H. Koepsell, R. Cunard, K.
Sharma, S. C. Thomson and T. Rieg (2012). "Knockout of Na-glucose transporter SGLT2
221
attenuates hyperglycemia and glomerular hyperfiltration but not kidney growth or injury in
diabetes mellitus." American Journal of Physiology-Renal Physiology 304(2): F156-F167.
van den Bergh Weerman, M. A., K. J. Assmann, J. J. Weening and S. Florquin (2004). "Podocyte
foot process effacement is not correlated with the level of proteinuria in human
glomerulopathies." Kidney international 66(5): 1901-1906.
Van, J. A., J. W. Scholey and A. Konvalinka (2017). "Insights into diabetic kidney disease using
urinary proteomics and bioinformatics." Journal of the American Society of Nephrology 28(4):
1050-1061.
Verhave, J. C., J. Bouchard, R. Goupil, V. Pichette, S. Brachemi, F. Madore and S. Troyanov
(2013). "Clinical value of inflammatory urinary biomarkers in overt diabetic nephropathy: a
prospective study." Diabetes research and clinical practice 101(3): 333-340.
Veron, D., G. Villegas, P. K. Aggarwal, C. Bertuccio, J. Jimenez, H. Velazquez, K. Reidy, D. R.
Abrahamson, G. Moeckel and M. Kashgarian (2012). "Acute podocyte vascular endothelial
growth factor (VEGF-A) knockdown disrupts alphaVbeta3 integrin signaling in the glomerulus."
PloS one 7(7): e40589.
Verstovsek, S., H. Kantarjian, R. A. Mesa, A. D. Pardanani, J. Cortes-Franco, D. A. Thomas, Z.
Estrov, J. S. Fridman, E. C. Bradley and S. Erickson-Viitanen (2010). "Safety and efficacy of
INCB018424, a JAK1 and JAK2 inhibitor, in myelofibrosis." New England Journal of Medicine
363(12): 1117-1127.
Viedt, C., R. Dechend, J. Fei, G. M. Hänsch, J. Kreuzer and S. R. Orth (2002). "MCP-1 induces
inflammatory activation of human tubular epithelial cells: involvement of the transcription
factors, nuclear factor-κB and activating protein-1." Journal of the American Society of
Nephrology 13(6): 1534-1547.
222
Vij, N., A. Sharma, M. Thakkar, S. Sinha and R. R. Mohan (2008). "PDGF-driven proliferation,
migration, and IL8 chemokine secretion in human corneal fibroblasts involve JAK2-STAT3
signaling pathway." Mol Vis 14: 1020-1027.
Villegas, G. and A. Tufro (2002). "Ontogeny of semaphorins 3A and 3F and their receptors
neuropilins 1 and 2 in the kidney." Mechanisms of development 119: S149-S153.
Villeneuve, L. M. and R. Natarajan (2010). "The role of epigenetics in the pathology of diabetic
complications." American Journal of Physiology-Renal Physiology 299(1): F14-F25.
Visvikis, O., N. Ihuegbu, S. A. Labed, L. G. Luhachack, A.-M. F. Alves, A. C. Wollenberg, L.
M. Stuart, G. D. Stormo and J. E. Irazoqui (2014). "Innate host defense requires TFEB-mediated
transcription of cytoprotective and antimicrobial genes." Immunity 40(6): 896-909.
Visweswaran, G. R., S. Gholizadeh, M. H. Ruiters, G. Molema, R. J. Kok and J. A. Kamps
(2015). "Targeting Rapamycin to Podocytes Using a Vascular Cell Adhesion Molecule-1
(VCAM-1)-Harnessed SAINT-Based Lipid Carrier System." PLoS One 10(9): e0138870.
Voelker, J., P. H. Berg, M. Sheetz, K. Duffin, T. Shen, B. Moser, T. Greene, S. S. Blumenthal, I.
Rychlik and Y. Yagil (2017). "Anti–TGF-β1 antibody therapy in patients with diabetic
nephropathy." Journal of the American Society of Nephrology 28(3): 953-962.
Vogelmann, S. U., W. J. Nelson, B. D. Myers and K. V. Lemley (2003). "Urinary excretion of
viable podocytes in health and renal disease." American Journal of Physiology-Renal Physiology
285(1): F40-F48.
Wada, T., K. Furuichi, N. Sakai, Y. Iwata, K. Yoshimoto, M. Shimizu, S.-I. Takeda, K.
Takasawa, M. Yoshimura and H. Kida (2000). "Up-regulation of monocyte chemoattractant
protein-1 in tubulointerstitial lesions of human diabetic nephropathy." Kidney international 58(4):
1492-1499.
223
Wada, T., K. Furuichi, N. Sakai, Y. Iwata, K. Yoshimoto, M. Shimizu, S. I. Takeda, K.
Takasawa, M. Yoshimura, H. Kida, K. I. Kobayashi, N. Mukaida, T. Naito, K. Matsushima and
H. Yokoyama (2000). "Up-regulation of monocyte chemoattractant protein-1 in tubulointerstitial
lesions of human diabetic nephropathy." Kidney Int 58(4): 1492-1499.
Waddington, C. H. (1939). "Introduction to modern genetics.", George Allen And Unwin Ltd
Museum Street; London.
Wald, C. and C. Wu (2010). "Of mice and women: the bias in animal models." Science
327(5973): 1571-1572.
Wallace, T. A. and P. P. Sayeski (2006). "Jak2 tyrosine kinase: a mediator of both housekeeping
and ligand-dependent gene expression?" Cell Biochem Biophys 44(2): 213-222.
Walz, G., K. Budde, M. Mannaa, J. Nürnberger, C. Wanner, C. Sommerer, U. Kunzendorf, B.
Banas, W. H. Hörl and N. Obermüller (2010). "Everolimus in patients with autosomal dominant
polycystic kidney disease." New England Journal of Medicine 363(9): 830-840.
Wang, C., H. Niederstrasser, P. M. Douglas, R. Lin, J. Jaramillo, Y. Li, N. W. Olswald, A. Zhou,
E. A. McMillan and S. Mendiratta (2017). "Small-molecule TFEB pathway agonists that
ameliorate metabolic syndrome in mice and extend C. elegans lifespan." Nature communications
8(1): 2270.
Wang, F., J. Flanagan, N. Su, L. C. Wang, S. Bui, A. Nielson, X. Wu, H. T. Vo, X. J. Ma and Y.
Luo (2012). "RNAscope: a novel in situ RNA analysis platform for formalin-fixed, paraffin-
embedded tissues." J Mol Diagn 14(1): 22-29.
Wang, X., J. Liu, J. Zhen, C. Zhang, Q. Wan, G. Liu, X. Wei, Y. Zhang, Z. Wang and H. Han
(2014). "Histone deacetylase 4 selectively contributes to podocyte injury in diabetic
nephropathy." Kidney international 86(4): 712-725.
224
Wang, X., S. Shaw, F. Amiri, D. C. Eaton and M. B. Marrero (2002). "Inhibition of the
Jak/STAT signaling pathway prevents the high glucose-induced increase in tgf-beta and
fibronectin synthesis in mesangial cells." Diabetes 51(12): 3505-3509.
Wang, X. X., J. Levi, Y. Luo, K. Myakala, M. Herman-Edelstein, L. Qiu, D. Wang, Y. Peng, A.
Grenz and S. Lucia (2017). "SGLT2 expression is increased in human diabetic nephropathy:
SGLT2 inhibition decreases renal lipid accumulation, inflammation and the development of
nephropathy in diabetic mice." Journal of Biological Chemistry 292(13):5335-5348.
Wang, Y. Z., W. Wharton, R. Garcia, A. Kraker, R. Jove and W. J. Pledger (2000). "Activation
of Stat3 preassembled with platelet-derived growth factor beta receptors requires Src kinase
activity." Oncogene 19(17): 2075-2085.
Wanner, C., S. E. Inzucchi, J. M. Lachin, D. Fitchett, M. von Eynatten, M. Mattheus, O. E.
Johansen, H. J. Woerle, U. C. Broedl and B. Zinman (2016). "Empagliflozin and progression of
kidney disease in type 2 diabetes." New England Journal of Medicine 375(4): 323-334.
Webster, A. C., E. V. Nagler, R. L. Morton and P. Masson (2017). "Chronic kidney disease." The
Lancet 389(10075): 1238-1252.
Weil, E. J., K. V. Lemley, C. C. Mason, B. Yee, L. I. Jones, K. Blouch, T. Lovato, M.
Richardson, B. D. Myers and R. G. Nelson (2012). "Podocyte detachment and reduced
glomerular capillary endothelial fenestration promote kidney disease in type 2 diabetic
nephropathy." Kidney international 82(9): 1010-1017.
Weiss, R. B. (1982). "Streptozocin: a review of its pharmacology, efficacy, and toxicity." Cancer
treatment reports 66(3): 427-438.
Weldegiorgis, M., D. de Zeeuw and H. J. L. Heerspink (2015). "Renal end points in clinical trials
of kidney disease." Current opinion in nephrology and hypertension 24(3): 284-289.
225
Weller, H. and R. L. Wiley (1985). Basic human physiology, Prindle Weber & Schmidt.
Welsh, G. I. and M. A. Saleem (2012). "The podocyte cytoskeleton—key to a functioning
glomerulus in health and disease." Nature reviews Nephrology 8(1): 14-21.
Werle, M., U. Schmal, K. Hanna and J. Kreuzer (2002). "MCP-1 induces activation of MAP-
kinases ERK, JNK and p38 MAPK in human endothelial cells." Cardiovasc Res 56(2): 284-292.
West, K. (2009). "CP-690550, a JAK3 inhibitor as an immunosuppressant for the treatment of
rheumatoid arthritis, transplant rejection, psoriasis and other immune-mediated disorders." Curr
Opin Investig Drugs 10(5): 491-504.
Wharram, B. L., M. Goyal, J. E. Wiggins, S. K. Sanden, S. Hussain, W. E. Filipiak, T. L.
Saunders, R. C. Dysko, K. Kohno and L. B. Holzman (2005). "Podocyte depletion causes
glomerulosclerosis: Diphtheria toxin–induced podocyte depletion in rats expressing human
diphtheria toxin receptor transgene." Journal of the American Society of Nephrology 16(10):
2941-2952.
Widlansky, M. E., N. Gokce, J. F. Keaney and J. A. Vita (2003). "The clinical implications of
endothelial dysfunction." Journal of the American College of Cardiology 42(7): 1149-1160.
Wiggin, G. R., A. Soloaga, J. M. Foster, V. Murray-Tait, P. Cohen and J. S. C. Arthur (2002).
"MSK1 and MSK2 are required for the mitogen-and stress-induced phosphorylation of CREB
and ATF1 in fibroblasts." Molecular and cellular biology 22(8): 2871-2881.
Wilkinson, D. S. and M. Hansen (2015). "LC3 is a novel substrate for the mammalian Hippo
kinases, STK3/STK4." Autophagy 11(5): 856-857.
Wilkinson, D. S., J. S. Jariwala, E. Anderson, K. Mitra, J. Meisenhelder, J. T. Chang, T. Ideker,
T. Hunter, V. Nizet and A. Dillin (2015). "Phosphorylation of LC3 by the Hippo kinases
STK3/STK4 is essential for autophagy." Molecular cell 57(1): 55-68.
226
Winter, L., L. A. Wong, G. Jerums, J.-m. Seah, M. Clarke, S. M. Tan, M. T. Coughlan, R. J.
MacIsaac and E. I. Ekinci (2018). "Use of readily accessible inflammatory markers to predict
diabetic kidney disease." Frontiers in endocrinology 9.
Wolf, G., S. Chen and F. N. Ziyadeh (2005). "From the periphery of the glomerular capillary wall
toward the center of disease: podocyte injury comes of age in diabetic nephropathy." Diabetes
54(6): 1626-1634.
Wolkow, P. P., M. A. Niewczas, B. Perkins, L. H. Ficociello, B. Lipinski, J. H. Warram and A. S.
Krolewski (2008). "Association of urinary inflammatory markers and renal decline in
microalbuminuric type 1 diabetics." Journal of the American Society of Nephrology 19(4): 789-
797.
Wong, E. and A. M. Cuervo (2010). "Autophagy gone awry in neurodegenerative diseases."
Nature neuroscience 13(7): 805-811.
Woroniecka, K. I., A. S. D. Park, D. Mohtat, D. B. Thomas, J. M. Pullman and K. Susztak
(2011). "Transcriptome analysis of human diabetic kidney disease." Diabetes 60(9): 2354-2369.
Wu, M., P. R. Wahl, M. Le Hir, Y. Wäckerle-Men, R. P. Wüthrich and A. L. Serra (2007).
"Everolimus retards cyst growth and preserves kidney function in a rodent model for polycystic
kidney disease." Kidney and blood pressure research 30(4): 253-259.
Xiao, Q., P. Yan, X. Ma, H. Liu, R. Perez, A. Zhu, E. Gonzales, J. M. Burchett, D. R. Schuler
and J. R. Cirrito (2014). "Enhancing astrocytic lysosome biogenesis facilitates Aβ clearance and
attenuates amyloid plaque pathogenesis." Journal of Neuroscience 34(29): 9607-9620.
Xie, Y., B. Bowe, A. H. Mokdad, H. Xian, Y. Yan, T. Li, G. Maddukuri, C.-Y. Tsai, T. Floyd
and Z. Al-Aly (2018). "Analysis of the Global Burden of Disease study highlights the global,
regional, and national trends of chronic kidney disease epidemiology from 1990 to 2016." Kidney
international 94(3): 567-581.
227
Xin, B. and R. Rohs (2018). "Relationship between histone modifications and transcription factor
binding is protein family specific." Genome Res 28: 321-333.
Xin, H., A. Herrmann, K. Reckamp, W. Zhang, S. Pal, M. Hedvat, C. Zhang, W. Liang, A. Scuto
and S. Weng (2011). "Anti-angiogenic and anti-metastatic activity of JAK inhibitor AZD1480."
Cancer research 71(21):6601-6610.
Yale, J. F., G. Bakris, B. Cariou, D. Yue, E. David‐Neto, L. Xi, K. Figueroa, E. Wajs, K. Usiskin
and G. Meininger (2013). "Efficacy and safety of canagliflozin in subjects with type 2 diabetes
and chronic kidney disease." Diabetes, Obesity and Metabolism 15(5): 463-473.
Yamahara, K., S. Kume, D. Koya, Y. Tanaka, Y. Morita, M. Chin-Kanasaki, H. Araki, K. Isshiki,
S.-i. Araki and M. Haneda (2013). "Obesity-mediated autophagy insufficiency exacerbates
proteinuria-induced tubulointerstitial lesions." Journal of the American Society of Nephrology
24(11):1769-1781.
Yamamoto, T., T. Matsuda, A. Muraguchi, K. Miyazono and M. Kawabata (2001). "Cross-talk
between IL-6 and TGF-beta signaling in hepatoma cells." FEBS Lett 492(3): 247-253.
Yamamoto-Nonaka, K., M. Koike, K. Asanuma, M. Takagi, J. A. O. Trejo, T. Seki, T. Hidaka,
K. Ichimura, T. Sakai and N. Tada (2016). "Cathepsin D in podocytes is important in the
pathogenesis of proteinuria and CKD." Journal of the American Society of Nephrology
27(9):2685-26700.
Yamaoka, K., P. Saharinen, M. Pesu, V. E. Holt, 3rd, O. Silvennoinen and J. J. O'Shea (2004).
"The Janus kinases (Jaks)." Genome Biol 5(12): 253.
Yamout, H., I. Lazich and G. L. Bakris (2014). "Blood pressure, hypertension, RAAS blockade,
and drug therapy in diabetic kidney disease." Advances in chronic kidney disease 21(3): 281-286.
228
Yang, T. and C. Xu (2017). "Physiology and pathophysiology of the intrarenal renin-angiotensin
system: an update." Journal of the American Society of Nephrology 28(4): 1040-1049.
Yang, Y., J. Wang, L. Qin, Z. Shou, J. Zhao, H. Wang, Y. Chen and J. Chen (2007). "Rapamycin
prevents early steps of the development of diabetic nephropathy in rats." American journal of
nephrology 27(5): 495-502.
Yang, Z. and D. J. Klionsky (2010). "Mammalian autophagy: core molecular machinery and
signaling regulation." Current opinion in cell biology 22(2): 124-131.
Yazdani, U. and J. R. Terman (2006). "The semaphorins." Genome biology 7(3): 211.
Yerra, V. G. and A. Advani (2018). "Histones and heart failure in diabetes." Cell Mol Life Sci
7(17): 3193–3213.
Yi, M., L. Zhang, Y. Liu, M. J. Livingston, J.-K. Chen, N. S. Nahman Jr, F. Liu and Z. Dong
(2017). "Autophagy is activated to protect against podocyte injury in adriamycin-induced
nephropathy." American Journal of Physiology-Renal Physiology 313(1): F74-F84.
Yin, W., S. M. Naini, G. Chen, D. M. Hentschel, B. D. Humphreys and J. V. Bonventre (2016).
"Mammalian target of rapamycin mediates kidney injury molecule 1-dependent tubule injury in a
surrogate model." Journal of the American Society of Nephrology 27(7): 1943-1957.
Yoon, S., D. Gingras and M. Bendayan (2001). "Alterations of vitronectin and its receptor αv
integrin in the rat renal glomerular wall during diabetes." American journal of kidney diseases
38(6): 1298-1306.
Yoshimura, A., T. Naka and M. Kubo (2007). "SOCS proteins, cytokine signalling and immune
regulation." Nat Rev Immunol 7(6): 454-465.
229
Yoshioka, M., T. Kayo, T. Ikeda and A. Koizuni (1997). "A novel locus, Mody4, distal to
D7Mit189 on chromosome 7 determines early-onset NIDDM in nonobese C57BL/6 (Akita)
mutant mice." Diabetes 46(5): 887-894.
You, H., T. Gao, W. M. Raup-Konsavage, T. K. Cooper, S. K. Bronson, W. B. Reeves and A. S.
Awad (2017). "Podocyte-specific chemokine (CC motif) receptor 2 overexpression mediates
diabetic renal injury in mice." Kidney international 91(3): 671-682.
Yuen, D. A., B. E. Stead, Y. Zhang, K. E. White, M. G. Kabir, K. Thai, S. L. Advani, K. A.
Connelly, T. Takano and L. Zhu (2012). "eNOS deficiency predisposes podocytes to injury in
diabetes." Journal of the American Society of Nephrology 23(11): 1810-1823.
Yuen, D. A., B. E. Stead, Y. Zhang, K. E. White, M. G. Kabir, K. Thai, S. L. Advani, K. A.
Connelly, T. Takano, L. Zhu, A. J. Cox, D. J. Kelly, I. W. Gibson, T. Takahashi, R. C. Harris and
A. Advani (2012). "eNOS deficiency predisposes podocytes to injury in diabetes." J Am Soc
Nephrol 23(11): 1810-1823.
Zafar, I., K. Ravichandran, F. A. Belibi, R. B. Doctor and C. L. Edelstein (2010). "Sirolimus
attenuates disease progression in an orthologous mouse model of human autosomal dominant
polycystic kidney disease." Kidney international 78(8): 754-761.
Zatz, R., T. W. Meyer, H. G. Rennke and B. M. Brenner (1985). "Predominance of hemodynamic
rather than metabolic factors in the pathogenesis of diabetic glomerulopathy." Proceedings of the
National Academy of Sciences 82(17): 5963-5967.
Zhang, H., V. Nair, J. Saha, K. B. Atkins, J. B. Hodgin, T. L. Saunders, M. G. Myers Jr, T.
Werner, M. Kretzler and F. C. Brosius (2017). "Podocyte-specific JAK2 overexpression worsens
diabetic kidney disease in mice." Kidney international 92(4): 909-921.
230
Zhao, H. J., S. Wang, H. Cheng, M. Z. Zhang, T. Takahashi, A. B. Fogo, M. D. Breyer and R. C.
Harris (2006). "Endothelial nitric oxide synthase deficiency produces accelerated nephropathy in
diabetic mice." J Am Soc Nephrol 17(10): 2664-2669.
Zhao, X., Y. Chen, X. Tan, L. Zhang, H. Zhang, Z. Li, S. Liu, R. Li, T. Lin and R. Liao (2018).
"Advanced glycation end‐products suppress autophagic flux in podocytes by activating
mammalian target of rapamycin and inhibiting nuclear translocation of transcription factor EB."
The Journal of pathology 245(2): 235-248.
Zhao, X., Y. Zhang, L. Li, D. Mann, J.D. Imig, N. Emmett, G. Gibbons, L.M. Jin (2011).
“Glomerular expression of kidney injury molecule-1 and podocytopenia in diabetic
glomerulopathy.” American Journal of Nephrology 34(3):268–280.
Zimmet, P. Z., D. J. Magliano, W. H. Herman and J. E. Shaw (2014). "Diabetes: a 21st century
challenge." The lancet Diabetes & endocrinology 2(1): 56-64.
Ziyadeh, F. N., B. B. Hoffman, D. C. Han, M. C. Iglesias-De la Cruz, S. W. Hong, M. Isono, S.
Chen, T. A. McGowan and K. Sharma (2000). "Long-term prevention of renal insufficiency,
excess matrix gene expression, and glomerular mesangial matrix expansion by treatment with
monoclonal antitransforming growth factor-β antibody in db/db diabetic mice." Proceedings of
the National Academy of Sciences 97(14): 8015-8020.
Zoja, C., D. Corna, V. Nava, M. Locatelli, M. Abbate, F. Gaspari, F. Carrara, F. Sangalli, G.
Remuzzi and A. Benigni (2012). "Analogs of bardoxolone methyl worsen diabetic nephropathy
in rats with additional adverse effects." American Journal of Physiology-Renal Physiology
304(6): F808-F819.
Zucker, I. and A. K. Beery (2010). "Males still dominate animal studies." Nature 465(7299): 690.
Recommended