View
18
Download
1
Category
Tags:
Preview:
DESCRIPTION
GeneChip Experiments A set of Coordinately Expressed Genes. ESTs/cDNAs. BlastN/Blat Search for genomic sequence retrieval. - PowerPoint PPT Presentation
Citation preview
Identification of Compositionally Similar Cis-element Clusters in Coordinately Regulated GenesAnil G Jegga, Ashima Gupta, Andrew T Pinski, James W Carman, Bruce J Aronow
Cincinnati Children’s Hospital Medical Center, Cincinnati, OH-45229Abstract: A singular efficient method to decipher the underlying transcriptional
control elements in higher eukaryotic genomes is still elusive. We have explored
the extension of comparative genomics approaches to tackle this problem using
known TF binding sites. Starting with an earlier developed method for
identification of conserved cis-elements that are contained within evolutionarily
conserved genomic regions (http://trafac.chmcc.org), we extended the query to
identify compositionally similar cis-regulatory element clusters that occur in
groups of co-expressed genes within each of their ortholog-pair evolutionarily
conserved cis-regulatory regions (“peak analyzer”). We have tested series of co-
regulated ortholog pairs of promoters and genes using known regulatory regions
as training sets and microarray array profile data based co-expressed genes as test
sets in the central nervous system, liver, olfactory and immuno-hematologic
systems. Our results suggest that this combinatorial approach is broadly sensitive
for the identification of known and potential regulatory regions containing
conserved cis-elements for known compartment-specific trans-acting factors.
However, sensitive detection of some known regulatory regions leads to an
abundance of apparently false positives. We believe this approach can be
substantially refined by improvement in the use of compositional similarity
algorithms and weighted detection of preferred architecture models.
Method:
Gene 2: Hs-Mm
Gene 4: Hs-Mm
Gene 3: Hs-Mm
Gene 5: Hs-Mm
Gene 1: Hs-Mm
Local Alignment Similarity Score: 3074 Match Percentage: 51 % Number of Matches: 96 Number of Mismatches: 39 Total Length of Gaps: 52 Begins at (8281,8874) and Ends at (8416,9059)
Seq 1 <--> Seq 2 Sim% Nt8281-8300 <--> 8874-8893 70% (20 nt)8301-8310 <--> 8902-8911 90% (10 nt)8311-8324 <--> 8923-8936 57% (14 nt)8325-8376 <--> 8947-8998 62% (52 nt)8378-8386 <--> 8999-9007 67% (9 nt)8387-8416 <--> 9030-9059 90% (30 nt)
V$ETSF/ETS1_B 8333 - 8347
V$STAT/STAT1_01 8335 - 8355
V$ETSF/PU1_B 8335 - 8350
V$ETSF/GABP_B 8336 - 8347
V$ETSF/NRF2_01 8338 - 8347
V$CLOX/CDPCR3_01 8363 - 8377
V$ETSF/ETS1_B 8880-8894
V$STAT/STAT1_01 8881-8901
V$ETSF/PU1_B 8882-8897
V$ETSF/NRF2_01 8892-8902
V$CLOX/CDPCR3_01 8908-8922
V$GATA/GATA_C 8916-8928
Seq 1 <--> Seq 2 Sim% Nt Hits8301-8310 <--> 8902-8911 90% (10 nt) 38311-8324 <--> 8923-8936 57% (14 nt) 28325-8376 <--> 8947-8998 62% (52 nt) 38378-8386 <--> 8999-9007 67% (9 nt) 08387-8416 <--> 9030-9059 90% (30 nt) 4
Trafac
GeneChip ExperimentsA set of Coordinately Expressed Genes
BlastN/Blat Search for genomic sequence retrieval
TF Binding Sites TF Binding Sites
>Seq 1 Human/Mouse Genomic AGAGAAAATTGCTAGAGCTCAGGAGTTTGAGACCAGCCTGGGCAATAGAGTAAGACTTTGTCTCTATCAAAAATTTAAAAATTAACTGGGCTTGGCGGTGTGCACCTGTGGTCCAGCTACTCAGGAGGCTGAGGTGGGAGGATTGCTTGAGCCCAAGA
>Seq 2 Mouse/Human Genomic GACTGAGGGCTTGTGAAACAGCAAGAACCTGTCTCAAAAAACAGTGGGCAGGGAGGGGATTAATGAATAGGCAGCTACGTTCTGGGACTGGAGGGACTCGAGGTGGCTAGAAAGCAAGAGGTACTGGGAGACAAGGCTGCAGACATTTCTTTTTTTACTAGAGTC
BlastZ
ESTs/cDNAs
Seq 7 <--> Seq 8 Sim% Nt Hits8301-8310 <--> 8902-8911 90% (10 nt) 38311-8324 <--> 8923-8936 57% (14 nt) 28325-8376 <--> 8947-8998 62% (52 nt) 38378-8386 <--> 8999-9007 67% (9 nt) 08387-8416 <--> 9030-9059 90% (30 nt) 4
Seq 3 <--> Seq 4 Sim% Nt Hits8301-8310 <--> 8902-8911 90% (10 nt) 38311-8324 <--> 8923-8936 57% (14 nt) 28325-8376 <--> 8947-8998 62% (52 nt) 38378-8386 <--> 8999-9007 67% (9 nt) 08387-8416 <--> 9030-9059 90% (30 nt) 4
Seq 5 <--> Seq 6 Sim% Nt Hits8301-8310 <--> 8902-8911 90% (10 nt) 38311-8324 <--> 8923-8936 57% (14 nt) 28325-8376 <--> 8947-8998 62% (52 nt) 38378-8386 <--> 8999-9007 67% (9 nt) 08387-8416 <--> 9030-9059 90% (30 nt) 4
Seq 9 <--> Seq 10 Sim% Nt Hits8301-8310 <--> 8902-8911 90% (10 nt) 38311-8324 <--> 8923-8936 57% (14 nt) 28325-8376 <--> 8947-8998 62% (52 nt) 38378-8386 <--> 8999-9007 67% (9 nt) 08387-8416 <--> 9030-9059 90% (30 nt) 4
Peak-Analyzer
Gene1: Hs-Mm, Gene2: Hs-Mm, Gene3: Hs-Mm, … Genen: Hs-Mm Peak Analyzer
Coordinately Expressed Genes in Olfactory Mucosa: Three
genes with high levels of expression in Olfactory Mucosa shared
several clusters of cis-elements. Each of these clusters was also
conserved in human and mouse. The window size ranged from 200
to 300 base pairs. Two of the genes (XM_134943 and
XM_143313) depicted here encode hypothetical proteins while the
third is TPD52 (Tumor protein D52) (Genter et al., 2003).
Coordinately Expressed Genes in Cerebellum: Conserved Cis-
element clusters (200-300 base pair window) between human and
mouse homologs and shared by four genes (ATP2A2 (Ca++-
ATPase); HPCAL1 (Hippocalcin-like 1); CACNA1A (P/Q type Ca
channel alpha 1A); and PLA2G7 (phospholipase A2 group VII)).
highly expressed in Cerebellum (Zhang et al., 2003).
Skeletal Muscle Genes - Regulogram depiction of shared cis-elements: Horizontal bars with colored segments (exons) are human and mouse genomic sequences. The different colored quadrilaterals are regions of alignment. Within each of these blocks, the % sequence similarity and the number of TF-binding sites are represented as two separate line graphs.
TraFaC images of the experimentally validated regulatory regions of Skeletal Muscle genes (represented as blue circle on regulograms): The two gray vertical bars are the two genes that are compared. The TF-binding sites occurring in both the genes are highlighted as various colored bars drawn across the two genes.
DES: Upstream Enhancer Region MYL1: Intronic Enhancer Region
CKM: Upstream Enhancer Region ENO3: Intronic Enhancer Region
Peak Analyzer:
After the initial genomic sequence
alignment of orthologous skeletal muscle
genes (DES (Desmin), MYL1 (Myosin light
polypeptide 1), CKM (creatine kinase
muscle) and ENO3 (enolase 3 beta,
muscle)), the “peaks” or “hits” (common
cis-elements between orthologous gene pair
and occurring in conserved genomic
regions) were compared to identify shared
cis-regulatory modules. The identified cis
clusters included the experimental validated
regulatory regions in each of these genes
and comprised of multiple muscle
regulatory cis-elements (Wasserman and
Fickett, 1998) . The horizontal lines are the
genomic sequences of the base species
(human in this case). Yellow vertical bars
are the exons. The different colored boxes
represent the different cis-clusters.
Limitations:
1. Cis-elements that are not conserved across
the orthologous genes cannot be identified
even though they occur in regions of
sequence similarity across the species..
2. Cis-elements that occur in non-aligned
genomic regions across the two species
cannot be identified by this approach.
References:
http://trafac.chmcc.org
Support:
HHMI and NIEHS U01 ES11038 Mouse Centers Genomics Consortium
Conclusions:
1. The combinatorial approach of identifying coordinately regulated genes that
share compositional similarity of cis-elements within their orthologous non-
coding genomic regions offers a powerful filter that can aid in the
identification of potential functional cis-clusters.
2. Peak analyzer appears capable of identifying known and novel regulatory
modules within a cluster of coordinately regulated genes.
3. These novel cis-element modules may be useable as probes for genome wide
annotation of potential regulatory regions.
Recommended