View
0
Download
0
Category
Preview:
Citation preview
Enhancing the Efficiency of CRISPR/Cas9 Precise Gene Editing for Cystic Fibrosis Gene Therapy
by
Kyle E. Seigel
A thesis submitted in conformity with the requirements for the degree of Master of Science
Department of Laboratory Medicine and Pathobiology University of Toronto
© Copyright by Kyle E. Seigel, 2018
ii
Enhancing the Efficiency of CRISPR/Cas9 Precise Gene Editing for
Cystic Fibrosis Gene Therapy
Kyle E. Seigel
Master of Science
Department of Laboratory Medicine and Pathobiology University of Toronto
2018
Abstract
Cystic fibrosis (CF) is the most common cause of chronic obstructive lung disease in children
and young adults, yet there is no cure for this disease. Intimations of curative strategies have
emerged from gene therapy, but these approaches have failed in clinical trials due to insufficient
safety and efficacy profiles. The molecular technology necessary to overcome preeminent
challenges in gene therapy may reside in programmable nucleases – namely CRISPR/Cas9 –
which allow for site-specific genomic integration of therapeutic transgenes. However, the
clinical utility of these technologies is limited by inherently low efficiencies. Here, we use flow
cytometry and PCR assays to demonstrate the efficacy of perturbing DNA repair to overcome
such limitations. We demonstrate that overexpressing CtIP and EXO1-4D can enhance the
efficiency of CRISPR/Cas9-directed transgene integration by ~3- and ~6-fold, respectively.
These discoveries may provide necessary impetus for translating gene therapies into clinical
realities for genetic diseases such as CF.
iii
Acknowledgements
My thesis work and development as a scientist would not have been possible without the
professional wisdom, scientific expertise and personal support of a number of individuals. I would
first like to extend my utmost thanks and gratitude to my supervisor, Dr. Jim Hu. Your expertise
were foundational to the development of this project, and your continual encouragement and
support helped guide me through the adversities of science. I appreciate your persistent attention
to my experiments and challenges in the lab, regardless of how many other things you had going
on. This is a true testament to how much you care for your students; for their personal and
professional development as scientists. I would also like to thank my committee members: Dr.
Martha Brown, Dr. Grant Brown, and Dr. Andras Nagy. The diverse range of scientific expertise
that each of you contributed were instrumental to the progression of my project, and I am grateful
for your many hours of undivided attention. A special thanks to Dr. Martha Brown, who
continually made herself available to discuss my research, as well as to provide technical and
moral support. To Dr. Harry Elsholtz, thank you for your professional guidance and support
throughout the duration of my studies.
My fellow lab members were also extremely helpful in the development of this project. Dr. Huibi
Cao, Linda Li, Cathleen Duan, Fushan Shi, Emily Xia, Amy Zhang, Peter Zhou, Alexandra
Georgiou, Leo Yang, and Randolph Kissoon have all contributed to this work in some capacity.
Thank you for your helpful contributions in lab meetings, technical support at the bench, and
continual friendships. I would also like to extend my gratitude to all the staff in The SickKids-
UHN Flow and Mass Cytometry Facility at PGCRL. In particular, thank you Dr. Sherry Zhao and
Dr. Emily Reddy for tremendous technical support in designing experiments, operating flow
cytometers and analyzing data.
My heartfelt thanks to my family, without whom none of this work would have been possible. To
my Mom and Dad, and my brothers Jordan and Mathew: your unconditional love and support
form the bedrock upon which my career has thus far been built. Although none of you know
precisely what it is that I do, you have continuously supported my endeavours throughout my
academic career without question. Science is a fascinating and tremendously rewarding pursuit,
but it is not without its hardships. You guys have been there through it all and I am forever
iv
grateful. To my parents in particular, the invaluable sacrifices you have both made for my
education, my interests, personal growth and career development are incalculable, without which
none of this is possible. Finally, to my late grandfather Dr. Harold O. Seigel: Papa, your voracity
for understanding nature and insatiable passion for knowledge reverberate in me to this day; and
your contributions to science and technology have been a continual source of inspiration.
v
Table of Contents
Acknowledgments ....................................................................................................................... iii
Table of Contents ......................................................................................................................... v
List of Tables ............................................................................................................................... vii
List of Figures .............................................................................................................................viii
Abbreviations ............................................................................................................................... ix
CHAPTER 1. INTRODUCTION .............................................................................................. 1
1.1 Cystic fibrosis ........................................................................................................................ 1
1.1.1 CF biochemistry .................................................................................................... 1
1.1.2 CF pathophysiology .............................................................................................. 2
1.1.3 CF therapies .......................................................................................................... 3
1.2 Gene therapy .......................................................................................................................... 4
1.2.1 CF gene therapy .................................................................................................... 6
1.3 Gene editing ........................................................................................................................... 7
1.3.1 Zinc finger nucleases ............................................................................................. 8
1.3.2 TALENs ............................................................................................................... 10
1.3.3 CRISPR ............................................................................................................... 11
1.3.3.1 Discovery and mechanisms ................................................................... 11
1.3.3.2 Genome engineering ............................................................................. 12
1.3.3.3 CRISPR/Cas9 biochemistry and engineered Cas9 variants .................. 13
1.3.3.3.1 dCas9............................................................................. 15
1.3.3.3.2 Base pair editors ............................................................ 16
1.3.3.3.3 sgRNA engineering ....................................................... 17
1.3.3.4 CRISPR/Cas9 in genetics and disease modeling .................................. 17
1.3.3.5 CRISPR/Cas9 in gene and cell therapies .............................................. 18
1.4 DNA double-strand breaks .................................................................................................. 21
1.4.1 Non-homologous end-joining ............................................................................. 22
1.4.2 Homology-directed repair ................................................................................... 23
1.4.3 DSB repair pathway choice ................................................................................. 24
vi
1.5 Enhancing gene targeting efficiency by perturbing DSB repair .......................................... 29
CHAPTER 2. HYPOTHESIS AND OBJECTIVES ............................................................... 31
2.1 Rationale .............................................................................................................................. 31
2.1.1 CDK1 .................................................................................................................. 31
2.1.2 Post-translational modification-mimics .............................................................. 31
2.1.3 CtIP ..................................................................................................................... 32
2.1.4 EXO1 .................................................................................................................. 33
2.2 Hypothesis ........................................................................................................................... 34
2.3 Objectives ............................................................................................................................ 34
CHAPTER 3. MATERIALS AND METHODS ..................................................................... 35
3.1 Plasmids ............................................................................................................................... 35
3.2 Flow cytometry .................................................................................................................... 36
3.3 Junction PCR ....................................................................................................................... 37
3.4 Generating the IB3-1-CFTR-EGFP cell line ....................................................................... 37
3.4.1 Transfection ........................................................................................................ 37
3.4.2 FACS .................................................................................................................. 38
3.4.3 Puromycin selection and limited dilution ........................................................... 38
3.5 ssDNA donors ....................................................................................................................... 39
3.6 T7E1 assay ............................................................................................................................ 39
3.7 Data analysis ......................................................................................................................... 40
CHAPTER 4. RESULTS .......................................................................................................... 41
4.1 Flow cytometry assay for measuring gene targeting efficiency ........................................... 41
4.2 CtIP and EXO1-4D significantly enhance gene targeting efficiency .................................. 44
4.3 IB3-1-CFTR-EGFP cell line ................................................................................................ 51
CHAPTER 5. DISCUSSION.................................................................................................... 57
5.1 Future directions ................................................................................................................... 61
5.2 Conclusion ........................................................................................................................... 66
REFERENCES ......................................................................................................................... 68
vii
List of Tables
Table 1. DSB repair proteins and associated mutations
viii
List of Figures
Figure 1. CRISPR/Cas9-directed genomic DNA cleavage.
Figure 2. NHEJ is used to repair DSBs in G1 when CDK activity is low.
Figure 3. HDR is used to repair DSBs in S/G2 when CDK activity is high.
Figure 4. Schematic diagram of mCherry gene integration into the AAVS1 locus.
Figure 5. Enhancement of precise gene targeting efficiency by CDK1, CtIP and EXO1-4D in
HEK293 cells.
Figure 6. Enhancement of precise gene targeting efficiency by CtIP and EXO1-4D in HEK293
cells as measured by flow cytometry.
Figure 7. Enhancement of precise gene targeting efficiency by SCR7 in HEK293 cells.
Figure 8. Junction PCR demonstrating the enhancement of precise gene targeting efficiency by
CtIP and EXO1-4D in HEK293 cells.
Figure 9. Schematic representation of the IB3-1-CFTR-EGFP cell line and the associated
colour-switch assay.
Figure 10. Investigating the identity and CRISPR cleavage efficiency of IB3-1-CFTR-EGFP
cell line clones.
Figure 11. IB3-1 CFTR homology arm sequencing.
Figure 12. Single-stranded mCherry donor production.
ix
Abbreviations
53BP1 p53-binding protein 1
AAV Adeno-associated virus
AAVS1 Adeno-associated virus integration site 1
ABC ATP-binding cassette
AdV Adenovirus
Arg Arginine
ASL Airway surface liquid
Asp Aspartic acid
ATM Ataxia telangiectasia mutated
ATP Adenosine triphosphate
BG Benzylguanine
BIR Break-induced replication
cDNA Complementary DNA
CDK Cyclin-dependent kinase
CF Cystic fibrosis
CFTR Cystic fibrosis transmembrane conductance regulator
CRISPR Clustered regularly interspaced short palindromic repeats
crRNA CRISPR RNA
CtIP Carboxyl-terminal binding protein (CtBP)-interacting protein
dCas9 dead-Cas9
DMSO Dimethyl sulfoxide
DNA-PKcs DNA-dependent protein kinase catalytic subunit
DSB Double-strand break
dsDNA Double-stranded DNA
EDTA Ethylenediaminetetraacetic acid
EGFP Enhanced green fluorescence protein
ENaC Epithelium sodium channel
ER Endoplasmic reticulum
ESC Embryonic stem cell
x
EXO1 Exonuclease 1
FACS Fluorescence-activated cell sorting
FBS Fetal bovine serum
Glu Glutamic acid
GTE Gene targeting efficiency
HD-Ad Helper-dependent adenovirus
HDR Homology-directed repair
HEK293 Human embryonic kidney 293
HPV Human papillomavirus
HR Homologous recombination
HSPC Hematopoietic stem and progenitor cells
Indel Insertion or deletion
iPSC Induced pluripotent stem cell
LDL Low-density lipoprotein
LNP Lipid nanoparticle
MEM Minimal essential media
MMEJ Microhomology-mediated end-joining
MRN MRE11:RAD50:NBS1
MSD Membrane-spanning domain
NBD Nucleotide binding domain
NHEJ Non-homologous end-joining
NPG Non-obese diabetic (NOD)/Prkdcscid/IL-2Rnull
NSC Neural stem cell
NSG Immunodeficient, non-obese diabetic (NOD), severe combined immunodeficient
(SCID) c-/-
ORF Open reading frame
p(A) Polyadenylation
PAM Protospacer-adjacent motif
PCR Polymerase chain reaction
PBS Phosphate-buffered saline
PKA Protein kinase A
PSC Pluripotent stem cell
xi
PTM Post-translational modification
RIPA Radioimmunoprecipitation assay
RNAi RNA interference
RNP Ribonucleoprotein
RPA Replication protein A
RT-qPCR Reverse transcription quantitative real-time polymerase chain reaction
RVD Repeat-variable di-residue
SCID Severe combined immunodeficient
SDSA Synthesis-dependent strand annealing
SEM Standard error of the mean
sgRNA Single-guide RNA
SIN Self-inactivating
siRNA Small interfering RNA
SNCA Synuclein alpha
ssDNA Single-stranded DNA
TALE Transcription activator-like effector
TALEN Transcription activator-like effector nuclease
tracrRNA trans-activating CRISPR RNA
WT Wild type
ZF Zinc finger
ZFN Zinc finger nuclease
-RV Gamma-retrovirus
- 1 -
Chapter 1 Introduction
1.1 Cystic fibrosis
Cystic fibrosis (CF) is a life-threatening autosomal recessive disease caused by mutations in the
CF transmembrane conductance regulator (CFTR) gene. CF constitutes the most common cause
of severe chronic obstructive lung disease and exocrine pancreatic dysfunction in children and
young adults. The estimated worldwide incidence of CF is 1 in 2,500-3,000 newborns, and the
disease affects more than 70,000 individuals worldwide1,2. Furthermore, although CF is classified
as a rare disease, it is the most common lethal genetic disease in the Caucasian population1,2.
Disease onset occurs within the first year of life, and approximately two thirds of patients are
diagnosed within this time3. CF-related complications can persist throughout the duration of life,
for which life expectancy is approximately 50 years in the developed world3,4.
1.1.1 CF biochemistry
CFTR is a polytopic transmembrane protein that functions as a chloride (Cl−) and bicarbonate
(HCO3−) channel on the apical membranes of secretory epithelia, such as the lungs, sweat glands,
pancreas, and other exocrine glands5. CFTR is a member of the ATP-Binding Cassette (ABC)
transporter family, which utilize ATP hydrolysis to transport substrates such as ions, toxins,
peptides, drugs, and vitamins across biological membranes6. CFTR has a minimal architecture
common to all ABCs. It is made up of two cytosolic nucleotide binding domains (NBDs) that
undergo dimerization upon ATP hydrolysis, and two membrane-spanning domains (MSDs) that
come together to form a single transmembrane ion transport channel7. Most ABC proteins are
active transporters, and therefore use this modular structure in order to couple ATP hydrolysis to
transport substrates against a concentration gradient6. In contrast, ATP hydrolysis powers the
opening and closing of the CFTR ion channel, which in turn mediates passive electrochemical
diffusion of Cl- and HCO3- across cell membranes8,9. CFTR is also unique for its intrinsically
- 2 -
disordered regulatory domain (R domain), which controls channel activity in response to
phosphorylation by cAMP-dependent protein kinases, such as protein kinase A (PKA)8,9.
CF disease pathology is a consequence of structural, functional and/or regulatory defects in CFTR
due to genetic mutation. More than 2000 CFTR sequence variants have been identified to date,
including missense and nonsense mutations, frameshifts, and indels. There are various
mechanisms by which these mutations can result in CFTR dysfunction, the most notable of which
is defective protein processing. This is exemplified by the most common disease-causing CFTR
mutation, the F508 deletion in the NBD1 domain10–12. Almost 50% of CF patients are
homozygous for this mutation, and ~85% carry one F508 allele4. F508 disrupts normal
topography on the NBD1 surface, such that stabilizing interactions at the interface of NBD1 and
MSDs are prevented13. This local structural defect therefore interferes with domain-domain
interactions and prevents F508 CFTR from attaining a native conformation. As a consequence,
F508 CFTR forms aggregate-prone structures that are recognized by quality control mechanisms
in the ER during CFTR maturation, leading to ubiquitination and subsequent proteasome-
mediated degradation14,15. This ultimately prevents functional CFTR trafficking to the plasma
membrane. Other mutations are rare, but can cause CFTR dysfunction via defective channel
regulation or conduction, insufficient protein production, or reduced protein stability16.
1.1.2 CF pathophysiology
In the disease state, CFTR dysfunction results in Cl- and HCO3- impermeability across epithelial
apical membranes5. Such defective ion conductivity alters the quantity and composition of
epithelial fluids, in turn precipitating organ dysfunction. The widespread nature of this
abnormality in various tissues is concordant with the diverse clinical manifestations of CF disease
pathology, namely respiratory disease, intestinal obstruction, pancreatic dysfunction, salty sweat
and male infertility5. However, the main cause of morbidity and mortality in CF is progressive
lung disease17.
CF respiratory pathology is a consequence of defective CFTR-regulated ion homeostasis between
lung epithelia and the airway surface liquid (ASL), resulting in epithelial dehydration and
- 3 -
thickened mucus. The ASL is a region of fluid on the apical surface of airway epithelia, which is
composed of a periciliary layer adjacent to the epithelium and a superficial mucus layer. The
mucus layer contains gel-forming mucins that trap inhaled particles, which are subsequently
removed from the lung via mucociliary clearance18. Furthermore, antimicrobial factors within the
ASL are involved in innate and adaptive host immunity to protect the airways from inhaled
pathogens. The ASL requires a tightly regulated volume, pH, ionic and nutrient content for
sufficient antimicrobial activity, proper ciliary function and mucociliary clearance18.
CFTR directly controls anion flow between the airway epithelia and the ASL by mediating HCO3-
and Cl- movement, and indirectly by controlling Na+ diffusion via the epithelium sodium channel
(ENaC)19,20. CFTR normally inhibits ENaC, but its loss of function in CF results in excessive Na+
flow into epithelia. These electrochemical changes draw water into the epithelium, depleting ASL
depth and immersing cilia in the mucus layer, an environment in which their movement is severely
impaired. As a consequence, mucus builds up and airways become obstructed due to insufficient
mucociliary clearance21. Viscous and nutrient-rich mucus in turn provide a favourable
environment for bacterial colonization. Furthermore, the functions of many antimicrobial factors
are inhibited in the abnormally acidified ASL, a consequence of defective CFTR-mediated HCO3-
transport18. Consequently, CF patients suffer from chronic bacterial infections that facilitate
characteristic features of CF lung pathology, such as inflammation and progressive lung disease
involving tissue remodelling.
1.1.3 CF therapies
CF survival has dramatically improved from 5 years in the 1960s to now up to 50 years due to
clinical advances in treating symptoms and slowing disease progression3,4. The significant
progress made in extending life expectancy is largely a result of standardized multi-organ
therapies. Such treatments include antibiotics for bacterial lung infections – especially
Pseudomonas aeruginosa, a hallmark of CF – in addition to mucolytics that release thick
pulmonary mucus, chest physiotherapy, and high-calorie nutrition22. Lung transplantation
programs have also been beneficial23, and collectively these treatments have resulted in half of
CF patients being represented by adults in numerous countries24.
- 4 -
Novel mutation-specific therapies have recently been introduced into the clinic and many others
are in development or clinical trials. High-throughput drug screening has led to the identification
and development of two categories of mutation-specific therapies: ‘correctors’ that target the
CFTR processing defect, and ‘potentiators’ that improve mutant CFTR channel activity. Ivacaftor,
a CFTR potentiator, has been clinically successful in improving CFTR ion transport and
pulmonary function in patients with the G551D CFTR genotype25. However, these patients still
require additional therapies including pancreatic enzyme replacement, inhaled mucolytics, and
antibiotics16. Furthermore, this class of CFTR mutations accounts for only 4-5% of CF patients4.
As previously mentioned, ~85% of CF patients have the 'F508 CFTR defect. The drug
lumacaftor, a ‘corrector’, initially showed promise in rescuing the 'F508 CFTR folding defect in
primary cells26. However, this drug proved ineffective in improving lung function in 'F508
homozygous patients in clinical trials27. Lumacaftor-ivacaftor combinatorial therapy has also been
explored (Orkambi) for the 'F508 defect. Although this therapy has been approved due to success
in clinical trials, the overall efficacy was modest at best28. Accordingly, no effective treatments
are available for 'F508 CFTR patients, the most common CF-causing mutation.
Overall, despite clinical advances in treating symptoms and slowing disease progression, there is
still no cure for CF. As small molecules have proven inadequate for dramatically improving CF
pathology, distinct efforts have been made to correct the underlying source of the disorder, i.e.,
the CFTR genetic defect. For these purposes, investigators have long been interested in the
prospect of gene therapy for CF ever since the CFTR gene was discovered29.
1.2 Gene therapy
Scientists, clinicians and the general public have long been captivated by gene therapy, which
involves the correction or replacement of malfunctioning genes that give rise to disease
pathologies. Considerable interest in this approach is warranted due to the potential to treat
diseases at their genetic origins. Classically, gene therapy has been based on non-targeted,
retroviral-mediated insertion of therapeutic transgenes into the host genome. The approach was
initially based on gamma-retroviruses (J-RVs), but was evidently accompanied by numerous
limitations and salient risk factors, namely, poor gene transfer efficiencies in progenitor cells and
- 5 -
tumorigenesis due to vector insertion near oncogenes30–34. Accordingly, J-RVs were largely
replaced by safer and more efficacious vectors, such as self-inactivating-J-RVs (SIN-J-RVs) and
lentiviruses, which have found success in a number of phase 1/2 clinical trials in the past few
years. Notably, ex vivo gene transfer and subsequent transplantation of autologous hematopoietic
stem and progenitor cells (HSPCs) has been clinically useful in treating the genetic immune
diseases Wiskott-Aldrich syndrome (WAS)35,36 and X-linked severe combined immunodeficiency
(SCID-X1)37; as well as the blood disease E-thalassaemia38; and the neurodegenerative storage
diseases adrenoleukodystrophy39 and metachromatic leukodystrophy40.
Despite clinical success using improved delivery vectors, integrating viral vectors carry risks of
transcriptional silencing, insertional mutagenesis, and oncogenic transformation41–43.
Accordingly, lipid nanoparticles (LNPs) have emerged as an alternative to viral-mediated gene
delivery. LNPs similarly have the capacity to protect nucleic acid contents from degradation while
allowing cellular uptake of their cargo. However, these delivery methods are relatively generic
and cell type-nonspecific. Nonetheless, there are a number of clinical trials currently investigating
the utility of LNP-delivered siRNAs for the treatment of viral infections, cardiovascular diseases
as well as cancer44. In the realm of genetic diseases, LNPs have thus far shown preclinical utility
for the treatment of ocular45,46, auditory47, and hepatic disorders48.
Non-integrating viral vectors have also been successfully used for gene therapy applications.
These viral delivery platforms are maintained as episomal vectors expressing therapeutic
transgenes. Therefore, while avoiding potential insertional mutagenesis, the lack of permanent
genetic modifications restricts the utility of these approaches to targeting low-turnover or non-
proliferating cells. Various serotypes of adeno-associated viruses (AAVs) have been employed
for these purposes. For example, AAVs are able to stably express coagulation factor IX (FIX) – a
protein deficient in hemophilia B patients – from non-proliferating hepatocytes in animal
models49. Improvements in AAV vector design have since resulted in successful clinical
treatments of hemophilia B using this gene therapy approach50. Furthermore, AAV-based gene
therapies for type 2 Leber congenital amaurosis (LCA) and retinitis pigmentosa (both inherited
retinal diseases (IRDs)), recently became the first FDA-approved in vivo gene therapies for
clinical commercial use in the United States under the brand name LUXTURNATM (voretigene
neparvovec, AAV2-hRPE65v2) by Spark Therapeutics (NCT00999609)51.
- 6 -
1.2.1 CF gene therapy
Although CF affects multiple organs of the body, the primary cause of morbidity and mortality is
progressive lung disease. Furthermore, because of the monogenic nature of CF and the
accessibility of airway epithelia to gene therapy vectors, corrective gene therapy for CF lung
disease has been a major effort for the last few decades. Three years after the discovery of the
CFTR gene in 198929, Rosenfeld et al. successfully delivered replication-deficient first generation
adenovirus (AdV) carrying CFTR cDNA to the airway epithelium of rats, from which transgenic
CFTR mRNA and protein could be expressed52. AdVs are double-stranded, non-integrating
episomal viruses with a natural tropism for airway epithelial cells53. Furthermore, AdVs possess
high transduction efficiencies and relatively low virulence, and were therefore an obvious first
choice for CF gene therapy. Alternative non-viral liposomal CFTR delivery had also partially
corrected Cl- transport defects in the tracheal epithelium of CFTR knockout mice54. These
promising preclinical studies precipitated the first CF gene therapy trial. Although the study was
small and not placebo-controlled, Zabner et al. demonstrated correction of Cl- transport defects in
the nasal epithelium of three CF patients using first generation AdV carrying CFTR cDNA55.
Similar results were also obtained using liposome-mediated gene transfer56. Since then, nine
additional AdV CF gene therapy trials have been conducted57–65. However, this approach has
ultimately failed due to inefficient gene transfer, unsustainable gene expression, and the induction
of immune responses that preclude repeated administrations.
AAVs have also been extensively investigated as a delivery vector for CF gene therapy. Similar
to AdVs, AAVs are non-pathogenic and remain episomal in transduced cells in vivo66. A number
of CF gene therapy trials using AAV vectors have been conducted since 199867–72. Although
initial trials demonstrated sufficient safety profiles, they were ultimately discontinued due to lack
of efficacy in improving lung function. More recent studies utilizing pseudotyped lentiviral
vectors have demonstrated some efficacy in delivering genes to the airway of mice and pigs73–77,
however these have yet to be investigated in clinical trials.
Due to the evident limitations associated with the aforementioned vector delivery systems, our
group and others have been investigating the utility of helper-dependent adenoviral (HD-Ad)
vectors. HD-Ad vectors are based on AdV serotype 5 with all viral coding sequences deleted78.
Accordingly, these vectors exhibit stable, long-term transgene expression due to attenuated
- 7 -
immunogenicity, while maintaining adenoviral tropism for epithelial cells79. Our group has
demonstrated that CFTR knockout mice are protected from acute lung infection following HD-
Ad delivery of the CFTR gene to mouse airways80. Furthermore, this delivery elicited stable
transgene expression for up to 15 weeks in the absence of measurable pulmonary inflammation.
HD-Ad vectors have also been used to deliver transgenes to human primary epithelial cells81,82,
as well as airway epithelia and submucosal glands of pigs in vivo83. However, a major challenge
here is that the airway epithelium is a dynamic tissue that undergoes slow yet constant turnover,
and therefore therapeutic transgene expression will be limited accordingly84. This limitation
illuminates a more broadly diffuse challenge in gene therapy applications. That is, the efficacy of
safer, non-integrating vectors is limited by the half-life and finitude of their cognate target cells.
Furthermore, although stable transgene expression can be attained using integrating viral vectors,
untargeted integration of synthetic genetic elements into the host genome carries risks of
transcriptional silencing, insertional mutagenesis, and oncogenic transformation41–43.
The requisite technology for ultimately surmounting these barriers have recently come to light
with the dawn of programmable nucleases. Such technologies endow the capacity to make
targeted and permanent site-specific genomic edits, such as knocking down endogenous genes, or
precisely knocking in exogenous transgenes. These technologies can therefore mediate permanent
transgene expression while avoiding insertional mutagenesis associated with integrating vectors.
Furthermore, our group has recently demonstrated the capacity for targeting porcine airway
stem/progenitor cells in vivo85. Our modern approach to CF gene therapy is thus to correct CFTR
mutations into the genome of airway stem/progenitor cells using programmable nucleases, in
order to permanently correct CF genetic defects and consequent pathophysiology.
1.3 Gene editing
Classical genetics in the time of Mendel and Morgan was empirically limited to spontaneous
mutations as the objects of study. The first hints of deliberate genetic manipulation came from
Muller (1927)86, and Auerbach & Robson (1947)87, who demonstrated that radiation and chemical
treatment, respectively, could potentiate the rate of mutagenesis. More advanced molecular
technologies subsequently harnessed inducible transposable elements to transfer genetic
- 8 -
information. However, these procedures were all limited to inducing undirected and stochastic
mutations. It wasn’t until the late 1970’s that the first targeted genomic manipulations were
produced in yeast and mammalian cells by homologous recombination (HR)83–87. HR can be
utilized to transfer genetic information between two homologous genetic elements, and will be
discussed in more detail in subsequent sections. Utilizing spontaneous HR for genomic
manipulation was targeted and precise, yet suffered great practical inefficiencies requiring
powerful selection and laborious characterization83–87.
The key to high-efficiency, precise genome editing was discovered serendipitously through the
study of DNA damage and repair, specifically DNA double-strand breaks (DSBs). It was found
that the generation of DSBs by ionizing radiation led to sister chromatid crossover events92, and
that DSBs are intentionally induced by meiotic cells to facilitate genetic recombination between
homologous sequences93. These findings precipitated experiments using specific endonucleases
to facilitate HR and targeted gene transfer, which ultimately nucleated modern genome
engineering94–96. Artificial nucleases can now be deliberately programmed, endowing researchers
with the technical capacity to introduce DSBs at predetermined genomic loci. Following a
targeted genomic DSB, the requisite DNA repair mechanisms can then be hijacked to introduce
specific genetic modifications. Briefly, gene knock-outs can be generated if the break is repaired
by error-prone non-homologous end-joining (NHEJ). In contrast, homology-directed repair
(HDR) – which encompasses a number of distinct mechanisms including HR – is required for
precise gene repair or site-specific integration of transgenes.
1.3.1 Zinc finger nucleases
Zinc fingers (ZFs) are the most common DNA-binding domains found in the human genome. ZFs
are comprised of many subclasses, of which Cys2His2 has been repurposed for genome
engineering. Cys2His2 ZF domains are comprised of tandemly repeating zinc-binding motifs of
30 amino acids, in which positions -1, 3, and 6 mediate direct contact with three contiguous base
pairs of DNA and contribute to the binding specificity of the motif97,98. Of the natural Cys2His2
domains, Zif-268 has proven the most stable and versatile framework upon to which to engineer
- 9 -
ZFs with novel binding specificities. Modular zinc finger domains with unique specificities can
then be linked in tandem in order to recognize novel DNA targets 9-18 bp in length99.
Fusion of ZF tandem repeats to an unbiased restriction endonuclease effectively generates a
programmable, site-specific endonuclease. This was first successfully done by Kim et al., who
fused the cleavage domain of the FokI endonuclease to a ZF array, in turn creating the first zinc
finger nuclease (ZFN)100. Because FokI is an obligate dimer, effective DSB generation requires
two ZFNs concomitantly targeting adjacent DNA loci. Despite the evident utility of ZFNs, target
site overlap and crosstalk between ZF domains significantly complicate the prediction of binding
specificities, and therefore the production of ZFNs targeting user-defined sequences101–103.
Therefore, as there is no simple universal code for matching ZFN amino acid sequence to target
DNA sequence, selection strategies are often required for the production of ZFNs104,105. ZFNs
also appear to have a limited targeting range106. Nonetheless, ZFNs were essentially the first
generation of programmable site-specific endonucleases, and accordingly were the first with
prospective biotechnological and clinical utility.
ZFNs have been successfully utilized for genome engineering in swine107, cattle108, zebrafish109,
mice110, as well as human embryonic stem cells (ESCs) and induced pluripotent stem cells
(iPSCs)111. Prospective clinical utility has been demonstrated for correcting haemophilia112 and
sickle-cell in mice113; as well as 1-antitrypsin deficiency in iPSCs114; and Parkinson’s disease-
associated alpha-synuclein (SNCA) gene in patient fibroblast-derived iPSCs115. These
technologies have since been largely replaced by more powerful and robust programmable
nucleases. However, there are a number of active and completed clinical trials based on the
pioneering ZFNs due to their chronological primacy. For example, Phase I clinical trials
(NCT00842634) have investigated the safety and efficacy of transplantation of autologous CD4+
T cells edited by ZFNs ex vivo to disrupt the CCR5 gene for the treatment of HIV-1116. However,
treatment elicited severe adverse effects in some patients and variable efficacies, as viremia was
undetectable in only a single patient by the endpoint of the trial. Other active Phase I clinical trials
include those for the treatment of mucopolysaccharidosis (MPS) (NCT02702115,
NCT03041324), and HPV-positive cervical intraepithelial neoplasia (NCT02800369).
- 10 -
1.3.2 TALENs
Transcription activator-like effector (TALE) proteins are critical virulence factors of the
phytopathogenic bacterial genus Xanthomonas, which mediate host cell reprogramming by
mimicking eukaryotic transcription factors117–120. TALEs are DNA-binding proteins characterized
by repeating arrays of 33-35 amino acids, where each array recognizes a single base pair. The
repeat-variable di-residue (RVD) region harbours two amino acids that determine the specificity
of base pair recognition within each repeat121–123. Furthermore, modular TALE repeats can be
linked to FokI in order to generate unique site-specific endonucleases that recognize programmed
DNA sequences, analogous to ZFNs. In contrast to ZFNs, however, the simplicity of RVD base
pair recognition enables straightforward theoretical design of TALENs for targeting user-defined
DNA sequences. TALENs have also demonstrated a greater DNA targeting range with improved
specificities124–126. The principle impediments of TALEN usage are large coding sizes (~10 kb)
and the repeating nature of the RVDs, which impede efficient assembly and packaging of dimeric
TALENs into size-constrained vectors for mammalian cell delivery127. However, investigators
have devised superior methods by which to assemble TALENs, and have concurrently
demonstrated that TALENs have the capacity to target virtually any DNA sequence128–130.
Accordingly, TALEN libraries targeting over 18,000 human protein-coding genes have been
constructed using high-throughput Golden-Gate cloning131.
As with ZFNs, TALENs have been broadly applied for biotechnology and biomedicine, as they
have been applied for genome editing in roundworm132, silkworm133, fruitfly134, frog135, cricket136,
zebrafish137, rat138, cow and swine139. Delivery of two TALEN pairs targeting the same
chromosome has been demonstrated to elicit large indels (>6 kb) in pigs139. These authors used
TALENs to generate mono- and biallelic LDLR knockout pigs as models of familial
hypercholesterolemia139. Interestingly, TALENs have also been used to disrupt particular loci in
the rice genome to confer resistance to pathogenic TALEs in Xanthomonas infection (the source
from which this technology was initially discovered)140. After demonstrating utility for genome
editing in human somatic125 and pluripotent stem cells141, TALENs were subsequently applied as
preclinical anti-viral therapies for HIV infection142 and hepatitis B143. Furthermore, Phase I
clinical trials have been approved for the use of TALENs to treat HPV-related malignant
neoplasms (NCT03226470, NCT03057912).
- 11 -
1.3.3 CRISPR
1.3.3.1 Discovery and mechanisms
When investigating chemical mutagenesis in the 1940s, Auerbach and Robson pronounced that,
“…it could be hoped that among chemical mutagens there might be some with particular affinities
for individual genes. Detection of such substances not only would be of high theoretical interest
but would also open up the long-sought-for way to the production of directed mutations.”87 It
turns out that “such substances” had already been discovered eons ago by archaea, and integrated
into an adaptive genetic network nested within an evolutionary arms race against infectious
plasmids and phages. These prokaryotic immune systems are now known as the clustered
regularly interspaced short palindromic repeats (CRISPR).
Although named differently at the time, CRISPR systems were initially discovered
serendipitously through investigating the genetic origins of alkaline phosphatase isozyme
conversion in Escherichia coli144. The authors noted a peculiar set of repetitive sequences with
high sequence homology interspaced by variable spacers downstream of their gene of interest.
This investigation was indeed the first encounter with CRISPR sequences. Advancements in DNA
sequencing technologies in the 1990s uncovered these repetitive sequences in myriads of bacteria
and archaea. Despite numerous theories, however, their function remained largely enigmatic. It
wasn’t until 2000 that Mojica et al. recognized that these sequences must be functionally
related145. Furthermore, accumulating genomic data eventually revealed CRISPR-associated (cas)
genes adjacent to the repetitive CRISPR loci. These cas genes harboured recognizable subunits
indicating functions in DNA repair and recombination, transcriptional regulation and
chromosome segregation. Accordingly, their proximal association suggested they were involved
in generating the CRISPR loci themselves146.
The functional role of CRISPR was first glimpsed independently by a number of groups who
discovered that the variable spacer regions separating the repeats were homologous to phage
DNA147–149. Importantly, they showed that phages are unable to infect host strains containing
CRISPR elements with homology to their genomes. These phenomena were also observed in the
dairy industry, where investigators were selecting industrial bacteria resistant to phage attack.
Here, the authors provided the first empirical evidence for the involvement of cas genes in the
- 12 -
generation of CRISPR loci, and additionally as the enzymatic effectors of acquired phage
resistance150. These discoveries demonstrated that CRISPR can generate inheritable genetic
libraries of foreign genetic material, which function as part of a cellular immune system akin to
eukaryotic RNA interference (RNAi). Empirical evidence validated this model in subsequent
years151.
The CRISPR-Cas systems have been categorized into two classes (I and II), and further
subdivided into six types (I-VI)152. Although these subcategories exhibit distinct enzymes and
nuanced biochemical pathways, they share the same overarching functional architecture:
adaption, expression, and interference. The adaption stage is dependent on Cas1 and Cas2, which
form a multiprotein complex and mediate integration of short regions foreign DNA in between
CRISPR repeats153. These sequences are known as ‘spacers’, and are dependent on the presence
of a neighbouring protospacer-adjacent motif (PAM) on the cognate foreign DNA. PAM motifs
are typically only a few nucleotides long, and they ensure correct target recognition while
avoiding host self-cleavage154,155. The expression stage is characterized by transcription of the
CRISPR array into a precursor transcript (pre-crRNA), which is subsequently bound by multi-
subunit CRISPR RNA (crRNA)-effector complexes156–158, or, in type II systems, by a single
multi-domain Cas9 protein159. Following complex formation, mature crRNA is generated via
RNA endonuclease activity160, or a mechanism involving concerted action of RNase III and trans-
activating CRISPR RNA (tracrRNA)161. These RNA-protein complexes are then responsible for
mediating the interference module. Specifically, the activated crRNA-effector complexes
recognize the cognate target DNA (i.e., a foreign virus or plasmid) through specific base pair
interactions between the target DNA and the homologous spacer region of the crRNA. Target
DNA cleavage is then facilitated by a variety of nuclease domains embodied within the crRNA-
effector complexes, thus degrading the foreign DNA159,162.
1.3.3.2 Genome engineering
CRISPR-Cas systems are evidently comprised of multiple interacting enzymes, auxiliary proteins,
RNA and DNA molecules. Amongst the variety of CRISPR-Cas systems, however, the type II
CRISPR-Cas9 system is distinctly parsimonious, requiring only tracrRNA, crRNA, Cas9
- 13 -
nuclease, and host factor RNase III as necessary and sufficient for target DNA cleavage in
vitro163,164 and in vivo165,166. Accordingly, type II CRISPR-Cas9 has emerged as the archetypal
system, and has been the most widely repurposed and engineered. In fact, Jinek et al. showed that
tracrRNA and crRNA can be combined into a chimeric single-guide RNA (sgRNA)163. This
effectively reduced the necessary components for Cas9-directed DNA cleavage and has therefore
increased the versatility for biotechnological applications. The modern genome engineering
toolkit now consists of ectopic Cas9 (typically purified and codon optimized from Streptococcus
pyogenes), and a sgRNA harbouring 20 nt of complementarity to the target DNA sequence.
Selection of target DNA sequences are limited only by the presence of a neighbouring PAM
sequence, which in the case of Cas9 is only ‘NGG’. This system is therefore highly versatile,
allowing programmable and directed DNA cleavage at virtually any region within the genome of
a variety of organisms.
CRISPR/Cas9 has numerous advantages over preceding technologies like ZFNs and TALENs.
Namely, both ZFNs and TALENs must be expressed as pairs for effective cleavage, and require
design and production of novel proteins for targeting distinct genomic loci. In contrast, a single
Cas9 and sgRNA are sufficient for DNA cleavage, and targeting novel loci simply requires the
production of new sgRNA sequences (~20 nt). The nature of RNA-guided targeting also allows
for robust multiplexing approaches by expressing multiple sgRNAs, whereas multiplexing with
ZFNs or TALENs was severely limited by cloning constraints. The diverse targeting capacities
and ease of CRISPR/Cas9 design and production thus render this technology superior to preceding
nucleases. Accordingly, once the requisite components for DNA cleavage had been understood163,
CRISPR/Cas9 was rapidly applied for genomic engineering in bacteria167, yeast168, as well as
mouse and human cell lines169,170. These technologies have also profoundly influenced transgenic
animal production in the livestock industry, as CRISPR/Cas9 has already been used to generate
transgenic swine171,172, cattle173, sheep174, and goats175,176.
1.3.3.3 CRISPR/Cas9 biochemistry and engineered Cas9 variants
Despite the evident utility of CRISPR/Cas9 for genome engineering, a number of salient
limitations are hindering its clinical applications, namely, specificity and efficiency. Accordingly,
- 14 -
a number of research groups have sought to engineer more specific and efficient Cas9 variants.
To these ends, an understanding of Cas9 structural biochemistry has proven indubitably useful.
Cas9 is a multi-domain structure which can be broadly dissected into its recognition (REC) and
nuclease (NUC) lobes. The REC lobe is essential for sgRNA and target DNA binding, and
evidently lacks structural homology with other known proteins and is therefore Cas9-specific177.
In contrast, the NUC lobe is comprised of RuvC and HNH nuclease domains, which share
structural homology with the superfamily of retroviral integrases such as Escherichia coli RuvC178
and Thermus thermophilus RuvC179; and with phage T4 endonuclease180 and Vibrio vulnificus
nuclease181, respectively. The NUC lobe also harbours the PAM-interacting (PI) domain, which
recognizes PAM sequences on the non-complementary strand and confers PAM specificity177.
Following sgRNA:Cas9 complex formation, the active ribonucleoprotein (RNP) complex scans
dsDNA for PAM sequences. PAM recognition then stimulates destabilization of the adjacent
dsDNA and subsequent R-loop formation182 (Fig. 1). During this process, the sgRNA:DNA
heteroduplex is stabilized within a positively charged groove at the interface between the REC
and NUC lobes of Cas9. As the Cas9 complex interrogates DNA for complementarity, sequential
extension of the sgRNA:DNA heteroduplex proceeds distally from the PAM site183. Successful
target recognition is highly dependent on complementarity with the first 10-12 nucleotides
directly adjacent to the PAM sequence, known as the sgRNA ‘seed region’163,169,170,184,185.
Accordingly, mismatches detected early in directional melting prematurely destabilize the ternary
complex and prevent Cas9 nuclease activation183. Following successful target recognition, the
HNH and RuvC nuclease domains cleave the complementary and non-complementary strands,
respectively163,177.
- 15 -
Figure 1. CRISPR/Cas9-directed genomic DNA cleavage. The active sgRNA:Cas9 RNP complex scans dsDNA for PAM sequences (green). PAM recognition stimulates destabilization of the adjacent dsDNA and R-loop formation ensues. The sgRNA:DNA heteroduplex is stabilized within a positively charged groove, and sequential extension of the heteroduplex proceeds distally from the PAM site. sgRNA complementarity with the first 10-12 nucleotides adjacent to the PAM sequence (the seed region) is essential for successful target recognition and nuclease activation. Correct sequence complementarity stimulates the HNH and RuvC nuclease domains to cleave the complementary and non-complementary strands, respectively.
1.3.3.3.1 dCas9
The conservation of RuvC and HNH Cas9 nuclease domains has greatly assisted directed
mutagenesis to generate novel Cas9 functions. Notably, D10A and H840A mutations in the RuvC
and HNH domains, respectively, inactivate the catalytic activity of each respective nuclease. This
has allowed for the generation of the catalytically-inactive dead-Cas9 (dCas9) variant, as well as
Cas9 nickases. dCas9 was initially utilized for endogenous promoter binding and transcriptional
repression in Escherichia coli186 and human cells187. Since then, dCas9 has been widely
repurposed as a fusion protein platform for the recruitment of effector domains to targeted
genomic loci. For example, synthetic transcriptional activators constituted by dCas9-VP64 or -
p65 (subunit of nuclear factor kappa B (NF-B)) fusions have been successfully employed to
activate genes in human cells188,189. Researchers have recently used a similar approach to
simultaneously activate multiple endogenous neurogenic genes in transgenic mice, resulting in
the efficient conversion of astrocytes into functional neurons in vivo190. dCas9 has also been used
T A CCA TGGT
TGGTGACC
TAT C GGTCACA C
TGGTGACCTATACCGGTCACsgRNA
PAM
R-loopGG A GT GCA
complementary strand
RuvC
NGG
HNH
ACC
- 16 -
for targeted epigenomic modifications by fusing dCas9 to histone acetyltransferases (HATs)191.
Furthermore, fusions to the Krüppel-associated box (KRAB) mediates site-specific recruitment
of a heterochromatin-forming complex that facilitates histone methylation and deacetylation192.
dCas9 variants have also been employed to address off-target edits and increase the specificity of
Cas9-induced DNA cleavage. For these purposes, dCas9 has been fused to the unbiased FokI
nuclease. Because FokI is an obligate dimer, effective DSB induction is dependent on mutual on-
target activity of two dCas9-FokI fusions guided by two distinct sgRNAs to adjacent DNA
loci193,194. Although this approach reduces off-target effects, it comes at a cost of reduced
efficiency. A similar strategy has been demonstrated by multiplexing Cas9 nickases, where each
contain a single point mutation (either D10A or H840A), thus relying on mutual on-target activity
of both Cas9 variants for cutting195,196. Other efforts to increase Cas9 specificity have involved
directed mutagenesis to generate Cas9 variants with reduced DNA binding energies, which thus
require more stringent target interactions for nuclease activation. To this end, eSpCas9 has been
engineered by alanine mutagenesis to neutralize positively charged grooves that stabilize DNA
during target interrogation197. Furthermore, targeted alanine mutations that disrupt hydrogen
bonding with the DNA phosphate backbone have generated the SpCas9-HF variant with improved
specificities198. Distinct approaches to improving editing specificity include small molecule- and
light-inducible Cas9 variants199–201. These studies demonstrate that controlling the temporal
window within which Cas9 is active can substantially alleviate off-target edits.
1.3.3.3.2 Base pair editors
Significant engineering efforts have also been invoked to generate programmable single base-pair
editors. Pioneering work by Komor et al. generated the first of such enzymes by fusing dCas9 to
rAPOBEC1 (a cytidine deaminase), which became the first-generation base editor (BE1)202. This
was a significant step forward for genome engineering, as it allowed for directed C→T (or G→A)
base pair substitutions, while alleviating the necessity for DSBs. Although BE1 could generate
efficient substitutions in vitro, in vivo editing efficiencies were up to 36-fold lower. Second- and
third-generation BEs were engineered by adding a uracil DNA glycosylase inhibitor (UGI), and
using a Cas9 nickase instead of dCas9. BE3 has demonstrated superior utility, eliciting permanent
mutations in up to 75% of human cells with minimal indel formation (1%)202. Further
modifications have generated more efficacious fourth-generation base editors203. These
- 17 -
technologies have since been utilized for diverse applications, including targeted base editing in
mouse embryos204; wheat and maize205; as well as improving herbicide resistance in rice and
generating marker-free gene edits in tomato206.
1.3.3.3.3 sgRNA engineering
Another effort of Cas9 engineering has been to manipulate the chemical and structural properties
of the sgRNA, as means to maximize both cleavage efficiency and target specificity. It was
initially found that extending the canonical 20 nucleotide spacer region of the sgRNA does not
improve specificity196. In contrast, sgRNA reduction to 17 or 18 nucleotides can generally
ameliorate off-target effects while maintaining on-target cutting efficiencies for most sgRNAs
tested207,208. However, these truncated sgRNAs have proven incompatible with engineered Cas9
variants like SpCas9-HF due to marginal on-target efficiencies198. The influence of non-canonical
sgRNA nucleotide chemistry on Cas9 genome editing has also been investigated. For instance,
2’-O-methyl (M), 2’-O-methyl 3’phosphorothioate (MS), and 2’-O-methyl 3’thioPACE (MSP)
modifications of terminal nucleotides improves sgRNA intracellular stability, and significantly
increases Cas9 editing efficiencies in CD34+ HSPCs and human primary T cells209. However,
additional off-target activity accompanied these improvements. Further modifications to these
sgRNAs including interspaced 2’-fluoro groups increased stability and specificity but reduced on-
target efficiencies210.
1.3.3.4 CRISPR/Cas9 in genetics and disease modeling
In its brief history, CRISPR/Cas9 has already significantly impacted the way in which we study
genetic networks and the role of genetics in disease pathogenesis. For example, the explosion of
massive genomic data sets that has occurred in this century require powerful high-throughput
methods for annotating genomes. To this end, CRISPR has proven immensely successful for
conducting genome-scale knockout screens in mammalian cell cultures, eliciting substantial
phenotypic effects and high validation rates211–216. dCas9-derived base editors have also been
repurposed for generating diverse libraries of point mutations within targeted windows of
genomic loci, enabling high-throughput screening of genetically-diverse functional variants217,218.
The authors demonstrated the utility of such technologies by applying them to identify novel
- 18 -
mutations conferring resistance to the cancer therapeutics imatinib217 and bortezomib218. For these
high-throughput genetic screens, CRISPR supersedes chemical mutagenesis and RNAi screens.
As chemical mutagenesis is undirected, the genetic origins of measurable phenotypes is unknown,
and can be costly and laborious to investigate. Furthermore, although RNAi is high-throughput
and directed, this approach suffers from low signal-to-noise ratios due to high off-target activity
and incomplete gene knockout219–221.
CRISPR systems have also made significant contributions to stem cell research, endowing
researchers with the capacity to effectively knockout and knock-in genes in ESCs and iPSCs222–
225, as well as transcriptionally regulate genes in ESCs226,227, NSCs228, and iPSCs229. Notably, due
to the simplicity of multiplexing sgRNAs, many of these studies demonstrate the feasibility of
simultaneously modulating multiple genetic pathways. CRISPR has also been extensively applied
for disease modeling and drug screening in ESCs230,231, iPSCs232,233, and a number of organoids.
For example, investigators have utilized CRISPR to generate mutant kidney organoids234, as well
as intestinal organoids as disease models to study congenital disorders235 and colorectal cancer236–
239.
1.3.3.5 CRISPR/Cas9 in gene and cell therapies
The first applications of these tools in human cells were hastily welcomed as the dawn of
biomedical utopias in which human disease will be eradicated under the auspices of
CRISPR/Cas9. Although many of these claims were facile and hyperbolic, these rapidly evolving
technologies will undoubtedly have a profound influence on biology and medicine. The low cost
and technological simplicity of CRISPR/Cas9 endows researchers with unprecedented capacities
for manipulating the genetic profiles of clinically-relevant PSCs, autologous primary cells, and
diseased tissues.
CRISPR/Cas9 has already begun to show promise as powerful gene editing tool for gene and cell
therapy applications, as evidenced by several preclinical studies and recently emerging clinical
trials. For example, LNPs and AAV vectors have been used to deliver Cas9 mRNA and sgRNAs
to the liver of a mouse model of tyrosinemia, achieving up to 6% of genetically corrected
hepatocytes and full rescue of liver damage48. Furthermore, LNPs have also been used to deliver
- 19 -
CRISPR to the murine inner ear, with the capacity to edit the genome of 20% of hair cells47.
Interestingly, the power of CRISPR-induced indels has been demonstrated by the correction of a
splicing defect in the LAMA2 gene240. This gene encodes the D2 chain (Lama2) of the laminin-
211 complex expressed in muscle and Schwann cells. Splicing defects in Lama2 result from exon
skipping, which in turn produce truncated proteins and ultimately give rise to congenital muscular
dystrophy type 1A (MDC1A). Using CRISPR, the authors were able to excise the intronic region
containing the mutation, in turn creating a functional donor splice site to create full-length Lama2
protein. Furthermore, AAV-mediated delivery of this CRISPR system in a mouse model of
MDC1A resulted in substantial improvements in neuromuscular pathology240.
These technologies have also made their way into therapies for cardiovascular diseases. Most
notably, investigators have applied the power of CRISPR-induced indels to disrupt the PCSK9
gene. Naturally occurring loss of function mutations in PCSK9 reduce circulating LDL levels and
attenuate the risk of coronary heart disease by up to 88%241. For these reasons, Ding et al. injected
AdV carrying the requisite CRISPR components targeting exon 1 of hepatic PCSK9 into mice242.
Significant hepatic PCSK9 disruption resulted in a ~90% reduction in circulating PCSK9, and a
consequent ~40% reduction in total blood cholesterol. These studies have since been successfully
reproduced using AAV vectors243, as well as in humanized mouse liver in vivo244.
CRISPR has also made significant contributions to cancer therapeutics, namely chimeric antigen
receptor (CAR) T cell immunotherapies, which have been transformative for the treatment of
refractory blood cancers245. Directed gene manipulations facilitated by CRISPR technology have
generated synthetic CAR T cell variants with enhanced anti-tumour efficacy in vivo246,247, as well
as engineered iPSC-derived natural killer (NK) cells for the treatment of solid tumours248.
Advancements in CRISPR-edited CAR T cell therapies have since translated into clinical trials
for the treatment of relapsed or refractory leukemia and lymphoma (NCT03398967). CRISPR has
additionally been used to disrupt the PDCD1 gene encoding programmed death-1 (PD-1) receptor,
an immune checkpoint receptor which downregulates cytotoxic T cell proliferation and activity.
The activating ligand for this receptor can be overexpressed in tumor cells to subvert the immune
system. Accordingly, CRISPR-induced disruption of PDCD1 in cancer patient-derived primary
T cells enhanced cytotoxic anti-tumor activity249, and in vivo injection of these modified T cells
improved the survival of tumor-bearing mice250. The efficacy of these treatments has since led
- 20 -
to clinical trials for the treatment of Epstein-Barr virus (EBV)-positive advanced stage
malignancies (NCT03044743).
As previously discussed (section 1.2), editing HSPCs for inherited blood disorders are a major
effort of gene and cell therapy applications. Autologous HSPCs can be extracted from patients,
edited ex vivo, and subsequently transplanted back into patients. Patient-derived autologous
HSPCs can now be electroporated ex vivo with CRISPR-expressing plasmids251, mRNA209, or
Cas9:sgRNA RNPs252. The use of RNPs presents a particularly attractive strategy, as it manifests
a ‘hit and run’ approach, effectively minimizing nuclease exposure and therefore toxicity and off-
target edits209. De Ravin et al. utilized this approach to correct mutations in CYBB, the gene
encoding the catalytic centre of NADPH oxidase, which gives rise to X-linked chronic
granulomatous disease (X-CGD)253. Specifically, this group edited X-CGD patient-derived
CD34+ HSPCs with the requisite CRISPR components, in turn restoring NADPH oxidase function
in myeloid cells differentiated from the extracted progenitors in vitro. Subsequent transplantation
of corrected HSPCs into NSG mice resulted in effective engraftment and sustainable production
of functional mature human myeloid and lymphoid cells. These experiments represent a
significant step forward from similar studies using ZFNs, which failed to attain appreciable
correction rates following transplantation into NSG mice113,254.
These applications have also extended into anti-viral therapy, in particular for disrupting the
CCR5 gene to generate HIV-resistant human primary T-cells255,256 and iPSCs142,257. Notably, Xu
et al. have shown that CRISPR can be used to disrupt the CCR5 gene in human CD34+ HSPCs,
and that subsequent transplantation into NPG mice can generate multi-lineage progeny and confer
resistance to HIV-1 infection258. These experiments have precipitated the approval of Phase I
clinical trials (NCT03164135).
Substantial empirical evidence has also emerged in support of our current model of CRISPR-
based CF gene therapy. Namely, CRISPR/Cas9 has been used to correct the 'F508 mutation in
CF patient-derived iPSCs259. Corrected iPSCs were able to differentiate into mature airway
epithelial cells exhibiting physiologically normal CFTR function. Moreover, intestinal stem cells
from 'F508 CF patients have been corrected ex vivo, and subsequently able to form clonally
expanded intestinal organoids with restored CFTR function260. These are indeed promising
results. However, genome editing of airway stem cells in vivo will require significant
- 21 -
improvements in CRISPR-mediated transgene knock-in efficiencies. For these purposes, it is
necessary to understand the DSB repair mechanisms used by mammalian cells to repair Cas9-
induced genomic breaks.
1.4 DNA double-strand breaks
As with all biological macromolecules, DNA is subject to destabilizing and decomposing forces.
However, as the hereditary molecule of life, accurate reconstitution of DNA in response to
structural insults is essential to the faithful reproduction of the cells, multicellular networks,
organisms, and species in which it encodes. Of the various types of damage DNA can endure,
DSBs are indeed the most genotoxic and structurally threatening. DSBs can arise due to
extraneous stimuli like ionizing radiation and radiomimetic drugs, or as a consequence of
intracellular reactive oxygen species (ROS) or replication fork collapse261. Other DSBs are
programmed and essential to the reproduction and normal physiology of an organism, such as
meiotic crossover and V(D)J recombination, respectively. In an analogous manner, artificial
nucleases can be programmed to induce DSBs for deliberate genome editing. However, in contrast
to bottom-up, genetically-encoded programmed DSBs, those induced for genome editing are top-
down, encoded by scientists and the social institutions thereof. Accordingly, our deliberate
genomic manipulations will not have been tested and refined by eons of evolutionary pressures.
Understanding the molecular consequences of our programmed DSBs is therefore pertinent to
ensuring they are repaired in a manner conducive to our desired outcomes.
Because DSBs are highly genotoxic lesions, employment of the appropriate repair mechanism is
tightly regulated and crucial for maintaining genome integrity. In mammalian cells, DSBs are
predominantly repaired by one of two pathways, broadly classified as NHEJ and HDR. NHEJ-
related pathways commonly repair DSBs by direct re-ligation of the broken ends following some
or no processing on the ends themselves. Although NHEJ pathways are ostensibly error-prone
due to end processing and template-independent repair, they are probably accurate in many
cases262. On the contrary, HDR encompasses various distinct subpathways, which share the
common feature of requiring a homologous DNA sequence as a template for repair. Accordingly,
it is largely accepted that HDR pathways are exclusively error-free.
- 22 -
1.4.1 Non-homologous end-joining
Following a genomic DSB, the kinases ataxia telangiectasia mutated (ATM), ATM and Rad3-
related (ATR), and DNA-dependent protein kinase catalytic subunit (DNA-PKcs) rapidly
phosphorylate chromatin resident histone H2AX surrounding the break site263–266. This generates
H2AX, which acts as a DNA damage signal. In resting or quiescent vertebrate cells (G0/G1), the
Ku70/Ku80 heterodimer (Ku) is first to bind to free DNA ends generated by a DSB, likely due to
its shear abundance (~400,000 molecules/cell) and strong dissociation constant (~10-9 M)267,268.
However, Ku competes for DNA binding with the less abundant MRE11:RAD50:NBS1 (MRN)
complex, which promotes alternative end-joining pathways in G1269–271. In canonical NHEJ, the
Ku:DNA complex serves as a scaffold for the recruitment of additional repair proteins. The
Artemis:DNA-PKcs complex rapidly binds to Ku:DNA ends. Subsequent autophosphorylation of
Artemis:DNA-PKcs regulates access of other NHEJ proteins and activates the nucleolytic activity
of Artemis, thus initiating DNA end processing272–274. End processing functions to generate short
regions of microhomology (4 nucleotides) to serve as a template for ligation. Polymerases pol µ
and pol , which are capable of flexible template-independent and -dependent polymerase
activity, respectively, are then recruited to extend the processed DNA ends275,276. The
XLF:XRCC4:DNA ligase IV complex subsequently mediates ligation of the two DNA ends (Fig.
2). This enzymatic complex is a flexible ligase with the capacity to ligate complex and
incompatible DNA ends across gaps277. Depending on the chemistry of the break, additional
auxiliary proteins may be required for repair, including polynucleotide kinase (PNK), aprataxin,
and tyrosyl DNA phosphodiesterase 1 (TDP1)278.
Although described here as constrained and sequential mechanistic steps, NHEJ is more
accurately depicted as a semi-haphazard process involving malleable iterations of nuclease,
polymerase, and ligase activity278. It is evident that these enzymatic pathways and the proteins
involved are necessarily flexible. That is, it has proven evolutionarily adaptive to employ robust
biochemical pathways capable of repairing a diverse range of broken DNA substrates, as these
pathways are largely conserved from yeast to vertebrates.
- 23 -
1.4.2 Homology-directed repair
HDR encompasses a number of distinct repair subpathways, namely HR, synthesis-dependent
strand annealing (SDSA), and break-induced replication (BIR). These pathways are commonly
initiated by the generation of H2AX surrounding the DSB site, which function to recruit mediator
of DNA damage checkpoint 1 (MDC1) and the MRN complex279,280. These complexes in turn
scaffold the break site to recruit additional HDR factors. All HDR pathways are similarly
dependent on the generation of long regions of single-stranded DNA (ssDNA) surrounding the
break site. Specifically, ssDNA generation is catalyzed by the endonucleotic activity of the MRN
complex, which itself is dependent on the activity of carboxyl-terminal binding protein (CtBP)-
interacting protein (CtIP)281–283. Following MRN endonucleotic cleavage, exonuclease resection
proceeds bi-directionally via MRN 3’ – 5’exonuclease activity, and long range (~1-3 kb) 5’ – 3’
resection mediated by the redundant activities of EXO1 and BLM/DNA2 nucleases284–286. The
resulting ssDNA is then rapidly bound by replication protein A (RPA)287. The RPA coating
ssDNA is eventually replaced by RAD51 nucleoprotein filaments, aided by the concerted action
of PALB2, BRCA1, and the recombination mediator BRCA2288,289. RAD51 nucleofilaments are
the necessary substrates to search for and invade homologous DNA. Following homologous DNA
strand invasion, the subset of HDR pathways begin to diverge (Fig. 3).
Canonical HR is a consequence of both strands of the DNA break invading the homologous
template. Subsequent polymerization generates joint DNA molecules bearing a double-Holliday
junction (HJ), which can undergo considerable branch migration before dissolution. Double-HJ
dissolution and consequent separation of the conjoined DNA molecules is dependent on the
mutual activity of topoisomerase III and the BLM:RMI1:RMI2 (BTR) complex290. Processing
by BTR gives rise to non-crossover events that avoid loss of heterozygosity by inter-homologue
exchanges291,292. In contrast, if the double-HJs are resolved by the endonucleases MUS81-EME1,
SLX1-SLX4 and GEN1, crossovers are more likely to occur293.
SDSA can occur if one or both strands of the DNA break invades the homologous template, from
which extended D-loops are formed instead of double-HJs. Following homology-dependent
polymerization of the invading strand, D-loops are processed by helicases and the invading strand
is subsequently re-ligated to the other end of the DSB break294. In contrast, BIR results exclusively
from one-end invasion, and replication can proceed for hundreds of kilobases until the end of the
- 24 -
chromosome295,296. Another DSB repair pathway distinct from both HDR and NHEJ is
microhomology-mediated end-joining (MMEJ), which is highly error-prone. Although
categorically distinct, MMEJ shares similar features with HDR in that it requires CtIP-dependent
MRN nucleotyic action. In contrast to HDR, however, MMEJ ensues following limited resection
by MRN and subsequent alignment and ligation of short ssDNA ends, in the absence of any
homologous strand invasion297 (Fig. 2).
1.4.3 DSB repair pathway choice
The choice of DSB repair mechanism is largely dependent on cell cycle phase298. More
specifically, due to the dependence on a homologous sequence, HDR pathways are restricted to
S/G2 when a sister chromatid template is available for repair. On the contrary, NHEJ pathways
are active throughout the cell cycle. The cell cycle-regulated control of these repair pathways is
largely modulated by cyclin-dependent kinases (CDKs), which themselves are master regulators
of cell cycle progression. CDKs have extensive regulatory control over DNA end resection, which
is generally viewed as the committed step for HDR and functions as the primary regulatory node
for DSB repair pathway choice299.
p53-binding protein 1 (53BP1) is a key proximal regulator of DSB repair pathway choice. 53BP1
effectively inhibits end resection, and therefore HDR, principally through its concerted action
with Rap1 interacting factor 1 homolog (RIF1). In response to DSBs in G0/G1, ATM kinase-
mediated phosphorylation of 53BP1 induces recruitment of RIF1 to DSB sites. RIF1 DSB foci in
turn inhibit the accumulation of BRCA1 at DSBs, which ultimately inhibits end resection and
promotes repair by NHEJ300–304 (Fig. 2). The HDR-inhibitory action of 53BP1 is counteracted by
upstream CDK activity as cells enter S phase. More specifically, CDK-mediated phosphorylation
of CtIP in S/G2 promotes CtIP:BRCA1 complex formation, in turn relieving the 53BP1-
dependent, RIF1-mediated inhibition of end resection305. This regulation is also dependent on
CDK-mediated phosphorylation of BRCA1, which promotes UHRF1-mediated ubiquitylation
and consequent degradation of RIF1306. Chromatin remodeling has also recently been implicated
in this regulatory axis. More specifically, CDK- and ATM-mediated phosphorylation of the
chromatin remodeler Cockayne syndrome group B protein (CSB) promotes nucleosome
- 25 -
disassembly, which consequently inhibits and promotes RIF1 and BRCA1 accumulation,
respectively307 (Fig. 3).
In addition to the relief of 53BP1:RIF1 inhibition, positive stimulatory regulation is also required
to promote end resection. In this respect, CtIP has been recognized as a critical regulatory hub for
DSB repair pathway choice in mammalian cells, whose activity is a necessary prelude for end
resection and therefore HDR298,299,308–310. The involvement of CtIP in HDR regulation is
exemplified by low steady-state levels in G1 maintained by ubiquitin-dependent, proteasome-
mediated degradation311–313. CtIP degradation is subsequently suppressed during the G1/S
transition, in concordance with the upregulation of HDR upon S-phase entry. Its localization at
DSBs is also highly regulated. In particular, RNF138 ubiquitin ligase activity displaces Ku from
DSB sites while recruiting CtIP, and this process is necessary for the inhibition of NHEJ and
promotion of HDR314,315.
CtIP is also heavily phosphorylated by upstream kinases in S/G2, in particular by CDK1. For
example, CDK1 phosphorylates CtIP at Thr847 and Ser327 in S/G2, in turn facilitating its
interaction with BRCA1, promoting end resection, and ultimately stimulating HDR282,316–318.
CDKs also phosphorylates CtIP at 5 other residues, termed 5mCDK. These modifications do not
directly promote HDR, but instead facilitate subsequent CtIP phosphorylation at T859 by the
ATM kinase283. T859 phosphorylation promotes CtIP to stimulate end resection and recruit BLM
and EXO1, which in turn catalyze the extended end resection necessary for HDR283. In addition
to phosphorylation, CtIP is also constitutively acetylated at Lys432, Lys526, and Lys604319.
Following DNA damage, CtIP is deacetylated by sirtuin 6 (SIRT6), in turn promoting the ability
of CtIP to mediate end resection and therefore HDR319. Furthermore, loss of SIRT6 activity results
in severe HDR defects in human cells, exemplifying its role in stimulating CtIP-mediated DSB
end resection319,320. In fact, artificially expressing SIRT6 has been shown to rescue the decline of
HDR associated with replicative senescence320.
Limited resection by MRN:CtIP is sufficient for promoting the error-prone MMEJ pathway.
Extended end resection, however, mediated principally via the redundant activities of EXO1 and
BLM/DNA2 nucleases, is necessary for commitment to HDR pathways284–286. Accordingly,
EXO1 exonuclease activity is stimulated by CDK-mediated phosphorylation in S/G2, specifically
at residues Ser639, Thr732, Ser815, and Thr824321. The regulation of DSB repair proteins also
- 26 -
appears to be mutually interdependent, in that the activity of EXO1 is also stimulated by BLM,
MRN, and RPA286,322. These regulatory pathways effectively restrict long-range end resection to
S/G2, and therefore serve as additional levels of HDR regulation.
- 27 -
Figure 2. NHEJ is used to repair DSBs in G1 when CDK activity is low. In G1, ATM-mediated phosphorylation of 53BP1 promotes 53BP1 interactions with RIF1 and PTIP. These interactions in turn inhibit the accumulation of HDR factors such as CtIP, BRCA1, EXO1, BLM and DNA2 at DSB sites. Ku competes for binding with the MRN complex at DSB ends. Stable Ku binding invariably leads to NHEJ with the concerted actions of Artemis:DNA-PKcs, pol µ and , and DNA ligase IV. Limited end processing mediated by MRN:CtIP can lead to mutagenic MMEJ.
NHEJ MMEJ
Artemis
DNA-PKcs
pol µ
pol
Modified from Hustedt & Durocher; Nat Cell Biol. (2017) 19:1-9
- 28 -
Figure 3. HDR is used to repair DSBs in S/G2 when CDK activity is high. CDK-mediated phosphorylation of BRCA1 and CtIP promotes their accumulation at DSB sites by relieving the HDR inhibitory effects of 53BP1:RIF1. Chromatin remodelling directed by pCSB further promotes BRCA1 assembly while inhibiting RIF1. Active CtIP and MRN catalyze rate-limiting short-range end resection, and CDK-mediated phosphorylation of EXO1 stimulates long-range end-resection. RAD51 replaces RPA on ssDNA and catalyzes homologous strand invasion, which can subsequently result in SDSA, HR or BIR
OR
Non-crossover
Crossover HR SDSA BIR
CDK
CDK activity high
Modified from Hustedt & Durocher; Nat Cell Biol. (2017) 19:1-9
CSB
- 29 -
1.5 Enhancing gene targeting efficiency by perturbing DSB
repair
The power of programmable nucleases for genome editing lies in their ability to generate directed
DSBs. Furthermore, the precise nature of the edit depends on the repair pathway employed to
repair the DSB. Gene knockouts can be generated when NHEJ is used to repair the break, as this
pathway is prone to generating small mutations or indels. In contrast, due to the dependence of
HDR on a homologous template, this pathway can be harnessed to insert exogenous DNA
sequences into precise genomic locations. By flanking transgene cassettes – such as CFTR, for
example – with loci-specific sequence homology, exogenous DNA can be used as the template
for HDR in order to knock-in desired genetic elements. This approach is broadly referred to as
gene targeting.
The principle impediment to gene targeting is the inherently low frequency of HDR events. That
is, due to the fact that NHEJ is the predominant DSB repair mechanism, the efficiency of precise
gene targeting is exceedingly low. In mammalian cell lines, primary cells, PSCs and zygotes,
precise gene targeting efficiencies can range anywhere from 0.1-20% (with few exceptions
beyond this range), depending on the cell type, the genomic locus being targeted, method of
delivery, as well as the size and chemistry of the repair template. This represents a considerable
barrier for effective in vivo gene therapy, and more specifically, our CF gene therapy approach to
knock-in the CFTR gene into airway stem cells. Here, the low efficiency of gene targeting is
further compounded by practical barriers to gene delivery and the host immune response.
Accordingly, our approach requires significantly higher gene targeting efficiencies (GTE) to be
clinically useful.
It is worth recalling here the broadly applicable preclinical efficacies of CRISPR/Cas9 outlined
previously. It should be noted that the vast majority of those cases were using CRISPR/Cas9 to
generate knockouts by NHEJ. In the cases where HDR was necessary, small insertions or low
efficiencies sufficed for the application. Due to the evident limitations associated with
CRISPR/Cas9 gene targeting by HDR, a number of groups have sought to improve current
methods and enhance targeting efficiencies. The most widely used approach has been to
- 30 -
administer the small molecule SCR7, a DNA ligase IV inhibitor, in combination with the requisite
factors for CRISPR-mediated gene targeting (Cas9, sgRNA, and a HDR template). As previously
discussed, DNA ligase IV is responsible for ligating broken ends in DSB repair by NHEJ.
Accordingly, by inhibiting this enzyme, investigators have been able to upregulate compensatory
HDR and therefore GTE anywhere from ~2 to 20-fold in mammalian cell lines and zygotes323,324.
However, these results are often not reproducible325–329. Analogous approaches to small molecule
inhibition of NHEJ have been demonstrated using NU7441 and Ku-0060648 to inhibit DNA-
PKcs, resulting in ~2 to 4-fold enhancements in human cell lines and mouse embryonic fibroblasts
(MEFs)330. The RAD51-stimulating small molecule RS-1 can also elicit up to 5-fold
enhancements in human cell lines325 and rabbit embryos328. Furthermore, the small molecules
Brefeldin A and L755507, an ER-Golgi transport inhibitor and a E3-adrenergic receptor agonist,
respectively, enhance gene targeting efficiency ~2 to 9-fold in mammalian cell lines and hPSCs
by unknown mechanisms331.
The cell cycle-regulated control of DSB repair pathway choice also presents an opportunity to
potentiate the use of HDR in response to CRISPR/Cas9-generated DSBs. There are several well-
established mechanisms for synchronizing proliferating cells in specific cell cycle phases. Yang
et al. have shown that the use of nocodazole to synchronize cells in G2/M can enhance gene
targeting efficiency ~2 to 4-fold in human cell lines332. This approach has also demonstrated utility
in hPSCs and neural precursor cells329. Another interesting strategy was to fuse Cas9 to a fragment
of the human Geminin peptide, which is degraded by the proteosome pathway in G1. This
effectively restricts Cas9 expression to S/G2 when HDR is most active, in turn enhancing GTE,
albeit modestly326. Other approaches to enhancing CRISPR/Cas9 GTE have focused on the nature
of the donor template. More specifically, a number of studies have demonstrated greater targeting
efficiencies in mice333–335 and rats336–338 using ssDNA donors as opposed to canonical dsDNA
donor templates.
- 31 -
Chapter 2 Hypothesis and Objectives
2.1 Rationale
Researchers have evidently made significant progress in enhancing CRISPR/Cas9 GTE. It should
be noted that despite these improvements, large insertions (like those necessary to knock-in
CFTR) are more resistant to HDR enhancements. Furthermore, many of these advancements have
come with the use of small molecules, which cannot be packaged into viral vectors and are
therefore less amenable to in vivo gene therapy. Genetically-encoded factors would be more
beneficial for these purposes. In this respect, Orthwein et al. has shown that concurrently
overexpressing a CtIP and PALB2 mutant can enhance CRISPR/Cas9 GTE up to 4-fold in non-
dividing U2OS 53BP1 cells339. This study provided proof of principle for genetically-encoded
means by which to perturb DSB repair and enhance CRISPR/Cas9 GTE, which could be
effectively applied to viral-based gene therapies.
2.1.1 CDK1
Aforementioned studies have evidently demonstrated the utility of perturbing DSB repair pathway
choice as effective means by which to enhance CRISPR/Cas9-mediated gene targeting. In line
with this reasoning, overexpressing CDK1 is an attractive strategy to increase GTE due its
overwhelming control over the balance between HDR and NHEJ.
2.1.2 Post-translational modification (PTM)-mimics
An alternative strategy for increasing GTE would be to specifically harness the influence of CDKs
on DSB repair pathway choice, without directly altering CDK expression or activity. This can be
accomplished by specifically overexpressing the relevant phospho-products of CDK catalysis that
- 32 -
promote HDR. Many of the CDK DSB repair substrates up-regulate HDR and/or inhibit NHEJ in
response to CDK-mediated phosphorylation of specific residues. Furthermore, mutating such
residues to Asp or Glu can generate ‘phospho-mimics’ that recapitulate the activity of the
phosphorylated proteins. In addition to phosphorylation, DSB repair proteins endure other PTMs
such as acetylation and ubiquitylation, which also regulate their capacity to promote HDR in a
cell cycle-specific manner. Importantly, mutating acetylated and ubiquitylated residues to Arg can
generate DSB repair proteins that mimic their active states, regardless of cell cycle position. These
properties make phospho-, as well as acetylated- and ubiquitylated-mimics ideal candidates for
effectively potentiating GTE. Crucial HDR proteins that can be ectopically expressed as PTM-
mimics are outlined in detail below and summarized in Table 1.
2.1.3 CtIP
As previously outlined, CtIP is recognized as an essential regulatory hub for DSB repair pathway
choice in mammalian cells. CtIP activity is negatively regulated in resting cells by ubiquitin-
dependent, proteasome-mediated degradation311–313. However, these studies have shown that
mutating ubiquitylated residues S276, T315, and Y842 to alanine can block ubiquitylation, in turn
generating a hyperactive CtIP variant that constitutively promotes HDR in human cell lines. The
relief of G1 ubiquitin-directed, proteasome-mediated degradation of CtIP is endogenously elicited
as cells enter S phase. CtIP is then activated by PTMs in S/G2, namely by CDK and ATM-
mediated phosphorylation and SIRT6-catalyzed deacetylation. It has been shown that such
activity can be effectively mimicked by site-directed mutagenesis to artificially promote HDR
throughout the cell cycle. For example, the requirement of Thr847 phosphorylation can be
circumvented by a CtIP phospho-mimic in which Thr847 is replaced by Glu (T847E). This mutant
demonstrates normal end resection and HDR in the absence of CDK-mediated phosphorylation318,
and exogenous expression of CtIP T847E increases aberrant HDR while inhibiting NHEJ305,317.
Furthermore, CDK-mediated Ser327 phosphorylation promotes CtIP association with BRCA1,
which is necessary to promote end resection316,340. A Ser327 phospho-mimic (S327E) would
therefore presumably have similar HDR-promoting activities. In addition, 5mCDK CtIP
phosphorylation facilitates subsequent ATM-mediated T859 phosphorylation of CtIP, which in
- 33 -
turn stimulates end resection and the recruitment of additional necessary HDR factors283. Wang
et al. has demonstrated that a T859E CtIP phospho-mimic bypasses the requirement of 5mCDK
phosphorylation, and can alleviate the G1-repression of HDR283.
In addition to phosphorylation, CtIP is also dependent on SIRT6 deacetylase activity to promote
end resection319. Importantly, a CtIP deacetylated mimic, in which Lys432, 526, and 604 are
mutated to Arg (3KR), relieve the requirement of SIRT6-dependent deacetylation319. This CtIP
3KR mutant would presumably have a greater propensity to promote HDR than its wild-type
counterpart.
CtIP evidently endures multiple levels of PTMs that control its ability to promote HDR in
accordance with cell cycle phase and DNA damage. It appears that each individual modification
contributes to the activation of CtIP, where the collective influence of specific PTMs results in
robust HDR-promoting activity. Furthermore, the studies outlined above demonstrate that these
modifications can be effectively mimicked by expressing an artificial CtIP harbouring multiple
mutations.
2.1.4 EXO1
Following CtIP/MRN-mediated short-range DSB end resection (~50-100 bp), EXO1 is recruited
to the partially-resected ends to catalyze long-range end resection (~1-3 kb), a process that is
necessary for HDR341. Similar to CtIP, EXO1 exonuclease activity is stimulated by CDK-
mediated phosphorylation in S/G2, specifically at residues Ser639, Thr732, Ser815, and
Thr824321. This effectively restricts long-range end resection to S/G2, and therefore serves as an
additional level of HDR regulation. Furthermore, Tomimatsu et al. demonstrated that an EXO1
phospho-mimic (EXO1-4D) not only rescues the HDR defect associated with CDK inhibition, but
also significantly up-regulates HDR in wild-type cells321.
- 34 -
Table 1. DSB repair proteins and associated mutations Protein Mutations CDK1 CtIP-WT
- -
CtIP-3EA S327E, T847E, T859E, S276A, T315A, Y842A CtIP-M S327E, T847E, T859E, K432R, K526R, K604R CtIP-M2A S327E, T847E, T859E, K432R, K526R, K604R, S276A, T315A CtIP-M3A S327E, T847E, T859E, K432R, K526R, K604R, S276A, T315A, Y842A EXO1-4D S639D, T732D, S815D, T824D
2.2 Hypothesis
Overexpressing CDK1, as well as CtIP and EXO1 variants can enhance the efficiency of
CRISPR/Cas9-mediated precise gene targeting.
2.3 Objectives
1: Develop an assay to measure gene targeting efficiency.
2: Assess the utility of CDK1, as well as CtIP and EXO1 variants for enhancing CRISPR/Cas9
gene targeting efficiency.
3: Generate an IB3-1 cell line to verify precise gene targeting by a colour-switch assay using
ssDNA donors.
- 35 -
Chapter 3 Materials and Methods
3.1 Plasmids
The CRISPR/Cas9 plasmid for the mCherry AAVS1 integration assay was generated by cloning
the sgRNA (5’-ACCCCACAGTGGGGCCACTA-3’) into pSpCas9(BB)-2A-GFP (PX458)
(Addgene #48138) by conventional restriction cloning. The homology arms on the promoterless
mCherry donor construct were obtained by PCR from BAC clone: RP11 384-G4. The splice
accepter (SA) and T2A sequence were added upstream of mCherry-poly(A) (from pTRE3G-
mCherry) by PCR. The homology arms and SA-T2A-mCherry-p(A) cassette were then cloned
into an empty pSEAP backbone342 by In-Fusion cloning (In-Fusion HD Cloning Plus, ClonTech,
cat. #638911). The lacZ plasmid was constructed as previously described342. The CDK1 plasmid
was obtained from Addgene (Cdc2-HA, #1888). CtIP and EXO1 cDNAs were obtained from
Transomic Technologies (cat. #BC030590-seq, and BC007491-seq, respectively). FLAG tags
were inserted in frame with each cDNA by PCR. Each cDNA-FLAG cassette was then inserted
under the control of a chicken -actin (CBA) promoter in an empty pSEAP backbone342 by In-
Fusion cloning. Mutagenesis was performed using QuikChange Lightning Multi Site-Directed
Mutagenesis kit (Agilent Technologies, cat. #210515).
The CRISPR/Cas9 plasmid used for generating the IB3-1 cell line was obtained from OriGene
Technologies (cat. #GE100002) containing the sgRNA (5’-GAAGGTGGCCAACCGAGCTT-3’)
targeting exon1 of the CFTR gene. The donor plasmid harbouring the EGFP-puromycin cassette
flanked by CFTR homology was custom made from OriGene Technologies on a pUC vector. The
CRISPR/Cas9 plasmids for CMV-mCherry integration into the genomic EGFP-CFTR locus was
generated by cloning the sgRNAs (#1: 5’-AGCACTGCACGCCGTAGGTC-3’;
#2: 5’-CTCGTGACCACCCTGACCTA-3’; #3: 5’-GGGCACGGGCAGCTTGCCGG-3’) into
pSpCas9(BB)-2A-GFP (PX458) (Addgene #48138) by conventional restriction cloning, and the
GFP tag was removed by EcoR1 digestion. The donor plasmid designed to integrate CMV-
mCherry into the EGFP-CFTR genomic locus was assembled by restriction digestion of CMV-
- 36 -
mCherry-p(A) cassette, while the EGFP homology arms were obtained by PCR. The three
fragments were subsequently cloned into an empty pSEAP backbone342 by In-Fusion cloning. The
T7 promoter was inserted in the reverse orientation downstream of the right homology arm by
PCR.
3.2 Flow cytometry
3x105 HEK293 cells (cultured in MEM (Thermo Fisher Scientific, cat. #11095080) + 10% FBS
(Wisent Bioproducts, cat. #080-450) + 1% Pen/Strep (Thermo Fisher Scientific, cat. #15070063)
in a humidified 37 C, 5% CO2 incubator) were seeded into tissue culture-treated polystyrene 6-
well plates (Corning, cat. #353046), and transfected the following day (~70-80% confluency)
using jetPRIME (Polyplus-transfection, cat. #114-07) according to the manufacturer’s protocol
(jetPRIME:DNA = 2:1) (CRISPR/Cas9: 500 ng; Donor: 1 µg; lacZ, CtIP, EXO1, CDK1: 2 µg).
For SCR7-treated cells, SCR7 (Xcess Biosciences, cat. #M60082-2) was diluted to the indicated
concentrations in DMSO and added to the culture media 18 hr post-transfection. 48 hr post-
transfection, cells were either harvested for flow cytometry or passed 1/8 into new 6-well plates.
Passaged cells were subsequently passed 5 additional times over the course of 3 weeks before
harvesting for flow cytometry. When harvesting for flow cytometry, cells were detached by
incubating in 0.5 mL trypsin-EDTA (0.05%) (Thermo Fisher Scientific, cat. #25300062) for 1
min at 37 C (incubator), suspended in serum-containing media, and spun down at 220 g. Cells
were then washed with PBS (1X, pH 7.4), and subsequently re-suspended in PBS. Dead cell
staining was performed using LIVE/DEAD Fixable Violet Dead Cell Stain Kit (Thermo Fisher
Scientific, cat. #L34955) according to the manufacturer’s protocol for unfixed cells. Briefly, cells
were washed twice with PBS + 1% FBS, and re-suspended in 1 mL PBS + 1% FBS. Cells were
filtered through 70 µM nylon mesh into 5 mL round-bottom polystyrene tubes (Falcon, cat.
#352052). Flow cytometry was performed using an LSRII-CFI (Becton Dickinson), and data
analysis was done using FlowJo v.10.
- 37 -
3.3 Junction PCR
HEK293 cells were cultured, seeded, transfected and passaged as detailed in flow cytometry
methods (section 3.2). Following transfection and subsequent passaging for 3 weeks, cells were
trypsinized (as in flow cytometry methods), spun down at 220 g, and washed with PBS. Cells
were subsequently lysed in 500 µL of RIPA buffer (25 mM Tris-HCl pH 7.6, 150 mM NaCl, 1%
NP-40, 1% sodium deoxycholate, 0.1% SDS) + 650 µg/mL proteinase K (Thermo Fisher
Scientific, cat. #EO0491) + 100 µg/mL RNase A at 55 C with gentle shaking overnight. Genomic
DNA was purified by phenol-chloroform extraction and ethanol precipitation. Specifically, 1X
volume of phenol:chloroform:isoamyl alcohol (25:24:1, v/v) (Thermo Fisher Scientific, cat. #
15593031) was added to cell lysates, briefly vortexed, and spun down at 14,000 rpm for 2 min.
The top aqueous layer was extracted into a fresh microfuge tube. 0.5X volume of 7.5 M
ammonium acetate and 2X volume of 100% ethanol were added and incubated at -20 C for at
least 1 hr. The mixture was then spun down at 14,000 rpm at 4 C for 5 min and subsequently
washed with 1 mL 70% ethanol. Purified genomic DNA was re-suspended in Tris-EDTA (TE)
buffer (pH 8.0). 1 µg of genomic DNA was used as template in each PCR reaction, and PCR
products were run on non-denaturing 1% agarose gels. PCR primers illustrated in Fig. 5
(primer set #1: Fwd: 5’-GCTTTGCCACCCTATGCTGACAC-3’,
Rev: 5’- TGTGCACCTTGAAGCGCATGAACTC - 3’;
primer set #2: Fwd: 5’- TTAGCCACTCTGTGCTGACCACTCTG - 3’,
Rev: 5’-AGTCACCCAGAGACAGTGACCAAC - 3’). Band intensities were quantified using
ImageJ.
3.4 Generating the IB3-1-CFTR-EGFP cell line
3.4.1 Transfection
2x105 IB3-1 cells (cultured in LHC-8 (Thermo Fisher Scientific, cat. #12678017) + 10% FBS
(Wisent Bioproducts, cat. #080-450) + 1% Pen/Strep (Thermo Fisher Scientific, cat. #15070063)
in a humidified 37 C, 5% CO2 incubator) were seeded into a tissue culture-treated polystyrene
- 38 -
6-well plate (Corning, cat. #353046). The following day, seeded cells were transfected with
CRISPR/Cas9 targeting CFTR exon1 and the EGFP-puromycin donor DNA (1 µg each) using
FuGENE HD Transfection Reagent (Promega, cat. #E2311) according to the manufacturer’s
protocol (FuGENE:DNA=3:1).
3.4.2 FACS
Transfected cells were expanded to 10 cm plates and passaged for 2 weeks. One of the 10 cm
plates was trypsinized (as in flow cytometry methods, section 3.2) and spun down at 220 g. Cells
were then washed with PBS, and subsequently re-suspended in 1 mL PBS. Single EGFP+ cells
were then sorted into 10 collagen-coated (type I bovine collagen, Advanced Biomatrix, cat.
#5005), tissue culture-treated, polystyrene 96-well plates (Corning, cat. #C353227) containing
LHC-8 + 20% FBS + 1% Pen/Strep culture media.
3.4.3 Puromycin selection and limited dilution
Transfected cells were incubated in LHC-8 + 10% FBS + 1% Pen/Strep supplemented with 1
µg/mL puromycin for 2 weeks. Every 2 days, plates were washed with PBS (1X, pH 7.4) and
fresh puromycin-containing media added. Fluorescence microscopy was then used to identify
EGFP+, puromycin-resistant colonies. Sterile cylinders were placed around each individual
colony to allow for isolated trypsinization, re-suspension in serum-containing media
(supplemented with 1 µg/mL puromycin), and subsequent transfer to 48-well plate. These
colonies were expanded to 6-well plates. Each colony was then diluted in LHC-8 + 10% FBS +
1% Pen/Strep (supplemented with 1 µg/mL puromycin) to 5 cells/mL, and 100 µL pipetted into
96-well plates. Plates were monitored 12 hr later to mark wells which only contained a single cell.
These clones were allowed proliferate and then expanded to larger culture vessels. A total of 6
clones were successfully expanded and healthy at this stage.
- 39 -
3.5 Generating ssDNA donors
T7 in vitro transcription was performed using TranscriptAid T7 High Yield Transcription Kit
(Thermo Fisher Scientific, cat. #K0441) according to the manufacturer’s protocol using the CMV-
mCherry donor (targeting EGFP-CFTR) as a template. Reaction products were then digested with
1 µL DNaseI at RT for 15 min, followed by enzyme inactivation with 1 µL 25 mM EDTA at 65
C for 10 min. RNA was then purified using the PureLink RNA Mini Kit (Thermo Fisher
Scientific, cat. #12183018A) according to the manufacturer’s protocol for purification from liquid
samples. Purified RNA was then used for gene-specific reverse transcription with the SuperScript
IV Reverse Transcriptase (Thermo Fisher Scientific, cat. #18090010) according to the
manufacturer’s protocol. Products of this reaction were then digested with 1 µL RNaseH at 37 C
for 20 min to remove template RNA. RNaseH was inactivated by incubation at 65 C for 10 min.
The remaining ssDNA was purified using the PureLink RNA Mini Kit according to the
manufacturer’s protocol for purifying from liquid samples.
3.6 T7E1 Assay
2x105 IB3-1-CFTR-EGFP cells (from each of the 6 clones) were seeded into tissue culture-treated
polystyrene 12-well plates (Corning, cat. #C353225), and the following day transfected with
CRISPR/Cas9 (targeting EGFP-puromycin) (650 ng) and ssDNA mCherry donor (350ng) using
FuGENE HD Transfection Reagent (Promega, cat. #E2311) according to the manufacturer’s
protocol (Fugene:DNA = 3:1). 3 different CRISPR/Cas9 plasmids containing various sgRNAs
targeting different EGFP sequence motifs were tested for each clone (see plasmids methods,
section 3.1). 2 days post-transfection, transfectants were expanded to 6-well plates. 3 days later,
genomic DNA from each condition was harvested and purified using the GeneArt Genomic
Cleavage Detection Kit (Thermo Fisher Scientific, cat. #A24327) according to the manufacturer’s
protocol. PCR was used to amplify the EGFP sequence from genomic DNA. PCR products were
purified using the NucleoSpin Gel and PCR Cleanup Kit (ClonTech, cat. #740609). Purified PCR
products were subsequently denatured and randomly reannealed using a thermocycler (95 C for
5 min, 95→85 C (-2 C/sec), 85→25 C (-0.1 C/sec), 4 C hold). Randomly reannealed
- 40 -
amplicons were then digested with 1 µL of T7E1 (New England Biolabs, cat. #M0302) for 45
min at 37 qC, and subsequently run on a non-denaturing 2% agarose gel.
3.7 Data analysis
Graphical presentation and statistical analysis were performed using Prism 6 (GraphPad). All data
are presented as mean r SEM. Statistics were performed using unpaired, two-tailed Student’s t-
tests. Differences between means were considered statistically significant when p<0.05 and
p<0.01, and were represented graphically as * and **, respectively.
- 41 -
Chapter 4 Results
4.1 Flow cytometry assay for measuring gene targeting
efficiency
An assay to measure GTE requires two plasmid constructs: one for expressing CRISPR/Cas9 and
a sgRNA, and another harbouring the donor DNA to be integrated into the Cas9 cleavage site.
The Cas9 protein is co-expressed with a sgRNA from a single construct, as seen in Fig. 4A. Cas9
is expressed as a single transcript with EGFP, and the intervening T2A sequence facilitates
cleavage during protein translation, giving rise to individual Cas9 and EGFP proteins343,344. EGFP
fluorescence can therefore be used as a measure of transfection efficiency. The sgRNA is designed
to target Cas9 to induce a DSB within the first intron of the human PPP1R12C gene on
chromosome 19. This genomic region has been commonly referred to as the AAVS1 locus since
the observation that AAV integrates here345. AAV infection is not associated with any known
pathophysiology, and both hES and hiPS cells with disrupted PPP1R12C genes retain
pluripotency111,346. The AAVS1 locus is therefore considered a ‘genomic safe harbour’ for
transgene integration. Furthermore, this gene is ubiquitously expressed in all primary human cells
studied, as well as in commonly used transformed cell lines. For these reasons, the AAVS1 locus
is an ideal genomic locus to study precise gene targeting.
The donor DNA plasmid contains a promoterless mCherry cassette, which is flanked on both sides
by ~1 kb sequences that are homologous to the AAVS1 genomic DNA (Fig. 4B). These homology
arms facilitate site-specific integration of intervening plasmid sequence via HDR at the target
DSB site170. A splice acceptor site and T2A signal were inserted upstream of the mCherry ORF,
with a poly(A) signal downstream. Since AAVS1 exon 1 contains the translation start site,
insertion of this cassette into intron 1 gives rise to a single transcript driven by the endogenous
AAVS1 promoter. Because of the T2A signal upstream of mCherry, translation produces two
separate polypeptides: exon 1 of AAVS1, and mCherry. The absence of an upstream promoter on
the donor plasmid ensures that mCherry is only expressed from the endogenous AAVS1 promoter
- 42 -
following a successful integration event. This approach is analogous to gene trapping strategies347.
mCherry fluorescence is therefore a reliable measure of precise gene targeting, which can be
quantified by flow cytometry. This is demonstrated by the fact that transfection of either the donor
or CRISPR/Cas9 plasmid alone produces negligible mCherry expression (Fig. 4C). In contrast,
appreciable levels of mCherry expression are only attained following co-transfection of both
donor and CRISPR/Cas9 plasmids.
- 43 -
Figure 4. Schematic diagram of mCherry gene integration into the AAVS1 locus. a) CRISPR/Cas9 gene expression cassette containing the sgRNA and Cas9 flanked by a FLAG tag, NLS, T2A-EGFP, and a poly(A) signal. b) Promoterless mCherry donor construct containing the mCherry ORF downstream of a splice acceptor site and T2A, and upstream of a poly(A) signal. The entire cassette is flanked on either side by ~1kb of homologous sequence to the AAVS1 locus. Following a successful gene integration event, mCherry expression is driven by the endogenous AAVS1 promoter. c) HEK293 cells were transfected with the indicated plasmids and subsequently harvested 48 hr post-transfection for analysis by flow cytometry.
Exon1 Exon2AAVS1
Cas9
Exon1 Exon2AAVS1
a
b
Donor:CRISPR:
+-
-+
++
AAVS1
AAVS1
c
- 44 -
4.2 CtIP and EXO1-4D significantly enhance GTE
CtIP and EXO1 mutants were generated by site-directed mutagenesis (see Table 1 for a full list
of mutants). CtIP and EXO1 mutants, as well as CDK1, were then cloned into expression plasmids
under the control of the chicken E-actin promoter, which is frequently used to drive high levels of
gene expression in mammalian expression vectors. To assess the ability of CDK1, as well as CtIP
and EXO1 variants to enhance GTE, the respective expression plasmids were co-transfected with
the AAVS1 CRISPR/Cas9 and donor construct into HEK293 cells. 48 hr post-transfection, cells
were harvested for flow cytometry analysis. Representative flow cytometry data is shown in Fig.
5A. The depicted populations are gated on GFP+ cells, and the proportion of mCherry+ is
expressed as a percentage of the parent population. Because GFP is constitutively expressed from
the CRISPR/Cas9 plasmid, this effectively controls for transfection efficiency. To assess
enhancements in GTE, data were normalized to the CRISPR + donor condition. Co-transfection
with CtIP-WT, -3EA, -M, -M2A, -M3A as well as EXO1-4D and CDK1 elicited significant
enhancements in GTE up to ~2-3 fold (Fig. 5C). Furthermore, absolute targeting efficiencies
reached up to ~20% (Fig. 5B).
Subsequent studies investigated the possibility that observed enhancements in GTE were due in
part to a greater total amount of transfected DNA in experimental vs control conditions. For these
purposes, a lacZ expression plasmid (which theoretically would not influence GTE) was co-
transfected with either the donor plasmid alone, or together with the CRISPR + donor condition.
From these studies, it was evident that the total amount of DNA was indeed influencing the
observed GTE measurements (Fig. 5D). Furthermore, the increase in mCherry+ cells elicited by
co-transfection with lacZ (in the absence of CRISPR) indicated that there was a significant amount
of background mCherry expression from the donor plasmid. This is puzzling due to the absence
of an upstream promoter, but could be the result of weak cryptic promoter activity in the upstream
homology arm. Although the background expression may hinder the reliability of these data, these
experiments were taken as a sufficient initial screen to demonstrate that CtIP mutants were no
more effective than the wild-type CtIP protein. Accordingly, subsequent experiments were limited
to the investigation of CtIP-WT, CDK1 and EXO1-4D.
- 45 -
a
CtIP-3E
A
CtIP-M
3A
CtIP-M
CtIP-M
2A
CtIP-W
T
EXO1-4D
CDK10
1
2
3
4
%m
Che
rry+
/ %
GFP
+ (n
orm
aliz
ed)
**
*
CtIP-3E
A
CtIP-M
3A
CtIP-M
CtIP-M
2A
CtIP-W
T
EXO1-4D
CDK10
5
10
15
%m
Che
rry+
/ %
GFP
+
Donor: ++CRISPR:
++
Donor: +
+
lacZ lacZ
CRISPR:
Donor: +
+
CtIP-3EA CtIP-M3A CtIP-M
CtIP-M2A CtIP-WT CDK1 EXO1-4D
CRISPR:
b c
d
Figure 5. Enhancement of precise gene targeting efficiency by CDK1, CtIP and EXO1-4D in HEK293 cells. HEK293 cells were transfected with the indicated plasmids and subsequently harvested 48 hr post-transfection for analysis by flow cytometry. a) Representative flow cytometry experiment. The populations displayed are gated on GFP+ cells to control for transfection efficiency. b) Average gene targeting efficiency. c) Fold increase in gene targeting efficiency. All values are normalized to Donor+CRISPR condition. d) lacZ control reveals background mCherry expression from the Donor plasmid. Data presented as mean ± SEM (n=3). * P < 0.05, ** P < 0.01.
- 46 -
In order to dilute background mCherry expression from the donor plasmid, HEK293 cells were
passed 6 times over the course of 3 weeks post-transfection before flow cytometry analysis. This
effectively eliminated residual plasmid in cells and ensured that mCherry expression was only a
consequence of successful integration events. This is supported by the fact that in lacZ controls,
mCherry expression is an order of magnitude higher in the presence of CRISPR, despite equal
amounts of transfected DNA (Fig. 6A, panels 2,4). However, co-transfection of lacZ with
CRISPR + donor enhanced GTE values relative to CRISPR + donor controls (panels 3,4). This
can be explained due to the greater total amount of DNA transfected in the lacZ condition, which
effectively stabilizes CRISPR and donor plasmids, thus allowing greater opportunity for
integration events. Accordingly, GTE enhancements in the lacZ condition were subtracted from
GTE values in experimental samples in order to control for the amount of transfected DNA.
Corrected GTE values were then normalized to the CRISPR + donor condition. These experiments
demonstrated that CtIP-WT and EXO1-4D can elicit up to 3- and 6-fold enhancements in GTE,
respectively, whereas CDK1 had no significant effect (Fig. 6C). Absolute integration efficiencies
measured up to 0.5-1% of total cells (Fig 6B). Furthermore, various combinations of factors were
assessed for potential additive or synergistic effects on GTE enhancement, but revealed no
significant increases (Fig. 6E).
- 47 -
lacZ
lacZ
CtIP-WT+CDK1
EXO1+CDK1
CtIP-WT+EXO1-4D
0.0
0.2
0.4
0.6
0.8
1.0
%mCherry+
Donor: ++CRISPR:
lacZ
lacZ
CDK1
CtIP-W
T
EXO1-4D
0.0
0.5
1.0
1.5
%m
Che
rry+
Donor: ++CRISPR:
++
CDK1
CtIP-W
T
EXO1-4D
0
2
4
6
8
%m
Che
rry+
(nor
mal
ized
)
***
lacZ
lacZ
CDK1
CtIP-W
T
EXO1-4D
0.0
0.5
1.0
1.5
%m
Che
rry+
Donor: ++CRISPR:
++
CDK1
CtIP-W
T
EXO1-4D
0
2
4
6
8
%m
Che
rry+
(nor
mal
ized
)
***
CtIP-W
T + CDK1
CDK1 + EXO1-4
D
CtIP-W
T + EXO1-4
D0
2
4
6
%m
Che
rry+
(fol
d ch
ange
)
++
lacZ
lacZ
CDK1
CtIP-W
T
EXO1-4D
0.0
0.5
1.0
1.5
%m
Che
rry+
Donor: ++CRISPR:
++
CDK1
CtIP-W
T
EXO1-4D
0
2
4
6
8
%m
Che
rry+
(nor
mal
ized
)***nse
Figure 6. Enhancement of precise gene targeting by CtIP and EXO1-4D in HEK293 cells as measured by flow cytometry. HEK293 cells were transfected with the indicated plasmids and subsequently passed 6 times over the course of 3 weeks. Cells were then harvested for analysis by flow cytometry. a) Representative flow cytometry experiment. b) Average gene targeting efficiency of controls and individual factors. c) Fold change in gene targeting efficiency induced by individual factors. d) Average gene targeting efficiency of controls and combinations of factors. e) Fold change in gene targeting efficiency induced by combinations of factors. Data presented as mean ± SEM (n=3 or 4). * P < 0.05, ** P < 0.01.
lacZ CtIP EXO1-4D
lacZ
Donor: +
+CRISPR:
lacZ CDK1 CtIP-WT EXO1-4D
Panel #: 1 2 3 4 5 6 7
a
b c
lacZ
lacZ
CtIP-WT+CDK1
EXO1+CDK1
CtIP-WT+EXO1-4D
0.0
0.2
0.4
0.6
0.8
1.0
%mCherry+
Donor: ++CRISPR:
lacZ
lacZ
CtIP-WT+CDK1
EXO1+CDK1
CtIP-WT+EXO1-4D
0.0
0.2
0.4
0.6
0.8
1.0
%mCherry+
Donor: ++CRISPR:
d
- 48 -
Figure 7. Enhancement of precise gene targeting efficiency by SCR7 in HEK293 cells. a) HEK293 cells were transfected with the indicated plasmids. SCR7 was added to the culture media 18 hr post-transfection at the indicated concentrations. Cells were passed 6 times over the course of 3 weeks, and then harvested for analysis by flow cytometry. b) Comparing the respective fold changes associated with SCR7, CtIP-WT, and EXO1-4D as measured by flow cytometry 3 weeks post-transfection. Data presented as mean ± SEM (n=3). * P < 0.05.
DMSO0.0
1 0.1 10
1
2
3
4
%m
Che
rry+
(nor
mal
ized
) **
Donor: +
+
SCR7 (µM)
CRISPR:
0.1µM
SCR7
CtIP-W
T
EXO1-4D
0
2
4
6
8
rela
tive
enha
ncem
ent *
+
+
a b
SCR7 is a small molecule inhibitor of DNA ligase IV that has been widely utilized for
enhancing GTE. Investigators have been able to upregulate HDR and therefore GTE anywhere
from ~2 to 20-fold in mammalian cell lines and zygotes using SCR7315,316. Here, we
investigated the utility of SCR7 using our flow cytometry assay and compared these results to
those obtained by CtIP-WT and EXO1-4D. HEK293 cells treated with various concentrations
of SCR7 were similarly passed 6 times over the course of 3 weeks, and subsequently harvested
for flow cytometry analysis. These data demonstrate that 0.1µM SCR7 was the most effective
concentration used, eliciting up to 3-fold enhancements in GTE (Fig. 7A). Thus, the increase in
GTE evoked by CtIP-WT over-expression is comparable to that of SCR7, while EXO1-4D is
significantly more effective in this respect (Fig. 7B).
- 49 -
In order to confirm the GTE enhancements observed by flow cytometry, junction PCR was
performed at the AAVS1 integration site. Briefly, HEK293 cells were transfected with AAVS1
CRISPR/Cas9 and mCherry donor plasmids, as well as either CtIP-WT, EXO1-4D, or CDK1.
Transfectants were passed 6 times over the course of 3 weeks, and genomic DNA was
subsequently harvested and purified. Limited-cycle PCR was performed to amplify the junction
site using the indicated primers (Fig 8A). Band intensities for each condition were quantified and
normalized to their respective control amplicons (Fig. 8B). As in the flow cytometry experiments,
GTE enhancements in the lacZ condition were subtracted from GTE values in experimental
samples in order to control for the amount of transfected DNA. Corrected GTE values were then
normalized to the CRISPR + donor condition. These data largely corroborate those obtained from
flow cytometry experiments, demonstrating ~3- and 3.5-fold enhancements by CtIP-WT and
EXO1-4D, respectively. Furthermore, there was no significant enhancement by CDK1, and no
additive or synergistic effects by combining various factors (Fig. 8C).
- 50 -
a
c
Donor:
CRISPR:
+
+
CtIP-W
T
EXO1-4D
CDK1
CtIP-W
T + EXO1-4
D
CtIP-W
T + CDK1
CDK1+EXO1-4
D-1
0
1
2
3
4
5
band
inte
nsity
(nor
mal
ized
)
****
*
Donor: +
+CRISPR:
LeftArm RightArmpAmCherry2AGenomicDNA
----------------------------------------------1.45kb
--------------------------------------------------------------------------------------------------------------------------2.5kb
1:2:
b
1:
2:Prim
er s
et
Figure 8. Junction PCR demonstrating the enhancement of precise gene targeting efficiency by CtIP and EXO1-4D in HEK293 cells. a) Representation of genomic DNA containing a successfully integrated mCherry cassette. Primer set 1 is specific for the inserted cassette, while primer set 2 amplifies the wild-type AAVS1 locus. b) Representative junction PCR experiment. HEK293 cells were transfected with the indicated plasmids and subsequently passed 6 times over the course of 3 weeks. Genomic DNA was then harvested and purified from each treatment condition. Primer set 1 was used to amplify the mCherry insert, and primer set 2 was used as a PCR control. c) Fold change in gene targeting efficiency as measured by junction PCR. Data presented as mean ± SEM (n=3 or 4). * P < 0.05, ** P < 0.01.
Prim
er s
et
- 51 -
4.3 IB3-1-CFTR-EGFP cell line
One of the main limitations of the AAVS1 mCherry assay is that it cannot distinguish between
on-target and potential off-target integration events. Although the assay was designed so that
mCherry expression is driven by the endogenous AAVS1 promoter, it could also be inserted under
the control of an off-target promoter. We sought to generate a cell line that could be used for an
assay to distinguish between these distinct integration events. For these purposes, we generated a
cell line from IB3-1 cells, which are immortalized bronchial epithelial cells from a CF patient49.
To generate the cell line, CRISPR/Cas9 was programmed to cut immediately upstream of CFTR
exon 1 and insert an EGFP-puromycin cassette (Fig. 9A). Once the cell line had been obtained,
CRISPR/Cas9 was programmed to cut within the EGFP locus and insert an mCherry expression
cassette (Fig. 9B). A precise integration event would therefore knockout EGFP expression and
induce mCherry expression, whereas an off-target insertion would be double positive. These
distinct integration events could be readily measured by flow cytometry.
In order to generate the cell line, CRISPR/Cas9 targeting CFTR exon 1 and the requisite donor
DNA (Fig. 9A) were co-transfected into IB3-1 cells. Initially, we tried to isolate clonal integrants
by sorting EGFP+ cells using FACS. However, despite sorting close to 1000 single cells, not a
single well contained a growing colony after 3 weeks post-sorting. Puromycin selection was
thereafter performed on the remaining transfected plates in order to isolate clonal integrated cells.
Subsequent limited dilution allowed for single cell pipetting into 96-well plates. Single cell clones
were allowed proliferate (Fig. 10A), and were then expanded to larger culture vessels (Fig. 10B).
To this stage, 6 colonies were successfully expanded and healthy.
- 52 -
Exon1CFTRCas9
Exon2
Donor GFP pA puCMV PGK-puromycin-pA RightArmLeftArm
a
Figure 9. Schematic representation of the IB3-1-CFTR-EGFP cell line and the associated colour-switch assay. a) To generate the cell line, Cas9 was programmed to cut immediately upstream of CFTR exon1. The donor DNA to be integrated harbours an EGFP-puromycin expression cassette flanked on either side by ~500 bp of sequence homologous to the CFTR locus. b) Cas9 is programmed to cut the IB3-1-CFTR-EGFP cell line within the EGFP sequence, and subsequently insert an mCherry expression cassette.
Exon 1CFTR GFP pACMV
Cas9
GFP-mCherry+
GFP+mCherry-
GFP+mCherry+
Precise insertion:No integration: Random integration:
Left Arm pAmCherryCMV Right Arm
PGK-puromycin-pA
Donor T7
b
Exon 1CFTR GFP pACMV PGK-puromycin-pA
Exon 1CFTR GFP pACMV
Cas9
GFP-mCherry+
GFP+mCherry-
GFP+mCherry+
Precise insertion:No integration: Random integration:
Left Arm pAmCherryCMV Right Arm
PGK-puromycin-pA
Donor T7
Exon 1CFTR GFP pACMV
Cas9
GFP-mCherry+
GFP+mCherry-
GFP+mCherry+
Precise insertion:No integration: Random integration:
Left Arm pAmCherryCMV Right Arm
PGK-puromycin-pA
Donor T7
- 53 -
Figure 10. Investigating the identity and CRISPR cleavage efficiency of IB3-1-CFTR-EGFP cell line clones. a) Fluorescence microscopy image of clone #2 isolated from puromycin selection (20X magnification) and b) following 10 passages grown to confluency (5X magnification). c) PCR amplification of the wild-type CFTR locus and d) the transgenic EGFP sequence from purified genomic DNA of each clone. e) T7E1 measuring CRISPR cleavage efficiency in each clone. Each clone was transfected with CRISPR (targeting EGFP) and single-stranded mCherry donor DNA (Fig. 11), and genomic DNA was harvested and purified one week post-transfection. PCR was used to amplify EGFP from each clone, the products of which were denatured and randomly re-annealed. Re-annealed amplicons were then incubated with T7E1 endonuclease to cleave amplicons with base-pair mismatches, and then run on a 2% agarose gel.
a b
4% 6% 17% 19% 15% 13% 26% 34%Clone #: 2 3 1 2 3 4 5 6
negative controls
positivecontrol
Cleavageefficiency:
e
Clone #: 1 2 3 4 5 6 1 2 3 4 5 6
dc
- 54 -
In order to verify that the EGFP cassette had been inserted in the correct locus, we tried to amplify
the EGFP-CFTR junction from the 6 clones obtained from selection. However, despite being able
to amplify the wild-type CFTR locus (Fig. 10C) and the EGFP sequence (Fig. 10D), we were
unable to amplify the EGFP-CFTR junction. A myriad of primer sets and PCR conditions were
attempted with no success for any of the 6 clones obtained, indicating off-target integrations.
Because all 6 clones appeared to have off-target integrations, we speculated that the homology
arms flanking the EGFP-puromycin cassette on the donor DNA may not have perfect sequence
homology to the IB3-1 CFTR locus, as this is a transformed cell line. To investigate this
possibility, we PCR amplified the CFTR locus from genomic DNA isolated from IB3-1 cells, and
Sanger sequencing was used to analyze the PCR products. However, both homology arms used
on the donor DNA in fact harboured 100% identity to the IB3-1 CFTR genomic DNA (Fig. 11).
However, off-target insertions should not necessarily prohibit the use of these cell lines for the
colour switch assay, as the requisite homology arms on the mCherry donor do not span beyond
the EGFP cassette (Fig. 9B). Furthermore, numerous studies have demonstrated the utility of
linear single-stranded donor DNA (as opposed to circular double-stranded plasmids), for
CRISPR/Cas9-mediated gene targeting333–338. Therefore, we also wanted to assess the utility of
CtIP and EXO1-4D for enhancing GTE using ssDNA donors. In order to generate ssDNA from
the mCherry donor, a T7 promoter was cloned in the reverse orientation downstream of the
homology arms (Fig 9B). T7 in vitro transcription followed by DNaseI digestion and RNA
purification generates large quantities of donor transcripts. These transcripts are subsequently
used for gene-specific reverse transcription, followed by RNaseH digestion and ssDNA
purification. Products of each step were run on an agarose gel and can be seen in Fig. 12. In order
to verify the identity of the ssDNA, it was used as a template for PCR, purified, and sequenced.
- 55 -
GAGGAGGAAGGCAGGCTCCGGGGAAGCTGGTGGCAGCGGGTCCTGGGTCTGGCGGACCCTGACGCGAAGGAGGGTCTAGGAAGCTCTCCGGGGAGCCGGTTCTCCCGCCGGTGGCTTCTTCTGTCCTCCAGCGTTGCCAACTGGACCTAAAGAGAGGCCGCGACTGTCGCCCACCTGCGGGATGGGCCTGGTGCTGGGCGGTAAGGACACGGACCTGGAAGGAGCGCGCGCGAGGGAGGGAGGCTGGGAGTCAGAATCGGGAAAGGGAGGTGCGGGGCGGCGAGGGAGCGAAGGAGGAGAGGAGGAAGGAGCGGGAGGGGTGCTGGCGGGGGTGCGTAGTGGGTGGAGAAAGCCGCTAGAGCAAATTTGGGGCCGGACCAGGCAGCACTCGGCTTTTAACCTGGGCAGTGAAGGCGGGGGAAAGAGCAAAAGGAAGGGGTGGTGTGCGGAGTAGGGGTGGGTGGGGGGAATTGGAAGCAAATGACATCACAGCAGGTCAGAGAAAAAGGGTTGAGCGGCAGGCACCCAGAGTAGTAGGTCTTTGGCATTAGGAGCTTGAGCCCAGACGGCCCTAGCAGGGACCCCAGCGCCCGAGAGACC
ATCATTCATTGTTTTGAAAGAAAATGTGGGTATTGTAGAATAAAACAGAAAGCATTAAGAAGAGATGGAAGAATGAACTGAAGCTGATTGAATAGAGAGCCACATCTACTTGCAACTGAAAAGTTAGAATCTCAAGACTCAAGTACGCTACTATGCACTTGTTTTATTTCATTTTTCTAAGAAACTAAAAATACTTGTTAATAAGTACCTAAGTATGGTTTATTGGTTTTCCCCCTTCATGCCTTGGACACTTGATTGTCTTCTTGGCACATACAGGTGCCATGCCTGCATATAGTAAGTGCTCAGAAAACATTTCTTGACTGAATTCAGCCAACAAAAATTTTGGGGTAGGTAGAAAATATATGCTTAAAGTATTTATTGTTATGAGACTGGATATATCTAGTATTTGTCACAGGTAAATGATTCTTCAAAAATTGAAAGCAAATTTGTTGAAATATTTATTTTGAAAAAAGTTACTTCACAAGCTATAAATTTTAAAAGCCATAGGAATAGATACCGAAGTTATATCCAACTGACATTTAATAAATTGTATTCATAGCCTAATGTGATGAGCCACAGAAGCTTGCAAACTTTAATGAG
Figure 11. IB3-1 CFTR homology arm sequencing. Genomic DNA from IB3-1 cells was harvested as described in methods. PCR was used to amplify the region corresponding to the homology arms on the IB3-1 CFTR donor plasmid. PCR products were purified and analyzed by Sanger sequencing.
Exon1CFTRCas9
Left HA Right HA
Exon2
- 56 -
Lane: 1 2 3 4 5 6 7
CRISPR/Cas9 (targeting EGFP) and the ssDNA mCherry donor were co-transfected into each
of the 6 IB3-1-CFTR-EGFP clones. 3 different sgRNAs targeting different EGFP sequence
motifs were tested for each clone. One week post transfection, genomic DNA from each
condition was harvested and purified. The T7E1 genomic cleavage assay was performed to
assess CRISPR/Cas9 cutting efficiency. This assay relies on the fact that Cas9-induced DSBs
are frequently repaired by NHEJ, resulting in indels at the break site. The sequence
surrounding the break site is then amplified from genomic DNA by PCR, the products of
which are then denatured and randomly re-annealed. This results in mutated sequence (a
consequence of Cas9 cleavage) pairing with wild-type sequence. The randomly annealed
amplicons are then incubated with T7E1 endonuclease, which cleaves mismatched dsDNA.
The cleaved amplicons can then be visualized as two distinct bands on an agarose gel, and are
a measure of CRISPR/Cas9 cutting efficiency (Fig. 10E). Only one of the three sgRNAs tested
resulted in appreciable cutting efficiencies. Despite successful cutting, however, when the
transfected cells were visualized by fluorescence microscopy prior to harvesting genomic
DNA, no mCherry fluorescence was evident.
Figure 12. Single-stranded mCherry donor production. Lane 1 is an RNA ladder. T7 in vitro transcription was performed using the mCherry donor plasmid (Fig. 6B), followed by DNaseI digestion and RNA purification (product run in lane 2). RNA was then used as a template for primer-specific reverse transcription, followed by RNaseH digestion (product run in lane 3), and ssDNA purification (product run in lane 4). Lane 5 is a DNA ladder. Lanes 6 and 7 are the same as lanes 3 and 4, respectively, except they were produced using a different primer for reverse transcription.
- 57 -
Chapter 5 Discussion
The technological power of CRISPR/Cas9 gene editing has already made a substantial impact on
genetics and genomics; agriculture and livestock; stem cell research and tissue engineering; the
development of organoids and disease models; as well as a range of gene and cell therapies. Of
particular interest is the applicability of CRISPR/Cas9 gene editing for in vivo gene therapies.
More specifically, the power to generate permanent genomic changes in diseased tissues without
the use of integrating viral vectors. This represents a tremendous technological leap for our ability
to correct heritable diseases at their genetic origins. Our group has sought to apply these
technologies specifically for CF gene therapy. Using our HD-Ad vectors, our goal is to deliver
CRISPR/Cas9 and the wild-type CFTR gene to permanently correct the CFTR genetic defect in
airway stem/progenitor cells, for which we have recently demonstrated successful gene delivery
in vivo85. However, the utility of this approach is still limited by the inherently low efficiency of
CRISPR/Cas9 gene targeting by HDR. In these studies, we have discovered genetically-encoded
means by which to significantly enhance GTE, which may improve the clinical utility of in vivo
gene therapies.
Our approach to enhancing GTE was largely based on previous studies demonstrating the
feasibility of perturbing DSB repair in favour of HDR. Accordingly, we sought to overexpress
CDK1, which has extensive regulatory control over the balance between DSB repair pathways,
whose activity promotes HDR while inhibiting NHEJ. There was also strong theoretical and
empirical support to investigate more proximal regulators of DNA end resection, namely CtIP
and EXO1, and site-specific mutants thereof. Our AAVS1-mCherry integration assay initially
appeared to be a reliable measure by which to test these factors (Fig. 4C). Initial screens using
this assay suggested that CDK1, as well as the CtIP and EXO1 variants could enhance GTE by
~2 to 3-fold (Fig. 5C). However, further investigation revealed that there was significant
background mCherry expression from the donor plasmid itself (Fig. 5D). This is puzzling, as there
is no upstream promoter on the mCherry donor cassette (Fig. 4B). The background expression is
therefore likely a result of weak cryptic promoter activity in the upstream homology arm.
- 58 -
However, there is no documented evidence for promoter activity in intron 1 of the PPP1R12C
gene in the literature.
Due to the background expression from the donor plasmid, we reasoned that harvesting
transfectants 48 hr post-transfection for flow cytometry was not the most reliable measure of
targeting efficiencies. However, these experiments were taken as a sufficient initial screen to
demonstrate that CtIP mutants were no more effective than the wild-type protein for enhancing
GTE (Fig. 5C). Transfectants of subsequent experiments were passaged over the course of 3
weeks prior to flow cytometry. This effectively diluted the background mCherry expression, such
that mCherry expression was only a consequence of successful integration events (Fig. 6). These
experiments revealed that CtIP-WT and EXO1-4D can significantly enhance GTE by ~3 and 6-
fold, respectively. CDK1 surprisingly had a negative impact on GTE with respect to controls, but
this reduction was not statistically significant.
There are a number of potential reasons why CDK1 did not upregulate GTE in these studies.
Firstly, the catalytic activity of CDK1 is dependent on binding to its cognate cyclin proteins,
which are themselves transcriptionally restricted to S/G2348,349. Therefore, ectopic CDK1
expression would presumably only upregulate HDR in the cell cycle phases in which HDR is
already most active. Such upregulation is also conditional on the relative concentrations of CDK1
to cyclins. That is, if cyclin proteins are endogenously limiting, ectopically overexpressed CDKs
would in fact not potentiate CDK activity, and therefore have no influence on GTE. Furthermore,
although the effect was not statistically significant, there was a trend towards reduced GTE in
response to CDK1 overexpression (Fig. 6). This can potentially be explained by the fact that
CDK1 has, in some cases, been shown to down-regulate HDR. For example, CDK1 activity has
been shown to inhibit RAD51 nucleoprotein filament formation in M phase Xenopus extracts350,
and forced activation of CDK1 in interphase cells can attenuate HDR in human cell lines351. CDKs
also control a multitude of metabolic processes, epigenetic modifications and transcriptional
programs352. Therefore, their overexpression may be cytotoxic, in turn reducing GTE in
transfected cells.
Based on our initial screen using the AAVS1-mCherry assay, the CtIP mutants tested were no
more effective in potentiating GTE than the wild type protein (Fig. 5). Accordingly, they were
- 59 -
not included in subsequent experiments. Retrospectively, however, the reliability of these
experiments appears to have been severely hampered by background expression from the donor
plasmid. For example, the direction of the CDK1 effect was reversed following donor plasmid
dilution (Fig. 5C vs Fig. 6C). Flow cytometry following vector dilution was likely a more accurate
measure of GTE, and this effect was confirmed by semi-quantitative junction PCR (Fig. 8). In
hindsight, therefore, one cannot utilize the initial screens as a reliable measure of GTE, nor
potential enhancements thereof.
With that in mind, it may not be reasonable to speculate on why the CtIP mutants were not more
effective than the wild-type protein, as it is evident that they were not reliably tested. Future
studies should therefore subject these mutants to the experimental protocol used in Fig 6.
However, it is worthwhile to retrospectively speculate on the shortcomings of the CtIP mutants
generated in these studies. Firstly, the mutants tested concurrently harboured a number of
mutations. This may destabilize the native structure of the protein and therefore preclude its
potential utility for perturbing DSB repair. Such a phenomenon could be verified by RT-qPCR
and western blot. For these reasons, a more suitable approach would be to create a small library
of CtIP mutants, each possessing individual mutations and various combinations thereof.
However, assuming these combinatorial mutants did not influence native protein folding, there
are still limitations to this approach due to the quaternary structure of CtIP. That is, CtIP functions
as a homotetramer353, and therefore ectopically-expressed mutant peptides may readily form
quaternary structures with wild type conspecifics. This would presumably subject these proteins
to wild type regulatory stimuli, thus reducing potential efficacies of these mutants. A viable
solution to this limitation would be to co-express siRNAs targeting endogenous CtIP with siRNA-
resistant CtIP mutants.
It is evident that the results obtained here for the potential GTE-enhancing effects of the CtIP
mutants studied were inconclusive. Perhaps surprisingly, however, CtIP-WT significantly
enhanced GTE up to ~3-fold, as evidenced by flow cytometry (Fig. 6) and junction PCR (Fig. 8).
This may be a consequence of overcoming the endogenous down-regulation of CtIP-dependent
end resection natively mediated by ubiquitylation311–313. That is, CtIP overexpression may saturate
or exceed the capacities of the cognate E3 ubiquitin ligases to ubiquitylate CtIP, thus overcoming
the associated suppression of end resection.
- 60 -
The substantial increase in GTE in response to EXO1-4D overexpression is unsurprising, as it has
been shown to possess hyper-resective activity and potentiate HDR321. However, it is evident that
the magnitude of the ~6-fold increase observed using flow cytometry was not entirely
recapitulated by the ~3.5-fold increase observed using junction PCR (Fig. 6C vs Fig. 8C). This
discrepancy may be a consequence of off-target insertions. The flow cytometry assay measures
loci-independent mCherry expression within cells, whereas a positive junction PCR product is
dependent on a precise insertion at the AAVS1 locus. The 6-fold enhancement measured by flow
cytometry in response to EXO1-4D may therefore reflect an up-regulation of both on- and off-
target insertions. If this is indeed the case, the observed enhancements for CtIP would not have
been a consequence of off-target insertions, as the fold increases measured by flow cytometry and
junction PCR were virtually identical at ~3-fold (Fig. 3C, Fig. 5C). The discrepancy between
junction PCR and flow cytometry data for EXO1-4D could also be explained by the semi-
quantitative nature of junction PCR. Due to the exponential amplification of DNA in PCR,
saturation of amplicons may reduce the dynamic range of absolute band intensities, and thus the
fold enhancement in GTE.
We also investigated potential synergistic or additive effects associated with co-expression of
CtIP-WT and EXO1-4D (Fig. 6D,E). However, although these combinatorial approaches
increased GTE, the effects were not statistically significant, and thus no more effective than the
individual factors. Because CtIP and EXO1 function in contiguous biochemical pathways in
HDR, their co-overexpression may lead to dramatic hyper-resection phenotypes and severe
genomic instability. Concurrently overexpressing these factors may therefore be synthetically
lethal and undesirable for our purposes.
The IB3-1-CFTR-EGFP cell line would have been a useful model to test the efficacies of CtIP
and EXO1-4D, as it would have been able to distinguish between on- and off-target integration
events. Perhaps ironically, it was evident that all 6 clones obtained for the cell line harboured
EGFP-puromycin cassettes knocked in at off-target genomic loci. This could not be explained by
lack of sequence identity between the donor homology arms and CFTR genomic DNA, as the
genomic DNA was sequenced and revealed 100% identity. The results of this cell line generation
underscore another significant challenge facing CRISPR technology, that is, specificity. Although
not the focus of these studies, the ability to eliminate (or at least minimize) off-target genomic
- 61 -
cleavage events will be especially important for CRISPR therapeutics. This exemplifies the utility
of highly specific Cas9 variants such as eSpCas9 and SpCas9-HF197,198, which should be used in
these studies going forward.
Despite the fact that IB3-1 cell line clones harboured off-target insertions, we reasoned that this
would not abolish the utility of the clones. The requisite homology arms on the mCherry donor
do not span beyond the EGFP cassette (Fig. 9B), and therefore these clones could still theoretically
be used to assess precise insertions. Accordingly, we sought to test the utility of ssDNA donors
using this assay, as they have become the preferred donor template for many CRISPR gene
targeting applications333–338. However, upon co-transfection of the mCherry ssDNA donor and
CRISPR/Cas9 into each of these clones, no mCherry expression was evident by fluorescence
microscopy. This may have been a result of the integrity of the ssDNA production. As seen in
Fig. 12, the purified ssDNA migrates as a smear and faster than the corresponding RNA of similar
size. It remains unclear if this is simply the nature of how long (>2kb) ssDNA migrates on a non-
denaturing agarose gel, or if the product is a heterogeneous mixture of various species. Future
experiments should perform linear PCR (using a single primer) on the plasmid mCherry donor
template to generate ssDNA, in order to observe its migratory behavior on an agarose gel. This
will help evaluate the identity of the ssDNA. Furthermore, plasmid donor DNA should be co-
transfected with the CRISPR/Cas9 plasmid into the IB3-1 cell line clones and monitored for
mCherry expression. These experiments will help explain the inability to elicit mCherry
expression in the IB3-1 cell line clones using ssDNA donors in these studies.
5.1 Future directions
Further studies will undoubtedly need to confirm the efficacy of these approaches in primary
human cells to evaluate their applicability for clinical therapies. For such purposes, these factors
will need to be cloned into our HD-Ad vectors together with CRISPR/Cas9 and donor DNA.
Changing the context of the donor DNA from plasmids to HD-Ad vectors may influence the utility
of these factors, as it has been shown that the type of DSB repair pathway employed can be
- 62 -
dependent on the nature of the repair template354–356. Indeed, there are evident differences in the
behavior of viral DNA and small circular plasmids within the nucleus357,358.
If the efficacies of these factors are translatable to viral vectors in the context of primary cells and
animal models, this will have a tremendous impact on clinical applications for CF gene therapy.
Preliminary data from our laboratory suggests that we can achieve permanent transgene
integration in ~10% of transformed airway cells using our CRISPR HD-Ad vectors, without CtIP
or EXO1-4D (unpublished data). If the addition of CtIP or EXO1-4D to our CRISPR HD-Ad
vectors elicits GTE enhancements consistent with the data obtained here, we may be able to
achieve therapeutically-significant levels of gene editing in airway stem/progenitor cells.
Additional barriers to this goal include in vivo gene delivery and the host immune response. To
these ends, we have recently shown that our vectors can effectively target airway stem/progenitor
cells in primary culture, as well as in mouse and pig lungs in vivo85. Furthermore, studies have
shown that ~10% of wild type CFTR expression in CF airways is sufficient to correct lung
pathology359,360. Therefore, if the GTE enhancing strategies discovered here can be applied to our
HD-Ad vectors, in parallel with improvements in subverting the host immune response, we may
be able to achieve permanent correction of CF lung pathology.
Additional genetically-encoded approaches to enhancing CRISPR/Cas9 GTE have recently been
documented. For example, Canny et al. has generated a small ubiquitin peptide variant, i53, that
inhibits 53BP1 accumulation at DSB sites, in turn down-regulating NHEJ and promoting
compensatory HDR361. The authors demonstrate that i53 can be used to enhance CRISPR/Cas9
GTE by up to 5.6-fold in mouse and human cell lines using ds- and ssDNA donors. Furthermore,
the upregulation of HDR using i53 was largely dependent on the presence of CtIP. This suggests
that potential synergistic effects on GTE could be elicited by co-expressing i53 and CtIP (or
mutant CtIP variants). This may indeed be true for EXO1 as well, although not tested in this study.
Due to the large cloning capacity of HD-Ad vectors (~36 kb), i53 could be readily packaged into
our vectors together with either CtIP or EXO1-4D, in order to further enhance CRISPR/Cas9
GTE.
Despite the advancements made here and elsewhere for enhancing CRISPR/Cas9 GTE, there are
still unanswered questions and further room for improvement. It is commonly understood in the
- 63 -
research community that the favourability of NHEJ over HDR represents the sole and principle
impediment to CRISPR/Cas9 GTE. However, there are likely additional cellular and molecular
barriers to GTE that have been unexplored and largely overlooked, yet may be equally relevant.
These include the bias for sister chromatids as templates for repair in HDR, and the necessity of
exogenous donor DNA to spatially co-localize with the integration site for successful gene
targeting.
When HDR is employed to repair DSBs in post-replicative cells, the sister chromatid template is
physically linked to the DSB by the cohesin complex and associated factors362. Cohesin maintains
spatial co-localization of sister chromatids, and is crucial for efficient HDR in yeast and
mammalian cells363–365. Accordingly, cohesin is readily recruited to DSBs via the DNA damage
response366,367, and genome-wide sister chromatid cohesion is up-regulated in response to DSBs
in S/G2368. Furthermore, the ability of a particular sequence to function as a template for
recombinational repair is primarily limited by its proximity to the site of DNA damage369.
Unsurprisingly, the frequency at which sister chromatids are used as templates for HDR is orders
of magnitude greater than that of ectopic sequences370–372. Efficient HDR is therefore dependent
on the spatiotemporal co-localization of the template sequence with the DSB. It logically follows
that during the stage of the cell cycle in which HDR is most efficient (S/G2), the sister chromatid
physically associated with the DSB will predominate as the template for repair over exogenous
DNA that lacks a spatial bias for the genomic integration site. This is supported by the fact that
down-regulating essential cohesin subunits dramatically increases aberrant gene conversion
between homologous chromosomes373. The biased use of sister chromatids as templates for HDR
may therefore be a significant barrier suppressing CRISPR/Cas9 GTE.
The challenge of the sister chromatid bias is further compounded by the fact that exogenous DNA
does not have the liberty of unrestricted nuclear diffusion. In fact, some reports have shown that
plasmid DNA is >100-fold less mobile than soluble proteins of similar dimensions357, and that
DNA ranging from 21 bp to 6 kb is completely immobile374. Similarly, others have reported that
plasmids >5 kb accumulate in stagnant clusters at the periphery of the nucleus at sites of nuclear
entry375. On the contrary, some reports suggest that DNA <400 bp rapidly diffuses throughout the
nucleus and cytoplasm376, whereas others have demonstrated that plasmid mobility and
localization depends on its transcriptional output377,378. It appears that the spatiotemporal
- 64 -
dynamics of exogenous DNA within the nucleus remains relatively unclear. However, one could
reasonably conclude that an exogenous donor template would not have the liberty of unrestricted
nuclear diffusion, thus further amplifying the limitation of lacking a spatial bias for the genomic
integration site.
The impetus of conventional wisdom in this field has restricted investigative efforts on
potentiating compensatory HDR by inhibiting NHEJ. This is straightforwardly obvious, as gene
targeting depends on HDR. This approach also subverts the sister chromatid bias by artificially
upregulating HDR in G1 – i.e., in the absence of a sister chromatid. However, the lack of an active
spatial bias of the donor template for the target site raises additional concerns in this context. That
is, if HDR is employed at targeted DSBs in G1 in the absence of a spatiotemporally associated
donor template, ectopic recombination between non-allelic genomic sequences is a foreseeable
consequence. Such recombination events can lead to loss of heterozygosity (LOH), gross
chromosomal rearrangements (GCRs) and tumorogenesis379,380. These potential consequences
deserve more attention from the research community investigating ways to enhance CRISPR-
mediated gene targeting.
A number of potential strategies independent of DSB repair pathway choice could be employed
to circumvent the prospective deleterious consequences mentioned above. One idea would be to
minimize the use of sister chromatids as templates for repair in HDR in S/G2, thus raising the
probability that exogenous sequences would be used as templates for repair. This could be
accomplished by targeting critical regulators of cohesin dynamics, such as sororin and WAPL, to
reduce the physical association of sister chromatids in S/G2381,382. However, this approach
introduces the possibility of adverse cytogenetic effects that are observed in cohesinopathies383.
A potential solution to this would be to localize perturbations in cohesin dynamics to the target
integration site. This could be accomplished by using dCas9 as a fusion platform to direct cohesin
regulators to target sites, analogous to the use of dCas9 for transcriptional and epigenetic
regulation. This approach would additionally require the use of an orthogonal programmable
nuclease to induce the targeted DSB. The principle drawback here would therefore be the
necessity for excessive molecular machinery and attendant cloning capacities.
- 65 -
There may be a more parsimonious and effective way to overcome a number of these challenges
simultaneously. That is, active spatiotemporal recruitment of donor DNA molecules to the target
integration site. The approach would involve covalently linking ssDNA donors to the Cas9
enzyme inducing the targeted DSB. This could be effectively accomplished by fusing Cas9 to
SNAP-tag, a synthetic mutant of the DNA repair protein O6-alkylguanine-DNA alkyltransferase
(AGT) that reacts specifically with benzylguanine (BG) derivatives to generate covalent
linkages384. BG derivatives can themselves be covalently linked to ssDNA donors if the ssDNA
is generated using terminal amine-modified oligos. The covalent linkage between Cas9-SNAP
and BG-ssDNA can then be generated in vivo following co-transfection of Cas9-SNAP and BG-
ssDNA, or by in vitro methods (see online New England Biolabs, SNAP-tag Technologies for
details). Interestingly, studies have shown that Cas9 remains strongly associated with DSB
cleavage products following nucleolytic catalysis183. Cas9-SNAP-BG-ssDNA would therefore
establish and maintain donor co-localization following DSB induction, thus increasing the
probability that the localized donor will be used as a template for subsequent repair. Cas9-SNAP-
BG-ssDNA would be a large nucleoprotein complex, theoretically capable of making targeted
genomic DSBs while delivering the template donor DNA to the target locus. Using this engineered
approached, therefore, not only would Cas9 function as a programmable nuclease, but additionally
as a molecular motor that guides transgene cassettes to their cognate target loci.
This approach would simultaneously overcome a number of limitations currently facing efficient
CRISPR-mediated gene targeting. Namely, this would impose a spatiotemporal bias on the donor
DNA for its cognate target integration site. Accordingly, this would increase the probability that
exogenously supplied donor DNA is used as a template for Cas9 DSB repair over the sister
chromatid in S/G2. This could also be used in parallel with strategies that enhance the use of HDR
in G1. In this context, spatiotemporal co-localization of donor DNA would mitigate the possibility
of deleterious recombination events at the target site in the absence of a sister chromatid. This
approach would also presumably reduce the frequency of off-target insertions, as the donor DNA
would be spatially restricted to its target site, and therefore less available for recombination at
distant off-target loci.
The main limitation of this approach would be the requirement for chemical modifications on the
donor DNA which cannot be genetically encoded. Therefore, these could not be collectively
- 66 -
packaged into viral vectors. However, Cas9-SNAP-BG-ssDNA nucleoprotein complexes could
be readily synthesized in vitro and packaged into LNPs for ex vivo and in vivo delivery. These
components could also be packaged separately and assembled in vivo. That is, Cas9-SNAP could
be encoded and delivered in viral vectors in parallel with LNP-delivered BG-ssDNA. LNPs are
able to effectively deliver proteins and nucleic acids to the brain385, retina45,46, inner ear47, liver48,
as well as the nasal epithelium56,386 and lung54,387. This approach could therefore be amenable to
a variety of gene therapy applications, including lung gene therapy for CF.
5.2 Conclusion
Gene therapies have attracted substantial attention from physicians, scientists and the public alike,
and have found broad ranging therapeutic applications. However, many gene therapy clinical
trials have failed in the last few decades due to insufficient understanding of the major challenges
and a lack of the requisite technologies. Classical approaches involving -RTs were initially
effective but elicited deleterious genotoxic effects due to random genomic insertions. On the
contrary, superior integrating vectors like SIN--RVs and lentiviruses with improved safety
profiles have demonstrated utility in a number of clinical trials. However, they still rely on semi-
random integration, and therefore carry the risk of insertional mutagenesis and oncogenic
transformation. Semi-random integration also gives rise to transgene expression heterogeneity
amongst targeted cells, thus generating cells with differential potency for cell therapies. Although
non-integrating vectors such as AdVs and AAVs subvert these risks and therefore possess better
safety profiles, their efficacies for gene therapy are limited by the half-life and finitude of their
cognate target cells.
The advent of programmable nucleases such as CRISPR/Cas9 will greatly attenuate these risks
and overcome impeding limitations. The targeting capacities of CRISPR/Cas9 to permanently
correct gene code will improve the efficacies of non-integrating vectors, while mitigating the
genotoxic risks of insertional mutagenesis associated with integrating viruses. Directed genome
edits also have the advantage of preserving endogenous regulatory elements and therefore the
native spatiotemporal patterns of gene expression. Furthermore, Cas9 has proven to be a robust
- 67 -
platform for rationally-engineered mutants with novel genomic targeting functions. As a
consequence, this technology has opened the door to inducing genetic manipulations that were
hitherto unfeasible, such as making single base pair edits and targeted epigenetic modulations.
Despite the power of CRISPR/Cas9, immanent challenges remain for the application of these
technologies into the clinic. In particular, hijacking HDR of targeted DSBs to insert therapeutic
transgenes has thus far remained inefficient with limited solutions. Here, we present the use of
CtIP and EXO1-4D as novel, genetically-encoded strategies to perturb DSB repair in favour of
HDR and consequently enhance GTE. These studies have demonstrated that CtIP and EXO1-4D
overexpression can upregulate CRISPR/Cas9 GTE up to ~3- and 6-fold, respectively, in human
cell lines. These discoveries represent a significant step forward for our CF gene therapy strategy,
but future studies will be necessary to address a host of lingering unanswered questions. In
particular, assessing the utility of these strategies in the context of viral vectors in primary cells
and in vivo animal models will be pertinent to clinical translations.
Our efforts to generate the IB3-1-CFTR-EGFP cell line also illuminate the potential for insidious
off-target edits, which remain a preeminent concern for CRISPR therapeutics. Furthermore, the
long-term consequences of transiently manipulating DSB repair have yet to be thoroughly
investigated. The appropriate clinical implementations of CRISPR/Cas9 technologies will be
incumbent on our fastidious attention to these salient risk factors. Notwithstanding these persistent
challenges, however, CtIP and EXO1-4D may be clinically significant for viral gene therapy for
genetic diseases such as CF. Our high capacity HD-Ad vectors provide a unique opportunity to
co-package these factors with CRISPR/Cas9 and donor DNA on a single vector, which can readily
target airway stem/progenitor cells. The realization of this approach with the requisite
technologies may ultimately provide a cure for CF, the most common genetic disease in the
Caucasian population.
- 68 -
References
1. Bobadilla, J. L., Macek, M., Fine, J. P. & Farrell, P. M. Cystic fibrosis: A worldwide
analysis of CFTR mutations - Correlation with incidence data and application to
screening. Hum. Mutat. 19, 575–606 (2002).
2. O’Sullivan, B. P. & Freedman, S. D. Cystic fibrosis. The Lancet 373, 1891–1904 (2009).
3. MacKenzie, T., Gifford, A. H., Sabadosa, K. A., Quinton, H. B., Knapp, E. A., Goss, C.
H. & Marshall, B. C. Longevity of patients with cystic fibrosis in 2000 to 2010 and
beyond: Survival analysis of the Cystic Fibrosis Foundation Patient Registry. Ann. Intern.
Med. 161, 233–241 (2014).
4. Marshall, B., Elbert, A., Petren, K., Rizvi, S., Fink, A., Ostrenga, J., Sewall, A., Loeffler,
D. Patient Registry: Annual Data Report 2015. Cyst. Fibros. Found. Patient Regist. 94
(2016).
5. Elborn, J. S. Cystic fibrosis. The Lancet 388, 2519–2531 (2016).
6. Locher, K. P. Mechanistic diversity in ATP-binding cassette (ABC) transporters. Nat.
Struct. Mol. Biol. 23, 487–493 (2016).
7. Hunt, J. F., Wang, C. & Ford, R. C. Cystic fibrosis transmembrane conductance regulator
(ABCC7) structure. Cold Spring Harb. Perspect. Med. 3, a009514 (2013).
8. Hwang, T. C. & Kirk, K. L. The CFTR Ion channel: Gating, regulation, and anion
permeation. Cold Spring Harb. Perspect. Med. 3, a009498 (2013).
9. Chong, P. A., Kota, P., Dokholyan, N. V. & Forman-Kay, J. D. Dynamics intrinsic to
cystic fibrosis transmembrane conductance regulator function and stability. Cold Spring
Harb. Perspect. Med. 3, a009522 (2013).
10. Dalemans, W., Barbry, P., Champigny, G., Jallat, S., Jallat, S., Dott, K., Dreyer, D.,
Crystal, R. G., Pavirani, A., Lecocq, J.P. & Lazdunski, M. Altered chloride ion channel
kinetics associated with the ΔF508 cystic fibrosis mutation. Nature 354, 526–528 (1991).
- 69 -
11. Li, C., Ramjeesingh, M., Reyes, E., Jensen, T., Chang, X., Rommens, J. M. & Bear, C. E.
The cystic fibrosis mutation (ΔF508) does not influence the chloride channel activity of
CFTR. Nat. Genet. 3, 311–316 (1993).
12. Lukacs, G. L., Chang, X. B., Bear, C., Kartner, N., Mohamed, A., Riordan, J. R. &
Grinstein, S. The ΔF508 mutation decreases the stability of cystic fibrosis transmembrane
conductance regulator in the plasma membrane: Determination of functional half-lives on
transfected cells. J. Biol. Chem. 268, 21592–21598 (1993).
13. Protasevich, I., Yang, Z., Wang, C., Atwell, S., Zhao, X., Emtage, S., Wetmore, D., Hunt,
J. F. & Brouillette, C. G. Thermal unfolding studies show the disease causing F508del
mutation in CFTR thermodynamically destabilizes nucleotide-binding domain 1. Protein
Sci. 19, 1917–1931 (2010).
14. Wang, X. & Li, C. Decoding F508del misfolding in cystic fibrosis. Biomolecules 4, 498–
509 (2014).
15. Farinha, C. M. & Canato, S. From the endoplasmic reticulum to the plasma membrane:
mechanisms of CFTR folding and trafficking. Cell. Mol. Life Sci. 74, 39–55 (2017).
16. Grasemann, H. CFTR Modulator Therapy for Cystic Fibrosis. N. Engl. J. Med. 377,
2085–2088 (2017).
17. Ong, T. & Ramsey, B. W. Update in cystic fibrosis 2014. Am. J. Respir. Crit. Care Med.
192, 669–675 (2015).
18. Haq, I. J., Gray, M. A., Garnett, J. P., Ward, C. & Brodlie, M. Airway surface liquid
homeostasis in cystic fibrosis: pathophysiology and therapeutic targets. Thorax. 71, 284–
287 (2015).
19. Boucher, R. C., Stutts, M. J., Knowles, M. R., Cantley, L. & Gatzy, J. T. Na+ transport in
cystic fibrosis respiratory epithelia. Abnormal basal rate and response to adenylate
cyclase activation. J. Clin. Invest. 78, 1245–1252 (1986).
- 70 -
20. Boucher, R. C. Evidence for airway surface dehydration as the initiating event in CF
airway disease. J. Intern. Med. 261, 5–16 (2007).
21. Kreda, S. M., Davis, C. W. & Rose, M. C. CFTR, mucins, and mucus obstruction in
cystic fibrosis. Cold Spring Harb. Perspect. Med. 2, a009589 (2012).
22. Cohen-Cymberknoh, M., Shoseyov, D. & Kerem, E. Managing cystic fibrosis: Strategies
that increase life expectancy and improve quality of life. Am. J. Respir. Crit. Care Med.
183, 1463–1471 (2011).
23. Snell, G., Reed, A., Stern, M. & Hadjiliadis, D. The evolution of lung transplantation for
cystic fibrosis: A 2017 update. J. Cyst. Fibros. 16, 553–564 (2017).
24. McIntyre, K. Gender and survival in cystic fibrosis. Curr. Opin. Pulm. Med. 19, 392–397
(2013).
25. Ramsey, B. W. et al. A CFTR potentiator in patients with cystic fibrosis and the G551D
mutation. N. Engl. J. Med. 365, 1663–1672 (2011).
26. Van Goor, F., Hadida, S., Grootenhuis, P. D. J., Burton, B., Stack, J. H., Straley, K. S.,
Decker, C. J., Miller, M., McCartney, J., Olson, E. R., Wine, J. J., Frizzell, R. A.,
Ashlock, M. & Negulescu, P. A. Correction of the F508del-CFTR protein processing
defect in vitro by the investigational drug VX-809. Proc. Natl. Acad. Sci. 108, 18843–
18848 (2011).
27. Boyle, M. P., Bell, S. C., Konstan, M. W., McColley, S. A., Rowe, S. M., Rietschel, E.,
Huang, X., Waltz, D., Patel, N. R. & Rodman, D. A CFTR corrector (lumacaftor) and a
CFTR potentiator (ivacaftor) for treatment of patients with cystic fibrosis who have a
phe508del CFTR mutation: A phase 2 randomised controlled trial. Lancet Respir. Med. 2,
527–538 (2014).
28. Wainwright, C. E. et al. Lumacaftor–Ivacaftor in Patients with Cystic Fibrosis
Homozygous for Phe508del CFTR. N. Engl. J. Med. 373, 220–231 (2015).
29. Kerem, B., Rommens, J. M., Buchanan, J. A., Markiewicz, D., Cox, T. K., Chakravarti,
- 71 -
A., Buchwald, M. & Tsui, L. C. Identification of the cystic fibrosis gene: genetic analysis.
Science 245, 1073–1080 (1989).
30. Hacein-Bey-Abina, S. et al. Insertional oncogenesis in 4 patients after retrovirus-
mediated gene therapy of SCID-X1. J. Clin. Invest. 118, 3132–3142 (2008).
31. Howe, S. J. et al. Insertional mutagenesis combined with acquired somatic mutations
causes leukemogenesis following gene therapy of SCID-X1 patients. J. Clin. Invest. 118,
3143–3150 (2008).
32. Stein, S. et al. Genomic instability and myelodysplasia with monosomy 7 consequent to
EVI1 activation after gene therapy for chronic granulomatous disease. Nat. Med. 16, 198–
204 (2010).
33. Kang, H. J., Bartholomae, C. C., Paruzynski, A., Arens, A., Kim, S., Yu, S. S., Hong, Y.,
Joo, C. W., Yoon, N. K., Rhim, J. W., Kim, J. G., Von Kalle, C., Schmidt, M., Kim, S. &
Ahn, H. S. Retroviral gene therapy for X-linked chronic granulomatous disease: results
from phase I/II trial. Mol. Ther. 19, 2092–2101 (2011).
34. Braun, C. J. et al. Gene therapy for Wiskott-Aldrich syndrome-long-term efficacy and
genotoxicity. Sci. Transl. Med. 6, (2014).
35. Aiuti, A. et al. Lentiviral hematopoietic stem cell gene therapy in patients with wiskott-
aldrich syndrome. Science 341, (2013).
36. Hacein-Bey Abina, S. et al. Outcomes Following Gene Therapy in Patients With Severe
Wiskott-Aldrich Syndrome. JAMA 313, 1550 (2015).
37. Hacein-Bey-Abina, S. et al. A Modified γ-Retrovirus Vector for X-Linked Severe
Combined Immunodeficiency. N. Engl. J. Med. 371, 1407–1417 (2014).
38. Cavazzana-Calvo, M. et al. Transfusion independence and HMGA2 activation after gene
therapy of human β-thalassaemia. Nature 467, 318–322 (2010).
39. Cartier, N. et al. Hematopoietic stem cell gene therapy with a lentiviral vector in X-linked
- 72 -
adrenoleukodystrophy. Science 326, 818–823 (2009).
40. Biffi, A. et al. Lentiviral hematopoietic stem cell gene therapy benefits metachromatic
leukodystrophy. Science 341, (2013).
41. Ellis, J. Silencing and Variegation of gammaretrovirus and lentivirus vectors. Hum. Gene
Ther. 16, 1241–1246 (2005).
42. Rivière, I., Dunbar, C. E. & Sadelain, M. Hematopoietic stem cell engineering at a
crossroads. Blood 119, 1107–1116 (2012).
43. von Kalle, C., Deichmann, A. & Schmidt, M. Vector integration and tumorigenesis. Hum.
Gene Ther. 25, 475–481 (2014).
44. Cullis, P. R. & Hope, M. J. Lipid Nanoparticle systems for enabling gene therapies. Mol.
Ther. 25, 1467–1475 (2017).
45. del Pozo-Rodríguez, A., Delgado, D., Solinís, M. A., Gascón, A. R. & Pedraz, J. L. Solid
lipid nanoparticles for retinal gene therapy: Transfection and intracellular trafficking in
RPE cells. Int. J. Pharm. 360, 177–183 (2008).
46. Delgado, D., Del Pozo-Rodríguez, A., Solinís, M. Á., Avilés, M., Weber, B. H. F.,
Fernández, E., Rodríguez Gascón, A., Soliní, M. Á., Ferná, E. & Rodrí, A. Dextran and
protamine-based solid lipid nanoparticles as potential vectors for the treatment of X
linked juvenile retinoschisis. Hum. Gene Ther. 23, 345–355 (2012).
47. Zuris, J. A., Thompson, D. B., Shu, Y., Guilinger, J. P., Bessen, J. L., Hu, J. H., Maeder,
M. L., Joung, J. K., Chen, Z. Y. & Liu, D. R. Cationic lipid-mediated delivery of proteins
enables efficient protein-based genome editing in vitro and in vivo. Nat. Biotechnol. 33,
73–80 (2015).
48. Yin, H. et al. Therapeutic genome editing by combined viral and non-viral delivery of
CRISPR system components in vivo. Nat. Biotechnol. 34, 328–333 (2016).
49. High, K. H., Nathwani, A., Spencer, T. & Lillicrap, D. Current status of haemophilia
- 73 -
gene therapy. Haemophilia 20, 43–49 (2014).
50. Nathwani, A. C. et al. Long-Term Safety and Efficacy of Factor IX Gene Therapy in
Hemophilia B. N. Engl. J. Med. 371, 1994–2004 (2014).
51. Russell, S. et al. Efficacy and safety of voretigene neparvovec (AAV2-hRPE65v2) in
patients with RPE65-mediated inherited retinal dystrophy: a randomised, controlled,
open-label, phase 3 trial. Lancet 390, 849–860 (2017).
52. Rosenfeld, M. a, Yoshimura, K., Trapnell, B. C., Yoneyama, K., Rosenthal, E. R.,
Dalemans, W., Fukayama, M., Bargon, J., Stier, L. E. & Stratford-Perricaudet, L. In vivo
transfer of the human cystic fibrosis transmembrane conductance regulator gene to the
airway epithelium. Cell 68, 143–55 (1992).
53. Volpers, C. & Kochanek, S. Adenoviral vectors for gene transfer and therapy. J. Gene
Med. 6, S164–S171 (2004).
54. Hyde, S. C., Gill, D. R., Higgins, C. F., Trezise, A. E. O., MacVinish, L. J., Cuthbert, A.
W., Ratcliff, R., Evans, M. J. & Colledge, W. H. Correction of the ion transport defect in
cystic fibrosis transgenic mice by gene therapy. Nature 362, 250–255 (1993).
55. Zabner, J., Couture, L. A., Gregory, R. J., Graham, S. M., Smith, A. E. & Welsh, M. J.
Adenovirus-mediated gene transfer transiently corrects the chloride transport defect in
nasal epithelia of patients with cystic fibrosis. Cell 75, 207–216 (1993).
56. Caplen, N. J., Alton, E. W., Middleton, P. G., Dorin, J. R., Stevenson, B. J., Gao, X.,
Durham, S. R., Jeffery, P. K., Hodson, M. E. & Coutelle, C. Liposome-mediated CFTR
gene transfer to the nasal epithelium of patients with cystic fibrosis. Nat. Med. 1, 39–46
(1995).
57. Crystal, R. G., McElvaney, N. G., Rosenfeld, M. A., Chu, C. S., Mastrangeli, A., Hay, J.
G., Brody, S. L., Jaffe, H. A., Eissa, N. T. & Danel, C. Administration of an adenovirus
containing the human CFTR cDNA to the respiratory tract of individuals with cystic
fibrosis. Nat. Genet. 8, 42–51 (1994).
- 74 -
58. Knowles, M. R., Hohneker, K. W., Zhou, Z., Olsen, J. C., Noah, T. L., Hu, P. C., Leigh,
M. W., Engelhardt, J. F., Edwards, L. J. & Jones, K. R. A controlled study of adenoviral-
vector-mediated gene transfer in the nasal epithelium of patients with cystic fibrosis. N.
Engl. J. Med. 333, 823–831 (1995).
59. Hay, J. G., McElvaney, N. G., Herena, J. & Crystal, R. G. Modification of Nasal
Epithelial Potential Differences of Individuals with Cystic Fibrosis Consequent to Local
Administration of a Normal CFTR cDNA Adenovirus Gene Transfer Vector. Hum. Gene
Ther. 6, 1487–1496 (1995).
60. Zabner, J., Ramsey, B. W., Meeker, D. P., Aitken, M. L., Balfour, R. P., Gibson, R. L.,
Launspach, J., Moscicki, R. A., Richards, S. M. & Standaert, T. A. Repeat administration
of an adenovirus vector encoding cystic fibrosis transmembrane conductance regulator to
the nasal epithelium of patients with cystic fibrosis. J. Clin. Invest. 97, 1504–11 (1996).
61. Bellon, G. et al. Aerosol administration of a recombinant adenovirus expressing CFTR to
cystic fibrosis patients: a phase I clinical trial. Hum. Gene Ther. 8, 15–25 (1997).
62. Harvey, B. G., Leopold, P. L., Hackett, N. R., Grasso, T. M., Williams, P. M., Tucker, A.
L., Kaner, R. J., Ferris, B., Gonda, I., Sweeney, T. D., Ramalingam, R., Kovesdi, I., Shak,
S. & Crystal, R. G. Airway epithelial CFTR mRNA expression in cystic fibrosis patients
after repetitive administration of a recombinant adenovirus. J. Clin. Invest. 104, 1245–55
(1999).
63. Zuckerman, J. B., Robinson, C. B., McCoy, K. S., Shell, R., Sferra, T. J., Chirmule, N.,
Magosin, S. A., Propert, K. J., Brown-Parr, E. C., Hughes, J. V, Tazelaar, J., Baker, C.,
Goldman, M. J. & Wilson, J. M. A phase I study of adenovirus-mediated transfer of the
human cystic fibrosis transmembrane conductance regulator gene to a lung segment of
individuals with cystic fibrosis. Hum. Gene Ther. 10, 2973–85 (1999).
64. Joseph, P. M., O’Sullivan, B. P., Lapey, A., Dorkin, H., Oren, J., Balfour, R., Perricone,
M. A., Rosenberg, M., Wadsworth, S. C., Smith, A. E., St Georg, J. A. & Meeker, D. P.
Aerosol and lobar administration of a recombinant adenovirus to individuals with cystic
fibrosis. I. Methods, safety, and clinical implications. Hum. Gene Ther. 12, 1369–1382
- 75 -
(2001).
65. Perricone, M. A., Morris, J. E., Pavelka, K., Plog, M. S., O’Sullivan, B. P., Joseph, P. M.,
Dorkin, H., Lapey, A., Balfour, R., Meeker, D. P., Smith, A. E., Wadsworth, S. C. & St
Georg, J. A. Aerosol and lobar administration of a recombinant adenovirus to individuals
with cystic fibrosis. II. Transfection efficiency in airway epithelium. Hum. Gene Ther. 12,
1383–1394 (2001).
66. Samulski, R. J. & Muzyczka, N. AAV-Mediated Gene Therapy for Research and
Therapeutic Purposes. Annu. Rev. Virol. 1, 427–451 (2014).
67. Wagner, J. A., Moran, M. L., Messner, A. H., Daifuku, R., Conrad, C. K., Reynolds, T.,
Guggino, W. B., Moss, R. B., Carter, B. J., Wine, J. J., Flotte, T.R. & Gardner, P. A
Phase I/II Study of tgAAV-CF for the Treatment of Chronic Sinusitis in Patients with
Cystic Fibrosis. Stanford University, Stanford, California. Hum. Gene Ther. 9, 889–909
(1998).
68. Wagner, J. a et al. Safety and biological efficacy of an adeno-associated virus vector-
cystic fibrosis transmembrane regulator (AAV-CFTR) in the cystic fibrosis maxillary
sinus. Laryngoscope 109, 266–74 (1999).
69. Wagner, J. A. et al. A Phase II, Double-Blind, Randomized, Placebo-Controlled Clinical
Trial of tgAAVCF Using Maxillary Sinus Delivery in Patients with Cystic Fibrosis with
Antrostomies. Hum. Gene Ther. 13, 1349–1359 (2002).
70. Aitken, M. L., Moss, R. B., Waltz, D. A., Dovey, M. E., Tonelli, M. R., McNamara, S.
C., Gibson, R. L., Ramsey, B. W., Carter, B. J. & Reynolds, T. C. A Phase I Study of
Aerosolized Administration of tgAAVCF to Cystic Fibrosis Subjects with Mild Lung
Disease. Hum. Gene Ther. 12, 1907–1916 (2001).
71. Flotte, T. R., Zeitlin, P. L., Reynolds, T. C., Heald, A. E., Pedersen, P., Beck, S., Conrad,
C. K., Brass-Ernst, L., Humphries, M., Sullivan, K., Wetzel, R., Taylor, G., Carter, B.J. &
Guggino, W.B. Phase I trial of intranasal and endobronchial administration of a
recombinant adeno-associated virus serotype 2 (rAAV2)-CFTR vector in adult cystic
- 76 -
fibrosis patients: a two-part clinical study. Hum. Gene Ther. 14, 1079–1088 (2003).
72. Moss, R. B. et al. Repeated Aerosolized AAV-CFTR for Treatment of Cystic Fibrosis: A
Randomized Placebo-Controlled Phase 2B Trial. Hum. Gene Ther. 18, 726–732 (2007).
73. Kobinger, G. P., Weiner, D. J., Yu, Q. C. & Wilson, J. M. Filovirus-pseudotyped
lentiviral vector can efficiently and stably transduce airway epithelia in vivo. Nat.
Biotechnol. 19, 225–230 (2001).
74. Mitomo, K. et al. Toward gene therapy for cystic fibrosis using a lentivirus pseudotyped
with Sendai virus envelopes. Mol. Ther. 18, 1173–82 (2010).
75. Sinn, P. L., Cooney, A. L., Oakland, M., Dylla, D. E., Wallen, T. J., Pezzulo, A. A.,
Chang, E. H. & McCray, P. B. Lentiviral vector gene transfer to porcine airways. Mol.
Ther. Nucleic Acids 1, e56 (2012).
76. Griesenbach, U. et al. Assessment of F/HN-pseudotyped lentivirus as a clinically relevant
vector for lung gene therapy. Am. J. Respir. Crit. Care Med. 186, 846–856 (2012).
77. Patel, M., Giddings, A. M., Sechelski, J. & Olsen, J. C. High efficiency gene transfer to
airways of mice using influenza hemagglutinin pseudotyped lentiviral vectors. J. Gene
Med. 15, 51–62 (2013).
78. Parks, R. J., Chen, L., Anton, M., Sankar, U., Rudnicki, M. A. & Graham, F. L. A helper-
dependent adenovirus vector system: removal of helper virus by Cre-mediated excision of
the viral packaging signal. Proc. Natl. Acad. Sci. U. S. A. 93, 13565–70 (1996).
79. Toietta, G., Koehler, D. R., Finegold, M. J., Lee, B., Hu, J. & Beaudet, A. L. Reduced
inflammation and improved airway expression using helper-dependent adenoviral vectors
with a K18 promoter. Mol. Ther. 7, 649–658 (2003).
80. Koehler, D. R., Sajjan, U., Chow, Y.-H., Martin, B., Kent, G., Tanswell, A. K., McKerlie,
C., Forstner, J. F. & Hu, J. Protection of Cftr knockout mice from acute lung infection by
a helper-dependent adenoviral vector expressing Cftr in airway epithelia. Proc. Natl.
Acad. Sci. U. S. A. 100, 15364–9 (2003).
- 77 -
81. Farmen, S. L., Karp, P. H., Ng, P., Palmer, D. J., Koehler, D. R., Hu, J., Beaudet, A. L.,
Zabner, J. & Welsh, M. J. Gene transfer of CFTR to airway epithelia: low levels of
expression are sufficient to correct Cl- transport and overexpression can generate
basolateral CFTR. Am. J. Physiol. Lung Cell. Mol. Physiol. 289, L1123-30 (2005).
82. Cao, H., Ouyang, H., Ip, W., Du, K., Duan, W., Avolio, J., Wu, J., Duan, C., Yeger, H.,
Bear, C. E., Gonska, T., Hu, J. & Moraes, T. J. Testing gene therapy vectors in human
primary nasal epithelial cultures. Mol. Ther. - Methods Clin. Dev. 2, 15034 (2015).
83. Cao, H. et al. Efficient gene delivery to pig airway epithelia and submucosal glands using
helper-dependent adenoviral vectors. Mol. Ther. - Nucleic Acids 2, (2013).
84. Rawlins, E. L. & Hogan, B. L. M. Epithelial stem cells of the lung: privileged few or
opportunities for many? Development 133, 2455–65 (2006).
85. Cao, H., Ouyang, H., Grasemann, H., Bartlett, C., Du, K., Duan, R., Shi, F., Estrada, M.,
Seigel, K., Coates, A., Yeger, H., Bear, CE., Gonska, T., Moraes, T.J. & Hu, J.
Transducing airway basal cells with a helper-dependent adenoviral vector for lung gene
therapy. Hum. Gene Ther. (2018) doi:10.1089/hum.2017.201.
86. Muller, H. J. Artificial transmutation of the gene. Science 66, 84–87 (1927).
87. Auerbach, C. & Robson, J. M. Chemical production of mutations. Nature 157, 302
(1946).
88. Scherer, S. & Davis, R. W. Replacement of chromosome segments with altered DNA
sequences constructed in vitro. Proc. Natl. Acad. Sci. U. S. A. 76, 4951–5 (1979).
89. Rothstein, R. J. One-Step Gene Disruption in Yeast. Methods Enzymol. 101, 202–211
(1983).
90. Smithies, O., Gregg, R. G., Boggs, S. S., Koralewski, M. A. & Kucherlapati, R. S.
Insertion of DNA sequences into the human chromosomal β-globin locus by homologous
recombination. Nature 317, 230–234 (1985).
- 78 -
91. Thomas, K. R., Folger, K. R. & Capecchi, M. R. High frequency targeting of genes to
specific sites in the mammalian genome. Cell 44, 419–428 (1986).
92. Latt, S. Sister chromatid exchange formation. Annu. Rev. Genet. 15, 11–55 (1981).
93. Padmore, R., Cao, L. & Kleckner, N. Temporal comparison of recombination and
synaptonemal complex formation during meiosis in S. cerevisiae. Cell 66, 1239–1256
(1991).
94. Plessis, A., Perrin, A., Haber, J. E. & Dujon, B. Site-specific recombination determined
by I-SceI, a mitochondrial group I intron-encoded endonuclease expressed in the yeast
nucleus. Genetics 130, 451–460 (1992).
95. Choulika, A., Perrin, A., Dujon, B. & Ois Nicolas, J. Induction of homologous
recombination in mammalian chromosomes by using the I-scei system of saccharomyces
cerevisiae. Mol. Cell. Biol. 15, 1968–1973 (1995).
96. Rouet, P., Smih, F. & Jasin, M. Introduction of double-strand breaks into the genome of
mouse cells by expression of a rare-cutting endonuclease. Mol. Cell. Biol. 14, 8096–106
(1994).
97. Pavletich, N. P. & Pabo, C. O. Zinc finger-DNA recognition: Crystal structure of a
Zif268-DNA complex at 2.1 Å. Science 252, 809–817 (1991).
98. Klug, A. The Discovery of Zinc Fingers and Their Applications in Gene Regulation and
Genome Manipulation. Annu. Rev. Biochem. 79, 213–231 (2010).
99. Liu, Q., Segal, D. J., Ghiara, J. B. & Barbas, C. F. Design of polydactyl zinc-finger
proteins for unique addressing within complex genomes. Proc. Natl. Acad. Sci. 94, 5525–
5530 (1997).
100. Kim, Y. G., Cha, J. & Chandrasegaran, S. Hybrid restriction enzymes: zinc finger fusions
to Fok I cleavage domain. Proc. Natl. Acad. Sci. 93, 1156–1160 (1996).
101. Isalan, M., Choo, Y. & Klug, A. Synergy between adjacent zinc fingers in sequence-
- 79 -
specific DNA recognition. Proc. Natl. Acad. Sci. U. S. A. 94, 5617–21 (1997).
102. Isalan, M., Klug, A. & Choo, Y. Comprehensive DNA recognition through concerted
interactions from adjacent zinc fingers. Biochemistry 37, 12026–12033 (1998).
103. Miller, J. C. & Pabo, C. O. Rearrangement of side-chains in a zif268 mutant highlights
the complexities of zinc finger-DNA recognition. J. Mol. Biol. 313, 309–315 (2001).
104. Pabo, C., Peisach, E. & Grant, R. Design and selection of novel cys2his2 zinc finger
proteins. Annu. Rev. Biochem. 70, 313–340 (2001).
105. Dutta, S., Madan, S. & Sundar, D. Exploiting the recognition code for elucidating the
mechanism of zinc finger protein-DNA interactions. BMC Genomics 17, (2016) doi:
10.1186/s12864-016-3324-8.
106. Moore, F. E., Reyon, D., Sander, J. D., Martinez, S. A., Blackburn, J. S., Khayter, C.,
Ramirez, C. L., Joung, J. K. & Langenau, D. M. Improved somatic mutagenesis in
zebrafish using transcription activator-like effector nucleases (TALENs). PLoS One 7,
e37877 (2012).
107. Yang, D. et al. Generation of PPARγ mono-allelic knockout pigs via zinc-finger
nucleases and nuclear transfer cloning. Cell Res. 21, 979–982 (2011).
108. Liu, X., Wang, Y., Guo, W., Chang, B., Liu, J., Guo, Z., Quan, F. & Zhang, Y. Zinc-
finger nickase-mediated insertion of the lysostaphin gene into the beta-casein locus in
cloned cows. Nat. Commun. 4, 2565 (2013).
109. Doyon, Y., McCammon, J. M., Miller, J. C., Faraji, F., Ngo, C., Katibah, G. E., Amora,
R., Hocking, T. D., Zhang, L., Rebar, E. J., Gregory, P. D., Urnov, F. D. & Amacher, S.
L. Heritable targeted gene disruption in zebrafish using designed zinc-finger nucleases.
Nat. Biotechnol. 26, 702–708 (2008).
110. Carbery, I. D., Ji, D., Harrington, A., Brown, V., Weinstein, E. J., Liaw, L. & Cui, X.
Targeted genome modification in mice using zinc-finger nucleases. Genetics 186, 451–
459 (2010).
- 80 -
111. Hockemeyer, D. et al. Efficient targeting of expressed and silent genes in human ESCs
and iPSCs using zinc-finger nucleases. Nat. Biotechnol. 27, 851–857 (2009).
112. Li, H. et al. In vivo genome editing restores haemostasis in a mouse model of
haemophilia. Nature 475, 217–221 (2011).
113. Hoban, M. D. et al. Correction of the sickle cell disease mutation in human hematopoietic
stem/progenitor cells. Blood 125, 2597–2604 (2015).
114. Yusa, K. et al. Targeted gene correction of α1-antitrypsin deficiency in induced
pluripotent stem cells. Nature 478, 391–394 (2011).
115. Soldner, F. et al. Generation of isogenic pluripotent stem cells differing exclusively at
two early onset parkinson point mutations. Cell 146, 318–331 (2011).
116. Tebas, P. et al. Gene editing of CCR5 in autologous CD4 T cells of persons infected with
HIV. N. Engl. J. Med. 370, 901–910 (2014).
117. Kay, S., Hahn, S., Marois, E., Hause, G. & Bonas, U. A bacterial effector acts as a plant
transcription factor and induces a cell size regulator. Science 318, 648–651 (2007).
118. Sugio, A., Yang, B., Zhu, T. & White, F. F. Two type III effector genes of Xanthomonas
oryzae pv. oryzae control the induction of the host genes OsTFIIAgamma1 and OsTFX1
during bacterial blight of rice. Proc. Natl. Acad. Sci. U. S. A. 104, 10720–5 (2007).
119. White, F. F. & Yang, B. Host and pathogen factors controlling the rice-xanthomonas
oryzae interaction. Plant Physiol. 150, 1677–1686 (2009).
120. Kay, S. & Bonas, U. How Xanthomonas type III effectors manipulate the host plant.
Curr. Opin. Microbiol. 12, 37–43 (2009).
121. Moscou, M. J. & Bogdanove, A. J. A simple cipher governs DNA recognition by TAL
effectors. Science 326, 1501 (2009).
122. Boch, J., Scholze, H., Schornack, S., Landgraf, A., Hahn, S., Kay, S., Lahaye, T.,
Nickstadt, A. & Bonas, U. Breaking the code of DNA binding specificity of TAL-type III
- 81 -
effectors. Science 326, 1509–1512 (2009).
123. Deng, D., Yan, C., Pan, X., Mahfouz, M., Wang, J., Zhu, J. K., Shi, Y. & Yan, N.
Structural basis for sequence-specific recognition of DNA by TAL effectors. Science 335,
720–723 (2012).
124. Christian, M., Cermak, T., Doyle, E. L., Schmidt, C., Zhang, F., Hummel, A.,
Bogdanove, A. J. & Voytas, D. F. Targeting DNA double-strand breaks with TAL
effector nucleases. Genetics 186, 756–761 (2010).
125. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. Nat.
Biotechnol. 29, 143–150 (2011).
126. Li, T., Huang, S., Jiang, W. Z., Wright, D., Spalding, M. H., Weeks, D. P. & Yang, B.
TAL nucleases (TALNs): Hybrid proteins composed of TAL effectors and FokI DNA-
cleavage domain. Nucleic Acids Res. 39, 359–372 (2011).
127. Holkers, M., Maggio, I., Liu, J., Janssen, J. M., Miselli, F., Mussolino, C., Recchia, A.,
Cathomen, T. & Gonçalves, M. A. F. V. Differential integrity of TALE nuclease genes
following adenoviral and lentiviral vector gene transfer into human cells. Nucleic Acids
Res. 41, (2013).
128. Reyon, D., Tsai, S. Q., Khgayter, C., Foden, J. A., Sander, J. D. & Joung, J. K. FLASH
assembly of TALENs for high-throughput genome editing. Nat. Biotechnol. 30, 460–465
(2012).
129. Zhang, Z., Zhang, S., Huang, X., Orwig, K. E. & Sheng, Y. Rapid assembly of
customized TALENs into multiple delivery systems. PLoS One 8, e80281 (2013).
130. Cermak, T., Starker, C. G. & Voytas, D. F. Efficient design and assembly of custom
talens using the golden gate platform. Chromosomal Mutagenesis: Second Edition 133–
159 (2014). doi:10.1007/978-1-4939-1862-1_7
131. Kim, Y. et al. A library of TAL effector nucleases spanning the human genome. Nat.
Biotechnol. 31, 251–258 (2013).
- 82 -
132. Wood, A. J., Lo, T. W., Zeitler, B., Pickle, C. S., Ralston, E. J., Lee, A. H., Amora, R.,
Miller, J. C., Leung, E., Meng, X., Zhang, L., Rebar, E. J., Gregory, P. D., Urnov, F. D.
& Meyer, B. J. Targeted genome editing across species using ZFNs and TALENs.
Science 333, 307 (2011).
133. Ma, S., Zhang, S., Wang, F., Liu, Y., Liu, Y., Xu, H., Liu, C., Lin, Y., Zhao, P. & Xia, Q.
Highly efficient and specific genome editing in silkworm using custom TALENs. PLoS
One 7, e45035 (2012).
134. Yu, Z. et al. Various applications of TALEN- and CRISPR/Cas9-mediated homologous
recombination to modify the Drosophila genome. Biol. Open 3, 271–280 (2014).
135. Lei, Y., Guo, X., Liu, Y., Cao, Y., Deng, Y., Chen, X., Cheng, C. H. K., Dawid, I. B.,
Chen, Y. & Zhao, H. Efficient targeted gene disruption in Xenopus embryos using
engineered transcription activator-like effector nucleases (TALENs). Proc. Natl. Acad.
Sci. 109, 17484–17489 (2012).
136. Watanabe, T., Ochiai, H., Sakuma, T., Horch, H. W., Hamaguchi, N., Nakamura, T.,
Bando, T., Ohuchi, H., Yamamoto, T., Noji, S. & Mito, T. Non-transgenic genome
modifications in a hemimetabolous insect using zinc-finger and TAL effector nucleases.
Nat. Commun. 3, 1017 (2012).
137. Sander, J. D., Cade, L., Khayter, C., Reyon, D., Peterson, R. T., Joung, J. K. & Yeh, J. R.
J. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. Nat.
Biotechnol. 29, 697–698 (2011).
138. Tesson, L., Usal, C., Meq́noret, S., Leung, E., Niles, B. J., Remy, S., Santiago, Y.,
Vincent, A. I., Meng, X., Zhang, L., Gregory, P. D., Anegon, I. & Cost, G. J. Knockout
rats generated by embryo microinjection of TALENs. Nat. Biotechnol. 29, 695–696
(2011).
139. Carlson, D. F., Tan, W., Lillico, S. G., Stverakova, D., Proudfoot, C., Christian, M.,
Voytas, D. F., Long, C. R., Whitelaw, C. B. A. & Fahrenkrug, S. C. Efficient TALEN-
mediated gene knockout in livestock. Proc. Natl. Acad. Sci. 109, 17382–17387 (2012).
- 83 -
140. Li, T., Liu, B., Spalding, M. H., Weeks, D. P. & Yang, B. High-efficiency TALEN-based
gene editing produces disease-resistant rice. Nat. Biotechnol. 30, 390–392 (2012).
141. Hockemeyer, D. et al. Genetic engineering of human pluripotent cells using TALE
nucleases. Nat. Biotechnol. 29, 731–734 (2011).
142. Ye, L., Wang, J., Beyer, A. I., Teque, F., Cradick, T. J., Qi, Z., Chang, J. C., Bao, G.,
Muench, M. O., Yu, J., Levy, J. A. & Kan, Y. W. Seamless modification of wild-type
induced pluripotent stem cells to the natural CCR5Δ32 mutation confers resistance to
HIV infection. Proc. Natl. Acad. Sci. 111, 9591–9596 (2014).
143. Bloom, K., Ely, A., Mussolino, C., Cathomen, T. & Arbuthnot, P. Inactivation of
Hepatitis B virus replication in cultured cells and in vivo with engineered transcription
activator-like effector nucleases. Mol. Ther. 21, 1889–1897 (2013).
144. Ishino, Y., Shinagawa, H., Makino, K., Amemura, M. & Nakata, A. Nucleotide sequence
of the iap gene, responsible for alkaline phosphatase isozyme conversion in Escherichia
coli, and identification of the gene product. J. Bacteriol. 169, 5429–33 (1987).
145. Mojica, F. J. M., Díez-Villaseñor, C., Soria, E. & Juez, G. Biological significance of a
family of regularly spaced repeats in the genomes of Archaea, Bacteria and mitochondria.
Mol. Microbiol. 36, 244–246 (2000).
146. Jansen, R., Embden, J. D. A. van, Gaastra, W. & Schouls, L. M. Identification of genes
that are associated with DNA repeats in prokaryotes. Mol. Microbiol. 43, 1565–1575
(2002).
147. Mojica, F. J. M., Díez-Villaseñor, C., García-Martínez, J. & Soria, E. Intervening
sequences of regularly spaced prokaryotic repeats derive from foreign genetic elements.
J. Mol. Evol. 60, 174–182 (2005).
148. Pourcel, C., Salvignol, G. & Vergnaud, G. CRISPR elements in Yersinia pestis acquire
new repeats by preferential uptake of bacteriophage DNA, and provide additional tools
for evolutionary studies. Microbiology 151, 653–663 (2005).
- 84 -
149. Bolotin, A., Quinquis, B., Sorokin, A. & Dusko Ehrlich, S. Clustered regularly
interspaced short palindrome repeats (CRISPRs) have spacers of extrachromosomal
origin. Microbiology 151, 2551–2561 (2005).
150. Barrangou, R., Fremaux, C., Deveau, H., Richards, M., Boyaval, P., Moineau, S.,
Romero, D. A. & Horvath, P. CRISPR provides acquired resistance against viruses in
prokaryotes. Science 315, 1709–1712 (2007).
151. Marraffini, L. A. & Sontheimer, E. J. CRISPR interference limits horizontal gene transfer
in staphylococci by targeting DNA. Science 322, 1843–1845 (2008).
152. Makarova, K. S. et al. An updated evolutionary classification of CRISPR-Cas systems.
Nat. Rev. Microbiol. 13, 722–736 (2015).
153. Nuñez, J. K., Kranzusch, P. J., Noeske, J., Wright, A. V., Davies, C. W. & Doudna, J. A.
Cas1-Cas2 complex formation mediates spacer acquisition during CRISPR-Cas adaptive
immunity. Nat. Struct. Mol. Biol. 21, 528–534 (2014).
154. Deveau, H., Barrangou, R., Garneau, J. E., Labonté, J., Fremaux, C., Boyaval, P.,
Romero, D. A., Horvath, P. & Moineau, S. Phage response to CRISPR-encoded
resistance in Streptococcus thermophilus. J. Bacteriol. 190, 1390–1400 (2008).
155. Shah, S. A., Erdmann, S., Mojica, F. J. M. & Garrett, R. A. Protospacer recognition
motifs: Mixed identities and functional diversity. RNA Biology 10, 891–899 (2013).
156. Staals, R. H. J. et al. Structure and activity of the RNA-targeting type III-B CRISPR-Cas
complex of Thermus thermophilus. Mol. Cell 52, 135–145 (2013).
157. Staals, R. H. J. et al. RNA Targeting by the type III-A CRISPR-Cas csm complex of
Thermus thermophilus. Mol. Cell 56, 518–530 (2014).
158. Tamulaitis, G., Kazlauskiene, M., Manakova, E., Venclovas, Č., Nwokeoji, A. O.,
Dickman, M. J., Horvath, P. & Siksnys, V. Programmable RNA shredding by the type
III-A CRISPR-Cas system of Streptococcus thermophilus. Mol. Cell 56, 506–517 (2014).
- 85 -
159. Jinek, M., Jiang, F., Taylor, D. W., Sternberg, S. H., Kaya, E., Ma, E., Anders, C., Hauer,
M., Zhou, K., Lin, S., Kaplan, M., Iavarone, A. T., Charpentier, E., Nogales, E. &
Doudna, J. A. Structures of Cas9 endonucleases reveal RNA-mediated conformational
activation. Science 343, (2014).
160. Wang, R., Preamplume, G., Terns, M. P., Terns, R. M. & Li, H. Interaction of the Cas6
riboendonuclease with CRISPR RNAs: Recognition and cleavage. Structure 19, 257–264
(2011).
161. Deltcheva, E., Chylinski, K., Sharma, C. M., Gonzales, K., Chao, Y., Pirzada, Z. A.,
Eckert, M. R., Vogel, J. & Charpentier, E. CRISPR RNA maturation by trans-encoded
small RNA and host factor RNase III. Nature 471, 602–607 (2011).
162. Huo, Y., Nam, K. H., Ding, F., Lee, H., Wu, L., Xiao, Y., Farchione, M. D., Zhou, S.,
Rajashankar, K., Kurinov, I., Zhang, R. & Ke, A. Structures of CRISPR Cas3 offer
mechanistic insights into Cascade-activated DNA unwinding and degradation. Nat.
Struct. Mol. Biol. 21, 771–777 (2014).
163. Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A. & Charpentier, E. A
programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.
Science 337, 816–821 (2012).
164. Gasiunas, G., Barrangou, R., Horvath, P. & Siksnys, V. Cas9-crRNA ribonucleoprotein
complex mediates specific DNA cleavage for adaptive immunity in bacteria. Proc. Natl.
Acad. Sci. 109, 2579–2586 (2012).
165. Sapranauskas, R., Gasiunas, G., Fremaux, C., Barrangou, R., Horvath, P. & Siksnys, V.
The Streptococcus thermophilus CRISPR/Cas system provides immunity in Escherichia
coli. Nucleic Acids Res. 39, 9275–9282 (2011).
166. Magadán, A. H., Dupuis, M. È., Villion, M. & Moineau, S. Cleavage of phage DNA by
the Streptococcus thermophilus CRISPR3-Cas system. PLoS One 7, e40913 (2012).
167. Jiang, W., Bikard, D., Cox, D., Zhang, F. & Marraffini, L. A. RNA-guided editing of
bacterial genomes using CRISPR-Cas systems. Nat. Biotechnol. 31, 233–239 (2013).
- 86 -
168. Dicarlo, J. E., Norville, J. E., Mali, P., Rios, X., Aach, J. & Church, G. M. Genome
engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res.
41, 4336–4343 (2013).
169. Cong, L. et al. Multiplex Genome Engineering Using CRISPR/Cas Systems. Science
339, 819–823 (2013).
170. Mali, P., Yang, L., Esvelt, K. M., Aach, J., Guell, M., DiCarlo, J. E., Norville, J. E. &
Church, G. M. RNA-guided human genome engineering via Cas9. Science 339, 823–826
(2013).
171. Ruan, J., Li, H., Xu, K., Wu, T., Wei, J., Zhou, R., Liu, Z., Mu, Y., Yang, S., Ouyang, H.,
Chen-Tsai, R. Y. & Li, K. Highly efficient CRISPR/Cas9-mediated transgene knockin at
the H11 locus in pigs. Sci. Rep. 5, 14253 (2015).
172. Wang, K., Ouyang, H., Xie, Z., Yao, C., Guo, N., Li, M., Jiao, H. & Pang, D. Efficient
Generation of Myostatin Mutations in Pigs Using the CRISPR/Cas9 System. Sci. Rep. 5,
16623 (2015).
173. Jeong, Y.-H. et al. Knock-in fibroblasts and transgenic blastocysts for expression of
human FGF2 in the bovine β-casein gene locus using CRISPR/Cas9 nuclease-mediated
homologous recombination. Zygote 24, 442–456 (2016).
174. Crispo, M., Mulet, A. P., Tesson, L., Barrera, N., Cuadro, F., Dos Santos-Neto, P. C.,
Nguyen, T. H., Crénéguy, A., Brusselle, L., Anegón, I. & Menchaca, A. Efficient
generation of myostatin knock-out sheep using CRISPR/Cas9 technology and
microinjection into zygotes. PLoS One 10, e0136690 (2015).
175. Ni, W., Qiao, J., Hu, S., Zhao, X., Regouski, M., Yang, M., Polejaeva, I. A. & Chen, C.
Efficient gene knockout in goats using CRISPR/Cas9 system. PLoS One 9, e106718
(2014).
176. Wang, X. et al. Generation of gene-modified goats targeting MSTN and FGF5 via zygote
injection of CRISPR/Cas9 system. Sci. Rep. 5, 13878 (2015).
- 87 -
177. Nishimasu, H., Ran, F. A., Hsu, P. D., Konermann, S., Shehata, S. I., Dohmae, N.,
Ishitani, R., Zhang, F. & Nureki, O. Crystal structure of Cas9 in complex with guide
RNA and target DNA. Cell 156, 935–949 (2014).
178. Ariyoshi, M., Vassylyev, D. G., Iwasaki, H., Nakamura, H., Shinagawa, H. & Morikawa,
K. Atomic structure of the RuvC resolvase: A holliday junction-specific endonuclease
from E. coli. Cell 78, 1063–1072 (1994).
179. Górecka, K. M., Komorowska, W. & Nowotny, M. Crystal structure of RuvC resolvase in
complex with Holliday junction substrate. Nucleic Acids Res. 41, 9945–9955 (2013).
180. Biertümpfel, C., Yang, W. & Suck, D. Crystal structure of T4 endonuclease VII resolving
a Holliday junction. Nature 449, 616–620 (2007).
181. Li, C. L., Hor, L. I., Chang, Z. F., Tsai, L. C., Yang, W. Z. & Yuan, H. S. DNA binding
and cleavage by the periplasmic nuclease Vvn: A novel structure with a known active
site. EMBO J. 22, 4014–4025 (2003).
182. Jiang, F., Taylor, D. W., Chen, J. S., Kornfeld, J. E., Zhou, K., Thompson, A. J., Nogales,
E. & Doudna, J. A. Structures of a CRISPR-Cas9 R-loop complex primed for DNA
cleavage. Science 351, 867–871 (2016).
183. Sternberg, S. H., Redding, S., Jinek, M., Greene, E. C. & Doudna, J. A. DNA
interrogation by the CRISPR RNA-guided endonuclease Cas9. Nature 507, 62–67
(2014).
184. Semenova, E., Jore, M. M., Datsenko, K. A., Semenova, A., Westra, E. R., Wanner, B.,
van der Oost, J., Brouns, S. J. J. & Severinov, K. Interference by clustered regularly
interspaced short palindromic repeat (CRISPR) RNA is governed by a seed sequence.
Proc. Natl. Acad. Sci. 108, 10098–10103 (2011).
185. Hsu, P. D., Scott, D. A., Weinstein, J. A., Ran, F. A., Konermann, S., Agarwala, V., Li,
Y., Fine, E. J., Wu, X., Shalem, O., Cradick, T. J., Marraffini, L. A., Bao, G. & Zhang, F.
DNA targeting specificity of RNA-guided Cas9 nucleases. Nat. Biotechnol. 31, 827–832
(2013).
- 88 -
186. Bikard, D., Jiang, W., Samai, P., Hochschild, A., Zhang, F. & Marraffini, L. A.
Programmable repression and activation of bacterial gene expression using an engineered
CRISPR-Cas system. Nucleic Acids Res. 41, 7429–7437 (2013).
187. Qi, L. S., Larson, M. H., Gilbert, L. A., Doudna, J. A., Weissman, J. S., Arkin, A. P. &
Lim, W. A. Repurposing CRISPR as an RNA-guided platform for sequence-specific
control of gene expression. Cell 152, 1173–1183 (2013).
188. Maeder, M. L., Linder, S. J., Cascio, V. M., Fu, Y., Ho, Q. H. & Joung, J. K. CRISPR
RNA-guided activation of endogenous human genes. Nat. Methods 10, 977–979 (2013).
189. Perez-Pinera, P., Kocak, D. D., Vockley, C. M., Adler, A. F., Kabadi, A. M., Polstein, L.
R., Thakore, P. I., Glass, K. A., Ousterout, D. G., Leong, K. W., Guilak, F., Crawford, G.
E., Reddy, T. E. & Gersbach, C. A. RNA-guided gene activation by CRISPR-Cas9-based
transcription factors. Nat. Methods 10, 973–976 (2013).
190. Zhou, H. et al. In vivo simultaneous transcriptional activation of multiple genes in the
brain using CRISPR–dCas9-activator transgenic mice. Nat. Neurosci. 21, 440–46 (2018).
191. Hilton, I. B., D’Ippolito, A. M., Vockley, C. M., Thakore, P. I., Crawford, G. E., Reddy,
T. E. & Gersbach, C. A. Epigenome editing by a CRISPR-Cas9-based acetyltransferase
activates genes from promoters and enhancers. Nat. Biotechnol. 33, 510–517 (2015).
192. Gilbert, L. A, Larson, M. H., Morsut, L., Liu, Z., Gloria, A., Torres, S. E., Stern-ginossar,
N., Brandman, O., Whitehead, H., Doudna, J. a, Lim, W. A & Jonathan, S. CRISPR-
mediated modular RNA-guided regualtion of transcription in eukaryotes. Cell 154, 442–
451 (2013).
193. Guilinger, J. P., Thompson, D. B. & Liu, D. R. Fusion of catalytically inactive Cas9 to
FokI nuclease improves the specificity of genome modification. Nat. Biotechnol. 32,
577–582 (2014).
194. Tsai, S. Q., Wyvekens, N., Khayter, C., Foden, J. A., Thapar, V., Reyon, D., Goodwin,
M. J., Aryee, M. J. & Joung, J. K. Dimeric CRISPR RNA-guided FokI nucleases for
highly specific genome editing. Nat. Biotechnol. 32, 569–576 (2014).
- 89 -
195. Mali, P., Aach, J., Stranges, P. B., Esvelt, K. M., Moosburner, M., Kosuri, S., Yang, L. &
Church, G. M. Cas9 transcriptional activators for target specificity screening and paired
nickases for cooperative genome engineering. Nat. Biotechnol. 31, 833–838 (2013).
196. Ran, F. A., Hsu, P. D., Lin, C. Y., Gootenberg, J. S., Konermann, S., Trevino, A. E.,
Scott, D. A., Inoue, A., Matoba, S., Zhang, Y. & Zhang, F. Double nicking by RNA-
guided CRISPR-Cas9 for enhanced genome editing specificity. Cell 154, 1380–1389
(2013).
197. Slaymaker, I. M., Gao, L., Zetsche, B., Scott, D. A., Yan, W. X. & Zhang, F. Rationally
engineered Cas9 nucleases with improved specificity. Science 351, 84–88 (2016).
198. Kleinstiver, B. P., Pattanayak, V., Prew, M. S., Tsai, S. Q., Nguyen, N. T., Zheng, Z. &
Joung, J. K. High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-
target effects. Nature 529, 490–495 (2016).
199. Davis, K. M., Pattanayak, V., Thompson, D. B., Zuris, J. A. & Liu, D. R. Small
molecule-triggered Cas9 protein with improved genome-editing specificity. Nat. Chem.
Biol. 11, 316–318 (2015).
200. Zetsche, B., Volz, S. E. & Zhang, F. A split-Cas9 architecture for inducible genome
editing and transcription modulation. Nat. Biotechnol. 33, 139–142 (2015).
201. Nihongaki, Y., Kawano, F., Nakajima, T. & Sato, M. Photoactivatable CRISPR-Cas9 for
optogenetic genome editing. Nat. Biotechnol. 33, 755–760 (2015).
202. Komor, A. C., Kim, Y. B., Packer, M. S., Zuris, J. A. & Liu, D. R. Programmable editing
of a target base in genomic DNA without double-stranded DNA cleavage. Nature 533,
420–424 (2016).
203. Komor, A. C., Zhao, K. T., Packer, M. S., Gaudelli, N. M., Waterbury, A. L., Koblan, L.
W., Kim, Y. B., Badran, A. H. & Liu, D. R. Improved base excision repair inhibition and
bacteriophage Mu Gam protein yields C:G-to-T:A base editors with higher efficiency and
product purity. Sci. Adv. 3, eaao4774 (2017).
- 90 -
204. Kim, K., Ryu, S. M., Kim, S. T., Baek, G., Kim, D., Lim, K., Chung, E., Kim, S. & Kim,
J. S. Highly efficient RNA-guided base editing in mouse embryos. Nat. Biotechnol. 35,
435–437 (2017).
205. Zong, Y., Wang, Y., Li, C., Zhang, R., Chen, K., Ran, Y., Qiu, J. L., Wang, D. & Gao, C.
Precise base editing in rice, wheat and maize with a Cas9-cytidine deaminase fusion. Nat.
Biotechnol. 35, 438–440 (2017).
206. Shimatani, Z., Kashojiya, S., Takayama, M., Terada, R., Arazoe, T., Ishii, H., Teramura,
H., Yamamoto, T., Komatsu, H., Miura, K., Ezura, H., Nishida, K., Ariizumi, T. &
Kondo, A. Targeted base editing in rice and tomato using a CRISPR-Cas9 cytidine
deaminase fusion. Nat. Biotechnol. 35, 441–443 (2017).
207. Fu, Y., Sander, J. D., Reyon, D., Cascio, V. M. & Joung, J. K. Improving CRISPR-Cas
nuclease specificity using truncated guide RNAs. Nat. Biotechnol. 32, 279–284 (2014).
208. Tsai, S. Q., Zheng, Z., Nguyen, N. T., Liebers, M., Topkar, V. V., Thapar, V., Wyvekens,
N., Khayter, C., Iafrate, A. J., Le, L. P., Aryee, M. J. & Joung, J. K. GUIDE-seq enables
genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases. Nat. Biotechnol.
33, 187–198 (2015).
209. Hendel, A., Bak, R. O., Clark, J. T., Kennedy, A. B., Ryan, D. E., Roy, S., Steinfeld, I.,
Lunstad, B. D., Kaiser, R. J., Wilkens, A. B., Bacchetta, R., Tsalenko, A., Dellinger, D.,
Bruhn, L. & Porteus, M. H. Chemically modified guide RNAs enhance CRISPR-Cas
genome editing in human primary cells. Nat. Biotechnol. 33, 985–989 (2015).
210. Rahdar, M., McMahon, M. A., Prakash, T. P., Swayze, E. E., Bennett, C. F. & Cleveland,
D. W. Synthetic CRISPR RNA-Cas9–guided genome editing in human cells. Proc. Natl.
Acad. Sci. 112, e7110–7 (2015)
211. Shalem, O., Sanjana, N. E., Hartenian, E., Shi, X., Scott, D. A., Mikkelsen, T. S., Heckl,
D., Ebert, B. L., Root, D. E., Doench, J. G. & Zhang, F. Genome-scale CRISPR-Cas9
knockout screening in human cells. Science 343, 84–87 (2014).
212. Wang, T., Wei, J. J., Sabatini, D. M. & Lander, E. S. Genetic screens in human cells
- 91 -
using the CRISPR-Cas9 system. Science 343, 80–4 (2014).
213. Koike-Yusa, H., Li, Y., Tan, E. P., Velasco-Herrera, M. D. C. & Yusa, K. Genome-wide
recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA
library. Nat. Biotechnol. 32, 267–273 (2014).
214. Zhou, Y., Zhu, S., Cai, C., Yuan, P., Li, C., Huang, Y. & Wei, W. High-throughput
screening of a CRISPR/Cas9 library for functional genomics in human cells. Nature 509,
487–491 (2014).
215. Liu, S. J. et al. CRISPRi-based genome-scale identification of functional long noncoding
RNA loci in human cells. Science 355, (2017).
216. Montalbano, A., Canver, M. C. & Sanjana, N. E. High-throughput approaches to pinpoint
function within the noncoding genome. Mol. Cell 68, 44–59 (2017).
217. Ma, Y., Zhang, J., Yin, W., Zhang, Z., Song, Y. & Chang, X. Targeted AID-mediated
mutagenesis (TAM) enables efficient genomic diversification in mammalian cells. Nat.
Methods 13, 1029–1035 (2016).
218. Hess, G. T., Frésard, L., Han, K., Lee, C. H., Li, A., Cimprich, K. A., Montgomery, S. B.
& Bassik, M. C. Directed evolution using dCas9-targeted somatic hypermutation in
mammalian cells. Nat. Methods 13, 1036–1042 (2016).
219. Jackson, A. L., Bartz, S. R., Schelter, J., Kobayashi, S. V., Burchard, J., Mao, M., Li, B.,
Cavet, G. & Linsley, P. S. Expression profiling reveals off-target gene regulation by
RNAi. Nat. Biotechnol. 21, 635–637 (2003).
220. Birmingham, A., Anderson, E. M., Reynolds, A., Ilsley-Tyree, D., Leake, D., Fedorov,
Y., Baskerville, S., Maksimova, E., Robinson, K., Karpilow, J., Marshall, W. S. &
Khvorova, A. 3’ UTR seed matches, but not overall identity, are associated with RNAi
off-targets. Nat. Methods 3, 199–204 (2006).
221. Jackson, A. L. & Linsley, P. S. Recognizing and avoiding siRNA off-target effects for
target identification and therapeutic application. Nat. Rev. Drug Discov. 9, 57–67 (2010).
- 92 -
222. Batista, P. J. et al. M6A RNA modification controls cell fate transition in mammalian
embryonic stem cells. Cell Stem Cell 15, 707–719 (2014).
223. Wang, Q., Zou, Y., Nowotschin, S., Kim, S. Y., Li, Q. V., Soh, C. L., Su, J., Zhang, C.,
Shu, W., Xi, Q., Huangfu, D., Hadjantonakis, A. K. & Massagué, J. The p53 family
coordinates wnt and nodal inputs in mesendodermal differentiation of embryonic stem
cells. Cell Stem Cell 20, 70–86 (2017).
224. Hunt, C. P. J., Pouton, C. W. & Haynes, J. M. Characterising the developmental profile
of human embryonic stem cell-derived medium spiny neuron progenitors and assessing
mature neuron function using a CRISPR-generated human DARPP-32WT/eGFP-
AMPreporter line. Neurochem. Int. 106, 3–13 (2017).
225. Adkar, S. S., Willard, V. P., Brunger, J. M., Shiao, K. T., Gersbach, C. A. & Guilak, F.
318. Targeted genome editing of human induced pluripotent stem cells using
CRISPR/Cas9 to generate a knock-in type II collagen reporter for the purification of
chondrogenic cells. Mol. Ther. 24, S128 (2016).
226. Kearns, N. A, Genga, R. M. J., Enuameh, M. S., Garber, M., Wolfe, S. A & Maehr, R.
Cas9 effector-mediated regulation of transcription and differentiation in human
pluripotent stem cells. Development 141, 219–23 (2014).
227. Guo, J., Ma, D., Huang, R., Ming, J., Ye, M., Kee, K., Xie, Z. & Na, J. An inducible
CRISPR-ON system for controllable gene activation in human pluripotent stem cells.
Protein Cell 8, 379–393 (2017).
228. Luo, Y., Xu, X., An, X., Sun, X., Wang, S. & Zhu, D. Targeted inhibition of the MIR-
199a/214 cluster by CRISPR interference augments the tumor tropism of human induced
pluripotent stem cell-derived neural stem cells under hypoxic condition. Stem Cells Int.
2016, 3598542 (2016).
229. Mandegar, M. A. et al. CRISPR Interference Efficiently Induces Specific and Reversible
Gene Silencing in Human iPSCs. Cell Stem Cell 18, 541–553 (2016).
230. Zhang, W. et al. A Werner syndrome stem cell model unveils heterochromatin alterations
- 93 -
as a driver of human aging. Science 348, 1160–1163 (2015).
231. Avior, Y., Lezmi, E., Yanuka, D. & Benvenisty, N. Modeling developmental and
tumorigenic aspects of trilateral retinoblastoma via human embryonic stem cells. Stem
Cell Reports 8, 1354–1365 (2017).
232. Chang, C. J., Kotini, A., Teruya-Feldstein, J., Abdel-Wahab, O., Bradley, R. &
Papapetrou, E. P. Isogenic iPSC models of SRSF2-mutant myelodysplastic syndrome
capture disease phenotypes, splicing defects and drug responses. Blood 128, 962 (2016).
233. Guo, D., Liu, H., Gao, G., Liu, Y., Zhuang, Y., Yang, F., Wang, K., Zhou, T., Qin, D.,
Hong, L., Li, J., Xu, K. & Li, Y.X. Creating a patient carried Men1 gene point mutation
on wild type iPSCs locus mediated by CRISPR/Cas9 and ssODN. Stem Cell Res. 18, 67–
69 (2017).
234. Freedman, B. S. et al. Modelling kidney disease with CRISPR-mutant kidney organoids
derived from human pluripotent epiblast spheroids. Nat. Commun. 6, 8715 (2015).
235. Woo, D. H., Chen, Q., Yang, T. L. B., Glineburg, M. R., Hoge, C., Leu, N. A., Johnson,
F. B. & Lengner, C. J. Enhancing a wnt-telomere feedback loop restores intestinal stem
cell function in a human organotypic model of dyskeratosis congenita. Cell Stem Cell 19,
397–405 (2016).
236. Matano, M., Date, S., Shimokawa, M., Takano, A., Fujii, M., Ohta, Y., Watanabe, T.,
Kanai, T. & Sato, T. Modeling colorectal cancer using CRISPR-Cas9-mediated
engineering of human intestinal organoids. Nat. Med. 21, 256–262 (2015).
237. Drost, J. et al. Sequential cancer mutations in cultured human intestinal stem cells.
Nature 521, 43–47 (2015).
238. Fessler, E. et al. TGFβ signaling directs serrated adenomas to the mesenchymal colorectal
cancer subtype. EMBO Mol. Med. 8, 745–760 (2016).
239. Verissimo, C. S., Overmeer, R. M., Ponsioen, B., Drost, J., Mertens, S., Verlaan-Klink, I.,
Van Gerwen, B., Van Der Ven, M., Van De Wetering, M., Egan, D. A., Bernards, R.,
- 94 -
Clevers, H., Bos, J. L. & Snippert, H. J. Targeting mutant RAS in patient-derived
colorectal cancer organoids by combinatorial drug screening. Elife 5, e18489 (2016).
240. Kemaladewi, D. U. et al. Correction of a splicing defect in a mouse model of congenital
muscular dystrophy type 1A using a homology-directed-repair-independent mechanism.
Nat. Med. 23, 984–989 (2017).
241. Cohen, J. C., Boerwinkle, E., Mosley, T. H. & Hobbs, H. H. Sequence variations in
PCSK9, low LDL, and protection against coronary heart disease. N. Engl. J. Med. 354,
1264–1272 (2006).
242. Ding, Q., Strong, A., Patel, K. M., Ng, S. L., Gosis, B. S., Regan, S. N., Cowan, C. A.,
Rader, D. J. & Musunuru, K. Permanent alteration of PCSK9 with in vivo CRISPR-Cas9
genome editing. Circ. Res. 115, 488–492 (2014).
243. Ran, F. A., Cong, L., Yan, W. X., Scott, D. A., Gootenberg, J. S., Kriz, A. J., Zetsche, B.,
Shalem, O., Wu, X., Makarova, K. S., Koonin, E. V., Sharp, P. A. & Zhang, F. In vivo
genome editing using Staphylococcus aureus Cas9. Nature 520, 186–191 (2015).
244. Wang, X., Raghavan, A., Chen, T., Qiao, L., Zhang, Y., Ding, Q. & Musunuru, K.
CRISPR-Cas9 targeting of PCSK9 in human hepatocytes in vivo - Brief report.
Arterioscler. Thromb. Vasc. Biol. 36, 783–786 (2016).
245. Kalos, M., Levine, B. L., Porter, D. L., Katz, S., Grupp, S. A., Bagg, A. & June, C. H. T
cells with chimeric antigen receptors have potent antitumor effects and can establish
memory in patients with advanced leukemia. Sci. Transl. Med. 3, 95ra73 (2011).
246. Rupp, L. J., Schumann, K., Roybal, K. T., Gate, R. E., Ye, C. J., Lim, W. A. & Marson,
A. CRISPR/Cas9-mediated PD-1 disruption enhances anti-tumor efficacy of human
chimeric antigen receptor T cells. Sci. Rep. 7, 737 (2017).
247. Eyquem, J., Mansilla-Soto, J., Giavridis, T., Van Der Stegen, S. J. C., Hamieh, M.,
Cunanan, K. M., Odak, A., Gönen, M. & Sadelain, M. Targeting a CAR to the TRAC
locus with CRISPR/Cas9 enhances tumour rejection. Nature 543, 113–117 (2017).
- 95 -
248. Blum, R., Arumugam, A., Wu, J., Walcheck, B. & Kaufman, D. Engineering human
pluripotent stem cell-derived natural killer cells to prevent CD16a shedding for enhanced
anti-tumor killing. Blood 128, 1336 (2016).
249. Su, S. et al. CRISPR-Cas9 mediated efficient PD-1 disruption on human primary T cells
from cancer patients. Sci. Rep. 6, 20070 (2016).
250. Su, S., Zou, Z., Chen, F., Ding, N., Du, J., Shao, J., Li, L., Fu, Y., Hu, B., Yang, Y., Sha,
H., Meng, F., Wei, J., Huang, X. & Liu, B. CRISPR-Cas9-mediated disruption of PD-1
on human T cells for adoptive cellular therapies of EBV positive gastric cancer.
Oncoimmunology 6, e1249558 (2017).
251. Mandal, P. K. et al. Efficient ablation of genes in human hematopoietic stem and effector
cells using CRISPR/Cas9. Cell Stem Cell 15, 643–52 (2014).
252. Gundry, M. C., Brunetti, L., Lin, A., Mayle, A. E., Kitano, A., Wagner, D., Hsu, J. I.,
Hoegenauer, K. A., Rooney, C. M., Goodell, M. A. & Nakada, D. Highly efficient
genome editing of murine and human hematopoietic progenitor cells by CRISPR/Cas9.
Cell Rep. 17, 1453–1461 (2016).
253. De Ravin, S. S. et al. CRISPR-Cas9 gene repair of hematopoietic stem cells from patients
with X-linked chronic granulomatous disease. Sci. Transl. Med. 9, (2017).
254. Genovese, P. et al. Targeted genome editing in human repopulating haematopoietic stem
cells. Nature 510, 235–240 (2014).
255. Li, C., Guan, X., Du, T., Jin, W., Wu, B., Liu, Y., Wang, P., Hu, B., Griffin, G. E.,
Shattock, R. J. & Hu, Q. Inhibition of HIV-1 infection of primary CD4+ T-cells by gene
editing of CCR5 using adenovirus-delivered CRISPR/Cas9. J. Gen. Virol. 96, 2381–2393
(2015).
256. Hou, P., Chen, S., Wang, S., Yu, X., Chen, Y., Jiang, M., Zhuang, K., Ho, W., Hou, W.,
Huang, J. & Guo, D. Genome editing of CXCR4 by CRISPR/cas9 confers cells resistant
to HIV-1 infection. Sci. Rep. 5, 15577 (2015).
- 96 -
257. Kang, H. J., Minder, P., Park, M. A., Mesquitta, W. T., Torbett, B. E. & Slukvin, I. I.
CCR5 disruption in induced pluripotent stem cells using CRISPR/Cas9 provides selective
resistance of immune cells to CCR5-tropic HIV-1 virus. Mol. Ther. - Nucleic Acids 4,
e268 (2015).
258. Xu, L. et al. CRISPR/Cas9-Mediated CCR5 Ablation in Human Hematopoietic
Stem/Progenitor Cells Confers HIV-1 Resistance In Vivo. Mol. Ther. 25, 1782–1789
(2017).
259. Firth, A. L., Menon, T., Parker, G. S., Qualls, S. J., Lewis, B. M., Ke, E., Dargitz, C. T.,
Wright, R., Khanna, A., Gage, F. H. & Verma, I. M. Functional gene correction for cystic
fibrosis in lung epithelial cells generated from patient iPSCs. Cell Rep. 12, 1385–1390
(2015).
260. Schwank, G., Koo, B. K., Sasselli, V., Dekkers, J. F., Heo, I., Demircan, T., Sasaki, N.,
Boymans, S., Cuppen, E., Van Der Ent, C. K., Nieuwenhuis, E. E. S., Beekman, J. M. &
Clevers, H. Functional repair of CFTR by CRISPR/Cas9 in intestinal stem cell organoids
of cystic fibrosis patients. Cell Stem Cell 13, 653–658 (2013).
261. Mehta, A. & Haber, J. E. Sources of DNA double-strand breaks and models of
recombinational DNA repair. Cold Spring Harb. Perspect. Biol. 6, a016428 (2014).
262. Bétermier, M., Bertrand, P. & Lopez, B. S. Is Non-Homologous End-Joining Really an
Inherently Error-Prone Process? PLoS Genetics 10, a016428 (2014).
263. Rogakou, E. P., Pilch, D. R., Orr, A. H., Ivanova, V. S. & Bonner, W. M. DNA double-
stranded breaks induce histone H2AX phosphorylation on serine 139. J. Biol. Chem. 273,
5858–5868 (1998).
264. Rogakou, E. P., Boon, C., Redon, C. & Bonner, W. M. Megabase chromatin domains
involved in DNA double-strand breaks in vivo. J. Cell Biol. 146, 905–16 (1999).
265. Paull, T. T., Rogakou, E. P., Yamazaki, V., Kirchgessner, C. U., Gellert, M. & Bonner,
W. M. A critical role for histone H2AX in recruitment of repair factors to nuclear foci
after DNA damage. Curr. Biol. 10, 886–895 (2000).
- 97 -
266. McKinnon, P. J. ATM and ataxia telangiectasia. EMBO Rep. 5, 772–776 (2004).
267. Mimori, T. & Hardin, J. A. Mechanism of interaction between Ku protein and DNA. J.
Biol. Chem. 261, 10375–10379 (1986).
268. Blier, P. R., Griffith, A. J., Craft, J. & Hardin, A. Binding of Ku Protein to DNA. J. Biol.
Chem. 268, 7594–7601 (1993).
269. Makharashvili, N., Tubbs, A. T., Yang, S. H., Wang, H., Barton, O., Zhou, Y.,
Deshpande, R. A., Lee, J. H., Lobrich, M., Sleckman, B. P., Wu, X. & Paull, T. T.
Catalytic and Noncatalytic Roles of the CtIP Endonuclease in Double-Strand Break End
Resection. Mol. Cell 54, 1022–1033 (2014).
270. Masani, S., Han, L., Meek, K. & Yu, K. Redundant function of DNA ligase 1 and 3 in
alternative end-joining during immunoglobulin class switch recombination. Proc. Natl.
Acad. Sci. U. S. A. 113, 1–6 (2016).
271. Chang, H. H. Y., Pannunzio, N. R., Adachi, N. & Lieber, M. R. Non-homologous DNA
end joining and alternative pathways to double-strand break repair. Nat. Rev. Mol. Cell
Biol. 18, 495–506 (2017).
272. Yoo, S. & Dynan, W. S. Geometry of a complex formed by double strand break repair
proteins at a single DNA end: recruitment of DNA-PKcs induces inward translocation of
Ku protein. Nucleic Acids Res. 27, 4679–4686 (1999).
273. Hammarsten, O., DeFazio, L. G. & Chu, G. Activation of DNA-dependent protein kinase
by single-stranded DNA ends. J. Biol. Chem. 275, 1541–1550 (2000).
274. Ma, Y., Pannicke, U., Schwarz, K. & Lieber, M. R. Hairpin opening and overhang
processing by an Artemis/DNA-dependent protein kinase complex in nonhomologous
end joining and V(D)J recombination. Cell 108, 781–794 (2002).
275. Ramadan, K., Maga, G., Shevelev, I. V., Villani, G., Blanco, L. & Hübscher, U. Human
DNA polymerase λ possesses terminal deoxyribonucleotidyl transferase activity and can
elongate RNA primers: Implications for novel functions. J. Mol. Biol. 328, 63–72 (2003).
- 98 -
276. Ramadan, K., Shevelev, I. V, Maga, G. & Hübscher, U. De novo DNA synthesis by
human DNA polymerase lambda, DNA polymerase mu and terminal
deoxyribonucleotidyl transferase. J. Mol. Biol. 339, 395–404 (2004).
277. Gu, J., Lu, H., Tippin, B., Shimazaki, N., Goodman, M. F. & Lieber, M. R. XRCC4:DNA
ligase IV can ligate incompatible DNA ends and can ligate across gaps. EMBO J. 26,
1010–1023 (2007).
278. Lieber, M. R. The Mechanism of Double-Strand DNA Break Repair by the
Nonhomologous DNA End-Joining Pathway. Annu. Rev. Biochem. 79, 181–211 (2010).
279. Stewart, G. S., Wang, B., Bignell, C. R., Taylor, A. M. R. & Elledge, S. J. MDC1 is a
mediator of the mammalian DNA damage checkpoint. Nature 421, 961–966 (2003).
280. Kobayashi, J., Tauchi, H., Sakamoto, S., Nakamura, A., Morishima, K.I, Matsuura, S.,
Kobayashi, T., Tamai, K., Tanimoto, K. & Komatsu, K. NBS1 localizes to γ-H2AX foci
through interaction with the FHA/BRCT domain. Curr. Biol. 12, 1846–1851 (2002).
281. Sartori, A. A., Lukas, C., Coates, J., Mistrik, M., Fu, S., Bartek, J., Baer, R., Lukas, J. &
Jackson, S. P. Human CtIP promotes DNA end resection. Nature 450, 509–514 (2007).
282. Chen, L., Nievera, C. J., Lee, A. Y.-L. & Wu, X. Cell cycle-dependent complex
formation of BRCA1.CtIP.MRN is important for DNA double-strand break repair. J.
Biol. Chem. 283, 7713–7720 (2008).
283. Wang, H., Shi, L. Z., Wong, C. C. L., Han, X., Hwang, P. Y. H., Truong, L. N., Zhu, Q.,
Shao, Z., Chen, D. J., Berns, M. W., Yates, J. R., Chen, L. & Wu, X. The Interaction of
CtIP and Nbs1 Connects CDK and ATM to Regulate HR-Mediated Double-Strand Break
Repair. PLoS Genet. 9, e1003277 (2013).
284. Garcia, V., Phelps, S. E. L., Gray, S. & Neale, M. J. Bidirectional resection of DNA
double-strand breaks by Mre11 and Exo1. Nature 479, 241–244 (2011).
285. Shibata, A. et al. DNA Double-Strand Break Repair Pathway Choice Is Directed by
Distinct MRE11 Nuclease Activities. Mol. Cell 53, 7–18 (2014).
- 99 -
286. Nimonkar, A. V., Genschel, J., Kinoshita, E., Polaczek, P., Campbell, J. L., Wyman, C.,
Modrich, P. & Kowalczykowski, S. C. BLM-DNA2-RPA-MRN and EXO1-BLM-RPA-
MRN constitute two DNA end resection machineries for human DNA break repair.
Genes Dev. 25, 350–362 (2011).
287. Ashton, N. W., Bolderson, E., Cubeddu, L., O’Byrne, K. J. & Richard, D. J. Human
single-stranded DNA binding proteins are essential for maintaining genomic stability.
BMC Mol. Biol. 14, 9 (2013).
288. Roy, R., Chun, J. & Powell, S. N. BRCA1 and BRCA2: Different roles in a common
pathway of genome protection. Nat. Rev. Cancer 12, 68–78 (2012).
289. Park, J. Y., Zhang, F. & Andreassen, P. R. PALB2: The hub of a network of tumor
suppressors involved in DNA damage responses. Biochim. Biophys. Acta. 1846, 263–275
(2014).
290. Cejka, P., Plank, J. L., Bachrati, C. Z., Hickson, I. D. & Kowalczykowski, S. C. Rmi1
stimulates decatenation of double Holliday junctions during dissolution by Sgs1-Top3.
Nat. Struct. Mol. Biol. 17, 1377–1382 (2010).
291. Wu, L. & Hickson, I. O. The Bloom’s syndrome helicase suppresses crossing over during
homologous recombination. Nature 426, 870–874 (2003).
292. Ira, G., Malkova, A., Liberi, G., Foiani, M. & Haber, J. E. Srs2 and Sgs1-Top3 suppress
crossovers during double-strand break repair in yeast. Cell 115, 401–411 (2003).
293. Wyatt, H. D. M., Sarbajna, S., Matos, J. & West, S. C. Coordinated actions of SLX1-
SLX4 and MUS81-EME1 for holliday junction resolution in human cells. Mol. Cell 52,
234–247 (2013).
294. Verma, P. & Greenberg, R. A. Noncanonical views of homology-directed DNA repair.
Genes Dev. 30, 1138–1154 (2016).
295. Donnianni, R. A. & Symington, L. S. Break-induced replication occurs by conservative
DNA synthesis. Proc. Natl. Acad. Sci. 110, 13475–13480 (2013).
- 100 -
296. Saini, N., Ramakrishnan, S., Elango, R., Ayyar, S., Zhang, Y., Deem, A., Ira, G., Haber,
J. E., Lobachev, K. S. & Malkova, A. Migrating bubble during break-induced replication
drives conservative DNA synthesis. Nature 502, 389–392 (2013).
297. Truong, L. N., Li, Y., Shi, L. Z., Hwang, P. Y.-H., He, J., Wang, H., Razavian, N., Berns,
M. W. & Wu, X. Microhomology-mediated end joining and homologous recombination
share the initial end resection step to repair DNA double-strand breaks in mammalian
cells. Proc. Natl. Acad. Sci. 110, 7720–7725 (2013).
298. Hustedt, N. & Durocher, D. The control of DNA repair by the cell cycle. Nat Cell Biol
19, 1–9 (2017).
299. Symington, L. S. & Gautier, J. Double-strand break end resection and repair pathway
choice. Annu. Rev. Genet. 45, 247–271 (2011).
300. Callen, E. et al. 53BP1 mediates productive and mutagenic DNA repair through distinct
phosphoprotein interactions. Cell 153, 1266–1280 (2013).
301. Chapman, J. R., Barral, P., Vannier, J. B., Borel, V., Steger, M., Tomas-Loba, A., Sartori,
A. A., Adams, I. R., Batista, F. D. & Boulton, S. J. RIF1 Is essential for 53BP1-
dependent nonhomologous end joining and suppression of DNA double-strand break
resection. Mol. Cell 49, 858–871 (2013).
302. Di Virgilio, M., Callen, E., Yamane, A., Zhang, W., Jankovic, M., Gitlin, A. D.,
Feldhahn, N., Resch, W., Oliveira, T. Y., Chait, B. T., Nussenzweig, A., Casellas, R.,
Robbiani, D. F. & Nussenzweig, M. C. Rif1 prevents resection of DNA breaks and
promotes immunoglobulin class switching. Science 339, 711–715 (2013).
303. Zimmermann, M., Lottersberger, F., Buonomo, S. B., Sfeir, A. & De Lange, T. 53BP1
regulates DSB repair using Rif1 to control 5′ end resection. Science 339, 700–704
(2013).
304. Feng, L., Fong, K. W., Wang, J., Wang, W. & Chen, J. RIF1 counteracts BRCA1-
mediated end resection during DNA repair. J. Biol. Chem. 288, 11135–11143 (2013).
- 101 -
305. Escribano-Díaz, C., Orthwein, A., Fradet-Turcotte, A., Xing, M., Young, J. T. F., Tkáč,
J., Cook, M. A., Rosebrock, A. P., Munro, M., Canny, M. D., Xu, D. & Durocher, D. A
cell cycle-dependent regulatory circuit composed of 53BP1-RIF1 and BRCA1-CtIP
controls DNA repair pathway choice. Mol. Cell 49, 872–883 (2013).
306. Zhang, H. et al. A cell cycle-dependent BRCA1-UHRF1 cascade regulates DNA double-
strand break repair pathway choice. Nat. Commun. 7, 10201 (2016).
307. Batenburg, N. L., Walker, J. R., Noordermeer, S. M., Moatti, N., Durocher, D. & Zhu, X.
D. ATM and CDK2 control chromatin remodeler CSB to inhibit RIF1 in DSB repair
pathway choice. Nat. Commun. 8, 1921 (2017).
308. Huertas, P. DNA resection in eukaryotes: Deciding how to fix the break. Nat. Struct. Mol.
Biol. 17, 11–16 (2010).
309. Chapman, J. R., Taylor, M. R. G. & Boulton, S. J. Playing the End Game: DNA double-
strand break repair pathway choice. Mol. Cell 47, 497–510 (2012).
310. Makharashvili, N. & Paull, T. T. CtIP: A DNA damage response protein at the
intersection of DNA metabolism. DNA Repair (Amst). 32, 75–81 (2015).
311. Steger, M., Murina, O., Hühn, D., Ferretti, L. P., Walser, R., Hänggi, K., Lafranchi, L.,
Neugebauer, C., Paliwal, S., Janscak, P., Gerrits, B., Del Sal, G., Zerbe, O. & Sartori, A.
A. Prolyl isomerase PIN1 regulates DNA double-strand break repair by counteracting
DNA end resection. Mol. Cell 50, 333–343 (2013).
312. Lafranchi, L., de Boer, H. R., de Vries, E. G. E., Ong, S.-E., Sartori, A. A. & van Vugt,
M. A. T. M. APC/C(Cdh1) controls CtIP stability during the cell cycle and in response to
DNA damage. EMBO J. 33, 2860–79 (2014).
313. Ferretti, L. P., Himmels, S. F., Trenner, A., Walker, C., Von Aesch, C., Eggenschwiler,
A., Murina, O., Enchev, R. I., Peter, M., Freire, R., Porro, A. & Sartori, A. A. Cullin3-
KLHL15 ubiquitin ligase mediates CtIP protein turnover to fine-tune DNA-end resection.
Nat. Commun. 7, 12628 (2016).
- 102 -
314. Ismail, I. H., Gagné, J. P., Genois, M. M., Strickfaden, H., Mcdonald, D., Xu, Z., Poirier,
G. G., Masson, J. Y. & Hendzel, M. J. The RNF138 E3 ligase displaces Ku to promote
DNA end resection and regulate DNA repair pathway choice. Nat. Cell Biol. 17, 1446–
1457 (2015).
315. Schmidt, C. K., Galanty, Y., Sczaniecka-Clift, M., Coates, J., Jhujh, S., Demir, M.,
Cornwell, M., Beli, P. & Jackson, S. P. Systematic E2 screening reveals a UBE2D-
RNF138-CtIP axis promoting DNA repair. Nat. Cell Biol. 17, 1458–1470 (2015).
316. Yu, X. & Chen, J. DNA damage-induced cell cycle checkpoint control requires CtIP, a
phosphorylation-dependent binding partner of BRCA1 C-terminal domains. Mol. Cell.
Biol. 24, 9478–86 (2004).
317. Huertas, P. & Jackson, S. P. Human CtIP mediates cell cycle control of DNA end
resection and double strand break repair. J. Biol. Chem. 284, 9558–9565 (2009).
318. Yun, M. H. & Hiom, K. CtIP-BRCA1 modulates the choice of DNA double-strand-break
repair pathway throughout the cell cycle. Nature 459, 460–463 (2009).
319. Kaidi, A., Weinert, B. T., Choudhary, C. & Jackson, S. P. Human SIRT6 promotes DNA
end resection through CtIP deacetylation. Science 329, 1348–1353 (2010).
320. Mao, Z., Tian, X., Van Meter, M., Ke, Z., Gorbunova, V. & Seluanov, A. Sirtuin 6
(SIRT6) rescues the decline of homologous recombination repair during replicative
senescence. Proc. Natl. Acad. Sci. 109, 11800–11805 (2012).
321. Tomimatsu, N., Mukherjee, B., Catherine Hardebeck, M., Ilcheva, M., Vanessa
Camacho, C., Louise Harris, J., Porteus, M., Llorente, B., Khanna, K. K. um & Burma, S.
Phosphorylation of EXO1 by CDKs 1 and 2 regulates DNA end resection and repair
pathway choice. Nat. Commun. 5, 3561 (2014).
322. Nimonkar, A. V., Ozsoy, A. Z., Genschel, J., Modrich, P. & Kowalczykowski, S. C.
Human exonuclease 1 and BLM helicase interact to resect DNA and initiate DNA repair.
Proc. Natl. Acad. Sci. 105, 16906–16911 (2008).
- 103 -
323. Chu, V. T., Weber, T., Wefers, B., Wurst, W., Sander, S., Rajewsky, K. & Kühn, R.
Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise
gene editing in mammalian cells. Nat. Biotechnol. 33, 543–548 (2015).
324. Maruyama, T., Dougan, S. K., Truttmann, M. C., Bilate, A. M., Ingram, J. R. & Ploegh,
H. L. Increasing the efficiency of precise genome editing with CRISPR-Cas9 by
inhibition of nonhomologous end joining. Nat. Biotechnol. 33, 538–542 (2015).
325. Pinder, J., Salsman, J. & Dellaire, G. Nuclear domain ‘knock-in’ screen for the evaluation
and identification of small molecule enhancers of CRISPR-based genome editing.
Nucleic Acids Res. 43, 9379–9392 (2015).
326. Gutschner, T., Haemmerle, M., Genovese, G., Draetta, G. F. & Chin, L. Post-translational
regulation of Cas9 during G1 enhances homology-directed repair. Cell Rep. 14, 1555–
1566 (2016).
327. Lee, J. S., Grav, L. M., Pedersen, L. E., Lee, G. M. & Kildegaard, H. F. Accelerated
homology-directed targeted integration of transgenes in Chinese hamster ovary cells via
CRISPR/Cas9 and fluorescent enrichment. Biotechnol. Bioeng. 113, 2518–2523 (2016).
328. Song, J., Yang, D., Xu, J., Zhu, T., Chen, Y. E. & Zhang, J. RS-1 enhances
CRISPR/Cas9- and TALEN-mediated knock-in efficiency. Nat. Commun. 7, 10548
(2016).
329. Yang, D., Scavuzzo, M. A., Chmielowiec, J., Sharp, R., Bajic, A. & Borowiak, M.
Enrichment of G2/M cell cycle phase in human pluripotent stem cells enhances HDR-
mediated gene repair with customizable endonucleases. Sci. Rep. 6, 21264 (2016).
330. Robert, F., Barbeau, M., Éthier, S., Dostie, J. & Pelletier, J. Pharmacological inhibition of
DNA-PK stimulates Cas9-mediated genome editing. Genome Med. 7, (2015).
331. Yu, C., Liu, Y., Ma, T., Liu, K., Xu, S., Zhang, Y., Liu, H., La Russa, M., Xie, M., Ding,
S. & Qi, L. S. Small molecules enhance CRISPR genome editing in pluripotent stem
cells. Cell Stem Cell 16, 142–147 (2015).
- 104 -
332. Lin, S., Staahl, B. T., Alla, R. K. & Doudna, J. A. Enhanced homology-directed human
genome engineering by controlled timing of CRISPR/Cas9 delivery. Elife 3, e04766
(2014).
333. Wang, H., Yang, H., Shivalila, C. S., Dawlaty, M. M., Cheng, A. W., Zhang, F. &
Jaenisch, R. One-step generation of mice carrying mutations in multiple genes by
CRISPR/cas-mediated genome engineering. Cell 153, 910–918 (2013).
334. Yang, H., Wang, H., Shivalila, C. S., Cheng, A. W., Shi, L. & Jaenisch, R. One-step
generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated
genome engineering. Cell 154, 1370–9 (2013).
335. Wu, Y., Liang, D., Wang, Y., Bai, M., Tang, W., Bao, S., Yan, Z., Li, D. & Li, J.
Correction of a genetic disease in mouse via use of CRISPR-Cas9. Cell Stem Cell 13,
659–662 (2013).
336. Yoshimi, K., Kaneko, T., Voigt, B. & Mashimo, T. Allele-specific genome editing and
correction of disease-associated phenotypes in rats using the CRISPR-Cas platform. Nat.
Commun. 5, 4240 (2014).
337. Ma, Y., Zhang, X., Shen, B., Lu, Y., Chen, W., Ma, J., Bai, L., Huang, X. & Zhang, L.
Generating rats with conditional alleles using CRISPR/Cas9. Cell Research 24, 122–125
(2014).
338. Yoshimi, K., Kunihiro, Y., Kaneko, T., Nagahora, H., Voigt, B. & Mashimo, T. ssODN-
mediated knock-in with CRISPR-Cas for large genomic regions in zygotes. Nat.
Commun. 7, 10431 (2016).
339. Orthwein, A., Noordermeer, S. M., Wilson, M. D., Landry, S., Enchev, R. I., Sherker, A.,
Munro, M., Pinder, J., Salsman, J., Dellaire, G., Xia, B., Peter, M. & Durocher, D. A
mechanism for the suppression of homologous recombination in G1 cells. Nature 528,
422–426 (2015).
340. Yu, X., Wu, L. C., Bowcock, A. M., Aronheim, A. & Baer, R. The C-terminal (BRCT)
domains of BRCA1 interact in vivo with CtIP, a protein implicated in the CtBP pathway
- 105 -
of transcriptional repression. J. Biol. Chem. 273, 25388–25392 (1998).
341. Tomimatsu, N., Mukherjee, B., Deland, K., Kurimasa, A., Bolderson, E., Khanna, K. K.
& Burma, S. Exo1 plays a major role in DNA end resection in humans and influences
double-strand break repair and damage signaling decisions. DNA Repair (Amst). 11, 441–
448 (2012).
342. Chow, Y. H., O’Brodovich, H., Plumb, J., Wen, Y., Sohn, K. J., Lu, Z., Zhang, F.,
Lukacs, G. L., Tanswell, A. K., Hui, C. C., Buchwald, M. & Hu, J. Development of an
epithelium-specific expression cassette with human DNA regulatory elements for
transgene expression in lung airways. Proc. Natl. Acad. Sci. U. S. A. 94, 14695–700
(1997).
343. Kim, J. H., Lee, S.-R., Li, L.-H., Park, H.-J., Park, J.-H., Lee, K. Y., Kim, M.-K., Shin, B.
A. & Choi, S.-Y. High cleavage efficiency of a 2A peptide derived from porcine
teschovirus-1 in human cell lines, zebrafish and mice. PLoS One 6, e18556 (2011).
344. Daniels, R. W., Rossano, A. J., Macleod, G. T. & Ganetzky, B. Expression of multiple
transgenes from a single construct using viral 2A peptides in Drosophila. PLoS One 9,
e100637 (2014).
345. Kotin, R. M., Linden, R. M. & Berns, K. I. Characterization of a preferred site on human
chromosome 19q for integration of adeno-associated virus DNA by non-homologous
recombination. EMBO J. 11, 5071–8 (1992).
346. Smith, J. R., Maguire, S., Davis, L. A., Alexander, M., Yang, F., Chandran, S., ffrench-
Constant, C. & Pedersen, R. A. Robust, persistent transgene expression in human
embryonic stem cells is achieved with AAVS1-targeted integration. Stem Cells 26, 496–
504 (2008).
347. Wiles, M. V., Vauti, F., Otte, J., Füchtbauer, E. M., Ruiz, P., Füchtbauer, A., Arnold, H.
H., Lehrach, H., Metz, T., Von Melchner, H. & Wurst, W. Establishment of a gene-trap
sequence tag library to generate mutant mice from embryonic stem cells. Nature Genet.
24, 13–14 (2000).
- 106 -
348. Gerard, C. & Goldbeter, A. Temporal self-organization of the cyclin/Cdk network driving
the mammalian cell cycle. Proc. Natl. Acad. Sci. 106, 21643–21648 (2009).
349. Malumbres, M. Cyclin-dependent kinases. Genome Biol. 15, 122 (2014).
350. Peterson, S. E., Li, Y., Chait, B. T., Gottesman, M. E., Baer, R. & Gautier, J. Cdk1
uncouples CtIP-dependent resection and Rad51 filament formation during M-phase
double-strand break repair. J. Cell Biol. 194, 705–720 (2011).
351. Krajewska, M., Heijink, A. M., Bisselink, Y. J. W. M., Seinstra, R. I., Silljé, H. H. W.,
De Vries, E. G. E. & Van Vugt, M. A. T. M. Forced activation of Cdk1 via wee1
inhibition impairs homologous recombination. Oncogene 32, 3001–3008 (2013).
352. Lim, S. & Kaldis, P. Cdks, cyclins and CKIs: roles beyond cell cycle regulation.
Development 140, 3079–3093 (2013).
353. Davies, O. R., Forment, J. V., Sun, M., Belotserkovskaya, R., Coates, J., Galanty, Y.,
Demir, M., Morton, C. R., Rzechorzek, N. J., Jackson, S. P. & Pellegrini, L. CtIP
tetramer assembly is required for DNA-end resection and repair. Nat. Struct. Mol. Biol.
22, 150–157 (2015).
354. Nakade, S., Tsubota, T., Sakane, Y., Kume, S., Sakamoto, N., Obara, M., Daimon, T.,
Sezutsu, H., Yamamoto, T., Sakuma, T. & Suzuki, K. I. T. Microhomology-mediated
end-joining-dependent integration of donor DNA in cells and animals using TALENs and
CRISPR/Cas9. Nat. Commun. 5, 5560 (2014).
355. He, X., Tan, C., Wang, F., Wang, Y., Zhou, R., Cui, D., You, W., Zhao, H., Ren, J.,
Feng, B. & Dna, C. C. Knock-in of large reporter genes in human cells via CRISPR/
Cas9-induced homology-dependent and independent DNA repair. Nucleic Acids Res. 19,
1–14 (2016).
356. Paix, A., Folkmann, A., Goldman, D. H., Kulaga, H., Grzelak, M. J., Rasoloson, D.,
Paidemarry, S., Green, R., Reed, R. R. & Seydoux, G. Precision genome editing using
synthesis-dependent repair of Cas9-induced DNA breaks. Proc. Natl. Acad. Sci. 114,
e10745–54 (2017).
- 107 -
357. Mearini, G., Nielsen, P. E. & Fackelmayer, F. O. Localization and dynamics of small
circular DNA in live mammalian nuclei. Nucleic Acids Res. 32, 2642–2651 (2004).
358. Everett, R. D. The spatial organization of DNA virus genomes in the nucleus. PLoS
Pathog. 9, e1003386 (2013).
359. Highsmith, W. E., Burch, L. H., Zhou, Z., Olsen, J. C., Strong, T. V., Smith, T.,
Friedman, K. J., Silverman, L. M., Boucher, R. C., Collins, F. S. & Knowles, M. R.
Identification of a splice site mutation (2789 + 5 G>A) associated with small amounts of
normal CFTR mRNA and mild cystic fibrosis. Hum. Mutat. 9, 332–338 (1997).
360. Kerem, E. et al. A cystic fibrosis transmembrane conductance regulator splice variant
with partial penetrance associated with variable cystic fibrosis presentations. Am. J.
Respir. Crit. Care Med. 155, 1914–1920 (1997).
361. Canny, M. D. et al. Inhibition of 53BP1 favors homology-dependent DNA repair and
increases CRISPR-Cas9 genome-editing efficiency. Nat. Biotechnol. 36, 95–102 (2018).
362. Brooker, A. S. & Berkowitz, K. M. The roles of cohesins in mitosis, meiosis, and human
health and disease. Methods Mol. Biol. 1170, 229–266 (2014).
363. Sjogren, C. & Nasmyth, K. Sister chromatid cohesion is required for postreplicative
double-strand break repair in Saccharomyces cerevisiae. Curr. Biol. 11, 991–995 (2001).
364. Ström, L., Karlsson, C., Lindroos, H. B., Wedahl, S., Katou, Y., Shirahige, K. & Sjögren,
C. Postreplicative formation of cohesion is required for repair and induced by a single
DNA break. Science 317, 242–245 (2007).
365. Whelan, G., Kreidl, E., Peters, J. M. & Eichele, G. The non-redundant function of
cohesin acetyltransferase Esco2: some answers and new questions. Nucleus 3, 330–334
(2012).
366. Ünal, E., Arbel-Eden, A., Sattler, U., Shroff, R., Lichten, M., Haber, J. E. & Koshland, D.
DNA damage response pathway uses histone modification to assemble a double-strand
break-specific cohesin domain. Mol. Cell 16, 991–1002 (2004).
- 108 -
367. Ström, L., Lindroos, H. B., Shirahige, K. & Sjögren, C. Postreplicative recruitment of
cohesin to double-strand breaks is required for DNA repair. Mol. Cell 16, 1003–1015
(2004).
368. Ünal, E., Heidinger-Pauli, J. M. & Koshland, D. DNA double-strand breaks trigger
genome-wide sister-chromatid cohesion through Eco1 (Ctf7). Science 317, 245–248
(2007).
369. Lee, C.-S., Wang, R. W., Chang, H.-H., Capurso, D., Segal, M. R. & Haber, J. E.
Chromosome position determines the success of double-strand break repair. Proc. Natl.
Acad. Sci. 113, e146–154 (2016).
370. Kadyk, L. C. & Hartwell, L. H. Sister chromatids are preferred over homologs as
substrates for recombinational repair in Saccharomyces cerevisiae. Genetics 132, 387–
402 (1992).
371. Johnson, R. D. & Jasin, M. Sister chromatid gene conversion is a prominent double-
strand break repair pathway in mammalian cells. EMBO J. 19, 3398–3407 (2000).
372. Johnson, R. D. & Jasin, M. Double-strand-break-induced homologous recombination in
mammalian cells. Biochem. Soc. Trans. 29, 196–201 (2001).
373. Covo, S., Westmoreland, J. W., Gordenin, D. A. & Resnick, M. A. Cohesin is limiting for
the suppression of DNA damage-induced recombination between homologous
chromosomes. PLoS Genet. 6, 1–16 (2010).
374. Lukacs, G. L., Haggie, P., Seksek, O., Lechardeur, D., Freedman, N. & Verkman, A. S.
Size-dependent DNA mobility in cytoplasm and nucleus. J. Biol. Chem. 275, 1625–1629
(2000).
375. Mieruszynski, S., Digman, M. A., Gratton, E. & Jones, M. R. Characterization of
exogenous DNA mobility in live cells through fluctuation correlation spectroscopy. Sci.
Rep. 5, 13848 (2015).
376. Shimizu, N., Kamezaki, F. & Shigematsu, S. Tracking of microinjected DNA in live cells
- 109 -
reveals the intracellular behavior and elimination of extrachromosomal genetic material.
Nucleic Acids Res. 33, 6296–6307 (2005).
377. Gasiorowski, J. Z. & Dean, D. A. Intranuclear trafficking of episomal DNA is
transcription-dependent. Mol. Ther. 15, 2132–2139 (2007).
378. Larkin, J. D., Papantonis, A. & Cook, P. R. Promoter type influences transcriptional
topography by targeting genes to distinct nucleoplasmic sites. J. Cell Sci. 126, 2052–2059
(2013).
379. Aguilera, A. & Gómez-González, B. Genome instability: A mechanistic view of its
causes and consequences. Nat. Rev. Genet. 9, 204–217 (2008).
380. Delacôte, F. & Lopez, B. S. Importance of the cell cycle phase for the choice of the
appropriate DSB repair pathway, for genome stability maintenance: The trans-S double-
strand break repair model. Cell Cycle 7, 33–38 (2008).
381. Kueng, S., Hegemann, B., Peters, B. H., Lipp, J. J., Schleiffer, A., Mechtler, K. & Peters,
J. M. Wapl controls the dynamic association of cohesin with chromatin. Cell 127, 955–
967 (2006).
382. Nishiyama, T., Ladurner, R., Schmitz, J., Kreidl, E., Schleiffer, A., Bhaskara, V., Bando,
M., Shirahige, K., Hyman, A. A., Mechtler, K. & Peters, J. M. Sororin mediates sister
chromatid cohesion by antagonizing Wapl. Cell 143, 737–749 (2010).
383. Cucco, F. & Musio, A. Genome stability: What we have learned from cohesinopathies.
Am. J. Med. Genet. 172, 171–178 (2016).
384. Keppler, A., Gendreizig, S., Gronemeyer, T., Pick, H., Vogel, H. & Johnsson, K. A
general method for the covalent labeling of fusion proteins with small molecules in vivo.
Nat. Biotechnol. 21, 86–89 (2003).
385. Kurakhmaeva, K. B., Djindjikhashvili, I. A., Petrov, V. E., Balabanyan, V. U., Voronina,
T. A., Trofimov, S. S., Kreuter, J., Gelperina, S., Begley, D. & Alyautdin, R. N. Brain
targeting of nerve growth factor using poly(butyl cyanoacrylate) nanoparticles. J. Drug
- 110 -
Target. 17, 564–574 (2009).
386. Hyde, S. C. et al. Repeat administration of DNA/liposomes to the nasal epithelium of
patients with cystic fibrosis. Gene Ther. 7, 1156–1165 (2000).
387. Alton, E. W. F. W. et al. A phase I/IIa safety and efficacy study of nebulized liposome-
mediated gene therapy for cystic fibrosis supports a multidose trial. Am. J. Respir. Crit.
Care Med. 192, 1389–1392 (2015).
Recommended