View
0
Download
0
Category
Preview:
Citation preview
Draft
Coagonist of GLP-1 and glucagon receptors ameliorates
non-alcoholic fatty liver disease
Journal: Canadian Journal of Physiology and Pharmacology
Manuscript ID cjpp-2017-0683.R1
Manuscript Type: Article
Date Submitted by the Author: 06-Nov-2017
Complete List of Authors: Patel, Vishal; Zydus Research Centre, Pharmacology&Toxicology Joharapurkar, Amit; Zydus Research Centre, Pharmacology&Toxicology Kshirsagar, Samadhan; Zydus Research Centre, Pharmacology&Toxicology Patel, Maulik; Zydus Research Centre, Pharmacology&Toxicology Sutariya, Brijesh; Zydus Research Centre, Pharmacology&Toxicology Patel, Hiren; Zydus Research Centre, Pharmacology&Toxicology
Pandey, Dheerendra; Zydus Research Centre, Pharmacology&Toxicology Patel, Dipam; Zydus Research Centre, Pharmacology&Toxicology Ranvir, Ramchandra ; Zydus Research Centre, Pharmacology&Toxicology Kadam, Shekhar; Zydus Research Centre, Pharmacology&Toxicology Bahekar, Rajesh; Zydus Research Centre, Medicinal Chemistry Jain, Mukul; Zydus Research Centre,
Keyword: Coagonist of GLP-1 and glucagon receptors, GLP-1, Glucagon, Inflammation, NAFLD
Is the invited manuscript for consideration in a Special
Issue?: N/A
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
1
Coagonist of GLP-1 and glucagon receptors ameliorates non-alcoholic fatty liver
disease
Vishal Patel, Amit Joharapurkar, Samadhan Kshirsagar, Maulik Patel, Brijesh Sutariya,
Hiren Patel, Dheerendra Pandey, Dipam Patel, Ramchandra Ranvir, Shekhar Kadam,
Rajesh Bahekar, and Mukul Jain
Zydus Research Centre, Cadila Healthcare Limited, Sarkhej-Bavla N.H.No.8A, Moraiya,
Ahmedabad, 382210, INDIA
Corresponding Author:
Amit Joharapurkar
Department of Pharmacology & Toxicology, Zydus Research Centre, Cadila Healthcare
Limited, Sarkhej-Bavla N.H.No.8A, Moraiya, Ahmedabad
Email address: amitjoharapurkar@zyduscadila.com
Tel: +91 2717665555; Fax: +91 2717665155
Page 1 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
2
Abstract
Nonalcoholic fatty liver disease (NAFLD) is often associated with obesity and type 2
diabetes. Coagonist of glucagon-like peptide-1 receptor (GLP-1R) and glucagon receptor
(GCGR) are under clinical investigation for the treatment of obesity and type 2 diabetes. In
this study, we have demonstrated the effect of a balanced coagonist in the treatment of
NAFLD using mice models. GLP-1R agonist exendin-4, glucagon, and coagonist (Aib2
C24 Chimera2) were administered to C57BL6/J mice, in which NAFLD was induced by
carbon tetrachloride (CCl4) treatment after in high fat diet (HFD) feeding, and CDAHFD
(choline-deficient, L-amino acid-defined, HFD). Repeated dose administration of coagonist
significantly attenuated liver inflammation and steatosis induced by acute and long-term
treatment with CCl4 in HFD-fed mice. Coagonist markedly attenuated the CDAHFD-
induced expression of TIMP-1, MMP-9, TNF-α, MCP-1, COL1A1 and α-SMA. It also
inhibited progression of hepatic steatosis and fibrosis in mice. Exendin-4 was better than
glucagon, but coagonist was most effective in reduction of hepatic inflammation as well as
steatosis. Coagonist of GLP-1R and GCGR improved NAFLD in C57BL6/J mice. This
effect is mediated by reduction in lipotoxicity and inflammation in liver.
Key words: Coagonist of GLP-1 and glucagon receptors, GLP-1, Glucagon, Inflammation,
NAFLD.
Page 2 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
3
Introduction
Nonalcoholic fatty liver disease (NAFLD) is caused by deposition of lipids in liver (Brea
and Puzo 2013). NAFLD may start from only steatosis, and can worsen to nonalcoholic
steatohepatitis (NASH), fibrosis, and cirrhosis. If left untreated, NAFLD can lead to total
liver dysfunction and carcinoma (Bellentani et al. 2010). NAFLD is closely associated with
obesity and insulin resistance, and the mortality due to NAFLD is mainly ascribed to
cardiovascular complications (Younossi et al. 2016; Dyson et al. 2015). NAFLD is mainly
treated with lifestyle changes, followed by pharmacotherapy that targets different aspects of
metabolic syndrome like obesity, dyslipidemia and insulin resistance. Despite these
multiple approaches, the efficacy of pharmacotherapy for NAFLD is minimal (Del et al.
2014; Schwenger and Allard 2014; Filozof et al. 2015).
Glucagon-like peptide-1receptor agonists (GLP-1RA) are used for the treatment of type 2
diabetes. In addition, they demonstrate a significant weight loss in overweight and obese
adults (Patel et al 2014). GLP-1RA, liraglutide treatment showed histological resolution of
liver abnormality in NASH patients (Armstrong et al. 2016). Another proglucagon derived
hormone, glucagon is a functional antagonist of insulin. It increases thermogenesis,
lipolysis and fatty acid oxidation (Habegger 2010). Development of coagonist of GLP-1R
and GCGR is a recent therapeutic strategy for achieving optimum control of type 2 diabetes
associated with obesity. Indeed, studies using Aib2 C24 chimera2, a balanced Glucagon-
like peptide-1 receptor (GLP-1R)/Glucagon receptor (GCGR) coagonist have demonstrated
that, balancing the opposing effects of GLP-1R and GCGR activation reduce diabetes and
obesity in animal models (Day et al. 2009). Oxyntomodulin endogenous coagonist of GLP-
Page 3 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
4
1R and GCGR showed weight loss, and increased energy expenditure in humans (Cohen et
al. 2003).
Hepatic lipogenesis and insulin resistance cause lipotoxicity, oxidative stress and induce
proliferative and apoptotic changes typically observed in NAFLD (Bechmann et al. 2012).
Earlier, we have observed that GLP-1R and GCGR coagonist treatment improved insulin
sensitivity, and reduced hepatic and circulating lipids in HFD fed C57BL6/J mice (Patel et
al. 2013). This effect was partially independent of food intake or body weight lowering
effect of the coagonist (Patel et al. 2013). It suggests that a direct hepatic effect of coagonist
that can be exploited for treatment of NAFLD. Hence, in this study we investigated the
effect of coagonist, exendin-4 (a GLP-1RA), and glucagon in NAFLD induced by carbon
tetrachloride (CCl4) and high fat diet (HFD), and choline-deficient, L-amino acid-defined
high fat diet (CDAHFD).
Materials and methods
Chemicals and Reagents
Aib2 C24 Chimera2 (H1SQGT
5FTSDY
10SKYLD
15EQAAK
20EFIAW
25LMNT-NH
2) the
coagonist of GCGR and GLP-1R, exendin-4 and glucagon were synthesized at Zydus
Research Centre, Ahmedabad, India. All other chemicals and reagents were purchased from
Sigma- Aldrich chemicals, USA, unless stated otherwise. Coagonist, exendin-4 and
glucagon were dissolved in normal saline. CCl4 was formulated in corn oil (5%v/v).
Page 4 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
5
Animals
Male C57BL6/J mice (6-8 weeks old) were obtained from the Animal Research Facility of
Zydus Research Centre, Ahmedabad, India. They had free access to food and water and
were kept on a 12 h light–dark cycle. The procedures for animal use and experimentation
were reviewed and approved by Institutional Animal Ethics Committee (as per CPCSEA,
Committee for the Purpose of Control and Supervision of Experiments on Animals,
Government of India) of Zydus Research Centre, which is an AAALAC accredited facility.
All the procedures were done in accordance with the Guidelines for the Care and Use of
Laboratory Animals from the National Institutes of Health, USA. Chow-fed control animals
were maintained on chow diet. All the animals were anesthetized using 2% isoflurane.
Animals were bled by retro-orbital puncture under anesthesia. Animals were sacrificed
under 5% isoflurane anesthesia.
Induction of hepatic inflammation after carbon tetrachloride administration in high
fat diet-fed mice
Animals were fed with a HFD (60% fat by kcal, D12492; Research Diets, Inc., New
Brunswick, NJ) for 20 weeks. We have used CCl4 induced hepatic inflammation in DIO
mice as it resembles key distinguishing characters of human liver fibrosis, i.e.
inflammation, regeneration, fibre-formation and potentially fibrosis regression (Liedtke et
al. 2013; Allman et al. 2010). Owing to this similarity, carbon tetrachloride induced liver
inflammation is most commonly used approach to induce experimental liver fibrosis in
preclinical models.
Page 5 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
6
In acute experiment, HFD-fed mice were randomized based on body weight. Hepatic
inflammation was induced by a single dose of CCl4 (0.5 mL.kg-1
, i.p.). Treatment of either
exendin-4 (50 µg.kg-1
, s.c.) or glucagon (150 µg.kg-1
, s.c.) or coagonist Aib2 C24 chimera 2
(150 µg.kg-1
, s.c.) was given twice a day starting two days prior to the administration of
CCl4, and continued for next three days after CCl4 dose. The doses of exendin-4, glucagon,
and coagonist selected using pilot studies based on literature reports (Day et al. 2009; Wang
et al. 2014; Patel et al. 2017b). All animals were bled through retro-orbital puncture under
isoflurane anesthesia 72 h after CCl4 administration and plasma samples were separated for
estimation of aspartate aminotransferase (AST), alanine aminotransferase (ALT) and
triglycerides (RCFL, Delhi, INDIA).
In chronic experiment, HFD–fed mice for 20 weeks were randomized based on body
weight. Chronic hepatic inflammation was induced by twice a week intraperitoneal
administration of CCl4 (0.5 mL.kg-1
, i.p.) in corn oil for six weeks. Treatment of either
vehicle or exendin-4 (50 µg.kg-1
, s.c.) or glucagon (150 µg.kg-1
, s.c.) or coagonist Aib2 C24
chimera 2 (150 µg.kg-1
, s.c.) was given twice a day for six weeks. Animals were bled and
sacrificed 72 h after last dose of CCl4. Plasma samples were separated for estimation of
AST, ALT, glucose and triglycerides (RCFL, Delhi, INDIA). Thereafter, mice were
sacrificed and liver samples were isolated and stored at -70ºC for further analysis.
Choline-deficient, amino acid-defined, high-fat diet (CDAHFD) -induced NASH
Animals were fed with CDAHFD (0.1% methionine without choline and 60% fat,
A06071302, Research Diet, New Brunswick, NJ, USA) for 8 weeks. Following which, they
were randomized based on plasma AST and ALT and assigned to either vehicle or exendin-
Page 6 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
7
4 (50 µg.kg-1
, s.c.) or glucagon (150 µg.kg-1
, s.c.) or coagonist Aib2 C24 chimera 2 (150
µg.kg-1
, s.c.) treatment twice a day for next 8 weeks. We use this model because it is
presented with steatosis and inflammation caused due to lipid accumulation, and not due to
inflammation per se, as observed with CCl4-induced toxic insult (Matsumoto et al. 2013).
Hence, CCl4-induced and CDAHFD-induced models were complimentary to each other,
encompassing the pathology of clinically observed NAFLD. At the end of treatment,
animals were bled and plasma samples were separated for estimation of AST, ALT, glucose
and triglycerides (RCFL, Delhi, INDIA). Thereafter, mice were sacrificed and liver
samples were isolated and stored at -70ºC for further analysis.
Hepatic lipid estimation
Liver samples were homogenized using a Polytron PT3100 tissue homogenizer
(Kinematica, Bohemia, NY, USA) in heptane-isopropanol-Tween mixture (3: 2: 0.01 v/v/v)
and centrifuged at 1,500 × g for 15 min at 4°C. The supernatant (the upper phase contained
extracted triglycerides) was collected and evaporated using a nitrogen evaporator. The
residue was solubilized in tritonX100:t-butyl alcohol (1:1). The triglyceride content was
determined using a triglyceride kit.
Hepatic hydroxyproline estimation
Hydroxyproline content in the liver was measured using a modified colorimetric method
(Reddy and Enwemeka 1996). Briefly, 50 mg of liver tissue was homogenized in 500 µL of
phosphate buffered saline (PBS), and centrifuged (10000 r.p.m., 10 min at 4 °C).
Supernatant (200 µL) was hydrolyzed in 200 µL of 4N NaOH and incubated for 30 min at
37 ºC. Methyl red solution (5 µL) was added to each tube, and pH was adjusted to 7.0 using
Page 7 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
8
2N HCl. Samples (400 µL) were diluted in PBS and oxidized with 200 µL chloramine-T at
room temperature for 20 min. Ehrlich’s aldehyde reagent (200 µL) was added to and tubes
were incubated at 60 °C for 30 min. Absorbance was measured at 550 nm. The
concentration of hydroxyproline was determined using a standard curve prepared from
known concentrations of hydroxyproline.
Histological Examination
Hepatic fibrosis and macrophages infiltration were examined in 10% formaldehyde-fixed
paraffin embedded tissue sections. Hepatic fibrosis was assessed by Masson’s trichome
staining method. Activated macrophages in liver i.e. kupffer cells, were visualized in liver
sections stained with periodic acid–schiff–diastase (PAS-D). Fat deposition, was assessed
using oil red O (ORO) staining technique in frozen tissue samples. NASH scoring was
applied to the severity of hepatocellular steatosis, ballooning, inflammation and fibrosis in
liver sectioned stained using hematoxylin and eosin (H&E) stain (Klener et al. 2005). The
scoring for Masson’s trichome, ORO and PAS-D stain were graded as 0-4 (0: No
abnormalities detected, 1: Minimal abnormality, 2: Mild abnormality, 3: Moderate
abnormality and 4: Severe abnormality).
Quantification of mRNA expression by real-time polymerase chain reaction
Expressions of monocyte chemoattractant protein 1(MCP-1), matrix metallopeptidase-9
(MMP-9), tissue inhibitor of metalloproteinases-1 (TIMP-1), alpha-smooth muscle actin (α-
SMA), collagen type 1 α 1 (COL1A) and tumor necrosis factor-α (TNF-α) and β-actin
mRNA in liver tissue were assessed by RT-PCR at the end of the study. Total RNA was
extracted with TRIzol reagent (Applied Biosystem, USA) according to the manufacturer's
Page 8 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
9
instructions. Thereafter, first strand cDNA synthesis was performed using the High-
Capacity cDNA reverse transcription kit (Applied Biosystem, USA). The resulting cDNAs
were used for quantitative PCR using the QIAGEN Quanti Fast SYBR Green kit (Cat. No.
204052, Qiagen, Germantown, MD, USA). The qPCR was run in an ABIprism-7300
(Applied Biosystems, Foster City, CA, USA). Quantitation of the mRNAs was performed
using the 2−∆∆Ct method using β-actin as a housekeeping gene. All primers and sequence
details are given in Table 1.
Data analysis
Data are represented as mean ± SD. Statistical significance was determined by one-way
ANOVA for multiple comparisons with post hoc Dunnett’s test. P<0.05 was considered as
significant. Histological score was evaluated using Kruskal–Wallis test followed by Dunn’s
test for multiple comparisons. All data were analyzed by using GraphPad Prism version
7.03 (GraphPad Software, San Diego, CA, USA).
Results
Coagonist reversed CCl4-induced hepatic steatosis in mice
A significant increase in plasma triglycerides, AST and ALT was observed after HFD with
CCl4 treatment in C57BL6/J mice, when compared to chow-fed mice (Fig. 1). Treatment
with exendin-4 reduced plasma AST by 22.1±10.8% (Fig. 1B) and plasma ALT by
18.4±8.8 % (Fig. 1C). Glucagon treatment showed 12.6±15.3% reduction in AST and
10.9±12.4% reduction in ALT, against vehicle control (Fig. 1B, C). The coagonist
treatment reduced plasma AST by 62.1±6.2% and ALT by 34.3±7.2% against vehicle
control (Fig. 1 B,C).
Page 9 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
10
Since the short-term treatment of the coagonist improved AST and ALT after single dose of
CCl4, we evaluated the effect of coagonist for a longer duration. Exendin-4, glucagon and
coagonist reduced plasma triglycerides, and body weight against vehicle control (Fig. 2 A,
C). Exendin-4 and coagonist reduced plasma glucose by 11.8±11.0 % and 29.6±12.4%,
while glucagon did not alter glucose levels (Fig. 2B). Exendin-4, glucagon and coagonist
treatment reduced plasma AST by 21.4±5.5%, 11.1±8.4% and 48.9 ± 7.4%, respectively
and plasma ALT by 22.5±10.5%, 13.7±16.0% and 52.1± 8.4%, respectively, when
compared to vehicle control group (Fig. 2D,E). A marked increase in NASH score was
observed in vehicle control (6.3±1.2) against chow-fed controls (0 score). Treatment by
exendin-4, glucagon, and coagonist caused 27.4±9.3%, 14.7±19.4% and 54.4±11.7%
reduction in NASH score (Fig. 3A,D). Lipid accumulation (as observed using oil red O
stain) and triglyceride levels in liver were significantly increased in vehicle control group
when compared to chow-fed mice (Fig. 3B,E). Treatment with exendin-4, glucagon and
coagonist reduced the lipid accumulation scores by 50.0±15.1%, 24.0±22.5%, and
75.0±23.7% and hepatic triglyceride levels by 33.3±13.2%, 25.5±14.4%, and 50.0 ± 10.2%,
respectively, when compared with vehicle control group (Fig. 2 B,E). Exendin-4, glucagon,
and coagonist treatment reduced fibrosis score (as observed by Masson’s trichome stain) by
33.3±13.2%, 16.7±19.9%, and 50.0±15.1%, respectively, when compared to vehicle control
group (Fig. 3C,F).
Coagonist ameliorated CDAHFD-induced hepatic inflammation in mice
Sixteen weeks exposure to CDAHFD significantly reduced plasma triglycerides, while
increased plasma ALT and AST in C57BL6/J mice (Fig. 4A,C). Exendin-4 and glucagon
Page 10 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
11
treatment did not change body weight, while coagonist treatment reduced weight gain by
28.5±2.4% when compared to vehicle control (Fig. 4A). Exendin-4, glucagon and coagonist
did not alter plasma glucose (Fig. 4B). Exendin-4 and glucagon treatment reduced plasma
AST by 42.6±13.9% and 24.9±11.5%, and plasma ALT by 36.6±15.8% and 42.6±13.9%,
respectively (Fig. 4D,E). Coagonist treatment caused 53.2±6.1% decrease in plasma AST
and 44.3±12.2% decrease in plasma ALT, respectively against vehicle control (Fig. 4D,E).
Exendin-4, glucagon and coagonist did not change plasma triglycerides (Fig. 4C).
Hepatocellular steatosis, hepatocyte ballooning, inflammation and moderate peri-sinusoidal
or peri-portal fibrosis was observed in liver of CDAHFD-fed animals, after H&E staining
(Fig. 5A,E). Exendin-4 and glucagon treatment reduced inflammatory and fibrotic changes
by 17.9±17.3%, 9.0±7.4%, respectively, when compared to vehicle control group (Fig.
5A,E). Coagonist treatment showed 40.3±12.1% reduction in NASH score against vehicle
control (Fig. 5 A,E). Oil red O staining showed significant fat accumulation in liver of
CDAHFD-fed animals, which was reduced by exendin-4, glucagon, and coagonist by
21.9±14.1%, 14.1±12.2% and 41.4±9.3% respectively, against vehicle control (Fig. 5B,F).
CDAHFD-fed animals showed an increase in intrahepatic triglycerides by 6.0±0.96 fold
and cholesterol by 2.9±0.4 fold against chow-fed animals (Fig. 4F,G). Glucagon and
exendin-4 treatment reduced hepatic triglycerides by 16.5±11.1 and 30.5±9.1%,
respectively, and cholesterol by 13.5±10.9% and 27.0±11.8%, respectively (Fig. 4F,G).
Coagonist showed a stronger effect by reducing hepatic triglycerides by 45.0±11.7% and
cholesterol by 47.1±15.3%, when compared to vehicle control (Fig. 4F,G).
Page 11 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
12
CDAHFD-fed animals showed increased collagen deposition and presence of activated
macrophages, when examined using Masson’s trichome and PAS-D staining (Fig. 5
C,D,G,H). Glucagon treatment did not reduce the fibrosis score (Fig. 5C,G) or PAS-D
score (Fig. 5D,H). Exendin-4 and coagonist treatment reduced fibrosis score by 21.3±9.1%
and 45.7±13.2%, respectively (Fig. 5C,G), and PAS-D score by 20.0±15.1% and
35.5±11.8%, respectively (Fig. 5D,H), against vehicle control. Increased collagen
deposition in the liver of CDAHFD-fed animals was also confirmed by increase in
hydroxyproline content (Fig. 4I). Treatment with exendin-4 and coagonist reduced hepatic
hydroxyproline by 28.6±11.7% and 44.3±8.8% respectively, while glucagon treatment did
not alter it (Fig. 4I). CDAHFD control showed increase in hepatic expression of COL1A1
by 2.1±0.47 fold and α-SMA by 1.8±0.24 fold against chow-fed control (Fig. 6E,F).
Exendin-4, glucagon and coagonist treatment reduced COL1A1 expression by 45.4±5.5%,
25.8±8.4% and 66.9±14.6%, respectively, against vehicle control (Fig. 6E). Expression of
α-SMA was also reduced by treatment with exendin-4, glucagon and coagonist in liver by
40.5±5.5%, 21.3±9.4% and 61.8±17.8%, respectively, against vehicle control (Fig. 6F).
CDAHFD exposure caused as increase in expression of pro-inflammatory genes, namely
TIMP-1, MMP-9, TNF-α, and MCP-1 in liver (Fig. 6A-D). Exendin-4 treatment decreased
expression of all these four pro-inflammatory genes, and glucagon treatment was only half-
way effective as that of exendin-4 treatment (Fig. 6 A-D). Coagonist treatment
demonstrated a significant reduction in the expression of TIMP-1, MMP-9, and MCP-1 by
more than 50% and reduced TNF-α by 48.0±11.0%, when compared to vehicle control (Fig.
6A-D). The inflammatory and fibrotic changes were associated with increased liver weight
Page 12 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
13
in CDAHFD-fed animals. Exendin-4, glucagon and coagonist treatment reduced liver
weight (Fig. 4H).
Discussion
In this study, we investigated the effect of GLP-1R and GCGR coagonist on hepatic
steatosis and fibrosis in mice models of NAFLD. Carbon tetrachloride causes hepatic injury
by inducing oxidative stress. Fibrosis induced by CCl4 is a reversible process, similar to the
symptoms of inflammation-induced hepatic fibrosis in clinic (Lassailly et al. 2015;
Neuschwander-Tetri et al. 2015). HFD prolongs the inflammatory and necrotic phase of
NAFLD induced by CCl4 (Allman et al. 2010; Wang et al. 2011). However, HFD feeding
in mice induced obesity, insulin resistance, hyperlipidemia which mimics NAFLD in
humans (Nakamura and Terauchi 2013). HFD feeding creates calorie overload in mice and
leads to development of obesity and insulin resistance involving multiple factors such as
mammalian target of rapamycin (mTOR). Hence, HFD was used in combination with CCl4
in the current work.
CDAHFD prevents secretion of hepatic lipids in circulation due to defective incorporation
of triglycerides into Apo B100. As a result, lipids get accumulated in hepatocytes, causing
steatosis, inflammation, oxidative stress, and fibrosis (Rinella et al. 2008). CDAHFD shuts
down the hepatic β-oxidation and triglyceride production, which leads to increase in liver
and causes subsequent cellular damage resulting in fibrosis (Matsumoto et al. 2013). This
model shows rapid onset and progression of hepatic fibrosis due to excess accumulation of
ectopic fat in the liver. Further, CDAHFD mouse model is useful for investigating multiple
hits leading to the treatment of NAFLD (Matsumoto et al. 2013).
Page 13 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
14
Acute and long-term treatment of exendin-4 caused decrease in liver inflammation,
accompanied by a reduction in hepatic lipids and inflammation in NAFLD mice models.
Our results are in line with previous studies, which reported a reduction in plasma
triglycerides by exendin-4 treatment (Varanasi et al. 2010; Lee et al. 2012). The effect of
exendin-4 on hepatic steatosis in ob/ob mice or HFD-induced obese mice is reported in
literature (Lee et al. 2012; Ding et al. 2006). Exendin-4 reduces food intake by its action on
ventromedial hypothalamus and arcuate nucleus (Yang et al. 2014; Burmeister et al. 2017).
GLP-1 receptors in brain cause anorexia by activating AMP-activated protein kinase
(AMPK) and mTOR (Burmeister et al. 2017). We have reported earlier that lipid lowering
effect of GLP-1 was also mediated by activation of central GLP-1R, which was partially
independent of anorexia (Patel V et al. 2015). Exendin-4 has protective role in cardiac
hypertrophy which is mediated by activation of mTOR signaling (Zhou et al. 2015).
Though we have not measured either mTOR or AMPK signalling after exendin-4 treatment
in these models, their involvement cannot be ruled out. In the current study, we have
observed the effect of exendin-4 in CCl4- or CDAHFD-induced hepatic injury, in a chronic
dosing regimen. It is interesting to note that acute and long-term treatment with exendin-4
caused a substantial reduction in plasma AST and ALT in CCl4-treated animals. This data
supports the anti-inflammatory properties of exendin-4, which was demonstrated in other
mice models of lipotoxicity (Ceriello et al. 2014). We have observed that the anti-
inflammatory effect of exendin-4 is mediated by a reduction in pro-inflammatory genes,
namely TIMP-1, MCP-1, MMP-9 and TNF-α. A potential role of exendin-4 in the treatment
Page 14 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
15
of hepatic steatosis and fibrosis is thus indicated by demonstration of its efficacy in animal
models for NAFLD employed in current study.
We have observed that glucagon reduces plasma ALT and AST in CCl4 -treated mice, an
effect that was inferior to that of exendin-4. Glucagon’s effect in CCl4-induced hepatic
injury model was associated with reduction in body weight, hepatic lipids and hepatic
inflammation. Reduction in hyperlipidemia is a known effect of glucagon (Jaya and Kurup
1987; Patel et al. 2017a). Hence, it can be concluded that glucagon has a weak anti-
inflammatory effect that can be utilized in the treatment of hepatic inflammation and
fibrosis.
The balanced coagonist of GLP-1 and glucagon used in the current work is reported to have
significant anti-obesity, anti-diabetic, hypolipidemic effect that is partially independent of
anorexia (Day et al. 2009; Patel et al. 2013). It has already been reported that the coagonist
used in the current work has optimally balanced agonistic activity on GLP-1 and glucagon
receptors (Day et al. 2009). Previously, we and others have observed that coagonist
activates both GLP-1R and GCGR, by which the pharmacological effect in glycemic and
lipid metabolism control is observed (Patel et al. 2013; Valdecantos et al. 2017; Pocai et al.
2009). Since these properties of coagonist can be used to alleviate NAFLD and related
disorders, we investigated the effect of the coagonist of GLP-1R and GCGR in the two
mice models of NAFLD. G49, a dual agonist of GLP-1 and glucagon receptors has been
reported to reduce inflammation, steatosis, oxidative stress, and apoptosis in NAFLD
induced by partial hepatectomy with methionine and choline-deficient (MCD) diet in mice
(Valdecantos et al. 2017). Treatment with another dual agonist of GLP-1 and glucagon
Page 15 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
16
receptors has also been reported to reduce lipid accumulation in liver of DIO mice (Zhou et
al. 2017). The models used in these studies are intended to induce obesity and not NAFLD.
Hence, in our work we have used carbon tetrachloride along with long term exposure of
high fat diet to induce overt NAFLD, as confirmed by histological markers (Allman et al.
2010; Nakamura and Terauchi 2013). Hence, ours is the first report in which a balanced
coagonist of GLP-1 and glucagon receptors has been shown to reduce hepatic inflammation
induced by carbon tetrachloride. This model of NAFLD is presented by inflammation,
insulin resistance and fibrosis, which resemble clinical NAFLD. Typically, for induction of
NAFLD, mice are fed with methionine- and choline-deficient diet. However, exposure to
this diet causes weight loss (Chiba et al. 2016). Since coagonist of GLP-1R and GCGR also
cause reduction in body weight, it can reinforce the weight loss inducing action of MCD,
causing undue toxicity. To avoid this complication, we have used choline-deficient amino
acid defined high fat diet, which induces NAFLD without body weight loss.
We have observed that acute and chronic treatment of coagonist prevented rise in plasma
AST and ALT in CCl4-induced hepatic inflammation in diet-induced obese mice. NAFLD
is a result of imbalance between lipogenesis and lipid disposal from liver (Kawano and
Cohen 2013). Coagonist reduced body weight and plasma triglycerides in CCl4-induced
hepatic steatosis in diet-induced obese mice. CDAHFD increased the hepatic macrophage
content in mice, which is a characteristic feature of advanced NAFLD in humans
(Vetelainen et al. 2007). Coagonist treatment suppressed liver weight and reduced signs of
inflammation, collagen and fibrosis. PAS-D staining of liver tissue indicated a significant
reduction in activated macrophage content by coagonist treatment in CDAHFD-fed
Page 16 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
17
C57BL6/J mice. NAFLD is associated with chronic inflammation in liver. The adipose
tissue is the primary source of inflammatory mediators, notably MCP-1 and TNF-α, in
obesity and dyslipidemia. NAFLD is associated with increased inflammatory mediators in
liver (Farrell et al. 2012), like TIMP-1 and MMP-9 and cause fibrosis (Okazaki et al. 2014).
Stellate cells are the principal collagen-producing cells, α-SMA is a marker for its
activation was upregulated in hepatic steatosis (Washington et al. 2000). Coagonist
treatment reduced expression of α-SMA and COL1A1 in liver. Coagonist treatment reduced
the liver lipid content, accompanied by a reduction in inflammatory markers and fat
accumulation in liver. We have observed that coagonist treatment has reduced expression
of TIMP-1, MMP-9, TNF-α and MCP-1 in liver. Earlier, we have observed that glucagon
enhances cholesterol excretion in bile (Patel et al. 2017a). These properties of glucagon
receptor agonism may also be responsible for the hepatoprotective effect of coagonist in
lipotoxicity conditions. Interestingly, no significant changes in plasma triglycerides were
observed after coagonist treatment in CDAHFD-fed mice. This indicates that the beneficial
effects of coagonist in CDAHFD-induced NAFLD cannot be attributed to hyperlipidemia,
but also to reduction ion inflammation in liver. Recently, we have observed that coagonist
improves FGF21 sensitivity, which might be involved in the hepatoprotective effect by
coagonist (Patel et al. 2017b). Signaling of mTOR is involved in the metabolic actions of
exendin-4, and glucagon activates mTOR signaling (Kimball et al. 2004; Burmeister et al.
2017). NAFLD is an independent risk factor for cardiovascular disease, in which mTOR
signalling has an important role (Tarantino and Capone 2013). Hence, in prospective,
involvement of mTOR/AMPK signaling in amelioration of NAFLD by coagonist is worth
Page 17 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
18
investigation. The balanced coagonist used in this study possesses potent GLP-1 agonist
activity, and weaker glucagon agonist effect (Day et al. 2009). This combination of dual
agonistic activity balances the opposing effects of GLP-1 and glucagon on glucose
metabolism, while reinforcing the effects on body weight and lipid metabolism. In
prospective, long term toxicity studies are required to understand the target-based and off-
target toxic effects of the coagonists, which were beyond the scope of the current work.
Taken together these results suggest that coagonist can be a therapeutic option for
ameliorating metabolic abnormality associated with NAFLD and can prevent NAFLD in
susceptible population.
Page 18 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
19
Acknowledgement
No funding received for this manuscript. This is a Zydus Research Centre (ZRC)
communication.
Disclosure
No author of this manuscript has any conflicting potential interest.
Page 19 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
20
References
Allman M, Gaskin L, Rivera CA. 2010. CCl4-induced hepatic injury in mice fed a Western
diet is associated with blunted healing. J Gastroenterol Hepatol. 25(3): 635-643.
PMID:20370733. DOI:10.1111/j.1440-1746.2009.06112.x
Armstrong, M.J., Hull, D., Guo, K., Barton, D., Hazlehurst, J.M., Gathercole, L.L., Nasiri,
M., Yu, J., Gough, S.C., Newsome, P.N. and Tomlinson, J.W. 2016. Glucagon-like peptide
1 decreases lipotoxicity in non-alcoholic steatohepatitis. J Hepatol. 64(2): 399-408.
PMID:26394161. DOI:10.1016/j.jhep.2015.08.03
Bechmann, L.P., Hannivoort, R.A., Gerken, G., Hotamisligil, G.S., Trauner, M. and
Canbay, A. 2012. The interaction of hepatic lipid and glucose metabolism in liver diseases.
J Hepatol. 56(4):952-964. PMID:22173168. DOI: 10.1016/j.jhep.2011.08.025
Bellentani, S., Scaglioni, F., Marino, M. and Bedogni, G., 2010. Epidemiology of non-
alcoholic fatty liver disease. Dig Dis. 28(1):155-161. PMID: 20460905. DOI:
10.1159/000282080
Brea, A., Puzo. J. 2013. Non-alcoholic fatty liver disease and cardiovascular risk. Int J
Cardiol. 167(4): 1109-17. PMID: 23141876. DOI:10.1016/j.ijcard.2012.09.085
Burmeister, M.A., Brown, J.D., Ayala, J.E., Stoffers, D.A., Sandoval, D.A., Seeley, R.J.
and Ayala, J.E. 2017. The Glucagon-Like Peptide-1 Receptor in the Ventromedial
Hypothalamus Reduces Short-Term Food Intake in Male Mice by Regulating Nutrient
Sensor Activity. American Journal of Physiology-Endocrinology and Metabolism. PMID:
28811293. DOI:10.1152/ajpendo.00113.2017
Page 20 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
21
Ceriello, A., Novials, A., Canivell, S., La Sala, L., Pujadas, G., Esposito, K., Testa, R.,
Bucciarelli, L., Rondinelli, M. and Genovese, S. 2014. Simultaneous GLP-1 and insulin
administration acutely enhances their vasodilatory, antiinflammatory, and antioxidant
action in type 2 diabetes. Diabetes Care. 37(7):1938-1943. PMID: 24667461. DOI:
10.2337/dc13-2618
Chiba, T., Suzuki, S., Sato, Y., Itoh, T. and Umegaki, K. 2016. Evaluation of Methionine
Content in a High-Fat and Choline-Deficient Diet on Body Weight Gain and the
Development of Non-Alcoholic Steatohepatitis in Mice. PloS one. 11(10):0164191. PMID:
27723801. DOI:10.1371/journal.pone.0164191
Cohen, M.A., Ellis, S.M., Le Roux, C.W., Batterham, R.L., Park, A., Patterson, M., Frost,
G.S., Ghatei, M.A. and Bloom, S.R. 2003. Oxyntomodulin suppresses appetite and reduces
food intake in humans. J Clin Endocrinol Metab. 88(10): 4696-4701. PMID: 14557443.
DOI: 10.1210/jc.2003-030421
Day, J.W., Ottaway, N., Patterson, J.T., Gelfanov, V., Smiley, D., Gidda, J., Findeisen, H.,
Bruemmer, D., Drucker, D.J., Chaudhary, N., Holland, J., Hembree, J., Abplanalp, W.,
Grant, E., Ruehl, J., Wilson, H., Kirchner, H., Lockie, S.H., Hofmann, S., Woods, S.C.,
Nogueiras, R., Pfluger, P.T., Perez-Tilve, D., Dimarchi, R., and Tschop, M.H. 2009. A new
glucagon and GLP-1 co-agonist eliminates obesity in rodents. Nat.Chem.Biol. 5(10):749-
757. PMID:19597507. DOI: 10.1038/nchembio.209
Del Ben, M., Polimeni, L., Baratta, F., Pastori, D., Loffredo, L. and Angelico, F. 2014.
Modern approach to the clinical management of non-alcoholic fatty liver disease. World J
Gastroenterol. 20(26), 8341-8350. PMID:25024593. DOI: 10.3748/wjg.v20.i26.8341
Page 21 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
22
Ding, X., Saxena, N.K., Lin, S., Gupta, N. and Anania, F.A. 2006. Exendin‐4, a glucagon‐
like protein‐1 (GLP‐1) receptor agonist, reverses hepatic steatosis in ob/ob mice.
Hepatology. 43(1):173-181. PMID:16374859. DOI:10.1002/hep.21006
Dyson, J.K., Anstee, Q.M. and McPherson, S. 2015. Republished: Non-alcoholic fatty liver
disease: a practical approach to treatment. Postgrad Med J. 91(1072):92-101.
PMID:25655252. DOI:10.1136/postgradmedj-2013-100404rep
Farrell, G.C., Van Rooyen, D., Gan, L. and Chitturi, S. 2012. NASH is an inflammatory
disorder: pathogenic, prognostic and therapeutic implications. Gut liver. 6(2):149-171.
PMID:22570745. DOI:10.5009/gnl.2012.6.2.149
Filozof, C., Goldstein, B.J., Williams, R.N. and Sanyal, A. 2015. Non-alcoholic
steatohepatitis: limited available treatment options but promising drugs in development and
recent progress towards a regulatory approval pathway. Drugs.75(12):1373-1392.
PMID:26201461. DOI:10.1007/s40265-015-0437-3
Habegger, K.M., Heppner, K.M., Geary, N., Bartness, T.J., DiMarchi, R. and Tschöp, M.H.
2010. The metabolic actions of glucagon revisited. Nat Rev Endocrinol. 6(12):689-697.
PMID:20957001. DOI:10.1038/nrendo.2010.187
Jaya, P., Kurup, P.A.1987. Mechanism of hypocholesterolemic action of glucagon. J
Biosci. 12(2):111-114. DOI:10.1007/BF02702961
Kawano, Y. and Cohen, D.E. 2013. Mechanisms of hepatic triglyceride accumulation in
non-alcoholic fatty liver disease. J Gastroenterol. 48(4):434-441. PMID:23397118.
DOI:10.1007/s00535-013-0758-5
Page 22 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
23
Kimball, S.R., Siegfried, B.A. and Jefferson, L.S. 2004. Glucagon represses signaling
through the mammalian target of rapamycin in rat liver by activating AMP-activated
protein kinase. Journal of Biological Chemistry. 279(52):54103-54109. PMID:15494402.
DOI:10.1074/jbc.M410755200
Kleiner, D.E., Brunt, E.M., Van, N.M., Behling, C., Contos, M.J., Cummings, O.W.,
Ferrell, L.D., Liu, Y.C., Torbenson, M.S., Unalp-Arida, A., Yeh, M., McCullough, A.J., &
Sanyal, A.J. 2005. Design and validation of a histological scoring system for nonalcoholic
fatty liver disease. Hepatology. 41(6):1313-1321. PMID:15915461.
DOI:10.1002/hep.20701
Lassailly, G., Caiazzo, R., Buob, D., Pigeyre, M., Verkindt, H., Labreuche, J., Raverdy, V.,
Leteurtre, E., Dharancy, S., Louvet, A., Romon, M., Duhamel, A., Pattou, F., and Mathurin,
P. 2015. Bariatric Surgery Reduces Features of Nonalcoholic Steatohepatitis in Morbidly
Obese Patients. Gastroenterology. 149(2):379-388. PMID:25917783.
DOI:10.1053/j.gastro.2015.04.014
Lee, J., Hong, S.W., Chae, S.W., Kim, D.H., Choi, J.H., Bae, J.C., Park, S.E., Rhee, E.J.,
Park, C.Y., Oh, K.W., Park, S.W., Kim, S.W., and Lee, W.Y. 2012. Exendin-4 improves
steatohepatitis by increasing Sirt1 expression in high-fat diet-induced obese C57BL/6J
mice. PLoS.One. 7(2):e31394. PMID:22363635. DOI:10.1371/journal.pone.0031394
Liedtke, C., Luedde, T., Sauerbruch, T., Scholten, D., Streetz, K., Tacke, F., Tolba, R.,
Trautwein, C., Trebicka, J. and Weiskirchen, R. 2013. Experimental liver fibrosis research:
update on animal models, legal issues and translational aspects. Fibrogenesis & tissue
repair. 6(1):19. PMID: 24274743. DOI:10.1186/1755-1536-6-19
Page 23 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
24
Matsumoto, M., Hada, N., Sakamaki, Y., Uno, A., Shiga, T., Tanaka, C., Ito, T., Katsume,
A. and Sudoh, M. 2013. An improved mouse model that rapidly develops fibrosis in non‐
alcoholic steatohepatitis. Int J Exp Pathol. 94(2):93-103. PMID:23305254.
DOI:10.1111/iep.12008
Nakamura, A. and Terauchi, Y. 2013. Lessons from mouse models of high-fat diet-induced
NAFLD. International journal of molecular sciences. 14(11):21240-21257.
Neuschwander-Tetri, B.A., Loomba, R., Sanyal, A.J., Lavine, J.E., Van Natta, M.L.,
Abdelmalek, M.F., Chalasani, N., Dasarathy, S., Diehl, A.M., Hameed, B., Kowdley, K.V.,
McCullough, A., Terrault, N., Clark, J.M., Tonascia, J., Brunt, E.M., Kleiner, D.E., and
Doo, E. 2015. Farnesoid X nuclear receptor ligand obeticholic acid for non-cirrhotic, non-
alcoholic steatohepatitis (FLINT): a multicentre, randomised, placebo-controlled trial.
Lancet. 385(9972):956-965. PMID:25468160. DOI: 10.1016/S0140-6736(14)61933-4
Okazaki, I., Noro, T., Tsutsui, N., Yamanouchi, E., Kuroda, H., Nakano, M., Yokomori, H.
and Inagaki, Y. 2014. Fibrogenesis and carcinogenesis in nonalcoholic steatohepatitis
(NASH): involvement of matrix metalloproteinases (MMPs) and tissue inhibitors of
metalloproteinase (TIMPs). Cancers (Basel). 6(3):1220-1255. PMID:24978432.
DOI:10.3390/cancers6031220
Patel, V., Joharapurkar, A., Dhanesha, N., Kshirsagar, S., Patel, K., Bahekar, R., Shah, G.,
and Jain, M. 2013. Co-agonist of glucagon and GLP-1 reduces cholesterol and improves
insulin sensitivity independent of its effect on appetite and body weight in diet-induced
obese C57 mice. Can.J Physiol Pharmacol.91(12):1009-1015. PMID:24289070.
DOI:10.1139/cjpp-2013-0189
Page 24 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
25
Patel, V.J., Joharapurkar, A.A., Shah, G.B., and Jain, M.R. 2014. Effect of GLP-1 based
therapies on diabetic dyslipidemia. Curr Diabetes Rev. 10(4):238-250. PMID:24998439.
DOI:10.2174/1573399810666140707092506
Patel, V., Joharapurkar, A.A., Kshirsagar, S.G., Patel, K.N., Bahekar, R., Shah, G. and Jain,
M.R. 2015. Central GLP-1 receptor activation improves cholesterol metabolism partially
independent of its effect on food intake. Canadian journal of physiology and pharmacology.
94(2):161-167. PMID:26629909. DOI:10.1139/cjpp-2014-0457
Patel, V., Joharapurkar, A., Kshirsagar, S., Patel, H.M., Pandey, D., Patel, D., Shah, K.,
Bahekar, R., Shah, G.B., and Jain, M.R. 2017a. Central and Peripheral Glucagon Reduces
Hyperlipidemia in Rats and Hamsters. Drug Res.(Stuttg). 67(6)318-326. PMID:28445900.
DOI:10.1055/s-0043-102405
Patel, V., Joharapurkar, A., Kshirsagar, S., Patel, H.M., Pandey, D., Patel, D., Sutariya, B.,
Patel, M., Bahekar, R., and Jain, M.R. 2017b. Balanced Coagonist of GLP-1 and Glucagon
Receptors Corrects Dyslipidemia by Improving FGF21 Sensitivity in Hamster Model. Drug
Res.(Stuttg). PMID:28898910. DOI:10.1055/s-0043-118808
Pocai, A., Carrington, P.E., Adams, J.R., Wright, M., Eiermann, G., Zhu, L., Du, X.,
Petrov, A., Lassman, M.E., Jiang, G., Liu, F., Miller, C., Tota, L.M., Zhou, G., Zhang, X.,
Sountis, M.M., Santoprete, A., Capito', E., Chicchi, G.G., Thornberry, N., Bianchi, E.,
Pessi, A., Marsh, D.J., and SinhaRoy, R. 2009. Glucagon-like peptide 1/glucagon receptor
dual agonism reverses obesity in mice. Diabetes.58(10):2258-2266. PMID:19602537. DOI:
10.2337/db09-0278
Page 25 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
26
Pugazhenthi, U., Velmurugan, K., Tran, A., Mahaffey, G. and Pugazhenthi, S. 2010. Anti-
inflammatory action of exendin-4 in human islets is enhanced by phosphodiesterase
inhibitors: potential therapeutic benefits in diabetic patients. Diabetologia.53(11):2357-
2368. PMID:20635178. DOI:10.1007/s00125-010-1849-y
Reddy, G.K. and Enwemeka, C.S. 1996. A simplified method for the analysis of
hydroxyproline in biological tissues. Clin Biochem. 29(3):225-229. PMID:8740508.
DOI:10.1016/0009-9120(96)00003-6
Rinella, M.E., Elias, M.S., Smolak, R.R., Fu, T., Borensztajn, J. and Green, R.M. 2008.
Mechanisms of hepatic steatosis in mice fed a lipogenic methionine choline-deficient diet. J
Lipid Res. 49(5):1068-1076. PMID:18227531. DOI:10.1194/jlr.M800042-JLR200
Schwenger, K.J. and Allard, J.P. 2014. Clinical approaches to non-alcoholic fatty liver
disease. World journal of gastroenterology: World J Gastroenterol. 20(7):1712-1723.
PMID:24587650. DOI:10.3748/wjg.v20.i7.1712
Tarantino, G. and Capone, D. 2013. Inhibition of the mTOR pathway: a possible protective
role in coronary artery disease. Annals of medicine. 45(4):348-356. PMID:23668688.
DOI:10.3109/07853890.2013.770333
Valdecantos, M.P., Pardo, V., Ruiz, L., Castro-Sanchez, L., Lanzon, B., Fernandez-Millan,
E., Garcia-Monzon, C., Arroba, A.I., Gonzalez-Rodriguez, A., Escriva, F., Alvarez, C.,
Ruperez, F.J., Barbas, C., Konkar, A., Naylor, J., Hornigold, D., Santos, A.D., Bednarek,
M., Grimsby, J., Rondinone, C.M., and Valverde, A.M. 2017. A novel glucagon-like
peptide 1/glucagon receptor dual agonist improves steatohepatitis and liver regeneration in
mice. Hepatology. 65(3):950-968. PMID:27880981. DOI:10.1002/hep.28962
Page 26 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
27
Varanasi, A., Chaudhuri, A., Dhindsa, S., Arora, A., Lohano, T., Vora, M. and Dandona, P.
2010. Durability of effects of exenatide treatment on glycemic control, body weight,
systolic blood pressure, C-reactive protein, and triglyceride concentrations. Endocr Pract.
17(2):192-200. PMID:20841306 DOI:10.4158/EP10199.OR
Veteläinen, R., Van Vliet, A. and Van Gulik, T.M. 2007. Essential pathogenic and
metabolic differences in steatosis induced by choline or methione‐choline deficient diets in
a rat model. J Gastroenterol Hepatol. 22(9):1526-1533. PMID:17716355.
DOI:10.1111/j.1440-1746.2006.04701.x
Wang, X., Cao, Y., Fu, Y., Guo, G. and Zhang, X. 2011. Liver fatty acid composition in
mice with or without nonalcoholic fatty liver disease. Lipids Health Dis. 10(1):234-240.
PMID:22165986. DOI: 10.1186/1476-511X-10-234
Wang, Y., Parlevliet, E.T., Geerling, J.J., Tuin, S.J.L., Zhang, H., Bieghs, V., Jawad,
A.H.M., Shiri‐Sverdlov, R., Bot, I., Jager, S.C.A. and Havekes, L.M. 2014. Exendin‐4
decreases liver inflammation and atherosclerosis development simultaneously by reducing
macrophage infiltration. Br J Pharmacol.171(3):723-734. PMID:24490861.
DOI:10.1111/bph.12490
Washington, K., Wright, K., Shyr, Y., Hunter, E.B., Olson, S. and Raiford, D.S. 2000.
Hepatic stellate cell activation in nonalcoholic steatohepatitis and fatty liver. Hum
Pathol.31(7): 822-828. PMID:10923919. DOI:10.1053/hupa.2000.8440
Yang, Y., Moghadam, A.A., Cordner, Z.A., Liang, N.C. and Moran, T.H. 2014. Long term
exendin-4 treatment reduces food intake and body weight and alters expression of brain
Page 27 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
28
homeostatic and reward markers. Endocrinology.155(9):3473-3483. PMID: 24949661.
DOI:10.1210/en.2014-1052
Younossi, Z.M., Koenig, A.B., Abdelatif, D., Fazel, Y., Henry, L. and Wymer, M. 2016.
Global epidemiology of nonalcoholic fatty liver disease—Meta‐analytic assessment of
prevalence, incidence, and outcomes. Hepatology. 64(1):73-84. PMID:26707365
DOI:10.1002/hep.28431
Zhou, Y., He, X., Chen, Y., Huang, Y., Wu, L. and He, J. 2015. Exendin-4 attenuates
cardiac hypertrophy via AMPK/mTOR signaling pathway activation. Biochemical and
biophysical research communications. 468(1):394-399. PMID:26519882.
DOI:10.1016/j.bbrc.2015.09.179
Zhou, J., Cai, X., Huang, X., Dai, Y., Sun, L., Zhang, B., Yang, B., Lin, H., Huang, W. and
Qian, H. 2017. A novel glucagon-like peptide-1/glucagon receptor dual agonist exhibits
weight-lowering and diabetes-protective effects. European Journal of Medicinal Chemistry.
138:1158-1169. PMID:28772236. DOI:10.1016/j.ejmech.2017.07.046
Page 28 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
29
Table
Table 1. Primer sequences used for real time PCR reactions.
Hepatic gene primer Sequence 5'to3'
MCP1 Forward ACACTCCCGTCCTTACATGG
MCP1 Reverse ATGAGCTCCAAGGGTGACAG
MMP-9 Forward CGTCATTCGCGTGGATAAGG
MMP-9 Reverse TTTGGAAACTCACACGCCAG
TIMP1 Forward GTGCACAGTGTTTCCCTGTT
TIMP1 Reverse AAGTGACGGCTCTGGTAGTC
TNF-α Forward GGATTATGGCTCAGGGTCCA
TNF-α Reverse AGGCTCCAGTGAATTCGGAA
α-SMA Forward AGCATCCGACACTGCTGAC
α-SMA Reverse GGGACAGCACAGCCTGAAT
COL1A1 Forward TGATGGGGAAGCTGGCAAG
COL1A1 Reverse GAAGCCTCGGTGTCCCTTC
Page 29 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
30
Figure legands
Figure 1. Effect of acute treatment of exendin-4, glucagon and coagonist in carbon
tetrachloride-induced hepatotoxicity in diet-induced obese mice. A. Triglycerides, B.
Aspartate Aminotransferase (AST) and C. Alanine Aminotransferase (ALT). Data in graph
are presented as mean ± SD, n=6. *P<0.05 when compared with vehicle control.
Figure 2. Effect of chronic treatment of exendin-4, glucagon and coagonist in carbon
tetrachloride-induced hepatotoxicity in diet-induced obese mice. A. Body weight, B.
Plasma glucose, C. Plasma triglycerides, D. Plasma AST, E. Plasma ALT, F. Hepatic
triglycerides. Data in graph are presented as mean ± SD, n=6. *P<0.05 when compared
with vehicle control. TG, Triglycerides, AST, Aspartate transaminase, ALT, Alanine
transaminase.
Figure 3. Effect of chronic treatment of exendin-4, glucagon and coagonist in carbon
tetrachloride-induced hepatotoxicity in diet-induced obese mice. A. NASH score (H&E
score), B. Fat accumulation score (oil red O stain), C. Fibrosis score (Masson’s trichome
stain), D. Liver sections stained with H&E, E. Liver sections stained with oil red O, F.
Liver sections stained with Masson’s trichome, Data in graph are presented as mean ± SD,
n=6. *P<0.05 when compared with vehicle control. Liver histology slides are representative
of each group. H&E, hematoxylin and Eosin.
Figure.4 Effect of exendin-4, glucagon and coagonist in CDAHFD-induced NASH in mice.
A. Body weight, B. Plasma glucose, C. Plasma triglycerides, D. Plasma AST, E. Plasma
ALT, F. Hepatic cholesterol, G. Hepatic triglycerides, H. Relative liver weight, I Hepatic
Page 30 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
31
hydroxyproline, Data in graph are presented as mean ± SD, n=6. *P<0.05 when compared
with vehicle control. AST, Aspartate transaminase, ALT, Alanine transaminase.
Figure.5 Effect of exendin-4, glucagon and coagonist on hepatic gene expression in
CDAHFD-induced NAFLD in mice. A. TIMP-1, B. MMP-9, C. TNF-α, D. MCP-1, E.
COL1A1 and F. α-SMA Data in graph are presented as mean ± SD, n=6. *P<0.05 when
compared with vehicle control. TIMP-1, tissue inhibitor of metalloproteinases-1, MMP-9,
Matrix metallopeptidase-9, MCP-1, Monocyte chemoattractant protein-1, TNF-α, Tumour
Necrosis Factor alpha, α-SMA, alpha-smooth muscle actin; COL1A, collagen type 1 α 1.
Figure.6 Effect of exendin-4, glucagon and coagonist in CDAHFD-induced NAFLD in
mice. A. NASH score (H&E stain), B. Fat accumulation score (oil red O stain), C. Fibrosis
score (Masson’s trichome stain), and D.PAS-D score (PAS-D stain), E. Liver sections
stained with H&E, F. Liver sections stained with oil red O, G. Liver sections stained with
Masson’s trichome stain, H. Liver section stained with PAS-D stain, Data in graph are
presented as mean ± SD, n=6. *P<0.05 when compared with vehicle control. Liver
histology slides are representative of each group.
Page 31 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
Figure 1
258x78mm (300 x 300 DPI)
Page 32 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
Figure 2
156x97mm (300 x 300 DPI)
Page 33 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
Figure 3
248x213mm (300 x 300 DPI)
Page 34 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
Figure 4
176x154mm (300 x 300 DPI)
Page 35 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
Figure 5
184x121mm (300 x 300 DPI)
Page 36 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Draft
Figure 6
195x276mm (300 x 300 DPI)
Page 37 of 37
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
Recommended