View
1
Download
0
Category
Preview:
Citation preview
1
LOOP-MEDIATED ISOTHERMAL AMPLIFICATION FOR RAPID AND RELIABLE 1
DIAGNOSIS OF TUBERCULOUS MENINGITIS 2
Khushboo J. Nagdev1,
, Rajpal S. Kashyap1,Manmohan M. Parida
2, Rajkumar C. Kapgate
1, 3
Hemant J. Purohit3, Girdhar M. Taori
1 and Hatim F. Daginawala
1*. 4
1. Biochemistry Research Laboratory, Central India Institute of Medical Sciences, Nagpur - 440 5
010, India. 6
2. Division of Virology, Defence Research & Development Establishment, Gwalior, Madhya 7
Pradesh 474002, India 8
3. Environmental Genomics Unit, National Environmental Engineering Research Institute, Nehru 9
Marg, Nagpur-440020, India. 10
Email addresses: 11
KN: khushbu.nagdev@gmail.com 12
RK: raj_ciims@rediffmail.com ; 13
MP: paridamm@rediffmail.com 14
RK: rkapgate@gmail.com 15
HP: hemantdrd@hotmail.com 16
GT: taorigm_ciims@yahoo.co.in 17
HFD: hfd_ciims@rediffmail.com 18
Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Clin. Microbiol. doi:10.1128/JCM.00824-10 JCM Accepts, published online ahead of print on 16 March 2011
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
2
* Corresponding Author 19
Dr.H.F.Daginawala 20
Biochemistry research Laboratory, 21
Central India Institute of Medical Sciences, 22
88/2 Bajaj Nagar, Nagpur-440010. 23
Maharashtra,India. 24
Tel no. (lab): +91-712-2233381 *Ext. 262/263. Fax no.:0712-2236416 25
E-mail: hfd_ciims@rediffmail.com 26
Running title: LAMP for TBM diagnosis 27
Affiliations 28
Khushboo J. Nagdev-M.Sc. 29
Rajpal S. Kashyap –M.Sc., Ph.D. 30
Manmohan M. Parida - M.Sc., Ph.D. 31
Hemant J. Purohit M.Sc., Ph.D. 32
Girdhar M. Taori- M.D., F.R.C.P. 33
Hatim F. Daginawala-M.Sc., Ph.D. 34
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
3
Abstract 35
Diagnosis of Tuberculous Meningitis (TBM) is often difficult. A reliable, simple and rapid 36
diagnostic test, which can be performed in any standard laboratory, could be helpful in TBM 37
diagnosis. In this study, a loop mediated isothermal amplification assay (LAMP) was evaluated 38
to rapidly detect and diagnose TBM infection and was compared to the performance of nested 39
PCR. Six specific primers were used to recognize the IS6110 genomic sequence from 40
Mycobacterium tuberculosis (MTB), which included one forward outer primer, one reverse outer 41
primer, two respective inner primers and two loop primers. The optimum reaction temperature 42
and time were 63°C and 60 min, respectively. Nested PCR was performed targeting the IS6110 43
region from MTB using a commercial kit. The LAMP method yielded a sensitivity of 88.23% 44
and a specificity of 80%, compared to the nested PCR assay, which yielded a sensitivity of 45
52.9% and a specificity of 90% for TBM diagnosis. Comparative experiments showed that the 46
LAMP assay is a rapid, sensitive and specific method to detect TBM infection, and that it is 47
superior to the nested PCR assay. LAMP is very simple, and it can be performed in any 48
laboratory and in rural settings. 49
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
4
50
Background 51
Tuberculous meningitis (TBM) is a fatal complication of the central nervous system (CNS) (10, 52
29). A major obstacle in treatment of TBM lies in the initial delay of treatment. This delay is 53
caused by poor disease diagnosis at the initial onset of symptoms. Diagnosis of TBM relies on 54
detection of Mycobacterium tuberculosis (MTB), in cerebrospinal fluid (CSF) by acid fast bacilli 55
(AFB) staining and culturing (9). However, AFB staining of CSF is not very sensitive. Although 56
for diagnosis of TBM in culture, with respect to sensitivity, is better than AFB staining, it takes 57
3-5 weeks and is thus unable to provide the appropriate and timely diagnosis required for proper 58
patient management (32). 59
During the past decade, molecular methods such as the Polymerase Chain Reaction (PCR) have 60
been widely evaluated in TBM diagnosis (4, 17, 26). In addition to conventional PCR, recent 61
advanced technologies, like nested PCR and real time PCR, have been used for early and rapid 62
detection of TBM (27,28,31). Although nested PCR and real time PCR are beneficial, they both 63
require expensive equipment as well as a huge amount of space in routine diagnostic 64
laboratories, limiting their use to highly sophisticated facilities. These methods can be 65
technically difficult, and they require considerable expertise, which can be a major hindrance in 66
providing correct diagnosis to the patient. 67
To overcome the limitations of current molecular techniques, a new molecular-biological 68
technique, known as Loop Mediated Isothermal Amplification (LAMP), was developed by 69
Notomi et al.(19). This technique has many merits. It is highly sensitive and specific, which is 70
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
5
due to the fact that all six primer pairs recognize eight distinct regions in the target DNA. A large 71
amount of product is formed due to the auto displacement activity of the enzyme and due to this 72
property, identification of a positive reaction does not require any special processing or 73
electrophoresis (13). It can be detected by a color change of the reaction mixture in ambient light 74
when a DNA binding dye is used. Another advantage of this assay is that the whole reaction 75
takes about one hour, saving a considerable amount of time (16). The most important benefit of 76
LAMP is that it can be conducted under isothermal conditions (ranging from 60 to 65°C), 77
eliminating the need for specialized equipment or expertise. 78
Due to all these characteristics, LAMP has the potential to be adopted in any laboratory and can 79
be used as a near-patient test. LAMP is increasingly used by various investigators to rapidly 80
detect and type mycobacteria in pulmonary samples (1, 2, 3, 8, 12, 21, 25, 33, 34). To the best of 81
our knowledge, there are currently no studies regarding the efficacy of the LAMP assay in 82
diagnosing TBM infections. In the present study, a one-step, single-tube, real-time, accelerated 83
LAMP assay targeting the IS6110 region was evaluated in diagnosis of TBM infection. Since 84
nested PCR is the method of choice for molecular diagnosis of TBM, we compared the LAMP 85
assay results to the results obtained by nested PCR. 86
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
6
Materials and Methods. 87
Clinical samples. A total of 27 CSF specimens were evaluated retrospectively using the LAMP 88
assay and the results were compared to the nested PCR assay results. All specimens were 89
collected from patients who were admitted to the Central India Institute of Medical Sciences 90
(CIIMS), Nagpur between September 2009 and December 2009. Patients included 17 cases with 91
TBM cases (17 clinically suspected with complete clinical findings) and 10 non-TBM disorder 92
cases (four infectious and six non-infectious neurological disorders). The age of the patients with 93
TBM ranged from 6 to 73 years, and there were 17 males and 10 females. CSF samples were 94
obtained from almost all TBM patients before initiation of anti Koch’s treatment (AKT) and 95
were stored at - 20°C until they were tested. The Institutional Ethics Committee of CIIMS, 96
Nagpur, approved the study. 97
98
Inclusion and exclusion criteria. 99
This study includes patients that were suspected to be infected with MTB based on their clinical 100
characteristics, and for whom the follow-up in response to treatment was available. Patients were 101
excluded if there was microbiological evidence of another central nervous system (CNS) 102
infection. 103
104
The clinical diagnosis of these entire groups was based on the criteria described below. 105
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
7
TBM group (=17) 106
TBM diagnosis was based on clinical features including subacute or chronic fever and signs of 107
meningeal irritation with or without other features of CNS abnormality. CSF findings in these 108
patients could be described as increased protein levels, decreased glucose levels (CSF/blood 109
glucose ratio, ≤0.5) and pleocytosis with lymphocyte predominance. Patients where AFB was 110
demonstrated by smear and/or cultures were considered “confirmed” cases of TBM. In the 111
remaining cases, evidence of tuberculosis meningitis from both computed tomography (CT) or 112
magnetic resonance imaging (MRI), and response to AKT, high Adenosine Deaminase Activity 113
(ADA) values were used as the criteria for the “suspected/probable” cases of TBM diagnosis. 114
115
Non-TBM group (=10) 116
Three female patients and seven male patients with a mean age of 39.25 years (age range, 117
19 to 73 years) with other infectious diseases of the CNS were enrolled as controls: 4 had 118
viral meningoencephalitis with a typical self-limited clinical course, slightly elevated CSF 119
protein concentrations, and increased cell counts dominated by lymphocytes; and 1 120
cryptococcus meningitis verified with an India ink preparation; and 5 had other 121
noninfectious neurological diseases including 2 cases of polyneuritis and 2 case of cerebral 122
infarction and 1 case of pituitary adenoma. 123
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
8
Microbiological Investigations. 124
125
CSF samples of approximately 3-4 ml were initially available. A total of 2 ml of CSF samples 126
were used for routine biochemical and microbiological tests. Briefly, 2 ml of CSF was 127
centrifuged, and a portion of the pellet was examined by Gram, India ink and Ziehl-Neelsen 128
stains. The remaining portion of the pellet was cultured on blood and chocolate agar for bacteria 129
and fungi, on Löwenstein-Jensen medium (Becton Dickinson) and in liquid 7H9 media 130
(Mycobacterium Growth Indicator Tubes, Becton Dickinson) for mycobacteria. CSF cultures 131
were incubated at 37°C for 12 weeks and examined weekly for growth. The supernatant was 132
used in routine biochemical tests. 133
Phenol Chloroform based DNA extraction. Approximately 1-1.5 ml of sample was used to 134
extract DNA. The DNA extracted was further used in the LAMP and the nested PCR assays as 135
previously described (4). Briefly, 100 ul of pellet suspensions of CSF samples were subjected to 136
cell lysis using detergents and then purified by phenol chloroform extraction. The resulting DNA 137
was ethanol precipitated and dissolved in 50 ul of TE buffer. 138
Primer Design. The LAMP reaction was designed using six primers targeting the MTB IS6110 139
gene as previously described by Aryan et al. (2): a forward inner primer (FIP), a reverse inner 140
primer (BIP), two outer primers (F3 and B3) and two loop primers (FLP and BLP). FIP consists 141
of a complementary F1 sequence and an F2 sense sequence. BIP consists of a B1 sense sequence 142
and a B2 complementary sequence. And two loop primers [the forward loop primer (FLP) and 143
the reverse loop primer (BLP)] were designed to accelerate the amplification reaction. The 144
primer sequences are as follows: F3 (5- AGACCTCACCTATGTGTCGA -3), B3 (5-145
TCGCTGAACCGGATCGA-3),FIP,(5-ATGGAGGTGGCCATCGTGGAAGCCTACGTGGC 146
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
9
CTTTGTCAC-3), BIP (5AAGCCATCT GGACCCGCCAACCCCTATCGTATGGTGGAT-3), 147
FLP (AGGATCCTGCGAGCGTAG) and BLP (AAGAAGGCGTACTCGACCTG). 148
LAMP reaction. LAMP was carried out in a 25 µl reaction mixture containing 50 pmol each of 149
the FIP and BIP primers, 5 pmol each of the outer F3 and B3 primers, 25 pmol each of the loop 150
primers F and B and 8 U of the large Bst DNA polymerase fragment (New England Biolabs, 151
Beverly, MA) in 20 mM Tris-HCl (pH 8.8), 10 mM KCl, 8 mM MgSO4 10 mM (NH4)2SO4, 152
0.1% Tween 20, 0.8 M betaine (Sigma, St. Louis, MO), and 1.4 mM of each dNTP and the 153
template DNA. The LAMP assay was monitored in real-time by incubating the reaction mixture 154
at 63°C for 60 min in a Loopamp real-time turbidimeter (LA-200; Teramecs, Japan). Positive 155
and negative controls were included in each run, and all precautions to prevent cross-156
contamination were observed. 157
158
Detection of the amplification products 159
Three detection methods were used to analyze false positive and false negative results real-time 160
turbidity detection, agarose gel analysis and visual detection. Changes in absorbance at 400 nm 161
were measured in real-time using a Loopamp real-time turbidimeter (LA-200) to detect changes 162
in turbidity. 163
164
Nested PCR. The sensitivity and specificity of the LAMP assay was compared with the 165
specificity and sensitivity of nested PCR targeting the IS6110 region according to the manual’s 166
instruction (Genei Amplification kit, Bangalore Genei, Banglore, India). In the first step, the IS 167
region of the complex MTB DNA sequence (220 bp) was amplified using specific external 168
primers. In the second step, nested primers were added to further amplify a 123 bp product. 169
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
10
Amplification products were separated on 2% agarose gels, visualized on a Gel Doc system 170
(Biotech R & D Laboratories, Yercud, Salem, India) and photographed. To prevent cross-171
contamination, different sets of pipettes and distinct work areas were used for DNA template 172
preparation, PCR mixture preparation, DNA amplification and gel analysis. Moreover, one 173
positive and negative control, included with every set of samples, was used during DNA 174
extraction, PCR and LAMP. 175
176
Statistical analysis 177
An O.D. cut-off value used in differentiating TBM from non-TBM patients was determined 178
using the Medcalc statistical software receiver operating characteristic curve (ROC) analysis. 179
The ROC point of inflexion was used as a diagnostic cut-off. Sensitivity was calculated as the 180
number of true positives/(number of true positives + number of false negatives), and the 181
specificity was calculated as the number of true negatives/(number of true negatives + number of 182
false positives). The positive predictive value (PPV) was calculated as true positives × 100/ (true 183
positives + false positives) and the negative predictive value (NPV) was calculated as true 184
negatives × 100/ (true negatives + false negatives). The concordance between the two tests was 185
calculated using Kappa statistics and expressed as a -value. 186
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
11
Results 187
Figure 1 shows the ROC curve for determining the cut-off value, which was determined to be 188
0.0024. Specimens with absorbance equal to or greater than the cut-off value were considered 189
positive reactions. 190
The TBM and non-TBM CSF LAMP assay results are listed in Table 1. The samples were 191
considered to be positive or negative on the basis of the turbidometric results. In 17 of the 192
clinically suspected TBM patients tested using the LAMP assay, 88.23% (15/17) were positive 193
for TBM. Clinical diagnosis of the two false negative cases revealed one case had HIV 194
encephalopathy with TBM, while the other case had TBM with pyogenic meningitis. Twenty 195
percent (2/10) of the non-TBM patients scored positive in the LAMP assay. One case was 196
diagnosed with encephalitis, but the patient had suffered from pulmonary TB five years prior to 197
the test, raising the possibility of TBM infection. The other case was diagnosed as being in a 198
multi-infarction state. Since AKT was not initiated in either of these cases, they were considered 199
to be non-TBM samples. Thus, specificity of the LAMP assay was 80%. The test PPV and NPV 200
were 88.23 % and 80%, respectively. 201
202
The nested PCR assay results for the TBM and non-TBM CSF samples are listed in Table 2. In 203
52.9% (09/17) of cases, the nested PCR result was positive, while the specificity of the nested 204
PCR was about 90%. The test PPV and NPV were 90% and 52.94%, respectively. 205
Table 3 shows the concordance of TBM diagnosis using both LAMP and nested PCR. Eight 206
samples were positive, while one sample was negative in both tests. Thus, there was concordance 207
between the two test results in 9 of 17 samples, and agreement was found to be 52% ( = 0.014). 208
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
12
Similarly, 7 of 10 samples in the non-TBM group were negative in both tests, yielding a 209
concordance of 80% ( =0.375). Two samples from the non-TBM infectious disorder group were 210
positive using the LAMP assay, and one of these samples was also positive using the nested PCR 211
assay. 212
To understand the reason for the high percentage of positive samples using the LAMP assay 213
compared to nested PCR, we analyzed the respective O.D. values obtained from the LAMP 214
assay. Table 4 lists the nested PCR and LAMP assay results from the clinically suspected TB 215
group. In subjects that had a positive nested PCR results, the LAMP O.D. values were 216
considerably higher than for samples that had negative nested PCR results. There was one 217
exception that had a positive nested PCR result and an O.D. value of -0.081, and this sample was 218
therefore negative in the LAMP assay. Another negative sample in the LAMP assay had an O.D. 219
value of -0.004 and was also negative in the nested PCR assay. 220
221
Comparative analysis was performed between the three methods used to detect LAMP products: 222
turbidometric analysis, visual detection by the naked eye and the gel-based detection assay. 223
Turbidometric analysis was performed as mentioned above. Visual detection was performed with 224
the naked eye using SYBR green I, which turns green in the presence of amplified DNA. A 225
sample was considered positive when the reaction mixture turned green after the addition of 226
SYBR green I dye. The end point determination for a positive sample by agarose gel-based 227
detection was done by observing a typical ladder pattern. The results obtained using SYBR green 228
I were not truly consistent with the results from the real-time turbidometer. Figure 2 shows that 229
all three systems were equally sensitive in detecting highly positive and negative cases. 230
However, CSF samples from the clinically suspected TBM group, in which the O.D. for the 231
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
13
LAMP assay was only slightly above the set threshold limit, were not easily discriminated as 232
positive or negative using the SYBR green assay. In all these cases, the typical ladder pattern 233
was detected on the gel. 234
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
14
Discussion 235
Therapy for TBM treatment is usually initiated empirically on the basis of strong clinical 236
suspicion, radiological, CSF cytological and biochemical, ADA findings (11,15,30). Newer 237
diagnostic modalities that can rapidly aid in confirming the clinical suspicion of TBM are 238
still needed. The present study in this context describes the diagnostic utility of LAMP in 239
the diagnosis of TBM which is difficult to diagnose clinically. LAMP detected MTB in 240
88.23% of culture negative cases, illustrating that LAMP can be a sensitive technique that 241
can provide clinical confirmation of suspected TBM cases. To the best of our knowledge, 242
our work is the first to report the use of LAMP to diagnose TBM in patients. However, a lot 243
of previous work detecting MTB in pulmonary samples, such as sputum, has been done and is in 244
good agreement with our study. Studies done by Pandey et al., have found a sensitivity of 96.1% 245
(49/51) in smear-positive and-culture positive sputum samples, but in smear-negative and 246
culture-positive samples, the sensitivity decreased to 85.0% (17/20 sputum samples). The 247
specificity was reported to be 76.7% (23/30 sputum samples) (21). In another study, the 248
sensitivity of MTB-LAMP in smear- and culture-positive sputum samples was 97.7% (173/177), 249
whereas the sensitivity was much lower than in the present results at only of 48.8% (21/43) in 250
smear-negative and culture- positive samples (3). These studies are in agreement with our study 251
and reflect that LAMP is useful not only for clinical confirmation in culture positive cases, but 252
also in the clinical confirmation where bacterial load is low. However, more studies are needed 253
to improve the sensitivity of the LAMP assay in culture negative cases. 254
255
The reason for high sensitivity in our study may be due to three factors. First, the sample 256
tested was CSF which have less inhibition as compared to other biological samples. The 257
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
15
second factor is the selection of primers targeting high copy number gene i.e IS6110. This is 258
supported by work done by Aryan et al., who have shown that by designing primers to this 259
region, 5 fg of MTB (equivalent to 1 copy) could be detected which was better than when 260
used by other primers(2). We have also performed experiments on serial dilutions by 261
spiking a control CSF sample with known concentrations of M.tuberculosis, and obtained a 262
high analytical sensitivity of about 10 CFU/100ul, demonstrating that by using the IS6110 263
primers, LAMP can also be effective in CSF samples. The second important point that we 264
have taken into account is the determination of an appropriate cut-off, or threshold value, 265
that can be helpful in discriminating between a TBM and non-TBM samples, even with a 266
very low load. This differs from the standard threshold value of 0.1 that had been 267
determined earlier by several workers (7, 14, 20, 22). With this O.D., a large number of 268
samples would have turned out to be false negatives. Therefore, we calculated a different 269
threshold value of 0.0024, which was more appropriate for CSF samples. This was similar 270
to the work done by, Han et al., who used different threshold values to differentiate 271
between different species of plasmodium (6). 272
273
LAMP performance was also compared to nested PCR in the same set of samples. Nested 274
PCR is the molecular method of choice for diagnosis of TBM infection in samples 275
harboring a low microbial load (27, 28).In accordance with few earlier published reports 276
(23,24), in our study also the LAMP assay was more sensitive than nested PCR. The 277
possible reason of lower sensitivity could have been inhibition of the nested PCR reaction 278
as mentioned in previous study (5). However in our study this was ruled out because all the 279
internal controls in nested PCR reaction yielded positive results. Even the clinical 280
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
16
sensitivity of the test was high in our previous studies (18). The reason which we could 281
figure out for the discrepancy between the two tests was the analytical sensitivity of the 282
nested PCR kit. By performing the spiking experiments in CSF, the analytical sensitivity of 283
nested PCR was found to be 20 CFU/100ul which is lower than the analytical sensitivity of 284
LAMP. It may be due to this fact that some samples with very low bacterial load have 285
turned out to be LAMP positive but nested PCR negative. Since it was further observed 286
that these LAMP positive but nested PCR negative samples have a low O.D value with 287
LAMP strongly suggests the presence of low bacterial load in these samples. Further 288
analysis of these LAMP-positive samples verified that these were positive samples, which 289
was determined through patient follow-up. This suggests LAMP can be useful for detecting 290
TBM cases at an early stage of disease that can be missed by other diagnostic test. 291
Despite the encouraging results obtained using LAMP, there were some issues of major concern. 292
Two of the clinically suspected TBM cases appeared to be LAMP-negative. In spite of having a 293
confirmatory observation, this issue needs to be further studied by incorporating internal 294
amplification controls. This will be helpful in determining whether any kind of inhibition is 295
occurring in these reactions that may be responsible for such results. Since the turbidity assay is 296
carried out in a closed system, the risk of contamination is lower than when agarose gel 297
electrophoresis is used, providing an additional advantage of the LAMP assay in clinical use. 298
However, we still obtained two false positive results using this assay. Analysis of false positive 299
reactions using sequencing and restriction enzyme analysis would easily distinguish between 300
false positives and contamination. To reduce the chances of contamination, we carried out 301
necessary precautions for avoiding any discrepancies in the results, however technical limitations 302
can be possible for erroneous results. 303
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
17
One of the great advantages of the LAMP assay is that amplification can be monitored with 304
the naked eye using SYBR Green I dye. Boehme et al., have found that this type of 305
detection system is easy and helpful in discriminating TB and non-TB samples, and they 306
have shown an inter-reader variability of only 0.4% (3). However, in our case, some 307
samples were not easily discriminated by visual detection. Although gel electrophoresis was 308
sensitive, real-time monitoring using an inexpensive turbidometer was the most suitable 309
method for interpretation of results because it was able to resolve small variability in 310
sample concentrations. 311
The LAMP technique can be a useful option for detecting TBM infection in low copy number 312
CSF samples. However, a greater number of samples have to be analyzed to compare it with 313
other commonly used methods. Based on our study, we propose the importance of setting 314
appropriate threshold limits, which should vary according to the biological fluid analyzed and the 315
amount of microbial load it harbors. For instance, it may be necessary to have a lower threshold 316
limit for CSF and a higher threshold limit for sputum samples for the same infection, such as TB, 317
for the assays to be clinically meaningful. 318
Conclusion 319
The LAMP assay can be beneficial in confirming TBM infection in clinically suspicious cases 320
when small mycobacterial loads are present. It is more sensitive than nested PCR. In addition, it 321
only takes 60 min, compared to the 3-4 hr it takes for other molecular tests, making it beneficial 322
for tertiary health care centers demanding quick results. 323
Acknowledgment 324
The study was funded by the Central India Institute of Medical Sciences (CIIMS) as part of an 325
in-house project.326
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
18
References 327
1. Adhikari, B.R., B.D. Pandey, P. Ghimire, B.Shrestha,M. Khadka, T. Yoda and Y. Suzuki. 328
2009. Loop-mediated isothermal amplification (LAMP) for the direct detection of human 329
pulmonary infections with environmental (nontuberculosis) mycobacteria. Jpn. J. Infect. 330
Dis. 62:212-214. 331
2. Aryan, E., M. Makvandi, A. Farajzadeh, K. Huygen, P. Bifani P, S.L., Mousavi , A. 332
Fateh ,A. Jelodar, M.M. Gouya and M. Romano.2010. A novel and more sensitive loop-333
mediated isothermal amplification assay targeting IS6110 for detection of 334
Mycobacterium tuberculosis complex. Microbiol. Res.165:211-220. 335
3. Boehme, C.C.,P. Nabeta , G. Henostroza , R. Raqib , Z. Rahim, M. Gerhardt, E. Sanga, 336
M. Hoelscher,T. Notomi, T. Hase, and M.D. Perkins.2007. Operational Feasibility of 337
Using Loop-Mediated Isothermal Amplification for Diagnosis of Pulmonary 338
Tuberculosisin Microscopy Centers of Developing Countries. J. Clin. Microbiol. 45: 339
1936–1940. 340
4. Deshpande, P.S., R.S. Kashyap , S.S. Ramteke , K.J. Nagdev , H.J. Purohit ,G.M. Taori 341
and H.F.Daginawala.2007. Evaluation of the IS6110 PCR assay for the rapid diagnosis of 342
tuberculous meningitis. Cerebrospinal Fluid Res.4: 10. 343
5. Enosawa, M.,S. Kageyama , K. Sawai , K. Watanabe ,T. Notomi, S. Onoe ,Y. Mori and 344
Y.Yokomizo.2003. Use of loop-mediated isothermal amplification of the IS900 sequence 345
for rapid detection of cultured Mycobacterium avium subsp. paratuberculosis. J Clin 346
Microbiol. 41:4359-4365. 347
6. Han, E.T., R. Watanabe, J. Sattabongkot , B. Khuntirat, J. Sirichaisinthop ,H. Iriko, L. Jin 348
,S. Takeo and T. Tsuboi.2007. Detection of four Plasmodium species by genus- and 349
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
19
species-specific loop-mediated isothermal amplification for clinical diagnosis. J. Clin. 350
Microbiol.45:2521-2528. 351
7. Hong, T.C., Q.L. Mai , D.V. Cuong, M. Parida, H. Minekawa, T. Notomi, F. Hasebe , 352
and K.Morita.2004.Development and evaluation of a novel loop-mediated isothermal 353
amplification method for rapid detection of severe acute respiratory syndrome 354
coronavirus. J. Clin. Microbiol.42:1956-1961. 355
8. Iwamoto, T., T. Sonobe and Hayashi. 2003, Loop-mediated isothermal amplification for 356
direct detection of Mycobacterium tuberculosis complex, M. avium, and M. intracellulare 357
in sputum samples. J Clin Microbiol. 41:2616-2622. 358
9. Kashyap, R.S., K.M. Dobos, J.T. Belisle, H.J. Purohit, N.H. Chandak, G.M. Taori and 359
H.F.Daginawala.2005.Demonstration of components of antigen 85 complex in 360
cerebrospinal fluid of tuberculous meningitis patients. Clin. Diagn. Lab. Immunol. 361
12:752-758. 362
10. Kashyap, R.S., S.P. Ramteke, P.S. Deshpande, H.J. Purohit, G.M. Taori and Daginawala 363
HF.2007. Comparison of an adenosine deaminase assay with ELISA for the diagnosis of 364
tuberculous meningitis infection. Med Sci Monit.13:200-204. 365
11. Katti, M.K.2004. Pathogenesis, diagnosis, treatment, and outcome aspects of cerebral 366
tuberculosis. Med Sci Monit.10:215-229. 367
12. Lee, M.F., Y.H. Chen and C.F. Peng.2009. Evaluation of reverse transcription loop-368
mediated isothermal amplification in conjunction with ELISA-hybridization assay for 369
molecular detection of Mycobacterium tuberculosis. J Microbiol Methods. 76:174-180. 370
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
20
13. Mori, Y., K. Nagamine, N. Tomita, and T. Notomi. 2001. Detection of loop-mediated 371
isothermal amplification reaction by turbidity derived from magnesium pyrophosphate 372
formation. Biochem. Biophys. Res. Commun. 289:150–154. 373
14. Mori, Y., M. Kitao, N. Tomita, and T. Notomi. 2004. Real-time turbidimetry of LAMP 374
reaction for quantifying template DNA. J. Biochem. Biophys. Methods 59:145-157. 375
15. Murakami, S., M. Takeno ,H. Oka , A. Ueda, T. Kurokawa , Y. Kuroiwa and Y. 376
Ishigatsubo . 2008. Diagnosis of tuberculous meningitis due to detection of ESAT-6-377
specific gamma interferon production in cerebrospinal fluid enzyme-linked immunospot 378
assay. Clin Vaccine Immunol. 15:897-899. 379
16. Nagamine, K., T. Hase, and T. Notomi. 2002. Accelerated reaction by loop mediated 380
isothermal amplification using loop primers. Mol. Cell Probes 16:223–229. 381
17. Nagdev, K.J., R.S. Kashyap, P.S. Deshpande, H.J. Purohit, G.M. Taori and H.F. 2010. 382
Comparative evaluation of a PCR assay with an in-house ELISA method for diagnosis of 383
Tuberculous meningitis. Med Sci Monit.16:289-295. 384
18. Nagdev, K.J., R.S. Kashyap, P.S. Deshpande, H.J. Purohit, G.M. Taori and H.F. 385
Daginawala. 2010. Determination of polymerase chain reaction efficiency for diagnosis 386
of tuberculous meningitis in Chelex-100® extracted DNA samples. Int J Tuberc Lung 387
Dis 14:1–7. 388
19. Notomi, T., H.Okayama, H. Masubuchi, T. Yonekawa, K. Watanabe, and N. Amino. 389
2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28:E63. 390
20. Okafuji, T., N. Yoshida,M. Fujino, Y. Motegi, T. Ihara ,Y. Ota, T. Notomi , and T. 391
Nakayama.2005. Rapid diagnostic method for detection of mumps virus genome by loop-392
mediated isothermal amplification. J. Clin. Microbiol. 43:1625-1631. 393
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
21
394
21. Pandey, B.D., A. Poudel, T. Yoda, A. Tamaru, N. Oda , Y. Fukushima, B. Lekhak, B. 395
Risal ,B. Acharya, B. Sapkota, C. Nakajima, T. Taniguchi, B. Phetsuksiri ,and Y. 396
Suzuki.2008. Development of an in-house loop-mediated isothermal amplification 397
(LAMP) assay for detection of Mycobacterium tuberculosis and evaluation in sputum 398
samples of Nepalese patients. J. Med. Microbiol. 57:439-443. 399
22. Parida, M.M., S.R. Santhosh, P.K. Dash, N.K. Tripathi, P. Saxena, S. Ambuj, A.K. Sahni, 400
P.V. Lakshmana Rao, and K.Morita.2006. Development and evaluation of reverse 401
transcription-loop-mediated isothermal amplification assay for rapid and real-time 402
detection of Japanese encephalitis virus. J Clin Microbiol.44:4172-4178. 403
23. Paris, D.H., M. Imwong , A.M. Faiz , M. Hasan, E.B. Yunus, K. Silamut, S.J. Lee, N.P. 404
Day and A.M. Dondorp. Loop-mediated isothermal PCR (LAMP) for the diagnosis of 405
falciparum malaria. Am J Trop Med Hyg.77:972-976. 406
24. Pham, H.M., C. Nakajima, K. Ohashi and M. Onuma. Loop-mediated isothermal 407
amplification for rapid detection of Newcastle disease virus.2005. J. Clin. Microbiol. 43: 408
1646–1650. 409
25. Poudel, A., B.D. Pandey , B. Lekhak , B. Rijal ,B.R. Sapkota and Y. Suzuki .Clinical 410
profiling and use of loop-mediated isothermal amplification assay for rapid detection of 411
Mycobacterium tuberculosis from sputum. Kathmandu Univ Med J (KUMJ). 2009.7:109-412
114. 413
26. Rafi, W., M.M. Venkataswamy, S. Nagarathna, P. Satishchandra and A. Chandramuki. 414
Role of IS6110 uniplex PCR in the diagnosis of tuberculous meningitis: experience at a 415
tertiary neurocentre.2007. Int J Tuberc Lung Dis. 11:209-214. 416
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
22
27. Takahashi, T., T. Nakayama, M. Tamura ,K. Ogawa ,H. Tsuda ,A. Morita, M. Hara, 417
M.Togo, H. Shiota , Y. Suzuki, M. Minami, H. Ishikawa, K. Miki , E. Shikata, S. 418
Takahashi and T. Kuragano.2005. Nested polymerase chain reaction for assessing the 419
clinical course of tuberculous meningitis. Neurology.64:1789-1793. 420
28. Takahashi, T., M. Tamura, Y. Asami , E. Kitamura, K. Saito, T. Suzuki , S.N. 421
Takahashi, K. Matsumoto, S. Sawada , E.Yokoyama and T. Takasu. 2008. Novel Wide-422
Range Quantitative Nested Real-Time PCR Assay for Mycobacterium tuberculosis 423
DNA: Clinical Application for Diagnosis of Tuberculous Meningitis . J Clin Microbiol. 424
46: 1698–1707. 425
29. Thwaites, G. E., T. T. Chau, K. Stepniewska, N. H. Phu, L. V. Chuong, D. X. Sinh, N. 426
J.White, C. M. Parry, and J. J. Farrar. 2002. Diagnosis of adult tuberculous meningitis by 427
use of clinical and laboratory features. Lancet 360:1287-1292. 428
30. Venkataswamy, M.M., W. Rafi , S. Nagarathna ,V. Ravi , A. Chandramuki. Comparative 429
evaluation of Bactec 460TB system and Lowenstein Jensen medium for the isolation of 430
M. tuberculosis from cerebrospinal fluid samples of tuberculous meningitis patients. Ind J 431
Med Microbiol 2007;25:236-40. 432
31. Wada, T., S. Maeda, A. Tamaru, S. Imai, A. Hase, and K. Kobayashi. 2004. Dual- probe 433
assay for rapid detection of drug-resistant Mycobacterium tuberculosis by real-time PCR. 434
J. Clin. Microbiol. 42:5277–5285. 435
32. Wang, J. T., C. C. Hung, W. H. Sheng, J. Y. Wang, S. C. Chang, and K. T. Luh. 2002. 436
Prognosis of tuberculous meningitis in adults in the era of modern antituberculous 437
chemotherapy. J Microbiol Immunol Infect. 35:215-222. 438
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
23
33. Zhang, J., G. H. Zhang ,L. Yang , R. Huang, Y. Zhang ,K. Jia, W. Yuan and S.J. Li . 6 439
Feb 2010. Development of a loop-mediated isothermal amplification assay for the 440
detection of Mycobacterium bovis. Vet J. doi:10.1016/j.tvjl.2010.01.001 441
34. Zhu, R.Y., K.X. Zhang, M.Q. Zhao , Y.H. Liu ,Y.Y. Xu , C.M. Ju, B. Li and J.D. Chen. 442
2009.Use of visual loop-mediated isotheral amplification of rimM sequence for rapid 443
detection of Mycobacterium tuberculosis and Mycobacterium bovis. J Microbiol 444
Methods. 78:339-343. 445
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
24
Table 1: Sensitivity, specificity, positive predictive value and negative predictive value for 446
LAMP in clinically suspected TBM and non-TBM classified groups. 447
448
449
450
Group Clinically
suspected TBM
cases=17
NON-TBM
cases=10
Sensitivity Specificity PPV NPV
LAMP
positive
15 2
LAMP
negative
2 8
88.23%
80%
88.23%
80.00%
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
25
Table 2: Sensitivity, specificity, positive predictive value and negative predictive value for 451
the nested PCR assay in clinically suspected TBM and non-TBM classified 452
groups. 453
454
455
456
457
458
459
Group Clinically
suspected TBM
cases=17
NON-TBM
cases=10
Sensitivity Specificity PPV NPV
PCR
positive
9 1
PCR
negative
8 9
52.9%
90%
90%
52.94%
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
26
Table 3: Concordance between PCR and LAMP results for TBM and non-TBM patients. 460
461
DIAGNOSIS LAMP Results PCR Positive PCR Negative Concordance( )
LAMP (+ 15) 8 7 TBM (17)
LAMP (- 02) 1 1
52% (0.014)
LAMP (+02) 1 1 Non-TBM (10)
LAMP (-08) 1 07
80% (0.375)
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
27
462
Table 4: Nested PCR and corresponding LAMP results in individual patients from the 463
clinically suspected TBM group. 464
Clinically suspected
TBM patients=
NESTED PCR LAMP result Corresponding
LAMP O.D.
values
1 Positive Positive .21
2 Positive Positive .081
3 Positive Positive .255
4 Positive Positive .257
5 Positive Positive .095
6 Positive Positive .089
7 Positive Positive .312
8 Positive Positive .378
9 Positive Negative -.081
10 Negative Positive .003
11 Negative Positive .025
12 Negative Positive .003
13 Negative Positive .034
14 Negative Positive .051
15 Negative Positive .003
16 Negative Positive .007
17 Negative Negative -.004
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
values
0 20 40 60 80 100
100
80
60
40
20
0
100-Specificity
Se
nsitiv
ity
Sensitivity: 88.2 Specificity: 80.0 Criterion : >0.0024
Figure 1: ROC curve analysis of the sensitivities and specificities of the LAMP
methods, with 0.0024 derived as the cut-off value
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
L1 L2 L3 L4 L5 L6
T1 T2 T3 T4 T5 T6
SAMPLES TBM TBM TBM TBM TBM NTBM
O.D. at 440 nm .378 .025 .034 .051 .03 -.081
FIG. 2: O. D. values, visualization with the naked eye after SYBR green addition and electrophoretic analysis of LAMP
products. T1-T5- Tubes representing visual detection by addition of SYBR green dye in clinically suspected TBM cases,
T6-non-TBM. L1-L6-respective gel pattern forT1-T6
on March 10, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
Recommended