View
214
Download
1
Category
Preview:
Citation preview
RESEARCH ARTICLE
Development of the Novel Loop Mediated IsothermalAmplification (LAMP) of IS711 Sequence for Rapid Detectionof Brucella Species
Stanzin Zadon • Narinder Singh Sharma •
Anil Kumar Arora • Mudit Chandra
Received: 30 January 2014 / Revised: 22 April 2014 / Accepted: 10 June 2014
� The National Academy of Sciences, India 2014
Abstract A reliable and novel loop mediated isothermal
amplification (LAMP) was developed in the laboratory for
rapid and specific detection of the Brucella species. Four
specific LAMP primers were designed targeting IS711
gene, a highly conserved element in the genus Brucella.
The assay could correctly amplified Brucella abortus S19,
B. abortus S99, B. abortus, B. melitensis and eight clinical
isolates of B. abortus but did not show any cross reaction
with non-Brucella organisms. Detection limit of LAMP
assay was 75 fg.
Keywords IS711 gene � LAMP � 75 fg
Introduction
Brucellosis is one of the worldwide zoonoses that is still of
veterinarian, public health and economic concern in many
parts of the world. Though brucellosis in livestock and its
transmission to humans has significantly decreased after
the effective vaccination-based control and prevention
programmes in many parts of the world, it remains an
uncontrolled problem in regions of high endemicity such as
the Mediterranean, Middle East, Africa, Latin America and
parts of Asia. Brucellosis may cause considerable eco-
nomic loss in terms of reduced productivity, abortions and
weak offsprings [1]. The disease is caused by genus Bru-
cella comprising of six classical species, Brucella abortus,
Brucella melitensis, Brucella suis, Brucella canis, Brucella
ovis, Brucella neotomae, two marine species: B. ceti, B.
pennipedilis and one human origin species B. innoponita
[2]. For the definite diagnosis of brucellosis, bacterial
isolation and identification is a gold standard [3] because
the clinical signs and symptoms are non-specific. However,
isolation is hampered by slow growth of the organisms and
their risk to laboratory personnel [4]. Molecular techniques
such as PCR and multiplex PCR [5] are useful for the
diagnosis of brucellosis and detection of the pathogen
because they are specific, rapid and simple. However, PCR
is not appropriate for resource limited laboratories since
costly specialised equipment and skilled personnel are
needed. Therefore, development of a rapid, accurate, sen-
sitive and more practical diagnostic method is of high
priority in the detection of brucellosis. A promising and
valuable tool that could fulfil these requirements is loop
mediated isothermal amplification (LAMP) which is an
innovative nucleic acid amplification method which can
amplify DNA with high specificity, efficiency and speed
[6]. The amplified products of LAMP could be visualised
either by gel electrophoresis generating a ladder of DNA
fragments or simply detected visualising fluorescence by
adding fluorescent dyes to the reaction tube after amplifi-
cation [7]. Till now only four reports of LAMP on Brucella
have been published [8–11].
The present study was aimed to develop a novel LAMP
test for the rapid detection of Brucella spp.
Material and Methods
Bacterial strains: B. abortus vaccine strain S19, B. abortus S99,
B. melitensis, B. abortus field isolates (n = 8) and non-Brucella
organisms include Pasteurella multocida, Proteus sp, Esche-
richia coli, Salmonella enteritidis and Staphylococcus aureus
S. Zadon (&) � N. S. Sharma � A. K. Arora � M. Chandra
Department of Veterinary Microbiology, Guru Angad Dev
Veterinary and Animal Sciences University (GADVASU),
Ludhiana 141004, Punjab, India
e-mail: stenza_303@yahoo.com; tenzinzadon@gmail.com
123
Proc. Natl. Acad. Sci., India, Sect. B Biol. Sci.
DOI 10.1007/s40011-014-0377-9
available in the Department of Veterinary Microbiology
GADVASU, Ludhiana, India were used.
Extraction of Genomic DNA
DNA was extracted from the organisms by phenol chlo-
roform method as described by Wilson [12].
Primer Design
Four Brucella specific primers for LAMP were designed by
primer explorer V4 software based on the IS711 element gene
sequence (Accession number: NC_006933) including two outer
primers (F3 and B3) and two inner primers (FIP and BIP) fol-
lowing the criteria described by Notomiet al [6, 13].
Nucleotide sequence of IS711 gene of B. abortus used for
designing the primers. Location of the target sequences of
primers are shown in red colour font.
Sequence of Primers Used in LAMP for Detection of
Brucella spp.
Optimization of the Novel Visual LAMP Conditions
The standardised final 25 ll reaction mixture consisted of
20 pmol (each) FIP and BIP primers, 10 pmol (each) of F3
and B3 outer primers, 10 mM dNTP (Qiagen), 1 M betaine
(Sigma), 0.5 ll of SYBR Green dye (New England Biolab),
50 mM Mgso4 (MBI Fermentas), 19 thermopol buffer (New
England Biolabs), 1 ll of Bst polymerase large fragment
(New England Biolabs) and 1 ll genomic DNA. The optimal
response time and temperature was maintained at 63 �C for
60 min followed by termination at 95 �C for 2 min. The
LAMP product was analysed by adding 0.5 ll SYBR Green
dye (1000X) after the amplification based on the conven-
tional LAMP. After amplification, the results of the novel
LAMP reaction could be visually judged by unaided eye
under day light or UV light.
PCR reaction was carried out to examine specificity of
the LAMP with F3 and B3 primers in 25 ll volume
reaction mixture containing 2.5 ll 109 PCR buffer,
10 mM of dNTP, 15 mM Mgcl2, 0.5 ll (20 pmol/ll each
forward and backward outer primers) and 5 U Taq
polymerase and 5 ll of template DNA. The cycling
condition consisted of initial denaturation at 95 �C for
5 min followed by 35 cycles of denaturation at 95 �C for
60 s, annealing at 56 �C for 60 s and extension at 72 �C
for 10 min and a final extension at 72 �C for 5 min. The
5 ll of LAMP and 10 ll PCR products were electro-
phoresed in 2 and 1 % agarose gel containing 0.5 lg/ml
ethidium bromide, respectively.
Specificity and sensitivity of the LAMP reaction was
studied by using DNA extracted from Brucella and non-
Brucella organisms. To evaluate the specificity of the LAMP
primers, B. abortus S19, B. abortus S99, B. abortus and B.
melitensis were tested. Further to check the cross reaction:
one B. abortus vaccine strain S19, eight clinical isolates of B.
abortus (isolated from the bovine aborted foetal stomach
contents, placental tissues, uterine discharges and vaginal
swabs of the animals having history of abortion in the last
term of pregnancy in and around Ludhiana, Punjab) and five
non-Brucella organisms (P. multocida, Proteus sp, E. coli, S.
Enteritidis and S. aureus) were tested.
Primers type Sequences (50–30) Length (bp)
F3 GCAGCCTATGATGCCGATC 19
B3 CAATGTTTTCTCGCATCGCA 20
FIP GGCACTGGAACGTGTTGGATTG
ttttCTTAAGGGCCTTCATTGCCA
46
BIP TCGACTGGAGGCTGTACAAGGA
ttttACGACGATAGCGTTTCAACT
46
S. Zadon et al.
123
The detection limit of novel visual LAMP assay was
tested by serial tenfold dilutions of purified genomic DNA
of B. abortus S19 starting from 75 ng per reaction. The
detection limit was defined as the last positive dilution and
the reactions were done in triplicates.
Results and Discussion
Diagnosis of a disease is very important in context of its
proper management and control. Various detection system
of Brucella spp. mainly include bacterial isolation, sero-
logical methods and molecular techniques such as PCR,
multiplex PCR and nested PCR [14–17]. However, more
specific and safe detection for Brucella spp. in the simple
laboratories and field level can be achieved by LAMP
without the need of expensive equipments such as thermal
cycler and real time thermal cycler [13–15]. LAMP is an
innovative gene amplification technique which is emerging
as a simple, fast diagnostic tool for early detection and
identification of microbial diseases [18]. Unlike PCR,
LAMP requires minimum four primers targeting six dis-
tinct regions on the target gene. In this study the authors
have used newly designed four primers against IS711 gene
sequence because of multi-copy target gene present in all
species of the Brucella [19]. This assay was performed by
incubating the reaction mixtures at a constant temperature
of 63 �C in a regular dry bath for 1 h and was terminated at
95 �C for 2 min. So, only 1 h is needed to perform LAMP
as compared to 2.5 h for PCR assay. Result of the novel
LAMP reaction could be simply observed by the devel-
opment of green colour/strong fluorescence in positive
reaction under day light/UV light and no change of colour/
orange in negative samples (Fig. 1). Upon gel electropho-
resis the characteristic ladder like pattern of bands was
obtained in LAMP reaction (Fig. 2).
The LAMP method is highly sensitive, specific, fast and
easy to perform. It has been widely used in detection of
food borne bacteria, viruses and parasites [20–22]. This
assay specifically identified targeted nucleic acid sequences
in the Brucella genome with minimal requirement of
technical equipments. The primers of LAMP correctly
identified vaccine strain B. abortus S19, B. abortus S99,
two classical species included B. abortus and B. melitensis
(Fig. 3 a, b, c) as well as in the eight field isolates of
Brucella while all the organisms other than Brucella
showed negative results (Fig. 4 a, b, c). Similar type of
specificity was also reported [8–10] targeting BCSP31 and
omp25 gene sequences of the Brucella species. The
amplified DNA was visualized after the addition of the
intercalating dye as SYBR Green dye to the amplified
LAMP products. Although SYBR Green dye has a high
Fig. 1 Visual detection of
Brucellla IS711-LAMP
products using SYBR Green dye
Fig. 2 Agar gel electrophoresis result of LAMP products. 1 B.
abortus S19, 2 control negative (nuclease free water), 3 control
negative (P. multocida), M 100 bp plus DNA ladder
Development of LAMP for Brucella species
123
binding activity to DNA [23], the colour change is dis-
cernable in LAMP assays but not in conventional PCR due
to the higher DNA yields of LAMP i.e. 10 lg as compared
to 0.2 lg in PCR in 25 ll reaction scale [18, 24].
The PCR products were analysed by 1 % gel electro-
phoresis and generated a band size at 223 bp (Fig. 5 a). The
detection limit of PCR and LAMP on serially tenfold diluted
DNA (75 ng, 7.5 ng, 0.75 ng, 75 pg, 7.5 pg, 0.75 pg, 75 fg,
7.5 fg) indicated that PCR was able to detect DNA up to
7.5 pg, while LAMP detected DNA up to 75 fg which
showed that Brucella-LAMP assay is approximately 100-
fold more sensitive than conventional PCR (Fig. 5 b, c, d).
Previous studies reported that sensitivity of LAMP was
higher such as 10 times for the detection of fish pathogen
[25], 20 times for the rapid detection of Avian Leucosis virus
from culture isolates and clinical samples [26], 50 times for
the detection of M. tuberculosis, M. avium, M. intracellulare
for the diagnosis of pulmonary tuberculosis in microscopy
Fig. 3 a–c Specificity of IS711
LAMP assay for specific
detection of B. abortus S99 and
two classical Brucella species
(B. abortus and B. melitensis). aSpecificity of LAMP products
after addition of SYBR Green
under day light. b Specificity of
LAMP products after addition
of SYBR Green under UV light.
c Specificity results of LAMP
on 2 % agarose gel. 1 B. abortus
S19 (Standard), 2 control
negative (nuclease free water), 3
control negative (P. multocida),
4 B. abortus S99, 5 B. abortus, 6
B. melitensis, M 100 bp plus
DNA ladder
S. Zadon et al.
123
centre of developing countries [27, 28] and 100 times more
sensitive than conventional PCR [29] for the detection of
yellow mosaic virus.
Based on the results of present work, LAMP primers and
conditions are very specific for Brucella spp. Further the
authors are interested in the extension of studies with more
species and strains of Brucella and non-Brucella organisms
and application on direct clinical samples.
Conclusion
Brucella IS711- LAMP assay developed in the present
study can be useful for Brucella diagnostic test in low
resource setting laboratories particularly in developing
countries because this assay is easy to perform, cost
effective, sensitive and rapid diagnostic technique for
assessment of brucellosis.
Fig. 4 a–c Analysis of
specificity of IS711 LAMP
assay for specific detection of
Brucella field isolates. aSpecificity of LAMP products
after addition of SYBR Green
under day light. b Specificity of
LAMP products after addition
of SYBR Green under UV light.
c Specificity LAMP products on
2 % agarose gel. 1 B. abortus
S19 (Standard), 2 control
negative (nuclease free water), 3
P. multocida, 4 Proteus, 5
E. coli, 6 S. Enteritidis, 7 S.
aureus, 8–15 B. abortus isolate
no. 1–8, M 100 bp plus DNA
ladder
Development of LAMP for Brucella species
123
Fig. 5 a–d Comparison of
sensitivity of IS711 LAMP
products with PCR assay for
detection of Brucella species. aAfter addition of SYBR Green
dye-under day light. b After
addition of SYBR Green dye-
under UV light. cElectrophoretic analysis of
LAMP products. M 100 bp plus
DNA Ladder, Lane 1 75 ng,
Lane 2 7.5 ng, Lane 3 0.7 ng,
Lane 4 75 pg, Lane 5 7.5 pg,
Lane 6 0.7 pg, Lane 7 75 fg,
Lane 8 7.5 fg, Lane 9 Control
negative. d Electrophoretic
analysis of PCR products. M
100 bp plus DNA Ladder, Lane
1 B. abortus S19, Lane 2 control
negative, Lane 3 75 ng, Lane 4
7.5 ng, Lane 5 0.7 ng, Lane 6
75 pg, Lane 7 75 pg, Lane 8
0.7 pg, Lane 9 75 fg, Lane 10
7.5 fg, Lane 11 Control
negative
S. Zadon et al.
123
Acknowledgments The authors are thankful to the university
administration for providing necessary facilities. None of the authors
of this paper has a financial or personal relationship with other people
or organisations that could inappropriately influence or bias the
content of the paper.
References
1. Smits HK, Kadri SM (2005) Brucellosis in India: a deceptive
infectious disease. Indian J Med Res 122:375–384
2. De BK, Stauffer L, Koylass MS (2008) Novel Brucella strain
(BO1) associated with a prosthetic breast implant infection. J Clin
Microbiol 46:43–49
3. OIE (2010) Caprine and Ovine Brucellosis (excluding Brucella
ovis). Manual of diagnostic tests and vaccines for terrestrial
animals (Chapter 2.7.2)
4. Yagupsky P, Baron EJ (2005) Laboratory exposures to Brucellae
and implications for bioterrorism. Emerg Infect Dis 11:1180–
1185
5. Leal-Klevezas DS, Martinez-Vazquez IO, Lopez-Merino A,
Martinez-Soriano JP (1995) Single-step PCR for detection of
Brucella spp. from blood and milk of infected animals. J Clin
Microbiol 33:3087–3090
6. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe
K, Amino N, Hase T (2000) Loop-mediated isothermal amplifi-
cation of DNA. Nucleic Acids Res 28:e63–e63
7. Qiao YM, Guo YC, Zang XE, Zhou YF, Zhang ZP (2007) Loop
mediated isothermal amplification for rapid detection of Bacillus
anthracis spores. Biol Lett 29:1939–1946
8. Ohtsuki R, Kawamoto K, Kato, Y, Shah MM, Ezaki T, Makino SI
(2008) Rapid detection of Brucella spp. by the loop-mediated
isothermal amplification method. J Appl Micro 108:1364–1372
9. Lin G, Zheng FY, Zhou JZ, Gong XW, Wang GH, Cao XA, Qiu
CQ (2011) Loop-mediated isothermal amplification assay tar-
geting the omp25 gene for rapid detection of Brucella spp. Mol
Cell Probes 25:126–129
10. Pan W, Wang JY, Shen HY, Zhao MQ, Ju CM, Dong XY, Yi L,
Chen JD (2011) Development and amplification of the novel
visual loop mediated isothermal amplification of omp 25
sequence for rapid detection of Brucella sp. J Anim Vet Adv
10:2120–2126
11. Song L, Li J, Hou S, Li X, Chen S (2012) Establishment of loop-
mediated isothermal amplification (LAMP) for rapid detection of
Brucella spp and application to milk and blood samples. J
Microbiol Methods 90:292–297
12. Wilson K (1987) Preparation of genomic DNA from bacteria. In:
Ausubal FM, Brent R, Kirston RL, Moore DD, Seidman JG,
Smith JA, Struhl K (eds) Current protocols in molecular biology,
vol 1. John Wiley and Sons, New York, pp 2.4.1–2.4.2
13. Tomita N, Mori Y, Kanda H, Notomi T (2008) Loop mediated
isothermal amplification (LAMP) of gene sequences and simple
visual detection of products. National Proto 3:877–882
14. Sreevatsan S, Bookout JB, Ringpis F, Perumaalla VS, Ficht TA,
Adams LG, Hagius SD, Elzer PH, Bricker BJ, Kumar GK, Raj-
asekhar M, Isloor S, Barathur RR (2000) A multiplex approach to
molecular detection of Brucella abortus and/or Mycobacterium
bovis infection in cattle. J Clin Microbiol 38:2602–2610
15. Dahouk AS, Nockler K, Hensel A, Tomaso H, Scholz HC, Hagen
RM, Neubauer H (2002) Human brucellosis in a nonendemic
country: a report from Germany, 2002 and 2003. Eur J Clin
Microbiol Infect Dis 24:450–456
16. Ping Z, Yang GL, Chen DJ (2008) Progress in studies on bru-
cellosis in cattle. China Cattle Sci 34:50–52
17. Wang J, Xu WM (2008) Progress in studies on the serum diag-
nosis of brucellosis. Chin J Pathol Biol 3:149–152
18. Parida M, Sannarangaiah S, Dash PK, Rao PVL, Morita K (2008)
Loop mediated isothermal amplification (LAMP): a new gener-
ation of innovative gene amplification technique; perspectives in
clinical diagnosis of infectious diseases. Rev Med Virol 18:407–
421
19. Ouahrani S, Michaux S, Sri WJ, Bourg G, Tournebize R, Ramuz
M, Liautard JP (1993) Identification and sequence analysis of
IS6501, an insertion sequence in Brucella spp.: relationship
between genomic structure and the number of IS6501 copies. J
Gen Intern Med 139:3265–3273
20. Maruyama F, Kenzaka T, Yamaguchi N, Tani K, Nasu M (2003)
Detection of bacteria carrying the stx2 gene by in situ loop-
mediated isothermal amplification. Appl Environ Microbiol
69:5023–5028
21. Ikadai H, Tanaka H, Shibahara N, Matsuu A, Uechi M, Itoh N,
Oshiro S, Kudo N, Garashi I, Oyamada T (2004) Molecular
evidence of infections with Babesia gibsoni parasites in Japan
and evaluation of the diagnostic potential of a loop mediated
isothermal amplification method. J Clin Microbiol 42:2465–2469
22. Yoshikawa T, Ihira M, Akimoto S, Usui C, Miyake F, Suga S,
Enomoto Y, Suzuki R, Nishiyama Y, Asano Y (2004) Detection
of human herpesvirus 7 DNA by loop mediated isothermal
amplification. J Clin Microbiol 42:1348–1352
23. Karleson F, Steen H, Nesland J (1995) SYBR green I DNA
staining increases the detection sensitivity of viruses polymerase
chain reaction. J Virol Methods 55:153–156
24. Nagamine K, Watanabe K, Ohtsuka K, Hase T, Notomi T (2001)
Loop mediated isothermal amplification reaction using a non
denatured template. Clin Chem 47:1742–1743
25. Tsai MA, Wang PC, Yoshida T, Liaw LL, Chen SC (2013)
Development of a sensitive and specific LAMP PCR assay for
detection of fish pathogen Lactococcus garvieae. Dis Aqua Organ
102:225–325
26. Zhang X, Liao M, Jiao P, Luo K, Zhang H, Ren T, Zhang G, Xu
C, Xin C, Cao W (2010) Development of a loop-mediated iso-
thermal amplification assay for rapid detection of subgroup J
avian leukosis virus. J Clin Microbio 48:2116–2121
27. Iwamoto T, Sonobe T, Hayashi K (2003) Loop-mediated iso-
thermal amplification for direct detection of Mycobacterium
tuberculosis complex, M. avium, and M. intracellulare in sputum
samples. J Clin Microbiol 41:2616–2622
28. Boehme CC, Nabeta P, Henostroza G, Raqib R, Rahim Z, Ger-
hardt M, Sanga E, Hoelscher M, Notomi T (2007) Operational
feasibility of using loop-mediated isothermal amplification for
diagnosis of pulmonary tuberculosis in microscopy centres of
developing countries. J Clin Microbiol 45:1936–1940
29. Zhang ZY, Liu XJ, Li DW, Yu JL, Han CG (2011) Rapid
detection of wheat yellow mosaic virus by reverse transcription
loop-mediated isothermal amplification. J Virol 8:550
Development of LAMP for Brucella species
123
Recommended