Cloning by PCR

Polymerase chain reaction If DNA sequence is known, amplify specific gene directly

Cloning by PCR

humanDNA

RPE65gene

Cloning by PCR• Human DNA• RPE65-specific 20-nt primers• Taq DNA polymerase• dNTPs

5′ ATGTCTATCCAGGTTGAGCATCCTGCTGGTGGTTACAAGAACTGTTTGAAACTGTGGAGG3′ TACAGATAGGTCCAACTCGTAGGACGACCACCAATGTTCTTGACAAACTTTGACACCTCC

part of RPE65

5′ ATGTCTATCCAGGTTGAGCATCCTGCTGGTGGTTACAAGAACTGTTTGAAACTGTGGAGG TTTGACACCT

5′primer

TACAGATAGGTCCAACTCGTAGGACGACCACCAATGTTCTTGACAAAC

5′ CCAGGTTGAG TACAGATAGGTCCAACTCGTAGGACGACCACCAATGTTCTTGACAAACTTTGACACCT

primerCATCCTGCTGGTGGTTACAAGAACTGTTTGAAACTGTGGA

Cloning by PCR

Once amplified, ligate and transform as before

Cloning by PCR

+amplified copiesof RPE65 gene

plasmidvector

Genetic engineering

Modified microorganisms: Insulin, growth hormone, clotting factors, EPO… HPV vaccine Ethanol from cellulose Oil-eating bacteria

Modified plants and animals BT corn Roundup-ready soybeans Golden rice

Modified humans Gene therapy

Genetic engineering

Previously derived from blood donations First “pharmed” drug approved by FDA (Feb 6, 2009)

Growing Human Antithrombin

Transgenic animals

Expression Vector

Transgenic animals

Transgenic animals ATryn 1 goat = 90,000 blood

donations

Transgenic plants Pest resistance Herbicide resistance Delayed ripening Increased nutritional values

Electroporation Agrobacterium tumefaciens

Transferring Genes to Plants

Human Gene Therapy

What diseases can we treat with Gene therapy?Replace genes, control expression

Microinjecting DNA into Cells

Transfection

Moving Genes around

DNA viruses: Adenovirus Retrovirus/Lentivirus

Moving Genes around

First therapy experiment: X-SCID (1990) First success: Metastatic melanoma (2006)

2 of 15 Patients had tumors shrink/disappear LCA2

Success?

Almost perfect… Adenovirus: elicits massive inflamation. Retrovirus: insertional mutagenesis

Embryonic Stem Cells Embryonic stem cells Embryonic germ cells

Induced Pluripotent stem cells Use of viral vectors Inject fibroblasts transduced with OCT4, SOX2, KLF4, and c-

Will we cause new disease using GMOs? What is normal? Somatic vs. Germline therapy? Human cloning?

Ethical considerations

Cloning by PCR

Documents

Cloning & PCR

Bacterial cloning Especially of PCR product DNA. PCR recap

TOPO XL-2 Complete PCR Cloning Kit...TOPO XL-2 Complete PCR Cloning Kit USER GUIDE Five-minute blunt-end cloning of extra long (up to 13 kb) PCR products Catalog Number K805010 and

Use of PCR Cloning Combined with DNA Barcoding to Identify

Cloning biologically active geminivirus DNA using PCR and

Cloning into Plasmids Restriction Fragment Cloning & PCR Cloning by the Topo TA™ Method

Zero Blunt TOPO PCR Cloning Kit for Sequencing · PDF fileZero Blunt ® TOPO® PCR Cloning ... The following table liststhe sequence and pmoles supplied of the sequencing ... PCR Cloning

Polymerase Chain Reaction What is PCR History of PCR How PCR works Optimizing PCR Fidelity, errors & cloning PCR primer design Application of PCR

QIAGEN PCR Cloning Handbook

BIGEASY Long PCR Cloning Kit€¦ · Mobile: +91-9810521400 Fax: +91-11-42208444 ... perform BigEasy Linear Cloning Technology and only as described in the BigEasy Linear Cloning

Zero Blunt PCR Cloning Kit - Thermo Fisher Scientific€¦ · Zero Blunt® PCR Cloning Kit A high efficiency system for cloning blunt-ended PCR products Catalog numbers K2700-20,

Manual: StrataClone Ultra Blunt PCR Cloning Kit

Chapter 6 PCR and in vitro Mutagenesis A. Basic features of PCR 1. PCR is a cell-free method of DNA cloning standard PCR reaction is a selective DNA amplification

Zero Blunt TOPO PCR Cloning Kit for Sequencing · PDF fileThe Mach1™-T1R E. coli strain is genetically modified to carry the lacZ∆M15 hsdR lacX74 ... PCR Cloning Kit for Sequencing

1. 2 CHAPTER 3 CELL ENGINEERING TECHNOLOGIES 1.Cell fusion, hybridization, and mAb 2.PCR, RT-PCR and real time PCR 3.Gene cloning, expression, and gene

PrinciplesofPCR · PrinciplesofPCR • Principles* • Designofprimers • PCRforcloning ... give amplification products (b) PCR of human DNA with 17-mer primers Only the desired

Cold Fusion Cloning Kit - System Biosciences€¦ · The Cold Fusion technology is a simple, rapid and highly efficient PCR cloning kit. It allows you to directly clone any PCR product(s)

INTRO TO MOLECULAR GENETICS Restriction enzymes Mapping Cloning PCR Sequencing Genetic engineering

Zero Bluntfi TOPOfi PCR Cloning Kit - University of …vazquezd/Documents/Protocol/Zero Blunt TOPO PCR...Zero Bluntfi TOPOfi PCR Cloning Kit Version K July 24, 2003 25-0215 Zero

pSpark DNA cloning system - Canvax Biotech€¦ · pSpark® DNA cloning systems: Better Tools for the Best Science is useful for cloning PCR products amplified from any plasmid vector