View
214
Download
1
Category
Preview:
Citation preview
Molecular Microbiology (2000) 35(6), 1383±1393
Characterization of the Lactococcus lactis transcriptionfactor FlpA and demonstration of an in vitro switch
Colin Scott, John R. Guest and Jeffrey Green*
The Krebs Institute for Biomolecular Research,
Department of Molecular Biology and Biotechnology,
University of Sheffield, Western Bank, Sheffield S10 2TN,
UK.
Summary
The commercially important bacterium Lactococcus
lactis contains two FNR-like proteins (FlpA and FlpB)
which have a high degree of identity to each other
and to the FLP of Lactobacillus casei. FlpA was
isolated from a GST±FlpA fusion protein produced in
Escherichia coli. Like FLP, isolated FlpA is a homo-
dimeric protein containing both Zn and Cu. However,
the properties of FlpA were more like those of the E.
coli oxygen-responsive transcription factor FNR than
the FLP of L. casei. As prepared FlpA recognized an
FNR site (TTGAT-N4-ATCAA) but not an FLP site
(CCTGA-N4-TCAGG) in band-shift assays. In contrast
to FLP, DNA binding by FlpA did not require the
formation of an intramolecular disulphide bond.
However, despite containing only two cysteine
residues per monomer, FlpA was able to acquire an
FNR-like, oxygen-labile [4Fe 4S] cluster. But, whereas
the incorporation of a [4Fe 4S] cluster into FNR
enhances interaction with target DNA, it abolished
DNA binding by FlpA. An FlpA variant (FlpA 0) with an
N-terminal region designed to be more FLP-like failed
to incorporate an iron±sulphur cluster but could now
form an intramolecular disulphide. This simple exam-
ple of protein engineering, converting an oxygen-
labile [4Fe 4S] containing FNR-like protein into a
dithiol±disulphide FLP-like redox sensor demon-
strates the versatility of the basic CRP structure.
Attempts to demonstrate an FlpA-based aerobic±
anaerobic switch in the heterologous host E. coli
were unsuccessful. However, studies with a series of
FNR-dependent lac reporter fusions in strains of E.
coli expressing flpA or flpB revealed that both
homologues were able to activate expression of
FNR-dependent promoters in vivo but only when
positioned 61 base pairs upstream of the transcription
start.
Introduction
Lactic acid bacteria are of major economic importance
because of their use in the production and preservation of
many fermented foods. Advances in the understanding of
the genetics and molecular biology of these bacteria has
provided new opportunities for biotechnological exploita-
tion (Gasson, 1993). One aspect of their biology that may
prove amenable to manipulation are the global regulatory
circuits that respond to metabolic and environmental
stimuli. The CRP family of global transcription regulators
control gene expression in response to stimuli such as
glucose starvation (CRP) and anoxia (FNR) in a wide
range of bacteria. The first member of the CRP family to
be identified in a Gram-positive bacterium was the
FNR-like protein (FLP) of Lactobacillus casei (Irvine and
Guest, 1993). Although lacking two of the four essential
cysteine residues that act as ligands for an oxygen-labile
[4Fe 4S] cluster in FNR, FLP was designated FNR-like
because its DNA binding helix retained the E± ±SR motif
that was predicted to confer specificity for an FNR site
(TTGAT± ± ± ±ATCAA). However, isolated FLP did not
recognize an FNR site but a related sequence
(CCTGA± ± ± ±TCAGG) in which the TGA core motifs
are separated by only four bases, suggesting that the
DNA-binding helices of FLP penetrate deeper into the
major groove and thus must be more closely configured
than those of FNR (Gostick et al., 1998). Because FLP
lacks two of the four essential cysteine residues of FNR it
was not surprising that it failed to incorporate a [4Fe 4S]
cluster but operated a different redox-sensing switch
based on the reversible interconversion of an intramole-
cular disulphide bond (Gostick et al., 1998). Recently, two
transcriptional regulators of the CRP family (FlpA and
FlpB), each 41% identical to FLP from L. casei, have been
identified in Lactococcus lactis as the distal components of
two paralogous operons, each containing three genes
(Gostick et al., 1999). Both of the potential regulators in L.
lactis are predicted to share the same essential secondary
structural features of CRP and FNR. The similarity of the
Flp DNA binding helices with that of FNR and FLP
suggests that both lactococcal Flp regulators recognize
either an FNR or an FLP site and, intriguingly, both flp
operons have FNR sites appropriately positioned for
Q 2000 Blackwell Science Ltd
Received 25 September, 1999; revised 29 November, 1999;accepted 3 December, 1999. *For correspondence. E-mail jeff.green@sheffield.ac.uk; Tel. (144) 114 222 4403; Fax (144) 114272 8697.
1384 The FlpA protein of L: lactis
Q 2000 Blackwell Science Ltd, Molecular Microbiology, 35, 1383±1393
regulatory activity (Gostick et al., 1999). The present work
indicates that the Flp proteins of L. lactis do indeed
recognize FNR sites, suggesting that the FNR boxes
within the promoter regions of the flp operons are
biologically significant sites of regulation. Furthermore,
the DNA binding activity of FlpA can be modulated in vitro
by the acquisition of an oxygen-labile [4Fe 4S] cluster,
despite possessing only two cysteine residues. The non-
cysteinyl ligands reside close to the N-terminal of FlpA and
deletion of this region converts FlpA from a [4Fe 4S] based
oxygen sensor into a dithiol±disulphide-based redox sensor.
Results
Overproduction of FlpA in Escherichia coli and properties
of the isolated protein
FlpA was overproduced in E. coli (JRG3507) as a
glutathione-S-transferase (GST) fusion protein. The over-
produced GST±FlpA fusion protein was mostly (75%) in
the cytoplasmic fraction and after induction by IPTG
constituted 17±20% of soluble cell protein, equivalent to
23 mg of GST±FlpA per litre of culture. However, despite
this efficient expression, cleavage of GST±FlpA with
thrombin only yielded 3.2 mg of pure FlpA per litre of
culture, representing only 21% of the theoretical
maximum (Fig. 1). A second expression vector,
pGS1035, based on pET16b, allowed the purification of
FlpA by a different procedure but, although expression
was once again good, FlpA was only recovered in low
yield. Consequently, because of the rapid purification
protocol developed for the GST±FlpA fusion it was this
expression system that was routinely used in these
studies. However, sufficient FlpA was produced by both
methods to allow some properties to be determined and
compared with those of FLP and FNR. As a consequence
of the strategy devised to purify FlpA an additional 15
amino acids were attached to the N-terminal of FlpA.
Amino acid sequencing (GSPGISGGGGGILDSMEIK)
confirmed the presence of the additional amino acids
and that the isolated protein was FlpA (native FlpA begins
MKIK but a K2E substitution is created in the engineering
of the NcoI restriction site). In common with many other
proteins expressed as GST fusions a number of minor
contaminating polypeptides were copurified along with the
GST±FlpA, but were shown by N-terminal sequencing
and Western blotting to be truncated GST±FlpA products
(not shown).
Analysis of the oligomeric state of purified FlpA
revealed that FlpA is, like FLP, a homodimer, with a Mr
of 27 700 by SDS±PAGE and 54 700 by gel filtration
(Table 1).
FlpA does not operate an FLP-like switch
The FLP from L. casei has been shown to be associated
with substoichiometric quantities of zinc and copper
following isolation from E. coli (Gostick et al., 1998).
Total metal ion analysis by inductively coupled plasma
(ICP) mass spectrometry of FlpA revealed the presence
of 1.32 atoms of Zn and 0.25 atoms of Cu per FlpA
monomer (Table 1). No other metals were present in
significant quantities. Thus, the metal ion content of FlpA
was similar to that of FLP from L. casei and as both
proteins have two cysteine residues, it was predicted that
FlpA would operate the same dithiol±disulphide based
redox switch used by FLP (Gostick et al., 1998, 1999).
However, in contrast to FLP, FlpA, even after prolonged
Fig. 1. SDS±PAGE analysis of overproduced FlpA. Lane 1,molecular weight markers (sizes in kDa are indicated); lane 2, crudeextract (20 mg); lane 3, GST±FlpA (10 mg); lane 4, FlpA (10 mg).
Table 1. Properties of purified FlpA.Property
Native FlpA Mr (gel filtration) 54 700Subunit FlpA Mr (SDS±PAGE) 27 700Subunit GST±FlpA Mr (SDS±PAGE) 55 800Metal ion content (atoms per FlpA monomer) Zn, 1.32; Cu, 0.25; Fe, , 0.006Reactive sulphydryl groups(SH per FlpA monomer)
1.4±1.7
Iron content after reconstitution(atoms per monomer of GST±FlpA)
3.8±4.05
Acid labile sulphide after reconstitution(atoms per monomer of GST±FlpA)
3.2±3.9
C. Scott, J. R. Guest and J. Green 1385
Q 2000 Blackwell Science Ltd, Molecular Microbiology, 35, 1383±1393
exposure to air in the absence of reducing agents, failed
to acquire an intramolecular disulphide bond as indicated
by a reactive sulphydryl content of 1.4±1.7 per monomer.
This observation was confirmed using FlpA expressed
from pGS1035, a pET16b derivative, encoding FlpA
without the extra N-terminal amino acids associated with
FlpA isolated from the GST±FlpA fusion protein. Accord-
ingly, further analysis showed that neither the addition of
hydrogen peroxide, nor the removal of metal ions (by
treatment with EDTA, 20 mM), nor the addition of CuII
ions could induce disulphide bond formation as indicated
by an increase in FlpA mobility on non-reducing
SDS±PAGE (not shown). This suggests that, despite their
similarity, FlpA and FLP do not sense their respective
stimuli by the same mechanism and that they may respond
to different environmental cues.
FlpA can acquire an oxygen-sensitive [4Fe 4S] cluster
The FLP of L. casei senses redox stress via the formation
of an intramolecular disulphide bond (Gostick et al., 1998)
and the FNR protein of E. coli senses oxygen via the
assembly disassembly of a [4Fe 4S] cluster that requires
four cysteine ligands (Jordan et al., 1997; Popescu et al.,
1998). Thus, the cysteine residues of these related
transcription factors are the key to their sensory capabil-
ities. As FlpA failed to respond to oxygen in an FLP-like
manner (see above) attempts were made to assemble an
iron±sulphur cluster in FlpA under anaerobic conditions
using the protocol developed for FNR (Green et al., 1996).
In preliminary experiments an iron±sulphur cluster was
assembled in FlpA as judged by a broad absorbance
maximum around 420 nM (not shown). However,
because the FlpA from the purification protocol was dilute
(and was further diluted during the removal of excess
reconstitution components) it was not possible to obtain
meaningful data using isolated FlpA and therefore the
GST±FlpA fusion protein had to be used for reconstitution
studies. The presence of GST is unlikely to influence the
assembly of an iron±sulphur cluster as it is separated
from FlpA by an unstructured 15 amino acid linker and this
approach has been successfully applied to the FNR
homologue HlyX (Green and Baldwin, 1997). Cluster
assembly in GST±FlpA was monitored by optical spectro-
scopy which revealed the formation of a single broad
absorbance band at around 420 nM (Fig. 2A). The
spectrum closely resembled that of FNR (Green et al.,
1996) and other [4Fe 4S] containing proteins and lacked
Fig. 2. Absorption spectra of GST±FlpA. Allspectra were obtained with anaerobicallyreconstituted samples of GST±FlpA insealed cuvettes.A. Assembly of the GST±FlpA (17 mMdimer) iron±sulphur cluster. Spectra werecollected at intervals for 3 h.B. Dithionite (0.1 mM) mediated reductionof the GST±FlpA (9 mM dimer) iron±sulphur cluster: bold line, before dithioniteaddition; thin line, after dithionite addition.C. Disassembly of the FlpA [4Fe 4S] clustermonitored by the decrease in absorbanceat 420 nm following exposure ofreconstituted GST±FlpA (9.5 mM dimer) toair.
1386 The FlpA protein of L: lactis
Q 2000 Blackwell Science Ltd, Molecular Microbiology, 35, 1383±1393
the additional features usually associated with [2Fe 2S]
proteins. A useful index to assess the iron±sulphur
content of a protein is the A420:A280 ratio. The 280 nm
absorbance of GST±FlpA consists of contributions from
four tryptophan, 13 phenylalanine and 20 tyrosine
residues yielding a predicted 1280 of 55 100 M21 cm21.
The model iron±sulphur compound [Fe4S4(S±Et)4]2± has
an A420:A280 ratio of 0.7 and an 1420 of 17 200 M21 cm21
(Green et al., 1996) therefore the ratio for FlpA containing
one [4Fe 4S] cluster per monomer (two per dimer) is
predicted to be 0.25. The observed value of 0.16
(A420:A280, 0.315:1.96 after anaerobic gel filtration to
remove unincorporated iron and other low molecular
weight components of the reconstitution mix) is lower than
expected, indicating either the presence of fewer than two
clusters per dimer or that the non-cysteine ligands reduce
1420 of FlpA. In support of the latter contention is the
observation that the molar extinction coefficient of [2Fe
2S] chromophores with two non-cysteine ligands (Rieske
iron±sulphur proteins) is only two-thirds that of [2Fe 2S]
clusters with four cysteine ligands such as ferredoxins
(Fee et al., 1984).
Estimations of the iron and acid labile sulphide content
of GST±FlpA after removing excess reconstitution reac-
tion components by anaerobic gel filtration indicated the
presence of 3.8±4.05 iron atoms and 3.2±3.9 atoms of
acid labile sulphur per FlpA monomer (Table 1). Iron was
not detectable in the GST±FlpA fusion protein before
reconstitution. Thus, on the basis of these measurements
and the appearance of the optical spectrum FlpA appears
to contain one [4Fe 4S] cluster per monomer with at least
two non-cysteine ligands.
Compared with FNR, the [4Fe 4S] cluster of FlpA can
be readily reduced as evidenced by the reduction in
absorbance at 420 nM upon anaerobic addition of 0.1 mM
dithionite (Fig. 2B). At least 1 mM dithionite is required
to reduce FNR (Green et al., 1996). Unfortunately it was not
possible to re-oxidize the cluster because it was destroyed
by the addition of potassium ferricyanide (0.1 mM).
The [4Fe 4S] cluster of FNR is a sensitive monitor of
environmental oxygen and is rapidly degraded upon
exposure to air (Jordan et al., 1997). Exposure of
anaerobically reconstituted FlpA to air caused the
destruction of the iron±sulphur clusters as estimated by
the decrease in absorbance at 420 nM (Fig. 2C). The
absence of any absorbance bands at longer wavelengths
and the absence of residual 420 nM absorbance after
45 min of air exposure indicated that the [4Fe 4S] cluster
was not converted to a [2Fe 2S] but was completely
disassembled. Thus, the cluster is both oxygen and redox
(potassium ferricyanide) sensitive.
To investigate the role of the N-terminal region of FlpA
in the assembly of the [4Fe 4S] cluster, an expression
vector encoding a GST±FlpA variant (GST-FlpA 0) lacking
the first 11 amino acids of FlpA and containing the
substitutions D12M, H13D, H14L was created by PCR.
This protein thus lacked the three N-terminal histidine
residues and failed to incorporate an iron±sulphur cluster
under the conditions developed for the unaltered
GST±FlpA fusion. This indicated that the N-terminal
region of FlpA contains the non-cysteine [4Fe 4S] cluster
ligands. Furthermore when these ligands are removed
from FlpA, the protein (FlpA 0) acquired the ability to form
an intramolecular disulphide as judged by increased
mobility on non-reducing SDS±PAGE. Titration of oxid-
ized FlpA 0 with dithiothreitol revealed that the midpoint of
the engineered FlpA 0 switch was 2420 mV, compared
with 2400 mV for FLP (Gostick et al., 1998) and 2185 mV
for OxyR (Zheng et al., 1998). Therefore, it would appear
that the presence of an extended N-terminal region is
sufficient to impede the interaction between C15 and C112
in FlpA preventing the operation of an FLP-like switch
(Gostick et al., 1998).
FlpA recognizes an FNR site
Following the characterization of FLP from L. casei the
prediction that members of the CRP family containing a
E± ±SR motif within the DNA binding helix will recognize
an FNR site (TTGAT± ± ± ±ATCAA) was modified to
include the related FLP site (CCTGA± ± ± ±TCAGG)
(Gostick et al., 1998). The DNA-binding specificity of FlpA
was tested in vitro by band-shift analysis with a promoter
region containing an FNR site (yfiD, Fig. 3A) and a
promoter containing both FNR and FLP sites FFmelR
(Fig. 3B). The mobility of both promoter regions was
retarded by the presence of FlpA indicating that it is the
FNR site and not the FLP site that is recognized. This was
confirmed by the failure of FlpA to retard an isolated FLP
site (Fig. 3C). Furthermore, in band-shift assays with the
FF, CC, NNmelR family of promoters in which each
member is identical except for symmetrically related base
pair replacements that create FNR (FF), CRP (CC) or
neutral (NN) consensus sites, only FFmelR was retarded
Fig. 3. FlpA retards the mobility of DNA containing FNR sites inband-shift assays.A. yfiD DNA incubated with FlpA as indicated: lane 1, no FlpA; lane2, 2 mM; lane 3, 10 mM.B. FFmelR DNA: lane 1, no FlpA; lane 2, 2 mM; lane 3, 10 mM.C. FlpA incubated with a synthetic FLP binding site (test site A,Gostick et al., 1998). Lane 1, no FlpA; lane 2, 2 mM; lane 3, 10mM. Free DNA and the retarded DNA:FlpA complexes areindicated, each experiment was carried out at least twice.
C. Scott, J. R. Guest and J. Green 1387
Q 2000 Blackwell Science Ltd, Molecular Microbiology, 35, 1383±1393
by FlpA, providing compelling evidence for FlpA±FNR-
site interaction. Like FNR, FlpA bound at the yfiD
promoter with higher affinity than at the FFmelR promoter.
However, whereas active FNR binds to target DNA at nM
concentrations, retardation with FlpA was only observed
in the 2±10 mM range, perhaps indicating that only a small
fraction of the FlpA present in the reaction is active,
although mM concentrations of FLP were required to
observe binding at its cognate binding site and low affinity
binding may be a feature of Flp:DNA interactions. Indeed
the affinity of FlpA for the promoter of the L. lactis flpA
operon was similar to that observed for FFmelR,
suggesting that the DNA context of the FNR site has little
effect on FlpA binding.
Attempts were made to increase the affinity of FlpA for
DNA by the addition of various types of coeffector known
to modulate the activity of other members of the CRP
family. Metal ions, cyclic nucleotide monophosphates,
reducing agents (DTT added to the sample anaerobically)
and cell-free extracts from L. lactis MG1363 were added
to band-shift reactions, but all failed to significantly
improve the efficiency of DNA binding by FlpA, although
a small, but reproducible enhancement was evident upon
addition of cGMP (data not shown).
The DNA recognition helices of FNR and Flp proteins
contain the E± ±SR motif but there are two significant
differences (Fig. 4). Valine 208 in FNR is replaced by a P
residue at the equivalent position in FlpA/B, and G216 in
FNR is replaced by a positively charged residue in FlpA/B
(K in FLP and FlpB, and R in FlpA). Because FlpA could
bind at an FNR site it was predicted that FNR variants with
these substitutions may have a reduced affinity for, but
should still recognize, the FNR target sequence. There-
fore, the FNR DNA binding helix was modified to carry a
V208P substitution, a G216K substitution, or both. The
ability to activate transcription from an FNR-driven
promoter was tested by b-galactosidase assay. The
FNR-V208P variant was capable of activating expression
from the FNR-dependent FF-41.5pmelR promoter
although at reduced levels (4120 Miller units) compared
with FNR (6990 Miller units). Therefore, the presence of P
at the beginning of the DNA binding helix of the Flp
proteins is not sufficient to prevent, but does impair,
recognition of an FNR site consistent with the lower affinity
of FlpA for an FNR site compared with FNR itself.
FNR variants containing the G216K substitution (FNR-
G216K and FNR-V208P,G216K) proved to be insoluble
(as judged by Western blotting) and as such were
incapable of activating transcription (data not shown).
Therefore, based on the data presented here for both FlpA
and the FNR variants, it seems clear that FlpA recognizes
an FNR site.
Recognition of target DNA by FNR is dramatically
enhanced by acquisition of a [4Fe 4S] cluster
(Khoroshilova et al., 1995; Jordan et al., 1997). However,
while unreconstituted FlpA bound target DNA, albeit with
low affinity (see above) rather than increasing affinity for a
FNR site, incorporation of an iron±sulphur cluster into
FlpA abolished DNA binding (Fig. 5). However, DNA
binding was restored after destruction of the [4Fe 4S]
Fig. 4. The interactions of CRP and theproposed interactions of FNR, FLP, FlpAand FlpB proteins with their respective DNAtargets. The DNA recognition helices ofCRP, FNR and Flp proteins are shown inhelical wheel format numbered from thefirst residue of the helix.A. The core interactions between Glu atposition 2 and Arg at position 6 with theconserved C±G and T±A base pairs of theFNR and CRP sites are shown. Theproposed discriminatory interactionsbetween Ser at position 5 and the A±Tbase pair of the FNR site and the Arg atposition 1 and the C±G base pair of theCRP site are also indicated.B. Comparison of the amino acidsequences of the DNA binding helices ofthe Flp proteins. The Glu, Arg and Serresidues that are proposed to be involved inFNR site recognition are indicated (italics).The Pro residue at position 1 that ispresent in all the Flp proteins and a CRP-like positively charged residue (Lys or Arg)at position nine are boxed.
1388 The FlpA protein of L: lactis
Q 2000 Blackwell Science Ltd, Molecular Microbiology, 35, 1383±1393
cluster by exposure to air. Thus, the incorporation/loss of
the iron±sulphur cluster constitutes an in vitro switch for
FlpA that operates in the opposite direction to that of FNR.
Flp proteins can activate gene expression in E. coli
The in vitro data obtained for FlpA suggested that it may
sense oxygen via an iron±sulphur cluster, active in the
absence of the cluster (aerobic) and inactive upon cluster
acquisition (anaerobic) via binding to an FNR site.
Therefore, a strain of E. coli lacking FNR, expressing
either flpA or flpB from a plasmid, and containing an
FNR-dependent lac reporter should allow Flp function to
be tested in vivo. Two ptac85 derivatives carrying flpA
(pGS1115) or flpB (pGS1149) were created to facilitate
IPTG-inducible expression of the Flp proteins in E. coli
strain JRG1728 (Dfnr) carrying lac reporter plasmids in
which the activating FNR site is positioned at 241.5 (Class
II promoter, pRW5/FF-41.5pmelR); 261.5 (Class I
promoter, pRW5/FF-61.5pmelR); or 271.5 (Class I,
pRW5/FF-71.5pmelR). The activity of b-galactosidase
estimated for both aerobic and anaerobic cultures expres-
sing either flpA, flpB or neither (empty ptac85 vector
control) were not significantly different when the FNR site
was positioned at 241.5 or at 271.5, indicating that the Flp
proteins were unable to activate transcription from these
promoters in E. coli (Table 2). However, a five- to
sevenfold increase in b-galactosidase activity was
observed when the Flp proteins were tested against the
FF-61.5pmelR promoter, indicating that FlpA can be active
in E. coli provided the FNR site is centred at 261.5.
Attempts to reproduce in vivo the oxygen-mediated
FlpA switch observed in vitro were unsuccessful. FlpA or
FlpB driven expression from the FF-61.5pmelR promoter
was similar for both aerobic and anaerobic cultures, nor
was it affected by the addition of hydrogen peroxide, or
cAMP, or the membrane permeable cGMP homologue
8-bromo-cGMP (data not shown).
Discussion
At the outset of this work it was expected that the Flp
proteins of L. lactis would respond to oxidative stress via
the formation of an intramolecular disulphide bond and
recognize an FLP site. However, the inability of FlpA to
form an intramolecular disulphide bond indicates that FlpA
cannot independently operate as an FLP-type redox
sensor (Gostick et al., 1998). It is possible that other
factors (perhaps the products of the other genes orfX and
orfY of the flpA operon) may be required for the oxidation
of FlpA, but it is clear that E. coli contains no analogue of
such a factor. The Zn binding chaperone Hsp33 responds
to oxidative stress via the formation of intramolecular
disulphide bonds (Jakob et al., 1999). The coordination of
Zn by the reactive cysteine sulphydryls is thought to
prevent disulphide bond formation under normal redox
conditions (Aslund and Beckwith, 1999). The Zn asso-
ciated with FlpA may play a similar role, although
treatment with EDTA did not facilitate the formation of a
FlpA disulphide.
In vitro assembly of an iron±sulphur cluster in FlpA
raises a number of questions because each FlpA
monomer has only two cysteine residues to act as ligands
for the cluster. Although the exact identity of the non-
cysteinyl ligands is unknown, it is likely that they are
located within the first 14 amino acids of FlpA. This region
Fig. 5. Cluster mediated switching of DNA binding by GST±FlpA. The effect of iron±sulphur cluster acquisition on the ability of GST±FlpA tobind at the yfiD promoter was assessed by band-shift analyses. Anaerobic incubations containing decreasing concentrations of GST±FlpA(lanes: 2, 6 and 10, 10 mM; 3, 7 and 11, 5 mM; 4, 8 and 12, 2 mM; 5, 9 and 13, 1 mM). The proteins used were: unreconstituted GST±FlpA(lanes 2±5); reconstituted GST±FlpA (lanes 6±9); and reconstituted GST±FlpA that had been exposed to air for 30 min (lanes 10±13). Lane 1contains yfiD DNA alone. The positions of the free DNA and GST±FlpA:DNA complexes are indicated.
Table 2. FlpA-dependent transcription activation in vivo.
b-Galactosidase activity (Miller units)
FF-71.5pmelR FF-61.5pmelR FF-41.5pmelR
Aerobic Anoxic Aerobic Anoxic Aerobic Anoxic
RegulatorFlpA 68.5 65.6 226.5 186.9 139.9 99.2
(9.1) (6.2) (13.9) (10.9) (3.8) (16.8)
FlpB 97.4 58.1 287.6 195.4 110.4 101.3(11.7) (3.5) (14.3) (9.2) (19.4) (10.2)
No regulator 72.0 61.2 41.2 23.3 127.8 97.1(3.0) (5.8) (2.4) (2.4) (14.7) (16.5)
b-Galactosidase activities (Miller units) expressed from plasmidscontaining model Class I (FF-61.5pmelR and FF-71.5pmelR) or ClassII (FF-41.5pmelR) promoters upstream of a promoterless lac operonin E. coli strain JRG1728(Dfnr) expressing either flpA, flpB, fnr,fnrV208P or no regulator. Aerobic and anoxic cultures were assayedduring the exponential phase of the growth cycle. The values quotedare from duplicate measurements of three independent cultures.Figures in parentheses are the standard deviations.
C. Scott, J. R. Guest and J. Green 1389
Q 2000 Blackwell Science Ltd, Molecular Microbiology, 35, 1383±1393
contains three histidine, three aspartate and a glutamate
residue, any of which may be involved in iron coordination
(Fig. 6). It is also possible that at least one ligand could be
contributed by an external thiol (Jung et al., 1996), such
as the dithiothreitol present in the reconstitution reaction
or from GST. However, if this were the case, it might be
expected that the GST±FlpA 0 protein would acquire a
cluster and that isolated FlpA would not and not vice
versa. The influence of the non-cysteinyl ligands on the
properties of the FlpA cluster is manifest in a relatively low
1420 compared with a conventional [4Fe 4S] cluster and
increased oxygen stability compared with FNR. The
enhanced stability of the [4Fe 4S] cluster of FNRL28H
(Khoroshilova et al., 1995) may be specifically due to the
presence of H28. These observations may indicate that
[4Fe 4S] clusters with non-cysteinyl ligands are more
stable than all C liganded clusters.
An iron±sulphur cluster can not be assembled in the
FLP of L. casei, which may be because FLP lacks all but
one of the N-terminal histidine residues of FlpA and so
lacks sufficient ligands to form the cluster. Accordingly
altering the N-terminal region of FlpA to make the protein
(FlpA 0) more FLP-like prevented anaerobic incorporation
of an iron±sulphur cluster but allowed the formation of an
intramolecular disulphide bond. Thus, this simple example
of protein engineering (deletion of 11 N-terminal amino
acids and substitution of D12, H13 and H14) converts
FlpA from a protein with an oxygen-labile FNR-like [4Fe
4S] cluster to one resembling FLP capable of operating a
disulphide±dithiol switch poised close to that of the FLP of
L. casei. Therefore, by gaining or losing N-terminal iron±
sulphur cluster ligands, different mechanisms can be
adopted by FlpA and FLP to sense changes in redox state
in vitro.
Although FlpA can acquire an iron±sulphur cluster in
vitro this does not necessarily reflect the situation in vivo,
especially when it is recalled that lactic acid bacteria do
not require iron to grow, although at least one example of
an iron±sulphur containing protein is known in L. lactis
(Rowland et al., 1997). Attempts to reproduce the in vitro
oxygen responsive FlpA switch in E. coli were unsuccess-
ful because although FlpA (and FlpB) could drive lac
expression from a Class I FNR-dependent promoter there
was no reduction in b-galactosidase activity in anaerobic
cultures. This indicates that the iron±sulphur cluster is not
assembled in E. coli, particularly as FlpA isolated from E.
coli is associated with Zn and Cu which may act to block
cluster assembly in vivo much as the Zn in Hsp33
prevents disulphide bond formation (Aslund and
Beckwith, 1999). Alternatively, the in vivo switch may not
operate by cluster assembly disassembly but by oxidation
reduction and that a suitable electron donor/acceptor may
not be present in E. coli. It is clear from previous work that
FlpA is involved in the response of L. lactis to oxidative
stress by hydrogen peroxide (Gostick et al., 1999) but
whether this stress is sensed by an FlpA [4Fe 4S] cluster is
not yet established. Once more these observations
suggest that the proteins encoded by the additional
genes of the L. lactis flp operons (orfX and orfY) may be
required for activating/deactivating FlpA in vivo and in
order to model the FlpA switch expression of the whole
operon may be necessary (Gostick et al., 1999).
A further constraint on the ability to observe an
FlpA-mediated switch in E. coli is the interaction between
the host RNA polymerase and the heterologous regulator.
The FlpA/B proteins were able to activate transcription
from a Class I but not a Class II promoter in E. coli.
However, in L. lactis expression of the flpB operon is
driven from a Class II promoter (Gostick et al., 1999). This
suggests that Flp proteins are adapted to the much smaller
s70 of L. lactis (GenBank accession no. X71493). This
suggestion is supported by the lack of conservation of the
FNR Activating Region 3 (AR3) determinant D86 (Ralph
et al., 1998) in Flp proteins. The CRP adopts a different
strategy to activate transcription from Class II promoters
by using AR2 and aNTD. Only one of the amino acids that
form the AR2 of CRP (Rhodius et al., 1997) is conserved in
FlpA and FlpB (none are conserved in FLP). Thus, the lack
of an effective AR2 or AR3 contact could account for the
lack of Flp activity at E. coli Class II promoters. A small
Fig. 6. Comparison of the N-terminalregions of the Flp proteins with othermembers of the CRP family and the FNR*protein FNRL28H. The sequences are:DNR (Pseudomonas aeruginosa); DnrD,DnrE and DnrS (Pseudomonas stutzeri);FlpA and FlpB (L. lactis); FLP(Lactobacillus casei); FnrL (Rhodobactersphaeroides); and FnrP (Paracoccusdenitrificans). Also included are: FNRL28H(an E. coli FNR variant, Kiley and Reznikof,1991); and the FlpA(protein generated inthis work). Potential metal ion ligands areboldfaced.
1390 The FlpA protein of L: lactis
Q 2000 Blackwell Science Ltd, Molecular Microbiology, 35, 1383±1393
region (AR1) of CRP centred around H159 is required for
regulation of Class I promoters (Savery et al., 1996).
However, the FNR AR1is much larger extending along the
whole of one face of the molecule. The pattern of
transcription activation observed with FlpA and FlpB
suggests that they share the extensive AR1 of FNR
permitting expression from the Class I promoter FF-
61.5pmelR in E. coli.
That FlpA recognizes an FNR site was unexpected, as
FLP interacts with a palindrome different from, but related
to, that of the consensus FNR binding site (Gostick et al.,
1998). Altering the FNR DNA-binding helix (aF) so that it
more closely resembled that of the Flp regulators was not
sufficient to alter target specificity, suggesting that there
are amino acids outside the DNA binding helices that are
involved in determining site specificity and binding affinity.
The unusual DNA recognition properties of FLP from L.
casei may not be unique. Paracoccus denitrificans has
two FNR homologues, FnrP and NNR, with distinct and
non-overlapping roles in respiratory adaptation that are
predicted to recognize FNR sites on the basis of
sequence similarity (van Spanning et al., 1997). The
lack of cross-talk between NNR and FnrP could result
from a similar differentiation in binding specificity/affinity to
that evident between FNR, FLP and FlpA, and the
presence of a P residue at the start of the NNR DNA
binding helix may suggest that this residue is required for
altering DNA target recognition, although from the data
presented here it is not sufficient. Comparing the DNA-
binding specificities of FNR, FLP and FlpA clearly
Table 3. E. coli strains, phages and plasmids.
Strain, phage orplasmid Relevant characteristics Source or reference
JRG1728 Dlac x74 D(araA±leu) D(tyrR±fnr±rac±trg)17zdd-230::Tn9
Spiro and Guest (1987)
DH5a_ D(argF-lac)U169 (F80±lacZM15) recA Sambrook et al. (1989)BL21 F2 ompT rB
2 mB2 Novagen
JRG3506 DH5a(pGS1021) This workJRG3507 BL21 (pGS1021) This workJRG3900 BL21 (pGS1289) This workJRG3800 JRG1728 (pRW5/FF-41.5) (ptac85) This workJRG2844 JRG1728 (pRW5/FF-71.5) (ptac85) This workJRG2855 JRG1728 (pRW5/FF-61.5) (ptac85) This workJRG3402 JRG1728 (pRW5/FF-41.5) (pGS330) This workJRG4128 JRG1728 (pRW5/FF-41.5) (pGS1161) This workJRG4129 JRG1728 (pRW5/FF-41.5) (pGS1162) This workJRG4130 JRG1728 (pRW5/FF-41.5) (pGS1266) This workJRG3801 JRG1728 (pRW5/FF-41.5) (pGS1115) This workJRG3919 JRG1728 (pRW5/FF-71.5) (pGS1115) This workJRG3921 JRG1728 (pRW5/FF-61.5) (pGS1115) This workJRG3902 JRG1728 (pRW5/FF-41.5) (pGS1149) This workJRG3920 JRG1728 (pRW5/FF-71.5) (pGS1149) This workJRG3922 JRG1728 (pRW5/FF-61.5) (pGS1149) This workf115c l-zap carrying the flpA operon and flanking region Gostick et al. (1999)pGEX±KG GST-fusion expression vector, ApR Amersham-Pharmaciaptac85 Expression vector, ApR Marsh (1986)pGS330 ptac85 containing the fnr coding region Green et al. (1991)pGS652 pUC118 containing the FFmelR semisynthetic promoter, ApR Gostick et al. (1998)pGS1021 pGEX±KG derivative with the flpA coding region,
ApRThis work
pGS1035 pET16b derivative with the flpA coding region, ApR This workpGS1063 pUC118 containing the modified yfiD promoter with
a single FNR binding site (Y2), ApRGreen et al. (1998)
pGS1115pGS1149pGS1161
ptac85 derivative with the flpA coding region, ApR
ptac85 derivative with the flpB coding region, ApR
ptac85 containing the fnr coding region encoding theV208P FNR variant, ApR
This workThis workThis work
pGS1162 As pGS1161 but encoding the G216K variant FNR This workpGS1266 As pGS1161 but encoding FNR V208P G216K This workpGS1289 pGEX±KG derivative with an altered flpA encoding
FlpA 0that lacks 11-terminal amino acids and containsD12 M, H13D and H14 l substitutions, ApR
This work
pRW5/FF-41.5 FF-41.5pmelR±lac operon fusion in low copy. ColE1compatible, broad host range vector, with consensusFNR site centred at 241.5, TcR
Lodge et al. (1990)
pRW5/FF-61.5 As pRW5/FF-41.5, but with FNR site centred at 261.5, TcR Wing et al. (1995)pRW5/FF-71.5 As pRW5/FF-41.5, but with FNR site centred at 271.5, TcR Wing et al. (1995)
C. Scott, J. R. Guest and J. Green 1391
Q 2000 Blackwell Science Ltd, Molecular Microbiology, 35, 1383±1393
illustrates the pitfalls in attempting to predict DNA targets
on the basis of amino acid sequence.
The characterization of the lactococcal Flp regulators
described demonstrates the inherent flexibility of the basic
CRP structure to accommodate a variety of sensory
domains and how DNA recognition must be influenced by
amino acid residues outside the DNA binding helix. The
ability of FlpA to acquire an oxygen-labile iron±sulphur
cluster despite retaining only two of the four essential
cysteine residues of typical FNR proteins indicates that
the FNR coordination pattern is not the only competent
one. FNR-like proteins such as DNR (Pseudomonas
aeruginosa) FnrP (Paracoccus denitrificans) and FnrL
(Rhodobacter sphaeroides) that have histidine rich
N-terminal regions but either lack or have altered
arrangements of cysteine residues may use histidine
ligands to coordinate iron±sulphur clusters with altered
redox properties and switch points (Fig. 6).
Thus, while many questions remain concerning the
physiological role of Flp regulators in lactic acid bacteria
the in vitro characterization of FlpA has revealed a
number intriguing features that merit further investigation
to provide new insights into both transcription regulation in
lactic acid bacteria and the CRP family of transcription
factors.
Experimental procedures
Bacterial strains, plasmids and microbiological methods
The bacterial strains, phages and plasmids used in this workare summarized in Table 3. E. coli strains were grown in Lmedium (Lennox, 1955) at 378C. Media were supplementedwith ampicillin (20 mg ml21), tetracycline (35 mg ml21) andisopropyl-b-D-thiogalactoside (IPTG, 30 mg ml21) as appro-priate. Aerobic cultures were grown either in 100 ml, 250 mlor 2000 ml flasks and shaken at 250 r.p.m. Anaerobiccultures were grown in anaerobic gas jars (Oxoid) andsupplemented with glucose (0.2%). Transcriptional activationwas analysed in vivo by estimating b-galactosidase produc-tion by the method of Miller (1972).
Standard methods for the manipulation of DNA werefollowed (Sambrook et al., 1989). The flpA gene wasamplified and isolated as a 750 bp product from the flpAoperon of L. lactis by PCR using the l-phage F115C as thetemplate and primers S540 (GATTGGATCCCCATGGAGAT-TAAAGATTTTGATGAGCATTTAAGTG) and S541 (TTTCTGCAGTCGACTAATTTCTCCCAATCCCCCAGTTTAC) containingunique NcoI and SalI restriction sites (underlined) to facilitatecloning into the expression vector pGEX-KG. The resultantplasmid (pGS1021) was transformed into DH5a(JRG3506) andthen transferred into BL21 (JRG3507). The latter strain wasused for expression because of its protease deficientphenotype (Table 3).
An FlpA variant (FlpA 0) that lacks 11 N-terminal aminoacids and contains the substitutions D12M, H13D and H14L(numbering as for FlpA) and thus retains both cysteine
residues but lacks the three N-terminal histidine residues ofFlpA was encoded by pGS1289. This plasmid was created bya two-step PCR using the following mutagenic primers(mismatches in lower case): S573, CATTAAAccatCCAC-CATTGTATCCAG; and S574, CATTAAACCATggACCtTTG-TATCCAG.
The ptac85 derivatives used in the investigation of FlpAand FlpB function in vivo were constructed by subcloning theNcoI/SalI fragment from pGS1021 to create the flpAexpression plasmid, pGS1115, and by cloning a PCR productcontaining the flpB coding sequence amplified from L. lactisssp. cremoris MG1363 genomic DNA using the primers S562(GAGAATCCCCACCATGGGTAG) and S563 (GGTTTTAGCTGATGTCGACAT) containing unique NcoI and SalI sites(underlined) to create pGS1149 (Table 3).
The singly mutated fnr variants were made by site-directedmutagenesis using oligonucleotides directing the desiredcodon changes according to the AlteredSites protocol(Promega) followed by subcloning into ptac85. The doubleFNR variant, V208P, G216K (pGS1266) was created by PCRand subcloning into ptac85 (Table 3). Automated DNAsequencing was used to confirm the desired codon altera-tions had been made.
GST±FlpA overexpression and purification
FlpA was amplified as a GST±FlpA fusion in E. coliJRG3507. Aerobic cultures (500 ml) were grown at 378C toan A600 0.2±0.3. At this point expression was induced by theaddition of IPTG (30 mg ml21) and incubation was continueduntil the cultures reached A600 1 ^ 0.1. The bacteria werethen collected by centrifugation and used immediately orstored at 2208C.
Clarified cell-free extracts were produced by resuspendingthe bacteria in 10 mM Tris±HCl (pH 8.0) containing 10 mMNaCl (10 ml l21 of original culture), lysis by two passagesthrough French pressure cell, followed by centrifugation. TheGST±FlpA fusion protein was adsorbed onto a column(1 ml l21 of culture) of GSH-Sepharose (Amersham-Pharma-cia) equilibrated with the resuspension buffer. The FlpA wasthen eluted either as a GST fusion, by washing withresuspension buffer containing 10 mM glutathione (pH 8´0),or as FlpA by incubation at 258C with thrombin (25 units) andsubsequent elution in resuspension buffer. The FlpA variantFlpA 0 was isolated by essentially the same procedure exceptthat induction by IPTG (200 mg ml21) was carried out at 258C.
Protein analysis
Protein concentration was estimated using the Bio-Rad proteinassay, using bovine serum albumin as standard. Proteinpurity was assessed by SDS±PAGE (Laemmli, 1970) andstaining with Coomassie brilliant blue. The oligomeric stateof FlpA was determined by gel filtration, using a calibrated(protein standards: BSA, 67 000; ovalbumin, 43 000; chymo-trypsinogen, 25 000; and ribonuclease A, 13 700) SephacrylS-200 column equilibrated with 10 mM Tris±HCl, 10 mMNaCl pH 8.0. Metal ion content was estimated by ICP-massspectroscopy of FlpA that had been samples dialysed
1392 The FlpA protein of L: lactis
Q 2000 Blackwell Science Ltd, Molecular Microbiology, 35, 1383±1393
against10 mM EDTA to remove adventitious metals. Thedialysis buffer was used as a blank.
Purified FlpA was tested for the presence of a disulphidebond by SDS±PAGE fractionation under non-reducing,reducing and oxidizing conditions (Green and Guest, 1993).Free thiol content was determined by sulphydryl grouptitration as described Thelander (1973).
Western blotting with anti-FNR serum (Spiro and Guest,1987) was used to assess the cellular location and content ofthe FNR variants with substitutions in their DNA-bindinghelices.
Iron±sulphur centre reconstitution and analysis
An iron±sulphur cluster was assembled in GST±FlpA(. 1 mg ml21) under anaerobic reducing conditions asdescribed for FNR (Green et al., 1996) in stoppered 1 mlmatched quartz curettes, and cluster formation was mon-itored by optical spectroscopy using a Unicam UV4 UV/VISspectrometer. After reconstitution, unincorporated iron,cysteine and DTT were separated from FlpA by anaerobicchromatography on Sephadex G25.
Iron content and acid labile sulphur were analysed asdescribed (Beinert, 1983; Woodland and Dalton, 1984).Stability to oxygen was analysed by exposing desalted FlpAto air and following the changes in absorbance over a periodof 45 min. All anaerobic manipulations were carried out in ananaerobic workstation (Don Whitley Scientific Mk3).
DNA binding and site recognition
DNA binding in vitro was tested by band-shift analysis on 6%non-denaturing TBE-buffered PAGE, using radiolabelledyfiD, FF, CC, NNmelR, flpA operon promoter DNA or FLPtest site A DNA (Gostick et al., 1998). Co-incubation of FlpAprotein and probe was permitted for < 1 min before loading.All band-shift experiments were carried out at least twice.
Acknowledgements
We would like to thank: Dr A. J. G. Moir (Sheffield) for DNA and
amino acid sequencing; Mr A. Cox (Sheffield) for ICP mass
spectroscopy. This work has been supported by postgraduate
studentship (CS) and Advanced Fellowship (JG) awards from the
BBSRC.
References
Aslund, F., and Beckwith, J. (1999) Bridge over troubled waters:sensing stress by disulfide bond formation. Cell 96: 751±753.
Beinert, H. (1983) Semi-micro methods for analysis of labilesulfide and for labile sulfide plus sulfane sulfur in unusually
stable iron-sulfur proteins. Anal Biochem 131: 373±378.
Fee, J.A., Findling, K.L., Yoshida, T., Hille, R., Tarr, G.E.,
Hearshen, D.O., et al. (1984) Purification and characterization
of the Rieske iron-sulfur protein from Thermus thermophilus. JBiol Chem 259: 124±133.
Gasson, M.J. (1993) Progress and potential in the biotechnologyof lactic acid bacteria. FEMS Microbiol Rev 12: 3±20.
Gostick, D.O., Green, J., Irvine, A.S., Gasson, M.J., and Guest,
J.R. (1998) A novel regulatory switch mediated by the FNR-likeprotein of Lactobacillus casei. Microbiology 144: 705±717.
Gostick, D.O., Griffin, H.G., Shearman, C.A., Scott, C., Green, J.,
Gasson, M.J., et al. (1999) Two operons that encode FNR-like
proteins in Lactococcus lactis. Mol Microbiol 31: 1523±1535.
Green, J., and Baldwin, M.L. (1997) HlyX, the FNR homologue ofActinobacillus pleuropneumoniae, is a [4Fe 4S]-containing
oxygen-responsive transcription regulator that anaerobically
activates FNR-dependent Class I promoters via an enhanced
AR1-contact. Mol Microbiol 24: 593±605.
Green, J., Baldwin, M.L., and Richardson, J. (1998) Down-
regulation of Escherichia coli yfiD expression by FNR occupy-
ing a site at -93.5 involves the AR1-containing face of FNR. Mol
Microbiol 29: 1113±1123.
Green, J., Bennett, B., Jordan, P., Ralph, E.T., Thompson, A.J.,and Guest, J.R. (1996) Reconstitution of the [4Fe-4S] cluster in
FNR and demonstration of the aerobic-anaerobic switch in
vitro. Biochem J 316: 887±892.
Green, J., and Guest, J.R. (1993) Properties of FNR proteinssubstituted at each of the five cysteine residues. Mol Microbiol
8: 61±68.
Green, J., Trageser, M., Six, S., Unden, G., and Guest, J.R.
(1991) Characterisation of the FNR protein of Escherichia coli,an iron binding transcription regulator. Proc R Soc Lond Ser B
244: 137±144.
Irvine, A.S., and Guest, J.R. (1993) Lactobacillus casei contains
a member of the CRP-FNR family. Nucleic Acid Res 21: 753.
Jakob, U., Muse, W., Eser, M., and Bardwell, J.C.A. (1999)Chaperone activity with a redox switch. Cell 96: 341±352.
Jordan, P.A., Thompson, A.J., Ralph, E.T., Guest, J.R., and
Green, J. (1997) FNR is a direct oxygen sensor having a
biphasic response curve. FEBS Lett 416: 349±352.
Jung, Y.S., Vassiliev, I.R., Qiao, F., Yang, F., Bryant, D.A., andGoldbeck, J.H. (1996) Modified ligands to FA and FB in
photosystem I. J Biol Chem 271: 31135±31144.
Khoroshilova, N., Beinert, H., and Kiley, P.J. (1995) Association
of a polynuclear iron-sulfur center with a mutant FNR proteinenhances DNA-binding. Proc Natl Acad Sci USA 92: 2499±
2505.
Kiley, P.J., and Reznikof, W.S. (1991) Fnr mutants that activate
gene expression in the presence of oxygen. J Bacteriol 173:
16±22.
Laemmli, U.K. (1970) Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature 277: 680±
685.
Lennox, E.S. (1955) Transduction of linked genetic characters of
host by bacteriophage P1. Virology 1: 190±206.
Lodge, J., Williams, R., Bell, A., Chan, B., and Busby, S. (1990)
Comparison of promoter activities in Escherichia coli and
Pseudomonas aeruginosa-use of a new broad range promoter
probe plasmid. FEMS Microbiol Lett 67: 221±225.
Marsh, P. (1986) ptac85, an Escherichia coli vector for expres-sion of non-fusion proteins. Nucleic Acids Res 14: 3603.
Miller, J.H. (1972) Experiments in Molecular Genetics. Cold
Spring Harbor, NY: Cold Spring, Harbor Laboratory Press.
Popescu, C.V., Bates, D.M., Beinert, H., Munck, E., and Kiley,P.J. (1998) Mossbauer spectroscopy as a tool for the study of
activation/inactivation of the transcription regulator FNR in
whole cells of Escherichia coli. Proc Natl Acad Sci USA 95:
13431±13435.
Ralph, E.T., Guest, J.R., and Green, J. (1998) Altering theanaerobic transcription factor FNR confers a hemolytic
phenotype on Escherichia coli K12. Proc Natl Acad Sci USA
95: 10449±10452.
C. Scott, J. R. Guest and J. Green 1393
Q 2000 Blackwell Science Ltd, Molecular Microbiology, 35, 1383±1393
Rhodius, V.A., West, D.M., Webster, C.L., Busby, S.J.W., andSavery, N.J. (1997) Transcription activation at Class II CRP-
dependent promoters: The role of different activating regions.
Nucleic Acids Res 25: 326±332.
Rowland, P., Nielsen, F.S., Jensen, K.F., and Larsen, S. (1997)
Crystallization and preliminary X-ray analysis of the hetero-
dimeric dihydrooratase dehydrogenase B of Lactococcus
lactis, a flavoprotein enzyme system consisting of two PyrDBsubunits and two iron-sulphur cluster containing PyrK subunits.
Acta Cryst 53: 802±804.
Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecular
Cloning: a Laboratory Manual, 2nd Edn. Cold Spring Harbor,NY: Cold Spring, Harbor Laboratory Press.
Savery, N., Rhodius, V., and Busby, S. (1996) Protein±protein
interactions during transcription activation: the case of theEscherichia coli cyclic AMP receptor protein. Phil Trans R Soc
Lond B 351: 543±550.
van Spanning, R.J.M., De Boer, A.P.N., Reijnders, W.N.M.,Westerhoff, H.V., Stouthamer, A.H., and Van Der Oost, J.
(1997) FnrP and NNR of Paracoccus denitrificans are bothmembers of the FNR family of transcriptional activators but
have distinct roles in respiratory adaptation in response to
oxygen limitation. Mol Microbiol 23: 893±907.
Spiro, S., and Guest, J.R. (1987) Regulation and over-expressionof the fnr gene of Escherichia coli. J Gen Microbiol 133: 3279±
3288.
Thelander, L. (1973) Physicochemical characterisation of ribo-nucleoside diphosphate reductase from Escherichia coli. J Biol
Chem 248: 4591±4601.
Wing, H.J., Williams, S.M., and Busby, S.J.W. (1995) Spacing
requirements for transcription activation by Escherichia coliFNR protein. J Bacteriol 177: 6704±6710.
Woodland, M.P., and Dalton, H. (1984) Purification and proper-
ties of component A of the methane monooxygenase of
Methylococcus capsulatus (Bath). J Biol Chem 259: 53±59.Zheng, M., Aslund, F., and Storz, G. (1998) Activation of the
OxyR transcription factor by reversible disulfide bond forma-
tion. Science 279: 1718±1721.
Recommended