View
0
Download
0
Category
Preview:
Citation preview
UNC Chapel HillCenter of Excellence for Eating Disorders
Cynthia Bulik, PhD, FAED
Karolinska InstitutetCentre for Eating Disorders Innovation
Changing the Way The World Thinks About Eating Disorders
@cbulik
Photo: Ruth Gwilly
Disclosures
▪ Shire Pharmaceuticals (consultant; advisory board)
▪ Idorsia (consultant)
▪ Pearson (author)
Gratitude
Everything you have ever learned about eating disorders is probably wrong
Misinformation:
• Harms patients and families
• Stunts science
• Hinders treatment
Photo by Kris Sikes
“The first problem for all of us, men and women, is not to learn, but to unlearn.”
Ms. Gloria Steinemhttps://commons.wikimedia.org/wiki/File%3AGloria_Steinem_(29715822936).jpg
Failure to Unlearn
Measles is back and killing people around the world
Topography of Feeding and Eating Disorders (DSM-5)
• Anorexia Nervosa (0.9% F 0.3% M)– Low Weight
– Intense fear of weight gain
– Inability to recognize seriousness of low weight
• Bulimia Nervosa (1.5% F 0.5% M)
– Binge eating
– Regular compensatory behaviors
– Normal, overweight, obese
• Binge-Eating Disorder (3.5% F 2.0% M)
– Binge eating
– No regular compensatory behaviors
– Distress
– Often overweight/obese
• Avoidant and Restrictive Food Intake Disorder (ARFID)(M>F?)– Feeding disturbance, refusal, fear
– Nutritional deficiencies
– Weight loss or failure to gain
• Most common age of onset is adolescence, but can
strike at any age
• Does not discriminate—all genders, races, ethnicities,
socioeconomic backgrounds!
• Highest mortality rate of any psychiatric disorder (only
recently surpassed by opioid-related deaths)
• Standardized mortality ratio 6-10
• Third most common chronic illness amongst
adolescents
• 20% severe and chronic course
• Only ~30% fully recover
• NO EFFECTIVE MEDICATIONS
Anorexia nervosa has high mortality and poor outcome
Associated Features
▪ Electrolyte imbalances
▪ Cardiac complications
▪ Osteoporosis
▪ Lanugo hair
▪ Low body temperature
▪ Hypotension
▪ Bradycardia
▪ Growth retardation
▪ Obsessionality
▪ Anxiety
▪ Depression
▪ Low self-esteem
▪ Cognitive impairment
Suicide is second most common cause of death in anorexia
Shuyang Yao, PhD
PMID: 26764185
0
1
2
3
4
5
6
7
Death By SuicideC
rud
e O
R
N = 2,268,786
▪ Bodies revert to a
negative settling point
Anorexia nervosa is perplexing!
• Starvation is reinforcing
▪ Fats are aversive ▪ Activity is more reinforcing than food
▪ Perplexing hypermetabolic
period during renourishment
Paradoxical response to negative energy balance
Energy consumed
ExercisePhysical activityRestFidgetingPurging
Energy expended
Defies global BMI trends
What have we been missing?
Why do we care?
Knowledge about eating disorders informs our understanding of many related phenotypes.
Obesity
Physical activity
Major depressive
disorder
Anxiety disorders
Metabolism
Nutrition
Twin-based heritability of AN, BN, BED
Anorexia Nervosa
Bulimia Nervosa
Binge Eating Disorder
.48 - .74
.55 - .62
.39 - .45
GWAS
CANDIDATE GENELINKAGE
Genome-Wide Association Study
(GWAS)
GWAS basics
Variant #1 (C/T)Less common: C
Cases
Controls
Variant #2 (A/G)Less common: G
Cases
Controls
Variant #3
Variant #4
...
CasesCurrent or past AN
ControlsNo history of eating disorders
ATTGGGCGAGTGTTCTAACCCG
ATTGGGTGAGTGTTCTGGCCCG
How to read a Manhattan plot
Chromosome
Significance level
5 x 10 -8
2013: Eating Disorders Working Group of the Psychiatric Genomics Consortium (PGC-ED)
Leipzig, 2017Glasgow, 2018
Anaheim, 2019
PGC-ED unites two consortia
The Price Foundation
2907 AN 14 860 controlsPMID: 24514567
1033 AN3733 controlsPMID: 21079607
+
Molecular Psychiatry
PGC-ED Freeze 1
PMID: 28494655
Laramie Duncan, PhD
3,495 people with AN10,982 people without ANSNP-h2=20%
chr12 (rs4622308)
type 2 diabetesautoimmune illnesses
How do we…
get more cases?PHOTO: Sérgio Valle Duarte
Preben Bo
Mortensen
Nick MartinMikael Landén
Martin Kennedy
Bulik, Sullivan, Thornton
Tracey
Wade
FlindersJenny Jordan
ANGI: Success due to engaged science
• We opened the gates to the ivory tower
• We made clinicians, families, patients, and
advocates our partners in science
• We leveraged the powerful online presence of the
eating disorders area
• We created the ANGI community
ANGI: Closed the US versus THEM gap
NIH Study Section 1958-62
2013 At Home with Eating Disorders, Brisbane, Australia
ANGI: Coordinated multi-channel outreach
Social media
Earned/traditional media
FamiliesClinicians
Advocacy Organizations
Influential bloggers
0
5
10
15
20
25
30
35
40
Pe
rce
nt
of
Pa
rtic
ipa
nts
Recruitment Source
Case Control
ANGI: Internet was most effective for recruitment
Clinic & non-clinic ascertained cases were similar
0
2
4
6
8
10
12
14
16
18
20
Lowest BMI Age at Low Weight
Clinic Non-clinic
PMID: 30287268
DSM-5 AN
Severe/Extreme
83% eating disorder clinics
63% community
ANGI successfully recruited
> 13,000 AN cases and 9,000 controls
in 3 years
PGC-ED Freeze 2
PGC-ED 1+
+
= 16,992 Cases55,525 Controls
3,495 AN10,982 Controls
Composition of GWAS Samples
74%
20%
<6%
33 datasets with
16,992 cases and 55,525 controls
from 17 countries
GWAS Results
8 genome-wide significant hits
Hunna Watson, PhD2019
Nature GeneticsPMID: 31308545
temozolomideresponse
Sjögren’sSyndrome
IBD, ulcerative colitis, Crohn’s, macrophage functions, blood protein levels, obesity-related traits, HDL, Parkinson’s
Age at menarche, obesity, body fatEsophageal adenocarcinoma, Barrett's esophagus, intellectual disabilityBMI
Autoimmune
Metabolic
Neuropsychiatric
Sex hormones
GWAS Results
There’s Valuable Information Below the Red Line!
LD Score Regression
▪ Estimates genetic correlations from published summary statistics
▪ Do not need to measure all of the traits on the same people
▪ Between diseases, “genetic analogue of comorbidity”
PMID: 25642630 Brendan Bulik-Sullivan, PhD
Positive (+)
Negative (-)
- +
Psychiatric, Personality, and Educational Traits
Mirrors clinical observations
-0.25 0.00 +0.25 +0.50
Genetic correlation
-0.25 0.00 +0.25 +0.50Genetic correlation
Physical Activity, Metabolic, & Glycemic Traits
- +
Anthropometric Traits
- +
▪ ALSPAC (N=1,839)
▪ Random-coefficient growth models to describe premorbid BMI trajectories for:
→anorexia nervosa (AN; N=261)
→bulimia nervosa (BN; N=333)
→binge-eating disorder (BED; N=126)
→purging disorder (PD; N=145)
→individuals without an ED (N=1,024)
Early drop from growth curve signals AN
Zeynep Yilmaz, PhD
PMID: 30738546
Males Females
Boys Girls
Anorexia nervosa and obesity may be metabolic mirror images
ObesityAnorexianervosa
Low settling point High settling point
Normalweight
BMI spectrum
Reconceptualizing Anorexia Nervosa as Metabo-Psychiatric
▪ Early divergence from BMI growth curves
▪ Perplexing ability to reach and maintain low BMI
▪ Frequent return to a “negative settling point”
▪ Negative genetic correlations with BMI and other “unfavorable” metabolic parameters
▪ Positive genetic correlations with HDL
▪ Paradoxical reaction to negative energy balance
Genes
Clearly influence risk for AN and genomic discovery is underway and accelerating
BUT, genes don‘t act alone…
Environment
Janne Tidselbak-Larsen
PMID: 29105808
Childhood adversities & eating disorders
• 495,244 Danish women
• Adversities age 0-5
• Increased risk of bulimia & EDNOS
• Unassociated or associated with decreased risk for anorexia
Hospitalization or Treatment with Anti-infectives
▪ Denmark: 525 643 girls born from 1/1/89 to 31/12/2006
▪ Later development of AN, BN, EDNOS
▪ Followed for 4 601 720.4 person-years until a mean age of 16.2 years (10.5-22.7 years)
Lauren Breithaupt, PhDPMID: 31017632
Childhood infection treatment
AN: 22% (HR, 1.22; 95% CI, 1.10-1.35) BN: 35% (HR, 1.35; 95% CI, 1.13-1.60) EDNOS: 39% (HR, 1.39; 95% CI, 1.23-1.57)
AN: 23% (HR, 1.23; 95% CI, 1.10-1.37) BN: 63% (HR, 1.63; 95% CI, 1.32-2.02) EDNOS: 45% (HR, 1.45; 95% CI, 1.25-1.67)
3-month risk window. Inflammation? Microbiome?
Hospitalizations Anti-infective agents
Genes and EnvironmentSweden
DNA
4,000 cases + controls
Denmark
DNA
5,000 cases + controls
Measured GenotypesRegister Linkage
Quality Registers
++
Unprecedented opportunity to model how GENES and ENVIRONMENT act and co-act in eating disorders
National Registers National Registers
Quality Registers
+Clinical records
Environment is important, but more complex than simplistic models
▪ Genomic data make the study of environmental factors more tractable
Critical points to consider
▪ Anorexia nervosa may be best conceptualized as a metabo-psychiatric disorder
▪ Greater attention to metabolic factors may improve outcome
▪ Results may explain why adequate refeeding is essential to preventing relapse
▪ Highly relevant to family-based treatment and inpatient therapeutic renourishment
▪ Setting low target weights and discharging patients prior to re-equilibration of metabolism = high risk for relapse
▪ Individuals with histories of AN should avoid negative energy balance at all costs
We have a massive task ahead
DSM-5 Feeding and Eating Disorders
▪ Anorexia Nervosa (0.9% F 0.3% M)
→ Low Weight
→ Intense fear of weight gain
→ Inability to recognize seriousness of low
weight
▪ Bulimia Nervosa
(1.5% F 0.5% M)→ Binge eating
→ Regular compensatory behaviors
→ Normal, overweight, obese
▪ Binge-Eating Disorder
(3.5% F 2.0% M)→ Binge eating
→ No regular compensatory behaviors
→ Distress
→ Often overweight/obese
▪ Avoidant and Restrictive Food Intake
Disorder (ARFID)(M>F?)
→ Feeding disturbance, refusal, fear
→ Nutritional deficiencies
→ Weight loss or failure to gain
Genes
Microbiota
Deep Phenotyping
Binge Eating Genetics INitiative
N=4000BN or BED
N=1000BN or BED
>900 completed
600 completedVirpi Leppä, PhD Malin Rådström
Next up: Eating Disorders Genetics Initiative (EDGI)
▪ NIMH funding US, Australia, New Zealand, and Denmark
▪ Launching 2020
▪ UK NIHR and charity funding collection in UK/Ireland
▪ Other countries joining
independently (Germany, France, Switzerland, Russia)
▪ GOAL: 100K cases
▪ Expand to bulimia nervosa and binge-eating disorder
EATING DISORDERS WORKING GROUP OF THE PSYCHIATRIC GENOMICS CONSORTIUM
Hunna J Watson PhD, MPsychClin, MBiostats, Zeynep Yilmaz PhD, Laura M Thornton PhD, Christopher Hübel MD, MSc, Jonathan RI Coleman PhD,a,
Julien Bryois PhD, Anke Hinney PhD, Héléna A. Gaspar PhD, Virpi Leppä PhD, Manuel Mattheisen MD, Sarah Medland PhD,b, Stephan Ripke MD, PhD,
Shuyang Yao PhD, Paola Giusti-Rodrìguez, Anorexia Nervosa Genetics Initiative, Ken B. Hanscombe PhD, Kristin L Purves MSc, Eating Disorders
Working Group of the Psychiatric Genomics Consortium (PGC-ED), Roger AH Adan PhD, Lars Alfredsson PhD, Tetsuya Ando MD, PhD, Ole A Andreassen
MD, PhD, Jessica H Baker PhD, Wade H Berrettini MD, PhD, Ilka Boehm PhD, Claudette Boni PhD, Vesna Boraska Perica PhD, Katharina Buehren MD,
PhD, Roland Burghardt MD, Matteo Cassina MD, Sven Cichon PhD, Maurizio Clementi MD, Roger D Cone PhD, Philippe Courtet MD, Scott Crow MD,
James Crowley PhD, Unna N Danner PhD, Oliver S P Davis MSc, PhD, Martina de Zwaan MD, George Dedoussis PhD, Daniela Degortes PhD, Janiece E
DeSocio PhD, RN, PMHNP-BC, Danielle M Dick PhD, Dimitris Dikeos MD, Christian Dina PhD, Monika Dmitrzak-Weglarz PhD, Elisa Docampo Martinez MD,
PhD, Laramie E Duncan PhD, Karin Egberts MD, Stefan Ehrlich MD, Geòrgia Escaramís PhD, Tõnu Esko PhD, Xavier Estivill MD PhD, Anne Farmer MD,
Angela Favaro MD, PhD, Fernando Fernández-Aranda PhD, Manfred M Fichter MD, Dipl-Psych, Krista Fischer PhD, Manuel Föcker MD, Lenka Foretova
MD, PhD, Andreas J Forstner MD, Monica Forzan PhD, Christopher S Franklin PhD, Steven Gallinger MD, Ina Giegling PhD, Johanna Giuranna MSc,
Fragiskos Gonidakis MD, Philip Gorwood MD, PhD, Monica Gratacos Mayora MD, PhD, Sébastien Guillaume MD, PhD, Yiran Guo PhD, Hakon Hakonarson
MD, PhD, Konstantinos Hatzikotoulas MD, PhD, Joanna Hauser MD, PhD, Johannes Hebebrand MD, Sietske G Helder PhD, Stefan Herms MSc, Beate
Herpertz-Dahlmann MD, Wolfgang Herzog MD, Laura M Huckins PhD, James I Hudson MD, ScD, Hartmut Imgart MD, Hidetoshi Inoko PhD, Vladimir
Janout PhD, Susana Jiménez-Murcia PhD, Antonio Julià PhD, Gursharan Kalsi PhD, Deborah Kaminská PhD, Jaakko Kaprio MD, PhD, Leila Karhunen
PhD, Andreas Karwautz MD, Martien J H Kas PhD, James L Kennedy MD, FRCP(C), Anna Keski-Rahkonen MD, PhD, MPH, Kirsty Kiezebrink PhD, FHEA,
RNutr, Youl-Ri Kim MD, PhD, Lars Klareskog MD, Kelly L Klump PhD, Gun Peggy S Knudsen PhD, Maria C La Via MD, Stephanie Le Hellard PhD, Robert D
Levitan MD, Dong Li PhD, Lisa Lilenfeld PhD, Bochao Danae Lin PhD, Jolanta Lissowska PhD, Jurjen Luykx MD, PhD, Pierre Magistretti PhD, Mario Maj
MD, PhD, Katrin Mannik PhD, Sara Marsal MD, PhD, Christian Marshall PhD, Morten Mattingsdal PhD, Sara McDevitt MB, MD, MRCPsych, MMedED, Peter
McGuffin MD, Andres Metspalu PhD, MD, Ingrid Meulenbelt PhD, Nadia Micali MD, PhD, Karen Mitchell PhD, Alessio Maria Monteleone MD, Palmiero
Monteleone MD, Melissa A Munn-Chernoff PhD, Benedetta Nacmias PhD, Marie Navratilova MUDr., PhD, Ioanna Ntalla PhD, Julie K O'Toole MD, Roel A
Ophoff PhD, Leonid Padyukov MD, PhD, Aarno Palotie MD, PhD, Jacques Pantel PhD, Hana Papezova MD, PhD, Dalila Pinto PhD, Raquel Rabionet PhD,
Anu Raevuori MD, PhD, Nicolas Ramoz PhD, Ted Reichborn-Kjennerud MD, PhD, Valdo Ricca MD, Samuli Ripatti PhD, Franziska Ritschel MSc, Marion
Roberts PhD, Alessandro Rotondo MD, Dan Rujescu MD, Filip Rybakowski MD, PhD, Paolo Santonastaso MD, André Scherag PhD, Stephen W Scherer
PhD, FRSC, Ulrike Schmidt MD, PhD, Nicholas J Schork PhD, Alexandra Schosser PhD, Jochen Seitz MD, Lenka Slachtova PhD, P. Eline Slagboom PhD, Margarita C T Slof-Op 't Landt PhD, Agnieszka Slopien MD, PhD, Sandro Sorbi MD, Beata Świątkowska PhD, Jin P Szatkiewicz PhD, Ioanna Tachmazidou
PhD, Elena Tenconi MD, Alfonso Tortorella MD, Federica Tozzi MD, Janet Treasure PhD, FRCP, FRCPsych, Artemis Tsitsika MD, PhD, Marta Tyszkiewicz-
Nwafor MD, PhD, Konstantinos Tziouvas MD, MSc, Annemarie A van Elburg MD, PhD, Eric F van Furth PhD, Gudrun Wagner Dr, MSc, DPO, Esther Walton
Dr. rer. nat., PhD, Elisabeth Widen MD, PhD, Eleftheria Zeggini PhD, Stephanie Zerwas PhD, Stephan Zipfel MD, Andrew W Bergen PhD, Joseph M Boden
PhD, Harry Brandt MD, Steven Crawford MD, Katherine A Halmi MD, L. John Horwood MSc, Craig Johnson PhD, Allan S Kaplan MSc, MD, FRCP(C), Walter
Kaye MD, James Mitchell MD, Catherine M Olsen PhD, MPH, John F Pearson PhD, Nancy L Pedersen PhD, Michael Strober PhD, Thomas Werge PhD,
David C Whiteman MBBS(Hons), PhD, FAFPHM, D. Blake Woodside MD, Garret Stuber, Scott Gordon PhD, Jakob Grove PhD, Anjali K Henders BSc(Hons),
Anders Juréus PhD, Katherine M Kirk PhD, Janne T Larsen MSc, Richard Parker BA(Hons), Liselotte Petersen PhD, Jennifer Jordan PhD, Martin Kennedy
PhD, Grant W Montgomery PhD, Tracey D Wade PhD, Andreas Birgegård PhD, Paul Lichtenstein PhD, Claes Norring PhD, Mikael Landén MD, PhD,
Nicholas G Martin PhD, Preben Mortensen MD, DrMedSc, Patrick F Sullivan MD, FRANZCP, Gerome Breen PhD & Cynthia M Bulik PhD
UNC Center of Excellence for Eating Disorders (CEED)/ National Center of Excellence for Eating Disorders (NCEED)
Karolinska Centre for Eating Disorders Innovation (CEDI)
@cbulik
@PGCgenetics
Take-home points on eating disorders:
• Genes play a role, but do not act alone
• Anorexia nervosa is best described as a metabo-psychiatric illness
• Greater attention to metabolic factors may improve anorexia outcome
• Ongoing work will help us understand how genes and environment influence the other eating disorders as well
Resources:
National Center of Excellence for Eating Disorders
https://www.nceedus.org/
Academy for Eating Disorders
www.aedweb.org
National Eating Disorders Association
https://www.nationaleatingdisorders.org/
F.E.A.S.T.
https://www.feast-ed.org/
Recommended