View
215
Download
0
Category
Tags:
Preview:
Citation preview
Breaking Barriers: getting biologists involved in everyday data integration using Moby Paul Gordon Genome Canada Bioinformatics Platform University of Calgary, Canada Slide 2 Outline concept, usage, future Getting Biologists Involved: Seahawk & Slide 3 DNASequence NCBI_gi Sequence_Alignment Slide 4 Slide 5 Core Moby Service Providers in Europe Slide 6 Founding partner Slide 7 SADI In A Nutshell Slide 8 As OWL Axioms HomologousMutantImage is owl:equivalentTo { Gene Q hasImage image P Gene Q hasSequence Sequence Q Gene R hasSequence Sequence R Sequence Q similarTo Sequence R Gene R = my gene of interest } Slide 9 Mobify the World. Slide 10 Pauls Maxims You cannot get rid of work You can: Distribute work amongst parties with vested interests & required capabilities Avoid redoing the same work repeatedly Slide 11 Agenda Motivation Audience Mechanism Slide 12 Larry Walls Virtues of a Programmer HUBRIS LAZINESSIMPATIENCE Slide 13 Audience God Amoeba Taverna self-starters Willing to take training Capable but no hubris Self-perception of computer skills Slide 14 Slide 15 Mans Prayer Im a man But I can change If I have to I guess Bioinformatician Slide 16 Take the output of the U of C service and send it to iHOP, then send its output to DDBJs service Slide 17 Slide 18 Slide 19 myGRID RDF Slide 20 Semantic Annotations for WSDL Slide 21 bioxml.info Slide 22 MOB Rule Syntax >gi|12434353 glycerol kinase cgatcagcatcgactagcatcgactatttgctatcat cagctacgatcagctacgactac Slide 23 Shared Responsibility Tu deviens responsable pour toujours de ce que tu as apprivois. Service Providers Proxy Provider Third Party Developers Biologists Slide 24 SAWSDL Required Infrastructure Calgary (Sun v240) Calgary Anywhere Compute Cloud (e.g. Calgary or Google App Engine) Slide 25 To Do Formal user studies HTML Form wrapping Enactment portal Biocatalogue? If you can not measure it, you can not improve it. Lord Kelvin Slide 26 Acknowledgements
Recommended