Biotechnology 2007-2008 Recombinant DNA DNA produced by combining DNA from different sources

Preview:

Citation preview

Biotechnology

2007-2008

Recombinant DNA

•DNA produced by combining DNA from different sources

Applications of Recombinant DNA Technology• found in industry, food production, human and veterinary medicine,

agriculture, and bioengineering.• EXAMPLES:

• Recombinant chymosin, is an enzyme required to manufacture cheese. Today about 60% of U.S. hard cheese is made with genetically engineered chymosin.

• Recombinant human insulin almost completely replaced insulin obtained from animal sources (e.g. pigs and cattle) for the treatment of insulin-dependent diabetes.

• Herbicide-resistant crops commercial varieties of important agricultural crops (including soy, maize/corn, sorghum, canola, alfalfa and cotton) have been developed that incorporate a recombinant gene that results in resistance to the herbicide Roundup

Restriction enzymes

• discovered in 1960s• evolved in bacteria to cut up foreign DNA

• Action of enzyme • cut DNA at specific sequences

• restriction site• produces protruding ends

• sticky ends• will bind to any complementary DNA• “restrict” the action of the attacking organism

Sticky ends help glue genes together

TTGTAACGAATTCTACGAATGGTTACATCGCCGAATTCACGCTTAACATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGTGCGAA

gene you want cut sitescut sites

AATGGTTACTTGTAACG AATTCTACGATCGCCGATTCAACGCTTTTACCAATGAACATTGCTTAA GATGCTAGCGGCTAAGTTGCGAA

chromosome want to add gene tocut sites

AATTCTACGAATGGTTACATCGCCG GATGCTTACCAATGTAGCGGCTTAA isolated gene

sticky ends

chromosome with new gene added

TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC

sticky ends stick together

DNA ligase joins the strands Recombinant DNA molecule

Why mix genes together?• Gene produces protein in different organism or different individual

TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC

aa aaaa aa aa aa aa aa aa aa

“new” protein from organism ex: human insulin from bacteria

human insulin gene in bacteria

bacteria human insulin

How can bacteria read human DNA?

Plasmids

•Accessory ring of DNA found in bacteria • Can replicate on quickly and easily in the

bacterial cell• Used as a vector (mechanism that transports the

gene of interest) in genetic engineering

Grow bacteria…make more

growbacteria

harvest (purify)protein

transformedbacteria

plasmid

gene fromother organism

+

recombinantplasmid

vector

•insert recombinant plasmid into bacteria

•grow recombinant bacteria in agar cultures • bacteria make lots of copies of plasmid (accessory DNA in

bacteria)• “cloning” the plasmid

•production of many copies of inserted gene•production of “new” protein

• transformed phenotype

DNA RNA protein trait

Transformation

Genetically Modified Organisms (GMO)• The universal nature of the genetic code makes it possible to

construct organisms that are transgenic, containing genes from other species.

• GM Crops• Larger crops• Resistant to herbicides and insecticides • More nutritious foods

• 92% of soy beans• 86% of cotton• 80% of corn

• GM Animals• Cows – more milk production • Salmon – growth hormones = larger• Pigs – produce more lean meat

Desirable Traits

• Increased yields, more nutritious, quality, etc.,

• More resistant to pestilence, weeds, water and nutrient deprivations,

• Ability to withstand marginal growth conditions,

• and thrive in new environmental ranges,

• Profit!!!!!!!!!!!

Wild tomato

Genome Era Traditional Breeding

Cultivar w/ 1 wild gene replacement

Transgenic Plants

• based on DNA technology,• single genes/traits can be transferred,• species boundaries are not limiting.

How are GMOs generated?

insert into plant

…via biolistics - or - Agrobacterium tumefaceins

...uses tools of molecular genetics,

- i.e. applied bacteria and virus genetics.

Agrobacterium

Plant CellsNature

Ti-Plasmid Transfer-DNA

Hormonegenes

Opinesgenes

Lab

Selectable Markers, etcAny Gene

Out: Ti genes, opine genes,

In: DNA of choice.

T-DNA

Ti: tumor inducing

Plasmid: extrachromosomal DNA evolved for genetic transfer.

Construct T-DNA

infect plant, select for plants with T-DNA

T-DNA (Transfer DNA)

transform, select for agro with T-DNA

Agrobacterium

Plant chromosome with T-DNA insert.

…with gene of interest,

carotene,- herbicide resistance, etc..

Many uses of restriction enzymes…• Now that we can cut DNA with restriction

enzymes…• we can cut up DNA from different people… or different

organisms… and compare it

• Genetic Fingerprinting• forensics• medical diagnostics• paternity• evolutionary relationships • and more…

Comparing cut up DNA•How do we compare DNA fragments?

• separate fragments by size•How do we separate DNA fragments?

• run it through a gelatin• agarose• made from algae

• gel electrophoresis

Gel electrophoresis• A method of separating DNA in a

gelatin-like material using an electrical field

• DNA is negatively charged• when it’s in an electrical field it moves

toward the positive side

+–

DNA

“swimming through Jello”

• DNA moves in an electrical field…• so how does that help you compare DNA fragments?

• size of DNA fragment affects how far it travels

• small pieces travel farther• large pieces travel slower & lag behind

Gel electrophoresis

+–

DNA

“swimming through Jello”

Gel Electrophoresis

longer fragments

shorter fragments

powersource

completed gel

gel

DNA &restriction enzyme

wells

-

+

Running a gel

1 2

cut DNA with restriction enzymes

fragments of DNAseparate out based

on size

3

Stain DNA• ethidium bromide

binds to DNA• fluoresces under UV

light

How is DNA fingerprinting done?1 Make the agarose gel 2Extract DNA and Cut DNA with a restriction enzyme to cut DNA into fragments *

3Insert DNA into wells of gel4Run a gel by electrophoresis to separate the pieces of DNA fragments by length

5Stain the Gel6Interpret the banding patterns for each person

* Explain why restriction enzymes cut different sized pieces of DNA for different individuals.

Uses: Medical diagnostic• Comparing normal allele to disease allele

chromosome with disease-causing

allele 2

chromosomewith normal

allele 1 –

+

allele 1allele 2

DNA

Example: test for Huntington’s disease

Uses: Forensics• Comparing DNA sample from crime scene with suspects & victim

+

S1

DNA

S2 S3 V

suspects crime scene sample

Differences at the DNA level

•Why is each person’s DNA pattern different?• sections of “junk” DNA

• doesn’t code for proteins• made up of repeated patterns

• CAT, GCC, and others

• each person may have different number of repeats

• many sites on our 23 chromosomes with different repeat patterns

GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTTCGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA

GCTTGTAACGGCATCATCATCATCATCATCCGGCCTACGCTTCGAACATTGCCGTAGTAGTAGTAGTAGTAGGCCGGATGCGAA

Allele 1

GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTTCGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA

repeats

DNA patterns for DNA fingerprintscut sitescut sites

GCTTGTAACG GCCTCATCATCATCGCCG GCCTACGCTTCGAACATTGCCG GAGTAGTAGTAGCGGCCG GATGCGAA

1 2 3

DNA – +allele 1

Cut the DNA

DNA fingerprints• Comparing blood samples on

defendant’s clothing to determine if it belongs to victim

• DNA fingerprinting• comparing DNA banding pattern between

different individuals• ~unique patterns

Allele 1

GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTTCGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA

Differences between peoplecut sitescut sites

DNA – +allele 1

Allele 2: more repeats

GCTTGTAACGGCCTCATCATCATCATCATCATCCGGCCTACCGAACATTGCCGGAGTAGTAGTAGTAGTAGTAGGCCGG

DNA fingerprint

allele 2

1 2 3

RFLPs• Restriction Fragment Length Polymorphism

• differences in DNA between individuals

change in DNA sequence affects restriction enzyme “cut” site

creates different fragment sizes & different band pattern

Alec Jeffries 1984

RFLP / electrophoresis use in forensics• 1st case successfully using DNA evidence

• 1987 rape case convicting Tommie Lee Andrews

“standard”

“standard”

“standard”

“standard”

semen sample from rapist

semen sample from rapist

blood sample from suspect

blood sample from suspect

How can you compare DNA from

blood & from semen?RBC?

Electrophoresis use in forensics• Evidence from murder trial

• Do you think suspect is guilty?

“standard”

blood sample 3 from crime scene

“standard”

blood sample 1 from crime scene

blood sample 2 from crime scene

blood sample from victim 2

blood sample from victim 1

blood sample from suspect OJ Simpson

N Brown

R Goldman

Uses: Paternity • Who’s the father?

+

DNA

childMom F1 F2–

Uses: Evolutionary relationships• Comparing DNA samples from different organisms to measure

evolutionary relationships

+

DNA

1 32 4 5 1 2 3 4 5

turtle snake rat squirrel fruitfly

1. Get out notes sheet from yesterday

2. Read DNA Goes to the Races article

3. Make an outline of the steps of gel electrophoresis on your notes sheet

Recommended