Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns MiscVocabulary Mutation Q $100 Q $200 Q $300 Q...

Biology Chapter 8.5-8.7Review

Aminno Acids mRNAns Misc Vocabulary Mutation

Q $100

Q $200

Q $300

Q $400

Q $500

Q $100 Q $100Q $100 Q $100

Q $200 Q $200 Q $200 Q $200

Q $300 Q $300 Q $300 Q $300

Q $400 Q $400 Q $400 Q $400

Q $500 Q $500 Q $500 Q $500

Final Jeopardy

$100 Question Amino Acids

How many amino acids areUsed to make all the proteinsThe body uses?

$100 Answer Amino Acids

20

$200 Question Amino Acids

How many amino acids are built in thisLine of mRNA

augccauaugcgguaacadaguag

$200 Answer Amino Acid

augccauaugcgguaacacaguag

One start AUGOne end UAG6 amino acids

$300 Question Amino Acids

What are the three nucleitide Bases called that identify anAmino acid?

$300 Answer Amino Acid

Triplet codon

$400 Question Amino Acid

What molecule carries the amino acid coded by mRNA to the ribosome??

$400 Answer Amino Acid

tRNA

$500 Question Amino Acid

What anticodon pairs with the codon AUG?

$500 Answer Amino Acid

TAC

$100 mRNA

What happens if the mRNA reading frame is changed??

$100 Answer mRNA

The amino acid sequence of the resulting protein changes.

$200 Question mRNA

What forms the peptide bonds that link amino acids in a protein??

ribosome

$200 Answer mRNA

$300 Question mRNA

How does the lac operon switch off?

$300 Answer mRNA

A repressor protein binds to the operator.

$400 Question mRNA

What does NOT happen during mRNA processing?

A) introns are cut outB) a cap and tail are added

c) exons are removedd) exons are spliced together

$400 Answer mRNA

C) Exons are removed

$500 Question mRNA

What determines the order ofAmino acids ina protein?

$500 Answer mRNA

The order of the mRNA anticodons

$100 Question Misc.

What is the function of transcription factors in eukaryotic cells?

$100 Answer Misc

They help RNA polymerase know where a gene starts

$200 Question Misc

Genes determine a person’sEye color by coding for _________That affect eye color?

$200 AnswerMisc

proteins

$300 Question Misc

Why type of bond are created duringDehydration synthesis?

$300 AnswerMisc

Polypeptide bonds

$400 Question Misc

Of the 20 amino acids, 12 are found in the cellAnd the remaiinng 8 are made from?a)Proteins floating in the cytoplasmb) Waterc) Hydrogend) The food we eat

$400 Answer Misc

d) From the food we eat

$500 Question Misc

Proteins are sometimes called?

$500 Answer Misc

Polypeptide chains

$100 Question Vocabulary

Define mutagen

$100 Answer Vocabulary

Agents in the environment that can change DNA

$200 Question Vocabulary

What is a mutation?

$200 Answer Vocabulary

Change in the organism’s DNA

$300 Question Vocabulary

What is frameshift?

$300 Answer Vocabulary

Insertion or deletion ofA nucleotide in DNA

$400 Question Vocabulary

What is Point Mutation?

$400 Answer Vocabulary

One nucelotide is substitutedFor another

$500 Question Vocabulary

What is chromosomal mutation?

$500 Answer Vocabulary

Different sized units that have no copy of the gene

$100 Question Mutation

Cystic Fibrosis is an example of a genetic disease caused by a deletion of a nucleotide . What is the term for this type of mutation?

$100 Answer Mutation

frameshift

$200 Question Mutation

What type of mutation has noEffect on phenotype?

$200 Answer Mutation

Translocation

$300 Question Mutation

Which is an example of a mutagen?a)Triglycerideb)UV sunlightc)Thymine

$300 Answer Mutation

UV Sunlight

$400 Question Mutation

Mutations that can affectOffspring occur in what Cell type?

$400 Answer Mutation

Chromosomal

$500 Question Mutation

List two causes of mutations

$500 Answer Mutations

a) Inheritatedb) Environmental Impact on epigenomec) Frame shiftd) Point mutation

Final Jeopardy

What is the difference betweenTranscription and translation?

Final Jeopardy AnswerTranscription is when theNucleotide T is changed to U formRNATranslation is when the tripletCodon is “read” to create a protein