View
22
Download
0
Category
Preview:
Citation preview
Please cite this article in press as: Tewari, P., et al., Benzanthrone induced immunotoxicity via oxidative stress and inflammatory
mediators in Balb/c mice. Immunobiology (2014), http://dx.doi.org/10.1016/j.imbio.2014.10.011
ARTICLE IN PRESSG Model
IMBIO51229; No. of Pages 13
Immunobiology xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Immunobiology
jo ur nal ho me page: www.elsev ier .com/ locate / imbio
Benzanthrone induced immunotoxicity via oxidative stress and
inflammatory mediators in Balb/c mice
Prachi Tewari a,b, Ruchi Roy a,b, Sakshi Mishra a, Payal Mandal a,b, Ashish Yadav a,Bhushan P. Chaudharid, Rajnish K. Chaturvedib,c, Premendra D. Dwivedi a,b,Anurag Tripathi a,∗, Mukul Das a,b,∗∗
a Food, Drugs and Chemical Toxicology Group, CSIRIndian Institute of Toxicology Research, Indiab Academy of Scientific and Innovative Research (AcSIR), New Delhi, Indiac Developmental Toxicology Division, CSIRIndian Institute of Toxicology Research, Indiad Pathology Laboratory, CSIRIndian Institute of Toxicology Research, Mahatma Gandhi Marg, Lucknow 226001, India
a r t i c l e i n f o
Article history:
Received 14 August 2014
Received in revised form
19 September 2014
Accepted 12 October 2014
Available online xxx
Keywords:
Benzanthrone
Cytokine
Reactive oxygen species
DNA damage
Antioxidant enzyme
Inflammation
Immunotoxicity
a b s t r a c t
Benzanthrone (BA) is an important dye intermediate which is used in the manufacturing of several
polycyclic vat and disperse dyes in textile industries. Several studies have indicated that the general
population is also exposed to BA owing to its release from furnace effluents and automobile exhausts in
the environment. In several clinical studies, it has been shown that workers exposed to BA developed
itching, burning sensation, erythema and hyperpigmentation of the skin, which could be an outcome of
the dysregulated immune response. In this study, we have used female Balb/c mice as a model to study the
immunoinflammatory changes after systemic administration of BA (7.5 mg/kg b.w. and 15 mg/kg b.w.)
for one week. BA exposed animals exhibited the signs of intense systemic inflammation as evident by
enhanced DTH response, MPO activity, hyperplastic and dysplastic histopathological organization of
spleen and lung tissue. Splenic evaluation revealed enhanced oxidative stress, upregulation of promi
nent inflammatory markers like iNOS and COX2 and DNA damage. In coherence with the observed
immunoinflammatory alterations, the levels of several inflammatory and regulatory cytokines (IL17,
TNFa, IFNg, IL1, IL10, IL4) were significantly enhanced in serum as well as the spleen. In addition,
BA administration significantly induced the activation of ERK1/2, p38, JNK MAPKs and their downstream
transcription factors AP1 (cfos, cjun), NFkB and Nrf2 which comprise important mechanistic path
ways involved in inflammatory manifestations. These results suggest the immunotoxic nature of the
BA and have implications for the risk assessment and management of occupational workers, and even
common masses considering its presence as an environmental contaminant.
© 2014 Elsevier GmbH. All rights reserved.
Introduction
Dye manufacturing units are an integral component of several
industrial sectors of the modern world. Production of synthetic dyes
and colors in India is about 25,000 metric tons every year, which
raises the possibility of its chronic exposure and potential toxicity
to occupational workers and common masses. BA is an important
Abbreviations: BA, benzanthrone; DCNB, 2,5dichloronitrobenzene; MPO,
myeloperoxidase; DTH, delayed type hypersensitivity.∗ Corresponding author. Tel.: +91 522 2963826; fax: +91 522 2628227.
∗∗ Corresponding author at: Food, Drug and Chemical Toxicology Division, CSIR
Indian Institute of Toxicology Research, India.
Email addresses: anurag1706@gmail.com (A. Tripathi), mditrc@rediffmail.com
(M. Das).
dye intermediate, which is used in the manufacturing of a num
ber of polycyclic vat and disperse dyes in textile industries (Colour
Index, 1971; Venkatraman, 1952). With the expansion of textile
and color industries, the demand of BA dye intermediate is con
stantly increasing. Several studies have suggested that the general
population can also be exposed to BA due to its presence in the envi
ronment as a contaminant (Handa et al., 1984; Ramdahl, 1983). It
has been reported during air quality monitoring surveys, that BA
is also released from diesel and gasoline engine vehicles (Sawacki
et al., 1965). BA has also been found to be present in furnace efflu
ents, effluents from the open burning of leaves, grass, municipal
refuses and automobile exhausts (Sawacki, 1967). Earlier studies
have shown that the liver, kidney, testis, urinary bladder and skin
are the target organs for BA induced toxicity, which involves the
depletion of ascorbic acid (Singh et al., 1990; Das et al., 1991a,b;
Das et al., 1994). In a recent study conducted by our group, we
http://dx.doi.org/10.1016/j.imbio.2014.10.011
01712985/© 2014 Elsevier GmbH. All rights reserved.
Please cite this article in press as: Tewari, P., et al., Benzanthrone induced immunotoxicity via oxidative stress and inflammatory
mediators in Balb/c mice. Immunobiology (2014), http://dx.doi.org/10.1016/j.imbio.2014.10.011
ARTICLE IN PRESSG Model
IMBIO51229; No. of Pages 13
2 P. Tewari et al. / Immunobiology xxx (2014) xxx–xxx
have demonstrated that BA showed skin tumorigenic potential
(Dwivedi et al., 2013). The process of absorption and disposition
are key determinants that influence the rate of delivery of a xeno
biotic to the site of pharmacological or toxicological effect (Walker
and Oesch, 1983). It has been shown in a guinea pig model, that
even after a single exposure, BA exhibited comparatively slower
urinary and fecal clearance and higher hepatic and testicular reten
tion (Das et al., 1991b). Similarly, a single exposure of BA to male
rabbits (0.2 g/kg of body weight, i.p.) and guinea pigs (0.03 g/kg of
body weight, i.p.) resulted in a multitude of inflammatory responses
(Pandya et al., 1976; Singh and Tripathi, 1973). In a study, where the
BA was administered intraperitoneally (0.05 g/kg of body weight)
to rats for 10–20 days, the animals developed normocytic anemia
due to hemolysis (Chandra and Singh, 1968). BA can also induce
a significant increase in plasma fibrinogen levels and decrease in
blood coagulation time (Mehrotra et al., 1975).
Despite several investigations on the toxicological effects of
BA, the information on the immunomodulatory potential of
BA is scanty. Exposure to environmental chemicals, such as
polychlorinated biphenyls, polycyclic aromatic hydrocarbons and
heavy metals can alter the immune system (Love et al., 2003;
Pabello and Lawrence, 2006; Rice and Hayward, 1997; Shridhar
et al., 2001). Immunotoxicity is defined as any adverse effect on
the structure and function of the immune system and can be
divided into immunosuppression, immunostimulation, hypersen
sitivity and autoimmunity (Duramad and Holland, 2011; Descotes,
2005). Modulation of the immune system may lead to increased
incidences of inflammation and allergic reactions toward environ
mental agents (Burnet, 1970). Hypersensitivity allergic reactions
like DTH are the most frequently detected immunotoxic effects
of chemicals. This process involves coordinated signaling events
mediated by proinflammatory cytokines and chemokines (Gotte,
2003; Vestweber, 2007). In several clinical studies, it has been
shown that workers exposed to BA during manufacture, pulveriza
tion and storage developed itching, burning sensation, erythema,
roughness, dryness, hyperpigmentation of the skin and allergic
reactions (NIOSH, 1979; Singh and Zaidi, 1969; Trivedi and Niyogi,
1968). BA induced skin inflammation manifested by hyperpigmen
tation, edema, dermatitis and redness of the skin could be an
outcome of hypersensitive response of immune cell types present
in dermal tissue. Taken together, all these studies suggest that a
dysregulated immune response could contribute to BA induced tox
icity. Keeping this in view, the present study was undertaken to
comprehensively assess the immunotoxicity risk associated with
BA exposure in experimental mice model and further delineate the
important inflammatory mediators aggravating the pathology.
Materials and methods
Chemicals, biochemicals and kits
BA (Indian Dyestuff Industries, Kalyan, India) was purified on
a neutral alumina column using 1,2dichloroetane as an eluent as
described earlier (Das et al., 1989). Phosphate buffered saline (PBS),
2′,7′dichlorodihydrofluorescein diacetate (H2DCFDA), protease
inhibitor cocktail and propidium iodide (PI) were purchased from
Sigma Chemical Co. (St. Luois, MO). Dulbecco’s modified Eagles
medium (DMEM) was purchased from Invitrogen Co. (Carlsbad,
CA), Cytometric Bead Assay Kit for TH1/TH2/TH17 cytokines was
purchased from BD Biosciences (San Diego, CA). Fetal bovine
serum (FBS) and antibiotic–antimycotic solution (10,000 U/ml
penicillin,10 mg/ml streptomycin sulfate) were purchased from
Gibco, Invitrogen Cor. (Grand Island, NY). Tris buffer, triton X
100, bovine serum albumin (BSA), were obtained from Sigma
Chemicals Co. (St. Louis, MO). AntigH2AX (Ser139), antip
JNK (Thr183/Tyr185), antiCOX2 and antiiNOS were procured
from Cell Signaling Technology (Beverly, MA). Antibactin, anti
tubulin, antipextracellular signalregulated kinases (ERK1/2)
(Thr202/Tyr204), antip38, anticjun Nterminal kinase (JNK),
antipNFkB were purchased from Santa Cruz Biotechnology
(Santa Cruz, CA). Halt Protease and Phosphatase Inhibitor Cocktail
were procured from Thermo Scientific (Rockford, IL). All other
chemicals used were of the highest purity commercially available.
Endotoxin detection
Limulus amebocyte lysate (LAL) was performed to detect endo
toxin contamination in BA with Pierce LAL Chromogenic Endotoxin
Quantification Kit (U.BEE. Scientific, USA) according to manufactur
ers protocol. It was found that the BA used in the present study was
free of endotoxin (data not shown).
Animals
Inbred strains of female Balb/c mice (6–8 weeks old, 18–20 g)
were procured from the animal breeding colony of Indian Institute
of Toxicology Research (Lucknow, India) and were acclimatized
under standard laboratory condition for one week prior to the
experiment. Animals were housed in polycarbonate cage main
tained at 22 ± 2 ◦C under standard laboratory conditions of light
and dark cycles (12–12 h). Animals were kept on a normal diet and
water ad libitum.
BA treatment schedule for intraperitoneal dosing
The experimental animals were divided into four groups. Ani
mals of group I served as control and received 0.1 ml corn
oil intraperitoneally. Animals of group II, III and IV received
3.25 mg/kg, 7.5 mg/kg and 15 mg/kg endotoxin free BA intraperi
toneally in 0.1 ml corn oil daily for one week, respectively
(n = 6 animals/group). The doses of BA were selected based on our
earlier studies where in i.p. doses of BA in rats (40 mg/kg) for
3, 7 and 21 days resulted in alterations of xenobiotic metaboliz
ing enzymes (Das et al., 1991a). The 3 doses of BA selected were
1/20th (15 mg/kg), 1/40th (7.5 mg/kg) and 1/80th (3.25 mg/kg) of
the intraperitoneal LD50 (i.p. 290 mg/kg) which was determined
by (Lundy and Eaton, 1994). The intraperitoneal exposure route
was selected to identify the effects of BA exposure on spleen. The
animals were sacrificed by cervical dislocation 24 h after the last
treatment for the analysis of below mentioned parameters. This
study was carried out after the approval by the Institutional Ethical
Committee (Approval no. IITR/IAEC/10/13).
Collection of blood samples and histopathological processing
After the treatment schedule, blood was collected by retro
orbital bleeding and serum was separated. After sacrificing the
mice, a portion of the spleen and lungs was washed with cold
normal saline, blotted dry over filter paper and fixed in 10% neu
tral formalin and embedded in paraffin. Serial sections of 5 mm
thickness were cut and stained with hematoxylin and eosin for
microscopic examination.
MPO activity
MPO activity was determined by the method of Bradley et al.
(1982). In brief, spleen and lung samples of control as well as
treated mice were weighed. A 100 mg of tissue was homogenized
in 3 ml of 0.5% hexadecyl trimethyl ammonium bromide in 50 mM
phosphate buffer, pH 6.0, by using homogenizer on ice. After three
freeze thaw cycles, homogenates were centrifuged at 40,000 × g for
15 min, and the MPO activity in the supernatant was measured by
Please cite this article in press as: Tewari, P., et al., Benzanthrone induced immunotoxicity via oxidative stress and inflammatory
mediators in Balb/c mice. Immunobiology (2014), http://dx.doi.org/10.1016/j.imbio.2014.10.011
ARTICLE IN PRESSG Model
IMBIO51229; No. of Pages 13
P. Tewari et al. / Immunobiology xxx (2014) xxx–xxx 3
incubating 20 ml of diluted sample with 180 ml of 50 mM potassium
phosphate buffer, pH 6.0, containing 0.157 mg/ml odianisidine
dihydrochloride Sigma Chemicals Co. (St. Louis, MO) and 0.0005%
of H2O2. Absorbance was measured at 450 nm using an ELISA plate
reader (BioTek, Winooski, VT). The MPO activity was expressed as
absorbance per 100 mg weight of tissue.
Preparation of splenocytes
Spleens from control and BA treated mice were taken out,
washed with cold phosphate buffered saline and cell suspension
was prepared by mincing tissue in incomplete Dulbecco’s modified
Eagles medium (DMEM) (Yadav et al., 2012, 2013). In brief, eryth
rocytes were lysed with erythrocytes lysis buffer (0.15 M NH4Cl,
1 mM NaHCO3, 0.1 mM EDTA, pH 7.4). The cells were then washed
two times with incomplete medium and centrifuged (300×g). Cells
were resuspended in DMEM containing 10% fetal bovine serum,
2 mM lglutamine, 100 U/ml of penicillin, 100 mg/ml of strepto
mycin, 25 mM HEPES, 1 mM sodium pyruvate, 25 mM dextrose and
50 mM 2mercaptoethanol. The total number of splenocytes/spleen
was determined by counting cells in a hemocytometer. 100 ml
volume of culture medium containing cells at a concentration of
2 × 106 cells/ml were seeded into black 96 well plates and used for
the assay of investigative parameter (ROS).
ROS measurement by DCFDA method and Western blot analysis of
DNA damage ( H2AX), MAPKs, NFкB, Nrf2, AP1 (cfos, cjun),
COX2 and iNOS
The treatment schedule was same as described under the sec
tion of “BA treatment schedule for intraperitoneal dosing”. For
estimaton of ROS, cells were incubated in presence of 100 mM
DCFDA (Saxena et al., 2009) for 30 min at 37 ◦C, in a 96 well plate
(black bottom), and relative fluorescence intensity was measured in
SYNERGYHT multiwall plate reader (BioTek, Winooski, VT) using
the KC4 software at excitation and emission wavelengths of 485
and 528 nm, respectively.
For Western blot analysis of H2AX (a marker of double stranded
DNA damage), MAPKs, NFкB, Nrf2, AP1, COX2 and iNOS; spleen of
control and BA treated mice were taken, washed with normal saline
and homogenized in icecold lysis buffer (50 mM Tris–HCl [pH 7.5],
150 mM NaCl, 1% Triton X100, 0.5% sodium deoxycholate, 0.1%
SDS, 1 mM dithiothreitol [DTT], 1 mM phenylmethanesulfonylflu
oride [PMSF], supplemented with protease inhibitor cocktail kept
on ice for 10 min with intermittent vortexing, and then centrifuged
at 14,000 × g for 20 min at 4 ◦C. The supernatant was collected and
protein concentration in each sample was measured by the bicin
choninic acid protein assay kit (Thermo Fisher Scientific, Waltham,
MA), using BSA (1 mg/ml) as a standard. Sixty micrograms of total
protein were resolved by 10% SDS polyacrylamide gel electrophore
sis and electrotransferred on polyvinylidene fluoride membranes.
The blotted membrane was blocked with either 5% nonfat dry
milk or 2% BSA in PBS containing 0.1% Tween 20 (blocking solu
tion), and incubated with specific antibodies against gH2AX, NFкB,
pERK1/2, pp38, pJNK, ERK1/2, p38, JNK, Nrf2, AP1, COX2 and
iNOS at dilutions indicated by the manufacturer. The blots were
further incubated with HRP conjugated secondary antibody (Sigma
Chemical Co., St. Louis, MO) and developed by ECL Western Blotting
Detection Kit as described in the manufacturer’s protocol (Amer
sham, Fairfield, CT). All the blots were stripped and reprobed with
bactin or the respective total nonphospho form of protein to
ensure equal loading.
Oxidative stress markers
To study the effect of BA on various oxidative stress mark
ers, spleens of control and treated mice were taken and washed
in chilled phosphate buffer. 10% (w/v) spleen homogenate was
prepared in 0.2 M phosphate buffer using an Ultra Turrax Poly
tron. Reduced glutathione (GSH) content was assayed in the spleen
homogenate according to the method of Ellman (1959). Lipid per
oxidation (LPO) in the spleen homogenate was determined by
estimating the formation of malondialdehyde (MDA) using the
method of Utley et al. (1967). Protein carbonyl content was mea
sured in the spleen homogenate according to the method of Levine
et al. (1990). Catalase activity was determined by the method of
Sinha (1972). Glutathione reductase (GR) and glutathione S trans
ferase (GST) activities were assayed according to the method of
Moron et al. (1979). Superoxide dismutase (SOD) activity was mea
sured by the method of Mishra and Fridovich (1972), whereas
glutathione peroxidase was determined by the method of Rotruck
et al. (1973).
Separation of serum
Blood was collected in dry centrifuge tubes and allowed to clot
at room temperature for 1 h. The tubes were then placed at 4 ◦C
overnight. Serum was separated by centrifugation at 3000 × g for
10 min and stored at −20 ◦C until further analysis.
Cytokine analysis
Serum from different groups was collected for the estimation
of TH1/TH2/TH17 cytokines by using Cytometric Bead Array (CBA)
Kit (BD Biosciences, San Diego, CA). Samples were prepared for
cytokine analysis as directed by the kit manufacturer and analyzed
on the same day. CBAFCAP array software evaluated the level of
cytokines present in the samples on the basis of standard curve
obtained for each cytokine.
Semiquantitative reverse transcriptasepolymerase chain
reaction (RTPCR) of cytokines in spleen
A semiquantitative RTPCR analysis of Th1/Th2 cytokines (IL
4, IL1 and IL10, IFNg, TNFa) in the spleen of mice was carried
out using genespecific primers in control and BA treated groups.
The oligonucleotide primers used are listed in Table 1. Total RNA
from spleen was isolated with RNAzol®RT (Molecular Research
Table 1
Primer sequences used for qPCR.
Gene Forward primer Reverse primer
IL4 5′TCGGCATTTTGAACGAGGTC3′ 5′AAAAGCCCGAAAGAGTCTC3′
IL1 5′GCCAGTTGAGTAGGATAAAGG3′ 5′CAGTCTGTCTCCTTCTTGAGG3′
IL10 5′TGCCTGCTCTTACTGACTGG3′ 5′CTGGGAAGTGGGTGCAGTTA3′
IFN 5′ATCTGGAGGAACTGGCAAAA3′ 5’TTCAAGACTTCAAAGAGTCTGAGGTA3′
TNF ̨ 5′AACTAGTGGTGCCAGCCGAT3′ 5′GACTCAT GTACTCCTGCTTGC3′
GAPDH 5′TCTCACTCTCGAGGCAGCATGA3′ 5′CTTCACAGAGCAATGACTCC3′
where IL, interleukin; INFg, interferon gamma; TNFa, tumor necrosis factor; GAPDH is internal control.
Please cite this article in press as: Tewari, P., et al., Benzanthrone induced immunotoxicity via oxidative stress and inflammatory
mediators in Balb/c mice. Immunobiology (2014), http://dx.doi.org/10.1016/j.imbio.2014.10.011
ARTICLE IN PRESSG Model
IMBIO51229; No. of Pages 13
4 P. Tewari et al. / Immunobiology xxx (2014) xxx–xxx
Fig. 1. (A) Effect of benzanthrone on histopathological analysis of spleen depicting inflammatory manifestations; (B) effect of benzanthrone on histopathological analysis
of lungs depicting inflammatory manifestations; (C) effect of benzanthrone on MPO activity in spleen and (D) effect of benzanthrone on MPO activity in lungs. Details of
processing of tissues are mentioned in “Materials and methods” section. The data represent mean ± SD (n = 6). *p < 0.05, indicates significant difference from corresponding
control.
Center, Inc., Cincinnati, OH). cDNA from different groups were
prepared by using High Capacity cDNA Reverse Transcription Kit
(Applied Biosystems, Foster City, CA) according to the manufac
turer’s instructions. The RTPCR was carried out using a PCR master
mix (Thermo Scientific, Waltham, MA) according to the manufac
turer’s instructions. After completion of PCR cycles, 20 ml of PCR
products were analyzed by 2% agarose gel electrophoresis. The den
sity of each band was estimated by the Genetool software (Syngene,
Los Altos, CA). GAPDH was taken as an endogenous control and its
respective densitometry values were used for normalizing differ
ent mRNA expressions in the spleen. Normalized values were used
for plotting the bar graphs.
DTH assay and MPO activity in ear pinna
DTH assay was performed as previously described (Corsini et al.,
1977; Gad, 1994). DTH assay was done to analyze whether BA
causes any kind of hypersensitivity. Animals were divided into 3
groups containing 6 mice in each group. 15 mg/kg dose was selected
to analyze the DTH response. Six BALB/c mice in each group were
sensitized by painting the left ear with 25 ml of 0.5% DNCB (w/v)
as a positive control of DTH, or 25 ml of BA (0.3%) dissolved in a
mixture of acetone and olive oil (4:1), or vehicle alone for 3 consec
utive days. Fourteen days after the initial sensitization, the animals
were challenged with 25 ml of 0.25% DNCB or 25 ml of 0.15% BA
on the left ear. The thickness of the ears was measured with an
engineer’s micrometer Vernier Caliper at 24 h after challenge. The
mice were then sacrificed and the left ear pinna of these mice
was dissected out. A portion of ear pinna was washed with cold
normal saline, blotted dry over filter paper and fixed in 10% neu
tral formalin and embedded in paraffin. Serial sections of 5 mm
thickness were cut and stained with hematoxylin and eosin for
microscopic examination, where as MPO activity was determined
by the method of Bradley et al. (1982) as described in MPO activity
section.
Statistical analysis
All the results were expressed as the mean ± SE. Differences
between groups were analyzed using t test and analysis of vari
ance (oneway ANOVA) with Bonferroni intergroup comparison
Please cite this article in press as: Tewari, P., et al., Benzanthrone induced immunotoxicity via oxidative stress and inflammatory
mediators in Balb/c mice. Immunobiology (2014), http://dx.doi.org/10.1016/j.imbio.2014.10.011
ARTICLE IN PRESSG Model
IMBIO51229; No. of Pages 13
P. Tewari et al. / Immunobiology xxx (2014) xxx–xxx 5
tests from GraphPad Prism version 3 Software (San Diego, CA). A
value of (*p < 0.05) was considered as statistically significant.
Results
Histopathological analysis of spleen and lungs
Histological analysis of tissues in control mice showed appar
ently normal structure in spleen and lungs, however tissues from
BA treated animals exhibited profound morphological changes
depicting dose dependent heavy inflammation. The spleens of mice
exposed to higher doses of BA (15 mg/kg) exhibited noteworthy
hyperplasia of the spleen and megakaryocytes infiltration, whereas
the lungs displayed pronounced thickening of alveolar septa and
marked alveolar edema with haemorhhages at a few sites (Fig. 1A
and B). We did not find any noticeable change in the dose of
3.25 mg/kg in histopathological analysis, therefore 3.25 mg/kg dose
was excluded from the rest of the investigative assays and mecha
nistic analysis.
Effect of BA on MPO activity in the spleen and lungs
Myeloperoxidase is secreted by inflammatory cells such as acti
vated macrophages and neutrophils. It catalyzes the conversion of
H2O2 into HOCl and tyrosine into tyrosyl radical. HOCl and tyrosyl
radical are cytotoxic in nature and are key components of oxida
tive burst and inflammatory responses. Therefore the MPO activity
in the spleen and lung tissue was measured following BA expo
sure. Increased MPO activity was observed in both tissues, in a dose
dependent manner. The MPO activity in the spleen was upregulated
by 157% ↑ and 571% ↑ at 7.5 mg/kg b.w., and 15 mg/kg b.w. of BA
dose. Similarly, in the lungs, the enzymatic activity was notably
increased with respect to control by 193% and 666% at 7.5 mg/kg
and 15 mg/kg doses of BA, respectively (Fig. 1 C and D).
Effect of BA on ROS generation and Nrf2 levels in spleen
As shown in Fig. 2A, BA administration induced signifi
cant enhancement in ROS generation by splenocytes in a dose
Fig. 2. Effect of benzanthrone on ROS, oxidative stress markers and DNA damage in spleen. (A) Effect of BA on ROS generation. Single cell suspensions from vehicle control
or BA treated mice spleen were prepared and 1 × 105 cells were incubated with 100 mM H2DCFDA for 30 min at 37 ◦C and relative fluorescence intensity was determined by
spectrofluorimetry (�ex = 488 nm, �em = 520 nm) and represented in terms of fold change; (B) effect of BA on LPO; (C) effect of BA on GSH content; (D) effect of BA on protein
carbonyl (PC); spleens of control and BA treated mice were washed in chilled phosphate buffer and 10% (w/v) spleen homogenate was prepared in 0.2 M phosphate buffer using
an Ultra Turrax Polytron for the assay of LPO, GSH and protein carbonyls. Data represented in terms of n mol MDA/mg protein, mol GSH/mg protein and mol PC/mg protein,
respectively; (E) effect of BA on H2AX; and (F) Nrf2 proteins; (G and H) densitometric analysis of H2AX and Nrf2 proteins were performed and values were normalized with
respect to tubulin and plotted in terms of fold difference. Details of processing of cells and tissues are mentioned in “Materials and methods” section. The data represent
mean ± SD (n = 6) for all the parameters except Western blot analysis of H2AX and Nrf2 wherein mean ± SD of three experiments have been indicated. *p < 0.05, indicates
significant difference from corresponding control.
Please cite this article in press as: Tewari, P., et al., Benzanthrone induced immunotoxicity via oxidative stress and inflammatory
mediators in Balb/c mice. Immunobiology (2014), http://dx.doi.org/10.1016/j.imbio.2014.10.011
ARTICLE IN PRESSG Model
IMBIO51229; No. of Pages 13
6 P. Tewari et al. / Immunobiology xxx (2014) xxx–xxx
Fig. 3. Effect of benzanthrone exposure on antioxidant enzymes of spleen. (A) Effect of BA on SOD; (B) GST; (C) GR; (D) catalase; and (E) GPx activities. Spleens from control
and BA treated mice were taken, washed in chilled phosphate buffer and 10% (w/v) spleen homogenate was prepared in 0.2 M phosphate buffer. Details of processing of tissues
are mentioned in “Materials and methods” section. Each value represents mean ± SD of 6 animals. *p < 0.05, indicates significant difference from corresponding control.
dependent manner. It is well known that cells create a homeo
static balance between production and removal of ROS, and Nrf2
transcription factor has been identified as the master regulator
for maintaining ROS balance (Kensler et al., 2007). We found that
the expression of Nrf2 was decreased by BA in a dose dependent
manner, thereby modulating the antioxidant defense system of the
spleen (Fig. 2F).
Effect of BA on oxidative stress markers in spleen
It was observed that BA at the doses of 7.5 mg/kg and 15 mg/kg,
caused a significant increase in LPO (106–450%) and protein car
bonyl content (25–173%) along with a significant decrease in
GSH content (55–73%) (Fig. 2B–D). However the activities of SOD
(24–66%), GST (37–75%), GR (34–55%), catalase (12–29%) and GPx
(74–85%) were found to be significantly downregulated at both the
doses of BA (Fig. 3).
Effect of BA on the DNA integrity of spleen
Since ROS generation has been known to cause DNA damage,
the effect of BA on the integrity of DNA was studied. The West
ern blot analysis revealed that the level of gH2AX protein, a well
established marker of DNA damage was significantly elevated in a
dose dependent manner by BA when compared to control (Fig. 2E).
Effect of BA exposure on serum cytokine levels
Cytokines play an important role in immunoregulation and
inflammation. Treatment of BA at higher dose (15 mg/kg b.w.)
increased the levels of all inflammatory cytokines – IL17 (4.8 fold,
Fig. 4A), TNFa (1.52 fold, Fig. 4B), IFNg (4.2 fold, Fig. 4C), IL4 (4.25
fold, Fig. 4D), IL10 (12.3 fold, Fig. 4E) and IL1 (427 fold, Fig. 4F).
However, at lower dose (7.5 mg/kg) only TNFa (1.2 fold), IL4 (1.5
fold) and IL1 (81 fold) were found to be increased.
Effect of BA exposure on the mRNA level of cytokines in spleen
A dysregulated inflammatory immune response and homeo
static imbalance are characterized by upregulation of proinflam
matory mediators at the transcriptome level and since serum
cytokines are primarily contributed by immune cell types, therefore
we examined the expression level of the cytokines at mRNA level in
the spleen. The RTPCR analysis of cytokines in spleen revealed that
BA treatment (7.5 mg/kg and 15 mg/kg b.w.) increased the expres
sion of cytokines – IL4, IL1, IL10, IFNg and TNFa (Fig. 5A).
Effect of BA on the phosphorylation of ERK1/2, p38 and JNK MAP
kinases levels
ERK1/2, p38 and JNK are a subgroup of a superfamily of ser
ine/threonine kinases known as mitogenactivated protein kinases
(MAPKs) which play a pivotal role in cell survival, proliferation,
inflammation and cell death. As shown in Fig. 6, the phosphory
lation of ERK1/2, p38 and JNK was significantly enhanced in BA
treated mice at both the doses.
Effect of BA on phosphorylation of transcription factors NFкB and
AP1 (cfos, cjun)
NFкB and AP1 transcription factors play an important role
downstream to the MAPK pathways in the regulation of several
Please cite this article in press as: Tewari, P., et al., Benzanthrone induced immunotoxicity via oxidative stress and inflammatory
mediators in Balb/c mice. Immunobiology (2014), http://dx.doi.org/10.1016/j.imbio.2014.10.011
ARTICLE IN PRESSG Model
IMBIO51229; No. of Pages 13
P. Tewari et al. / Immunobiology xxx (2014) xxx–xxx 7
Fig. 4. Benzanthrone induced alterations in the levels of cytokines in serum. (A) Effect of BA on IL17; (B) TNFa; (C) IFNg; (D) IL4; (E) IL10; and (F) IL1 levels. Serum
from different groups were collected for the estimation of TH1/TH2/TH17 cytokines using Cytometric Bead Array (CBA) Kit. CBAFCAP array software evaluated the level of
cytokines present in the samples on the basis of standard curve obtained for each cytokine. Values represent means ± SD of 6 animals. *p < 0.05, indicates significant difference
from corresponding control.
genes involved in inflammatory responses, therefore we examined
the effect of BA on NFкB as well as AP1 levels. It was observed that
BA administration resulted in a dose dependent enhancement of
NFкB, AP1 levels (Fig. 7A–D) in mouse splenocytes with respect to
control, indicating the plausible role of MAPK pathways in causing
inflammation.
Effect of BA on inflammatory markers iNOS and COX2
Since iNOS and COX2 are well known inflammatory markers,
the expression of iNOS and COX2 in spleens of control and BA
treated mice was undertaken. It was observed that both iNOS and
COX2 were signficantly upregulated in the spleen of BA treated
animals with respect to control (Fig. 7A, E, F).
Histological analysis, ear swelling and MPO activity in auricle
tissues of BA treated mice
DTH response is a complex inflammatory process which
involves an interaction between T lymphocytes, and macrophages
bridged by several inflammatory mediators. To determine if BA
induced toxicity involves DTH reactivity, BA (0.3%) was applied
Please cite this article in press as: Tewari, P., et al., Benzanthrone induced immunotoxicity via oxidative stress and inflammatory
mediators in Balb/c mice. Immunobiology (2014), http://dx.doi.org/10.1016/j.imbio.2014.10.011
ARTICLE IN PRESSG Model
IMBIO51229; No. of Pages 13
8 P. Tewari et al. / Immunobiology xxx (2014) xxx–xxx
Fig. 5. Benzanthrone induced expression of cytokines in spleen at mRNA level. (A) IL4, IL1, IL10, IFNg, TNFa. A semiquantitative RTPCR analysis of Th1/Th2 cytokines
(IL4, IL1, IL10, IFNg, TNFa) in the spleen of mice was carried out using genespecific primers in control and BA treated groups. Total RNA from spleen was isolated with
RNAzol®RT and cDNA from different groups were prepared by using High Capacity cDNA Reverse Transcription Kit. After completion of PCR cycles, 20 ml of PCR products
were analyzed on 2% agarose gel electrophoresis. (B) Densitometric analysis was performed and values were normalized with respect to its GAPDH and plotted in terms of
fold difference. Values represent means ± SD of 6 animals. *p < 0.05, indicates significant difference from corresponding control.
to ear pinna of animals, while DCNB (0.5%) was used as a pos
itive control. Histological sections of auricle tissue of control
mice showed apparently normal histological structure. The ear
pinna of DCNBchallenged mice revealed epidermal hyperpla
sia and infiltration of mixed inflammatory cells in the dermis,
whereas BA treated mice also showed hyperplasia of epidermis
protruding within the dermis, along with the presence of few
mixed inflammatory cells in the dermis (Fig. 8A). In line with
the histopathological evaluations, the ear thickness (Fig. 8B) and
MPO activity (Fig. 8C) in the ear tissue was also significantly
increased (69–150% ↑) in BA treated mice when compared to
control.
Discussion
The present study demonstrated the inflammatory effects of BA
and the underlying signaling mechanism in Balb/c mice model.
Although several reports on the toxicity of BA have been docu
mented (Garg et al., 1992a,b; Das et al., 1991a,b; Horakova and
Merhaut, 1966), but the knowledge gap from the immunotoxico
logical perspective is yet to be addressed. In a bid to understand
the association of immune system components in BA induced
inflammation, mice were administered BA intraperitoneally fol
lowed by histopathological evaluations of the spleen from BA
exposed animals showed marked hyperplasia and infiltration of
megakaryocytes, which is suggestive of profound inflammation.
The lungs are one of the primary targets of BA exposure via
inhalation of diesel exhausts (Sawacki et al., 1965). The present
investigation indicates that the lungs of BA administered animals
exhibited thickening of alveolar septa as well as moderate alveo
lar edema. These findings suggest that people affected by several
inflammatory lung pathologies could have BA as one of the con
tributing etiological factor.
Several reports have been published on the relationship
between oxidative stress and inflammation. Environmental xeno
biotics can induce oxidative stress and DNA damage in vitro and
in vivo, which stands as one of the widely cited prominent toxic
ity mechanism (Klaunig et al., 1997; Cooke et al., 2003; Das et al.,
2005a,b). The present study clearly demonstrates that BA adminis
tration creates oxidative imbalance in splenocytes by increasing the
levels of ROS, lipid peroxidation and protein carbonylation. Further
more, the antioxidant defense machinery of the cells was glitched,
causing significant downregulation in the enzymatic activities of
SOD, GST, GR, catalase and GPx. Nrf2 transcription factor plays an
Please cite this article in press as: Tewari, P., et al., Benzanthrone induced immunotoxicity via oxidative stress and inflammatory
mediators in Balb/c mice. Immunobiology (2014), http://dx.doi.org/10.1016/j.imbio.2014.10.011
ARTICLE IN PRESSG Model
IMBIO51229; No. of Pages 13
P. Tewari et al. / Immunobiology xxx (2014) xxx–xxx 9
Fig. 6. Benzanthrone induced protein expression of MAPKs in spleen of mice. (A) Effect of BA on pJNK, pERK, pp38 in spleen. For confirmation of equal protein loading, the
blots were probed with an antibody specific for total ERK, JNK, p38. (B–D) Densitometric analysis of JNK, ERK and p38 was performed and the values were normalized with
respect to total nonphospho form of the respective protein and plotted in terms of fold difference. Values represent means ± SD of 3 animals. *p < 0.05, indicates significant
difference from corresponding control.
important role in restoring and maintaining the cellular oxidative
stress at nontoxic levels (Cavin et al., 2007). The present study
demonstrated that BA induced Nrf2 suppression, which might
be the pivotal deregulation affecting the genotoxic and oxidative
damage persistent in the spleens of BA treated animals. MPO,
a hemoprotein stored in azurophilic granules of polymorphonu
clear neutrophils and macrophages, is a significant contributor
to cellular oxidative damage. It plays an important role in the
initiation and progression of acute and chronic inflammatory dis
eases (Takahiko et al., 2002; Sugiyama et al., 2001). Our present
findings showed that BA exposure results in enhancement of
MPO activity in the spleen and lungs. It was noteworthy that
the expression of COX2 and iNOS was also upregulated in the
spleens of BA exposed mice, which are wellestablished molecular
biomarkers of inflammation (Kwon et al., 2007). Severe oxida
tive stress is often accompanied by DNA damage, therefore we
examined whether BA toxic insult causes a breach of DNA integrity.
H2AX, a member of histone protein family H2A, is phosphory
lated on residue serine 139 in cells, when double strand breaks
(DSBs) are introduced into DNA by endogenous or exogenous fac
tors (Rogaku et al., 1998). BA exposure significantly enhanced
the protein levels of gH2AX, confirming DNA damage in spleno
cytes.
The oxidative stress response is known to upregulate several
inflammatory mediators such as COX2, TNFa, IL6, IFNg and
other inflammatory cytokines via the activation of signaling path
ways involving the transcription factor NFкB (Lu and Wahl, 2005;
Lefkowitz et al., 1993). Corroborating with these observations, BA
exposure to mice increased the production of proinflammatory
cytokines IL17, TNF a, IFNg and IL1. These cytokines have been
reported to play a pivotal role in the amplification of inflammatory
responses and progression of inflammatory disorders like asthma
Please cite this article in press as: Tewari, P., et al., Benzanthrone induced immunotoxicity via oxidative stress and inflammatory
mediators in Balb/c mice. Immunobiology (2014), http://dx.doi.org/10.1016/j.imbio.2014.10.011
ARTICLE IN PRESSG Model
IMBIO51229; No. of Pages 13
10 P. Tewari et al. / Immunobiology xxx (2014) xxx–xxx
Fig. 7. Benzanthrone induced protein expression of inflammatory mediators and transcription factors in spleen of mice. (A) Effect of BA on NFkb, cjun, cfos, COX2, and iNOS
in spleen of control and BA treated groups. For confirmation of equal protein loading, the blots were probed with an antibody specific for tubulin and bactin. Densitometric
analysis was performed and values were normalized with respect to tubulin or b actin, and plotted in terms of fold difference.
and autoimmune tissue inflammations (Strieter and Kunkel, 1994;
van de Veerdonk et al., 2011; Lu and Wahl, 2005; Awasthi and
Kuchroo, 2009; Wong et al., 2001). Interestingly, the levels of anti
inflammatory cytokines IL10 and IL4 were also elevated in BA
treated animals, which could be a counter response of the body for
damage control. Earlier reports have documented that upregulation
of IL10 and IL4 cytokines along with inflammation plays a pro
tective role in models of inflammation induced injury (Järveläinen
et al., 1999; Frankerberger et al., 1994).
Oxidative stress induces signaling pathways, including MAPKs,
which further modulate the activity of downstream transcription
factors such as NFкB, AP1 (Zhang and Liu, 2002). The MAP kinases
signaling cascades play a vital role in mediating a number of cellular
fates, including growth, proliferation, apoptosis and survival. More
over, they also regulate the release of several inflammatory proteins
and their mediators such as COX2 and iNOS (Dhillon et al., 2007;
Porter and Vaillancourt, 1998; Zhang and Liu, 2002; Johnson and
Lapadat, 2002; Engelberg, 2004; Lee et al., 2007). The MAPK family
of proteins includes the p38 kinases, extracellular signalregulated
protein kinases (ERK1/2), and cJun NH2terminal kinases (JNK1/2).
Our results showed that BA exposure increased the splenic expres
sion of pERK1/2, pp38 and pJNK in a dosedependent manner.
The MAPKs often lead to activation of transcription factors
such as NFкB and AP1, which are important signaling molecules
implicated in cell proliferation, apoptosis, cell adhesion and inflam
matory responses (Budunova et al., 1999; Poynter et al., 2004;
Sung et al., 2006). Upon activation, NFкB and AP1 translocate to
the nucleus, where they bind to the promoter region of various
target genes, including COX2 and iNOS (Surh and Kundu, 2005).
Corroborating with the earlier reports, our findings demonstrate
that BA affected the activation of NFкB and AP1 transcription
factors.
The large scale migration of inflammatory immune cells into
areas of tissue damage marks the severity of DTH response (Grabbe
and Schwarz, 1998; Gotte, 2003; Vestweber, 2007). To assess the
immunoinflammatory potential of BA on skin, first we topically
applied BA to the mice ear pinna for evaluation of DTH reactiv
ity. DTH and contact hypersensitivity (CHS) models are frequently
employed as preclinical animal models to evaluate the effect
of immunomodulatory agents on inflammatory skin responses
(Cavani et al., 2001; Dearman and Kimber, 2002; Grabbe and
Schwarz, 1998; Enk and Katz, 1992; Wang et al., 2003). It was
observed that even topical application of BA to mice ear pinna
significantly induced DTH response as evident by increased ear
swelling and enhancement of MPO activity. Further, histopatho
logical evaluations showed the dysplastic tissue organization and
thickened epidermal layer protruding into the dermis, with the
presence of few mixed inflammatory cells.
Please cite this article in press as: Tewari, P., et al., Benzanthrone induced immunotoxicity via oxidative stress and inflammatory
mediators in Balb/c mice. Immunobiology (2014), http://dx.doi.org/10.1016/j.imbio.2014.10.011
ARTICLE IN PRESSG Model
IMBIO51229; No. of Pages 13
P. Tewari et al. / Immunobiology xxx (2014) xxx–xxx 11
Fig. 8. Effect of Benzanthrone on delayed type hypersensitivity response in ear pinna of mice. (A) Histopathological changes showing epidermal hyperplasia and infiltration
of mixed inflammatory cells in ear pinna by BA; (B) ear swelling was measured with an engineer’s micrometer Vernier Caliper at 24 h after BA challenge as described in
“Materials and methods” section; and (C) MPO activity in ear pinna. Ihe MPO activity was measured in the supernatant of ear homogenate by incubating 20 ml of diluted
sample with 180 ml of 50 mM potassium phosphate buffer, pH 6.0, containing 0.157 mg/ml odianisidine dihydrochloride and 0.0005% of H2O2 as described in “Materials and
Methods”and absorbance was measured at 450 nm. The data represent mean ± SD (n = 6). *p < 0.05, indicates significant difference from corresponding control.
Fig. 9. Schematic representation of BA induced MAPKs signaling pathway involved
in immunotoxicity.
Conclusion
Our studies provide the first evidence for the immunomodula
tory potential of BA. We have shown that BA induced inflammatory
changes are associated with the upregulation of inflammatory
markers such as COX2, iNOS, oxidative stress, enhanced DTH
response and upregualtion of several proinflammatory and regu
latory cytokines. Next, it was attempted to elucidate the signaling
events underlying BA induced pathological manifestation. We
found that BA induced immunotoxic responses were mediated by
activation of MAP kinases ERK1/2, p38, JNK and their downstream
transcription factors NFкB and AP1 (Fig. 9).
Acknowledgments
We are grateful to the Director of our institute for his keen inter
est in this study. One of us (PT) is thankful to the Council of Scientific
and Industrial Research (CSIR) for the award of Senior Research Fel
lowship. PT and RR convey their gratitude to Academy of Scientific
& Innovative Research (AcSIR), New Delhi. The financial assistance
of CSIRINDEPTH Project – BSC 0111 is gratefully acknowledged.
The manuscript is IITR communication # 3250.
References
Awasthi, A., Kuchroo, V.K., 2009. Th17 cells: from precursors to players in inflam
mation and infection. Int. Immunol. 21, 489–498.
Please cite this article in press as: Tewari, P., et al., Benzanthrone induced immunotoxicity via oxidative stress and inflammatory
mediators in Balb/c mice. Immunobiology (2014), http://dx.doi.org/10.1016/j.imbio.2014.10.011
ARTICLE IN PRESSG Model
IMBIO51229; No. of Pages 13
12 P. Tewari et al. / Immunobiology xxx (2014) xxx–xxx
Bradley, P.P., Christensen, R.D., Rothstein, G., 1982. Cellular and extracellularmyeloperoxidase in pyogenic inflammation. Blood 60, 618–622.
Budunova, I.V., Perez, P., Vaden, V.R., Spiegelman, V.S., Slaga, T.J., Jorcano, J.L., 1999.
Increased expression of p50NFkB and constitutive activation of NFкB tran
scription factors during mouse skin carcinogenesis. Oncogene 18, 7423–7431.
Burnet, F.M., 1970. The concept of immunological surveillance. Prog. Exp. TumorRes. 13, 1–27.
Cavani, A., Albanesi, C., Traidl, C., Sebastiani, S., Girolomoni, G., 2001. Effector and
regulatory T cells in allergic contact dermatitis. Trends Immunol. 22, 118–120.Cavin, C., Delatour, T., MarinKuan, M., Holzhäuser, D., Higgins, L., et al., 2007.
Reduction in antioxidant defenses may contribute to ochratoxin A toxicity andcarcinogenicity. Toxicol. Sci. 96, 30–39.
Chandra, S.V., Singh, G.B., 1968. Effect of benzanthrone on haemopoietic system of
rats. Indian J. Ind. Med. 14, 102–106.
Colour Index, 1971. The Society of Dyers and Colorists and the American Association
of Textile Chemicals and Colorists. Lund Humphries, Bradford/London.
Cooke, M.S., Evans, M.D., Dizdaroglu, M., Lunec, J., 2003. Oxidative DNA damage:mechanisms, mutation and disease. FASEB J. 17, 1195–1214.
Corsini, A.C., Clayton, C., Askonas, B.A., Ogilvie, B.M., 1977. Supressor cells and loss ofBcell potential in mice infected with Trypanosoma brucei. Clin. Exp. Immunol.
29, 122–131.
Das, M., Ansari, K.M., Dhawan, A., Shukla, Y., Khanna, S.K., 2005a. Correlation of DNAdamage in epidemic dropsy patients to carcinogenic potential of argemone oil
and isolated sanguinarine alkaloid in mice. Int. J. Cancer 117, 709–717.
Das, M., Garg, K., Joshi, A., Singh, G.B., Khanna, S.K., 1991a. Interaction of ben
zanthrone with cytochrome P450: altered patterns of hepatic xenobioticmetabolism in rats. J. Biochem. Toxicol. 6, 37–44.
Das, M., Garg, K., Singh, G.B., Khanna, S.K., 1989. Benzanthrone: a new substrate for
hepatic microsomal cytochrome P450. Biochem. Int. 18, 1237–1244.Das, M., Garg, K., Singh, G.B., Khanna, S.K., 1991b. Bioelimination and organ reten
tion profile of benzanthrone in scorbutic and non scorbutic guinea pigs. Biochem.Biophys. Res. Commun. 178, 1405–1412.
Das, M., Garg, K., Singh, G.B., Khanna, S.K., 1994. Attenuation of benzanthrone toxicity
by ascorbic acid in guinea pigs. Fundam. Appl. Toxicol. 22, 447–456.
Das, M., Babu, K., Reddy, N., Srivastava, L.M., 2005b. Oxidative damage of plasma
proteins and lipids in epidemic dropsy patients: alterations in antioxidant status.Biochem. Biophys. Acta 1722, 209–217.
Dearman, R.J., Kimber, I., 2002. Cytokine profiling and chemical allergy. Toxicol. Appl.
Pharmacol. 185, 228–229.
Descotes, J., 2005. Immunotoxicolgy: role in the safety assessment of drugs. Drug
Saf. 28, 127–136.
Dhillon, A.S., Hagan, S., Rath, O., Kolch, W., 2007. MAP kinase signalling pathways incancer. Oncogene 26, 3279–3290.
Duramad, P., Holland, N.T., 2011. Biomarkers of immunotoxicity for environmental
and public health research. Int. J. Environ. Res. Public Health 8, 1388–1401.
Dwivedi, N., Kumar, S., Ansari, K.M., Khanna, S.K., Das, M., 2013. Skin tumorigenicpotential of benzanthrone: prevention by ascorbic acid. Food Chem. Toxicol. 59,687–695.
Ellman, G.L., 1959. Tissue sulphydryl groups. Arch. Biochem. Biophys. 82, 70–77.
Engelberg, D., 2004. Stressactivated protein kinasestumor suppressors or tumor
initiators? Semin. Cancer Biol. 14, 271–282.Enk, A.H., Katz, S.I., 1992. Early events in the induction phase of contact sensitivity.
J. Invest. Dermatol. 99, 39S–41S.
Frankerberger, M., Pechumer, H., ZieglerHeitbrock, H.W.L., 1994. Interleukin10 isupregulated in LPS tolerance. J. Inflamm. 150, 2017–3007.
Gad, S.C., 1994. The mouse ear swelling test (MEST) in the 1990s. Toxicology 93,33–46.
Garg, K., Khanna, S.K., Das, M., Singh, G.B., 1992a. Comparative study of bio
disposition profile of benzanthrone in different rodent species. Food Chem.Toxicol. 30, 517–520.
Garg, K., Khanna, S.K., Das, M., Singh, G.B., 1992b. Role of extraneous supplementation of ascorbic acid on the biodisposition profile of benzanthrone in guineapigs. Food Chem. Toxicol. 30, 967–971.
Gotte, M., 2003. Syndecans in inflammation. FASEB J. 17, 575–591.
Grabbe, S., Schwarz, T., 1998. Immunoregulatory mechanisms involved in elicitation
of allergic contact hypersensitivity. Immunol. Today 19, 37–44.
Handa, T., Yamauchi, T., Sawai, K., Yamamura, T., Koseki, Y., Ishii, I., 1984. In situ emission levels of carcinogenic and mutagenic compounds from diesel and gasoline
engine vehicles on an express way. Environ. Sci. Technol. 18, 895–902.
Horakova, E., Merhaut, J., 1966. Health of workers producing benzanthrone. Prac.
Lek. 18, 78–81.
Järveläinen, H.A., Fang, C., IngelmanSundberg, M., Lindros, K.O., 1999. Effect ofchronic coadministration of endotoxin and ethanol on rat liver pathology and
proinflammatory and antiinflammatory cytokines. Hepatology 29, 1503–1510.Johnson, G.L., Lapadat, R., 2002. Mitogenactivated protein kinase pathways medi
ated by ERK, JNK, and p38 protein kinases. Science 298, 1911–1912.
Kensler, T.W., Wakabayashi, N., Biswal, S., 2007. Cell survival responses to environmental stresses via the Keap1Nrf2ARE pathway. Annu. Rev. Pharmacol.
Toxicol. 47, 89–116.
Klaunig, J.E., Xu, Y., Bachowski, S., Jiang, J., 1997. Freeradical oxygeninducedchanges in chemical carcinogenesis. In: Free Radical Toxicology. Taylor and
Francis, London, pp. 375–400.Kwon, K.H., Barve, A., Yu, S., Huang, M.T., Kong, A.N., 2007. Cancer chemoprevention
by phytochemicals: potential molecular targets, biomarkers and animal models.Acta Pharm. Sin. 28, 1409–1421.
Lee, J.C., Kundu, J.K., Hwang, D.M., Na, H.K., Surh, Y.J., 2007. Humulone inhibits phorbol esterinduced COX2 expression in mouse skin by blocking activation of
NFкB and AP1: IкB kinase as respective potential upstream targets. Carcino
genesis 28, 1491–1498.
Lefkowitz, D.L., Mills, K.C., Moguilevsky, N.A., Bollen, A., Vaz Lefkowitz, S.S., 1993.
Regulation of macrophage functions by human recombinant myeloperoxidase.Immunol. Lett. 36, 43–49.
Levine, R.L., Garland, D., Oliver, C.N., Amici, A., Climent, I., et al., 1990. Determination
of carbonyl content of oxidatively modified proteins. Methods Enzymol. 186,464–478.
Love, O.P., Shutt, L.J., Silfies, J.S., Bortolotti, G.R., Smits, J.E., Bird, D.M., 2003. Effectsof dietary PCB exposure on adrenocortical function in captive American kestrels(Falco sparverius). Ecotoxicology 12, 199–208.
Lu, Y., Wahl, L.M., 2005. Oxidative stress augments the production of matrixmetalloproteinase1, cyclooxygenase2, and prostaglandin E2 through enhance
ment of NFKappa B activity in lipopolysaccharideactivated human primarymonocytes. J. Immunol. 175, 5423–5429.
Lundy, D., Eaton, J., 1994. Occupational Health Hazards Posed by Inventory U.S.
Army Smoke/Obscurant Munitions (Review Update). WRAIR/RT94001. ADA276774. U.S. Army Medical Research Detachment, WrightPatterson Air Force
Base, Ohio for Walter Reed Army Institute of Research, Washington, DC.
Mehrotra, N.K., Singh, G.B., Khanna, S.K., 1975. Blood coagulation disturbances dueto benzanthrone. Ind. Health 13, 101–103.
Mishra, H.P., Fridovich, I., 1972. The role of superoxide anion in the autoxidationof epinephrine and a simple assay for superoxide dismutase. J. Biol. Chem. 247,
3170–3175.Moron, M.S., Depierre, J.W., Mannervik, B., 1979. Levels of glutathione, glutathione
reductase and glutathione Stransferase activities in rat lung and liver. Biochim.
Biophys. Acta 582, 67–78.NIOSH, 1979. Toxic Effects of Chemical Substances – BA. USNTIS Report US
AMBRDLTR7704., pp. 34–45.
Pandya, K.P., Singh, G.B., Dhasmana, A., 1976. Urinary excretion of benzanthrone.Toxicol. Appl. Pharmacol. 38, 217–219.
Pabello, N.G., Lawrence, D.A., 2006. Neuroimmunotoxicology: modulation of neuroimmune networks by toxicants. Clin. Neurosci. Res. 6, 69–85.
Porter, A.C., Vaillancourt, R.R., 1998. Tyrosine kinase receptoractivated signal transduction pathways which lead to oncogenesis. Oncogene 17, 1343–1352.
Poynter, M.E., Cloots, R., van Woerkom, T., Butnor, K.J., Vacek, P., Taatjes, D.J., Irvin,
C.G., JanssenHeininger, Y.M., 2004. NFkappa B activation in airways modulates allergic inflammation but not hyper responsiveness. J. Immunol. 173,
7003–7009.Ramdahl, T., 1983. Polycyclic aromatic ketones in environmental samples. Environ.
Sci. Technol. 17, 666–670.
Rice, D.C., Hayward, S., 1997. Effects of postnatal exposure to a PCB mixture in
monkeys on nonspatialdiscrimination reversal and delayed alternation perfor
mance. Neurotoxicology 18, 479–494.
Rogaku, E.P., Pilch, D.R., Orr, A.H., Ivanova, V.S., Bonner, W.M., 1998. DNA doublestranded breaks induce histone H2AX phosphorylation on serine 139. J. Biol.
Chem. 273, 5858–5868.
Rotruck, J.T., Pope, A.L., Ganther, H.E., Swanson, A.B., Hafeman, D.G., Hoekstra, W.G.,
1973. Selenium: biochemical role as a component of glutathione peroxidase.Science 179, 588–590.
Sawacki, E., 1967. Airborne carcinogens and allied compounds. Arch. Environ. Health
14, 46–53.
Sawacki, E., Stanley, T.W., Elbert, W.C., 1965. Analysis of urban atmosphere and
air pollution source effluents for phenalcnlone and 7Hbenz (de)anthracen7one. Mikrochim. Acta 5–6, 1110–1123.
Saxena, N., Ansari, K.M., Kumar, R., Dhawan, A., Dwivedi, P.D., Das, M., 2009. Patulin
causes DNA damage leading to cell cycle arrest and apoptosis through modulation of Bax, p53 and p21/WAF1 proteins in skin of mice. Toxicol. Appl. Pharmacol.
234, 192–201.
Shridhar, S., Farley, A., Reid, R.L., Foster, W.G., Van Vugt, D.A., 2001. The effect of2,3,7,8tetrachlorodibenzopdioxin on corticotrophinreleasing hormone, argi
nine vasopressin, and proopiomelanocortin mRNA levels in the hypothalamusof the cynomolgus monkey. Toxicol. Sci. 63, 181–188.
Sinha, A.K., 1972. Colorimetric assay of catalase. Anal. Biochem. 47, 389–394.
Singh, G.B., Zaidi, S.H., 1969. Preliminary clinical and experimental studies on benzanthrone toxicity. J. Indian Med. Assoc. 53, 558–560.
Singh, G.B., Tripathi, V.N., 1973. Effect of benzanthrone on the urinary bladder ofguinea pig. Experientia 29, 683–684.
Singh, G.B., Khanna, S.K., Das, M., 1990. Recent studies on toxicity of benzanthrone.J. Sci. Ind. Res. 49, 288–296.
Strieter, R.M., Kunkel, S.L., 1994. Acute lung injury: the role of cytokines in the
elicitation of neutrophils. J. Investig. Med. 42, 640–651.Sugiyama, S., Okada, Y., Sukhova, G.K., Virmani, R., Heinecke, J.W., Libby, P., 2001.
Macrophage myeloperoxidase regulation by granulocyte macrophage colony
stimulating factor in human atherosclerosis and implications in acute coronarysyndromes. Am. J. Pathol. 158, 879–891.
Sung, B., Park, S., Yu, B.P., Chung, H.Y., 2006. Amelioration of agerelated inflammationand oxidative stress by PPARgamma activator: suppression of NFkappaB by2,4thiazolidinedione. Exp. Gerontol. 41, 590–599.
Surh, Y.J., Kundu, J.K., 2005. Signal transduction network leading to COX2 induction:a road map in search of cancer chemopreventives. Arch. Pharm. Res. 28, 1–15.
Takahiko, N., Makiko, V., Kazuo, H., et al., 2002. Neutrophil infiltration of culpritlesions in acute coronary syndromes. Circulation 106, 2894–2900.
Please cite this article in press as: Tewari, P., et al., Benzanthrone induced immunotoxicity via oxidative stress and inflammatory
mediators in Balb/c mice. Immunobiology (2014), http://dx.doi.org/10.1016/j.imbio.2014.10.011
ARTICLE IN PRESSG Model
IMBIO51229; No. of Pages 13
P. Tewari et al. / Immunobiology xxx (2014) xxx–xxx 13
Trivedi, D.H., Niyogi, A.K., 1968. BA hazard in dye factory. Indian J. Ind. Med. 14,13–22.
Utley, G.H., Bernheim, F., Hochstein, P., 1967. Effect of sulphydryl reagents on peroxidation in microsomes. Arch. Biochem. Biophys. 118, 29–32.
van de Veerdonk, F.L., Joosten, L.A., Shaw, P.J., Smeekens, S.P., Malireddi, R.K., van derMeer, J.W., Kullberg, B.J., Netea, M.G., Kanneganti, T.D., 2011. The inflammasomedrives protective Th1 and Th17cellular responses in disseminated candidiasis.Eur. J. Immunol. 41, 2260–2268.
Venkatraman, K., 1952. The chemistry of synthetic dyes: BZ derivatives. In: Fiescr,
L.F., Fieser, M. (Eds.), Organic and Biological Chemistry. A Series of Monographs.
Academic Press, New York, pp. 958–983.
Vestweber, D., 2007. Adhesion and signaling molecules controlling the transmigration of leukocytes through endothelium. Immunol. Rev. 218, 178–196.
Wang, B., Esche, C., Mamelak, A., Freed, I., Watanabe, H., Sauder, D.N., 2003. Cytokineknockouts in contact hypersensitivity research. Cytokine Growth Factor Rev. 14,
381–389.
Walker, C.H., Oesch, F., 1983. In: Cadwell, J., Jakoby, W.B. (Eds.), Biological Basis ofDetoxification. Academic Press, New York, pp. 349–368.
Wong, C.K., Ho, C.Y., Ko, F.W., Chan, C.H., Ho, A.S., Hui, D.S., Lam, C.W., 2001.
Proinflammatory cytokines (IL17, IL6, IL18 and IL12) and Th cytokines
(IFNgamma, IL4, IL10 and IL13) in patients with allergic asthma. Clin. Exp.Immunol. 125, 177–183.
Yadav, A., Kumar, A., Dwivedi, P.D., Tripathi, A., Das, M., 2012. In vitro studies onimmunotoxic potential of Orange II in splenocytes. Toxicol. Lett. 208, 239–245.
Yadav, A., Kumar, A., Tripathi, A., Das, M., 2013. Sunset yellow FCF, a permitted fooddye, alters functional responses of splenocytes at noncytotoxic dose. Toxicol.
Lett. 217, 197–204.
Zhang, W., Liu, H.T., 2002. MAPK signal pathways in the regulation of cell proliferation in mammalian cells. Cell. Res. 12, 9–18.
Recommended