Bacterial gene inactivation using pcr products

Inactivation of genes in bacteria

using PCR products

Requirements for the method

and adaptations to different models

Luis M. Ramírez Ch.

Why do we inactivate genes?

Is not it just a hobby?

Gene targeting: The classical approach

• Central to an understanding of the in vivo

function of genes is their analysis by mutation,

that is, inactivation or modification of a gene

by mutation and the study of the

consequences of the mutation in the mutant

organism.

Rajewsky et al. J. Clin. Invest. 1996.

Inactivation of genes in bacteria

using PCR products:

step by step

PCR amplify of a FRT-flanked resistance gene

Baba et al. Molecular Systems Biology. 2006.

Transform strain expressing λ Red Recombinase

Select antibiotic resistant transformants

Baba et al. Molecular Systems Biology. 2006.

Eliminate resistance cassette using a

FLP expression plasmid

Baba et al. Molecular Systems Biology. 2006.

Structure of deletions

Baba et al. Molecular Systems Biology. 2006.

Requirements

PCR amplify of a FRT-flanked resistance gene

Baba et al. Molecular Systems Biology. 2006.

Requirements for the step

• A Plasmid carrying a λ Red Recombinase system

Datsenko & Wanner. 2000. Liang & Liu. 2000.

Requirements for the step

• A Plasmid carrying a λ Red Recombinase system

Gust et al. 2004. Chaveroche et al. 2000.

Requirements for the step

• A Plasmid carrying a λ Red Recombinase system

• A template plasmid carrying an antibiotic resistance

gene flanked by FRT recombination sites

Datsenko & Wanner. PNAS. 2000.

Some tips..

• Use pKD3 (Cm) or pKD4 (Kan) if you would like toknockout a gene with minimal polarity effects ondownstream genes.

• Use pKD13 (Kan), pKD32 (Cm), or pKD81 (Kan fromTn903) to knockout entire operons, single genes, or anyother situation in which polarity shouldn’t matter.

Kim. 2001

from: http://falkow.stanford.edu/whatwedo/general/wanner.pdf

Requirements for the step

• Primer design

Datsenko & Wanner. PNAS. 2000. Baba et al. Molecular Systems Biology. 2006.

Requirements for the step

• Primer design (using pKD4 as a template)

Datsenko & Wanner. PNAS. 2000.

Forward:

(47 bp upstream sequence)(ATG)(TGTAGGCTGGAGCTGCTTCG)

Reverse:

(Codons for the

6 C Terminal residues)(Stop codon)(29-nt downstream)(TATGAATATCCTCCTTAG)

Baba et al. Molecular Systems Biology. 2006.

Transform strain expressing λ Red Recombinase

Select antibiotic resistant transformants

Baba et al. Molecular Systems Biology. 2006.

Requirements for the step

• Prepare electrocompetent cells. The media

must contain the inductor (L-Arabinose)

• Electroporate as much as possible DNA you

can, even though the ammount depends on

the species. High, but not enough to cause

arcing. So, to avoid arcing, DNA must be as

clean as possible.

Eliminate resistance cassette using a FLP

expression plasmid

Baba et al. Molecular Systems Biology. 2006.

Structure of deletions

Baba et al. Molecular Systems Biology. 2006.

Adaptation to different models

• Pseudomonas aeruginosa

(Lesic & Rahme. BMC Molecular Biology 2008, 9:20)

• Yersinia spp.

(Derbise, Lesic, Dacheux, Ghigo, Carniel. FEMS

Immunology and Medical Microbiology 2003 38:113-

116)

Pseudomonas aeruginosa

Lesic & Rahme. 2008

Thanks