View
2
Download
0
Category
Preview:
Citation preview
1
Function of VPA1418 and VPA0305 Catalase Genes in Growth of Vibrio 1
parahaemolyticus under Oxidative Stress 2
3
Ching-Lian Chen, Shin-yuan Fen, Chun-Hui Chung, Shu-Chuan Yu, 4
Cheng-Lun Chien, and Hin-chung Wong* 5
6
Department of Microbiology, Soochow University, Taipei, Taiwan 111, 7
Republic of China 8
9
Running title: KatE of Vibrio parahaemolyticus 10
Key words: Vibrio parahaemolyticus; catalase; mutant; oxidative stress 11
12
* Corresponding author. Mailing address: Department of Microbiology, 13
Soochow University, Taipei, Taiwan 111, Republic of China. Phone: 14
(886) 2-28819471, ext. 6852. Fax: (886) 2-28831193. E-mail: wonghc@ 15
scu.edu.tw. 16
17
Aug. 5, 2015 18
Revised: Nov. 23, 2015 19
20
AEM Accepted Manuscript Posted Online 8 January 2016Appl. Environ. Microbiol. doi:10.1128/AEM.02547-15Copyright © 2016, American Society for Microbiology. All Rights Reserved.
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
2
ABSTRACT 21
22
The marine foodborne enteropathogen, Vibrio parahaemolyticus, has 23
four putative catalase genes. The function of two katE-homologous genes, 24
katE1 (VPA1418) and katE2 (VPA0305), in the growth of this bacterium 25
was examined using gene deletion mutants with or without 26
complementary genes. The growth of the mutant strains in static or 27
shaken cultures in a rich medium at 37oC or low temperatures (12 and 28
4oC), with or without competition from Escherichia coli, did not differ 29
from that of the parent strain. When 175 μM of extrinsic H2O2 was added 30
to the culture medium, bacterial growth of the ΔkatE1 strain was delayed 31
and those of the ΔkatE1E2 and ΔkatE1-ahpC1 double mutant strains were 32
completely inhibited at 37oC for eight hours. The sensitivity of the 33
ΔkatE1 strain to the inhibition of growth by H2O2 was higher at low 34
incubation temperatures (12 and 22oC) than at 37oC. The determined gene 35
expression of these catalase and ahpC genes revealed that katE1 was 36
highly expressed in wild-type strain at 22oC under H2O2 stress, while the 37
katE2 and ahpC genes may play an alternate or compensatory role in the 38
ΔkatE1 strain. This study demonstrated that katE1 was the chief 39
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
3
functional catalase for detoxifying extrinsic H2O2 during logarithmic 40
growth, and the function of these genes was influenced by incubation 41
temperature. 42
43
Key words: Vibrio parahaemolyticus; catalase; mutant; oxidative stress, 44
hydrogen peroxide 45
46
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
4
47
Various reactive oxygen species (ROS), such as superoxide anion 48
(O2-), hydrogen peroxide (H2O2) and hydroxyl radical (.OH), are 49
generated by intrinsic metabolic activity in bacteria or induced by 50
environmental stresses (1-3). ROS are detrimental to cellular components, 51
including proteins, DNA and membrane lipids (4). 52
Most bacteria are equipped with various antioxidative enzymes for 53
scavenging ROS. Superoxide dismutase (SOD) transforms superoxide 54
anions into hydrogen peroxide, while catalase decomposes hydrogen 55
peroxide into oxygen and water. Two families of catalases, HPI (KatG) 56
and HPII (KatE), have been identified in Escherichia coli and some other 57
enteric bacteria (5). HPI, which is the family of bifunctional 58
catalases/peroxidases, is transcriptionally induced during logarithmic 59
growth in response to low concentrations of hydrogen peroxide. This 60
induction requires the positive activator OxyR, which directly senses 61
oxidative stress. HPII, the family of monofunctional catalases, is not 62
peroxide-inducible and is transcribed at the transition from exponential 63
growth to the stationary phase by the product of the rpoS gene, which is a 64
critical factor in the survival of bacteria in the stationary phase or under 65
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
5
other stresses (6, 7). OxyR also regulates the transcription of the alkyl 66
hydroperoxide reductase subunit C (ahpC) gene, which encodes a 67
2-cysteine peroxiredoxin for detoxifying organic peroxides (8, 9). 68
Food processing commonly imposes stresses on foodborne pathogens 69
and these stresses may account for the formation of ROS. Campylobacter 70
accumulates hydrogen peroxide under freeze-thaw treatment (10). 71
Environmental stresses lower the level of cellular SOD and catalase in 72
Vibrio parahaemolyticus, while increasing the susceptibility of this 73
pathogen to oxidative stress (11, 12). We have previously demonstrated 74
that the level of intracellular ROS is related to the survival of V. 75
parahaemolyticus under a combination of cold, starvation and low 76
salinity (13). Therefore, the functions of antioxidative factors may be 77
crucial to the persistence of these foodborne pathogens in the 78
environment. Also, extracellular ROS may be generated by other bacteria 79
or host of bacterial infection (14-16), and the presence of extracellular 80
catalase has been demonstrated in V. cholerae (17). The functions of 81
antioxidative factors may enhance the virulence of infectious bacteria in 82
human beings, establish natural symbionts in aquacultured animals (16), 83
and enable the successful growth of bacteria in the presence of 84
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
6
competitors. 85
V. parahaemolyticus is a halophilic Gram-negative bacterium that 86
frequently causes foodborne gastroenteritis in Taiwan and some Asian 87
countries (18), and has become a pathogen of global concern following 88
the appearance of the first pandemic O3:K6 strain in 1996 (19). In a 89
search of the genome sequence of the V. parahaemolyticus strain 90
RIMD2210633 (20), two katE- and two katG-homologous genes were 91
identified, namely, katE1 (VPA1418), katE2 (VPA0305), katG1 92
(VPA0768) and katG2 (VPA0453). VPA0768). Recently, four proteins 93
exhibiting catalase or catalase/peroxidase activity are demonstrated using 94
zymogram in V. parahaemolyticus, whereas two catalases are induced in 95
the exponential/early stationary phase (21). Unfortunately, the identities 96
of these proteins are not determined (21) and the functions of specific 97
catalase genes remain unclear. In addition to these catalase genes, 98
alkylhydroperoxide reductase subunit C gene (ahpC1) was also 99
responsive to different peroxides (22, 23). To understand the role of 100
specific catalase genes in the growth of V. parahaemolyticus under the 101
challenge of peroxides, low temperature and the presence of competitive 102
bacterium, the deletion mutants of katE1 and katE2 with and without 103
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
7
complementary genes were constructed and characterized. 104
105
MATERIALS AND METHODS 106
107
Bacterial strains and culture conditions. V. parahaemolyticus strain 108
KX-V231 (Kanagawa phenomenon positive, serotype O3:K6), isolated in 109
Thailand from a clinical specimen, was used in this study (Table 1). It 110
was stored frozen at -85°C in beads in Microbank cryovials (PRO-LAB 111
Diagnostics, Austin, TX, USA). It was cultured at 37°C on Tryptic Soy 112
Agar (Becton-Dickinson Diagnostic Systems, Sparks, MD, U.S.A.) that 113
was supplemented with 3% sodium chloride (TSA-3% NaCl), or in 114
Tryptic soy broth-3%NaCl (TSB-3%NaCl) in a 5 ml tube, which was 115
shaken at 160 rpm. A 50 μl aliquot of the 16 h broth culture was 116
inoculated into 5 ml of fresh TSB-3% NaCl and incubated at 37°C with 117
shaking for 2 h, to enter the exponential phase (around 108 CFU/ml) and 118
this culture was used as the inoculum in the following experiments. E. 119
coli was cultured in Luria-Bertani Broth (LB, Becton-Dickinson) at 37oC 120
and shaken at 160 rpm. Chloramphenicol (final concentration of 6 μg/ml) 121
or chloramphenicol (20 μg/ml)/ampicillin (50 μg/ml) was added to the 122
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
8
media as required for the cultivation of some of the V. parahaemolyticus 123
or E. coli strains, respectively. 124
125
Construction of deletion mutants. Deletion mutants of the catalase 126
genes (katE1 and katE2) were constructed following the published 127
methods (23, 24). For constructing ΔkatE2 mutant strain, two DNA 128
fragments were amplified by PCR with V. parahaemolyticus KX-V231 129
chromosomal DNA as the template – one with the primer pair 130
VPA0305-1 and VPA0305-2 and the other with the primer pair 131
VPA0305-3 and VPA0305-4 (Table 2). These two amplified fragments 132
were then used as templates for a second PCR with the primers 133
VPA0305-1 and VPA0305-4, resulting in the construction of a fragment 134
with a deletion in the VPA0305 gene. Such a fragment, that contained the 135
deletion was purified, and cloned into the pGEMT-easy vector and 136
transformed into E. coli XL1 blue, following the protocol of the 137
manufacturer (Promega Co., Madison, WI, U.S.A.). The inserted 138
sequence was verified by sequencing. This fragment was then removed 139
from the pGEMT-easy vector by digestion using SacI and SphI and 140
cloned into a suicide vector, pDS132, which contained the 141
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
9
chloramphenicol-resistant gene and the sacB gene, conferring sensitivity 142
to sucrose. This plasmid (pDS132-katE2-deletion) was introduced into E. 143
coli SM10-pir and then mated with V. parahaemolyticus strain KX-V231. 144
Thiosulfate-citrate-bile-sucrose (TCBS) agar that contained 145
chloramphenicol was used to screen the V. parahaemolyticus cells 146
containing the inserted plasmid. The V. parahaemolyticus clones were 147
isolated and cultured in LB broth that was supplemented with 2% NaCl 148
and chloremphenicol. DNA was extracted from these cultures and the 149
inserted sequence was detected by PCR using the VPA0305-1 and 150
VPA0305-4 primers. The culture that contained pDS132-katE2-deletion 151
plasmid was incubated at 37oC for 3 hours in the LB broth that contained 152
2% NaCl and then plated on an LB agar plate that contained 2% NaCl 153
and 10% sucrose. The colonies isolated that were unable to grow on LB 154
agar plate that contained chloremphenicol were selected, and the 155
homologous recombination of the deleted fragment was verified by PCR 156
(Table 2). Amplification of the katE2 gene with the primers VPA0305-0 157
and VPA0305-5 yielded amplicons of 3,275 bp or 1,733 bp in the 158
wild-type strain or ΔkatE2 strain, respectively. The mutated gene was also 159
verified by the nucleotide sequencing of the amplified fragments. 160
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
10
Following the same procedures using different primers (Table 2), the 161
ΔkatE1 strain was also constructed. The ΔkatE1E2 double mutant was 162
prepared similarly by construction of the katE2 gene deletion in strain 163
ΔkatE1, while ΔkatE1-ahpC1 was prepared similarly by construction of 164
the ahpC1 gene deletion in strain ΔkatE1. 165
Sequencing service was provided by Genomics BioSci & Tech, Inc., 166
Taipei, using Sanger’s method with Applied Biosystems 3730 analyzer. 167
168
Construction of complementary strains. The entire length of katE2 169
gene was amplified by PCR with V. parahaemolyticus KX-V231 170
chromosomal DNA as the template using primer pairs VPA0305-C1 and 171
VPA0305-C2 with restriction enzyme linkers (SalI, SphI) (Table 2). The 172
amplicon was digested with SalI and SphI, and ligated to the shuttle 173
vector pSCB01 which had been digested with the same enzymes (23). 174
The plasmid, pSCB01-katE2, containing the entire lengths of katE2 gene, 175
was propagated in E. coli SM10 λ-pir and conjugated to the 176
corresponding ΔkatE2 strain to generate gene complementation, which 177
was selected by their chloramphenicol resistance (Table 1). The presence 178
of entire length of katE2 gene in these strains was verified by PCR. 179
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
11
Following the same procedures, the complementation of katE1 gene in 180
the ΔkatE1 strain was also constructed (Table 1). 181
182
Effects of peroxides on bacterial growth. The V. parahaemolyticus 183
cultures in the exponential phase (200 μl) were dispensed into the wells 184
of a microtiter plate, to which various concentrations of H2O2 (Santoku 185
Chemical Industries, Tokyo, Japan), cumene hydroperoxide (cumene, 186
Alfa Aesar, Ward Hill, MA, U.S.A.) or tert-butyl hydroperoxide 187
(t-BOOH, Tokyo Kasei Chemicals, Tokyo, Japan) were added; the 188
cultures were then incubated statically at 37oC or 22oC for 8 h, or at 12 oC 189
for 56 h. Bacterial growth was determined by measuring the absorbance 190
of the culture at 590 nm using an MRXII microplate reader (Dynex 191
Technologies, Chantilly, VI, U.S.A.). 192
193
Low temperature stress. V. parahaemolyticus cultures in the 194
exponential phase (200 μl) were dispensed into the wells of a microtiter 195
plate, and statically incubated at 12oC. Bacterial growth was determined 196
by measuring the absorbance at 590 nm. In another experiment, the V. 197
parahaemolyticus cultures in the exponential phase were tenfold diluted 198
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
12
in TSB-3% NaCl and 100 ml volumes of these diluted cultures were 199
incubated at 4oC. At intervals, the survivors were counted on TSA-3% 200
NaCl agar. 201
202
Growth competition. Wild-type and mutant V. parahaemolyticus 203
strains were grown in a co-culture with E. coli SM10λ-pir that was 204
harboring pDS132. The V. parahaemolyticus culture in the exponential 205
phase was diluted tenfold in fresh TSB-1% NaCl. E. coli were cultured in 206
LB that contained chloramphenicol (20 μg/ml) until they reached the 207
exponential phase. The V. parahaemolyticus and E. coli cultures were 208
inoculated separately into TSB-1% NaCl or mixed in a 1:40 (v/v) ratio 209
and then inoculated; they were subsequently incubated statically or with 210
shaking at 160 rpm for 8 h. The V. parahaemolyticus and E. coli cells 211
were counted on TSA-3% NaCl that was supplemented with 15 μg/ml 212
ampicillin and Luria-Bertani (LB) agar that was supplemented with 5 213
μg/ml chloramphenicol, respectively, following incubation at 37oC for 16 214
h. To count the bacteria with the complementary gene, LB agar was used, 215
on which V. parahaemolyticus formed pale yellow, large colonies while 216
the E. coli formed white, small colonies. 217
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
13
218
Quantitative reverse transcription polymerase chain reaction. The 219
expression of genes (Table 3) was determined in the wild-type and 220
ΔkatE1 using the real-time quantitative reverse transcription-polymerase 221
chain reaction (RT-qPCR)(23). Briefly, bacterial strains were cultivated 222
statically in TSB-3% NaCl at 22 or 37oC, and the cultures in exponential 223
phase were challenged with 175 μM H2O2 for 1.5 h. Bacterial cells were 224
harvested by centrifugation, broken by TRIzol®Reagent (Invitrogen, U.K.) 225
and RNA samples were extracted using an RNApure kit (Genesis Biotech 226
Inc., Taipei, Taiwan), following the manufacturer's instructions. RNA 227
samples were treated with DNase I (Takara Bio Inc., Shiga, Japan) and 228
then reverse-transcribed using a SuperScript® III First-Strand Synthesis 229
SuperMix (Invitrogen, U.K.), following the instructions of the 230
manufacturer. Primers (Table 3) were designed using the Primer Express 231
Sequence Editor (http://www.fr33.net/seqedit.php) and Oligo Calculator 232
(http://www.sciencelauncher.com/oligocalc.html), and 16S rRNA was 233
used as the internal control. Real-time PCR was performed using the 234
StepOnePlus Real-Time PCR system v.2.0 (Applied Biosystems) with a 235
IQ2 SYBR Green Fast qPCR System Master Mix – High ROX (DBU-008) 236
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
14
and RT-PCR reagents. All the data were normalized with the 16S gene 237
expression levels of the culture at each time point and the normalized 238
values for each gene were compared (Applied Biosystems). Expression of 239
each target gene of the experimental group in relative to the expression of 240
the corresponding gene of the control was presented. Recombinant 241
plasmids for the target genes were used as a calibration standard (Table 242
1)(23). The quality of the RNA samples and the quantification protocols 243
that were adopted herein was evaluated by previously described methods 244
(23). 245
246
Statistical analysis. Triplicate experiments were performed, and the 247
data of the bacterial growth experiments were obtained from triplicate 248
determinations. The data were analyzed by performing one-way ANOVA 249
or t-test at a significance level of α = 0.05, using SPSS for Windows 250
version 11.0 (SPSS Inc., Chicago, IL, USA). 251
252
RESULTS 253
254
Growth and survival of catalase gene mutants. To evaluate the 255
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
15
significance of these katE-homologous genes in the growth of V. 256
parahaemolyticus under normal growth condition, the growth of the 257
single (ΔkatE1, ΔkatE2) and double (ΔkatE1E2) catalase gene mutants, 258
gene complementary strains (ΔkatE1/katE1, ΔkatE2/katE2) and the 259
wild-type strain (Table 1) in TSB-3% NaCl at 37oC under either shaking 260
or static conditions was determined. Bacterial growth was promoted by 261
shaking at 160 rpm, which approached the late exponential phase after 4 262
h of incubation, when they reached a maximal absorbance of about 4 at 263
590 nm (Supplementary Fig. S1) and cell density of about 1010 CFU/ml 264
(data not shown). In the static culture, the growth of bacterial cells 265
approached the stationary phase after 3 h of incubation, exhibiting a 266
maximal absorbance of about 0.7 at 590 nm (Fig. S1). No defective 267
growth was observed for these mutants under these conditions as 268
compared to the growth of the wild-type strain. Nevertheless, presence of 269
complementary katE2 gene in the △katE2 strain slightly affected its 270
growth, especially enhanced the growth of the shaking culture after 271
incubating for 6-8h (Fig. S1A). It suggests that the shaking culture 272
instead of the static culture may generate oxidative stress that activates 273
the expression of the katE2 gene. 274
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
16
Incubating these cultures statically at 12oC slowed down the growth 275
of the bacterial cells, and the cultures approached the late exponential 276
phase after 25 h of incubation; and reached a maximal absorbance of 0.5 277
after 55 h (data not shown). 278
Population of the culturable cells of the wild-type strain, ΔkatE1, 279
ΔkatE1E2 and ΔkatE1/ katE1 in TSB-3% NaCl were equal following 280
static incubation at 4oC. A slow decline in the number of culturable cells 281
was observed over time, and 108-109 CFU/ml remained culturable and 282
about 0.5x108 CFU/ml had been killed after 52 h of incubation (data not 283
shown). Results revealed that deletion mutations of these 284
katE-homologous genes did not influence on the growth and survival of 285
this pathogen in rich medium under growth-permitting (12-37oC) or 286
refrigerating temperatures. These results also suggest the presence of 287
efficient compensatory mechanism in these catalase-deficient mutants 288
under these conditions. 289
290
Growth of catalase gene mutant in co-culture with E. coli. 291
Extracellular ROS are produced by some bacteria species, such as 292
Enterococcus faecalis (25), while efflux of H2O2 also occurs in E. coli 293
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
17
(26). The catalase-deficient cells have a growth disadvantage over 294
catalase-proficient cells in a mixed culture (26). Thus, these catalase gene 295
mutations may decrease the competition of V. parahaemolyticus in 296
co-cultures and influences on its persistence in natural environment. In 297
this study, the growth of wild-type and different catalase mutants 298
co-cultured with E. coli was assayed. The TSB-1% NaCl medium 299
provided rapid growth for both species in shaken culture (Fig. 1A). In the 300
co-culture, the initial density of E. coli was ten times that of the V. 301
parahaemolyticus strains. In the shaken single culture, both the V. 302
parahaemolyticus strains and E. coli grew rapidly. In the co-culture, V. 303
parahaemolyticus strains, at much lower initial density than those of E. 304
coli, multiplied rapidly and became the dominant population after two to 305
three hours of incubation, after which the growth of E. coli was inhibited. 306
The cell densities of the V. parahaemolyticus strains at 6-8 h of 307
incubation were significantly lower in the co-culture than in the single 308
culture, nevertheless, deletion mutation of these catalase genes did not 309
significantly affected their growth competition (Fig. 1). 310
In the static culture, the population of E. coli remained at 107 CFU/ml 311
for 8 h of incubation when they were cultured separately or in the 312
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
18
co-culture. The V. parahaemolyticus strains, with a much lower initial 313
density in the co-culture, rapidly reached the maximal density of 109 314
CFU/ml after 4 h of incubation. Deletion mutation of these catalase genes 315
did not significantly affect its growth and competition under static culture 316
(Fig. S2). 317
318
Growth of catalase gene mutants in presence of extrinsic H2O2. The 319
addition of 175 or 200 μM of H2O2 to the TSB-3% NaCl medium 320
significantly slowed the growth of the wild-type strain of V. 321
parahaemolyticus at 37oC, and delayed the reaching of the exponential 322
and stationary phase (Fig. 2A). The concentrations of H2O2 used in this 323
study were not lethal to V. parahaemolyticus and it did not significantly 324
decay during the incubation time (data not shown). When 175 μM of 325
H2O2 was applied to catalase mutant strains, the bacterial growth of 326
ΔkatE2 was slightly delayed in, of ΔkatE1 was markedly delayed in, and 327
of the double mutants ΔkatE1E2 and ΔkatE1-ahpC1 was completely 328
inhibited (Fig. 2B). The growth of the ΔkatE1 strain that was inhibited by 329
H2O2 was restored in the complementary katE1 gene, while the growth of 330
ΔkatE2 in the presence of the complementary katE2 gene did not differ 331
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
19
significantly from that of the wild-type strain that harbored the cloning 332
vector (KX-V231V)(Fig. 2C). When considering the cultivation of 333
ΔkatE1/katE1, ΔkatE2/katE2 and KX-V231V in medium containing 334
chloramphenicol to maintain the plasmids in the cells, growth of 335
ΔkatE1/katE1 under extrinsic H2O2 was accelerated and reached late 336
exponential phase about one hour earlier than the other two strains 337
containing plasmids (Fig. 2C). Experimental results of Fig. S1 and Fig. 2 338
demonstrated that both katE1 and katE2 were functional, while katE1 was 339
more important than katE2 as the protective gene in the exponential phase 340
of V. parahaemolyticus against extrinsic H2O2, and the presence of 341
complementary katE1 in plasmid may provide sufficient protection 342
against extrinsic H2O2 and the growth inhibitory effect of 343
chloramphenicol. These results also suggest that ahpC1 may be the H2O2 344
detoxifier in the absence of katE1 (Fig. 2B). 345
346
Growth of catalase gene mutants in presence of extrinsic organic 347
peroxides. The addition of 60 or 90 μM of cumene significantly slowed 348
the growth of the wild-type strain of V. parahaemolyticus at 37oC (Fig. 349
S3A). When 60 μM of cumene was applied to the single and double 350
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
20
catalase mutant strains at 37oC, their growth did not differ significantly 351
from that of the wild-type strain (Fig. S3B). 352
Adding 100 or 130 μM of t-BOOH to the wild-type culture slightly 353
reduced the extent of bacterial growth at 37oC and the bacteria reached a 354
lower maximal absorbance than those in the control group without 355
peroxide. Adding 130 μM of t-BOOH did not cause the growth of these 356
catalase mutant strains to differ significantly from that of the wild-type 357
strain (data not shown). These experiments suggest that these 358
katE-homogenous genes may not detoxify organic peroxides. 359
360
Effect of H2O2 on growth of catalase gene mutants at 22 and 12oC. 361
At 22oC, 175μM of H2O2 strongly inhibited the growth of the ΔkatE1, 362
ΔahpC1 and double mutants of ΔkatE1E2 and ΔkatE1-ahpC1, and had no 363
significant effect on the growth of ΔkatE2 (Fig. 3A). Presence of 364
complementary gene of katE1 restored the growth of ΔkatE1 that was 365
inhibited by H2O2 (Fig. 3B). 366
At 12oC, the growth of bacteria was slowed. The corresponding 367
experiment was performed for 56 h. The presence of 70 μM of H2O2 368
inhibited the growth of the double mutant ΔkatE1E2 only for a period of 369
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
21
about 40 h, and the growth resumed thereafter. This concentration of 370
H2O2 had no effect on the wild-type and other mutant strains (Fig. 4A). A 371
100 μM concentration of H2O2 completely inhibited the growth of 372
ΔkatE1E2 for a full 56 h (Fig. 4B). A 175 μM concentration of H2O2 373
completely inhibited the growth of ΔkatE1 and ΔkatE1E2 at 12oC, but did 374
not affect the growth of the wild-type strain or ΔkatE2 (Fig. 4C). These 375
experiements showed that the susceptibility of the ΔkatE1 to extrinsic 376
H2O2 was sensitized at incubation temperatures lower than 37oC, and it 377
suggests that behavior of these genes in V. parahaemolyticus is 378
influenced by incubation temperatures. 379
380
Expression of catalase genes. In order to study how these catalase 381
genes are influenced by incubation temperatures, expression of the 382
catalase (katE1, katE2, katG1, katG2), ahpC1 and ahpC2 genes in the 383
exponential phase with and without the challenge of extrinsic H2O2 was 384
determined by RT-qPCR. Under the stress of extrinsic H2O2, the 385
expression of katE1, katE2 and ahpC1 in the wild-type strain was 386
significantly higher at an incubation temperature of 22oC than at an 387
incubation temperature of 37oC, whereas katE1 showed 4.7 and 0.5 fold 388
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
22
change at 22oC and 37oC, respectively (Fig. 5A). 389
When the ΔkatE1 strain was cultured under normal conditions 390
without challenge by extrinsic H2O2, the expression of ahpC1 and ahpC2 391
was significantly higher at 37oC than at 22oC (Fig. 5B). Under the 392
challenge of extrinsic H2O2, the expression of ahpC1, ahpC2 and 393
VPA0305 genes was significantly higher at 22oC than at 37oC (Fig. 5C), 394
while no significant difference was observed between the expressions of 395
the two katG-homologous genes (katG1, katG2) (data not shown). 396
397
DISCUSSION 398
399
Vibrio species have one to four catalase genes. V. fischeri has a single 400
katA gene, which is critical in forming symbionts in its squid host (16), 401
whereas V. vulnificus and V. cholerae have two catalase genes that 402
encode catalase and catalase/peroxidase (17). V. parahaemolyticus has 403
four putative catalase genes, which may have different functions and 404
regulatory characteristics than the catalase genes of E. coli and other 405
bacterial species. 406
Among the four putative catalase genes in V. parahaemolyticus, katE1 407
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
23
was demonstrated herein to be similar to the monofunctional peroxidase 408
gene (katE1) of E. coli and it is probably the chief functional catalase 409
gene against extrinsic H2O2 in the exponential phase of this bacterium 410
(Fig. 2 and Fig. S3). The other two katG-homologous genes (katG1 and 411
katG2) of V. parahaemolyticus did not exhibit a significant antioxidative 412
role during logarithmic growth (27). The putative amino acid sequence of 413
this KatE1 catalase exhibits high identities of 95.6% and 80.7% with the 414
KatE of V. alginolyticus (accession no. AGV18944) and the KatA of V. 415
fischeri (AF011784), respectively, and a 29.6% identity with the KatE of 416
E. coli. 417
In different bacterial species, different catalase genes play the major 418
role in detoxifying peroxides. In E. coli, KatG is the predominant 419
peroxide scavenger in the exponential phase (28), and the katG gene of V. 420
vulnificus has a similar protective function (29). In V. cholerae, both katG 421
and katB (a katE-like gene) are protective against H2O2 (17). In 422
Rhodobacter species, whether H2O2 induces the expression of katE or 423
katG depends on the species (30). 424
Although katE1 is probably the chief functional catalase gene in the 425
exponential phase, the deletion mutation of this gene did not harm the 426
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
24
normal growth of these mutant strains (Fig. S1), the survival thereof at a 427
refrigerating temperature, or its high competitiveness with E. coli (Fig. 1). 428
The endogenous ROS that is generated by aerobic metabolism in these 429
mutants (31) may be detoxified by other antioxidative factors (31). In V. 430
parahaemolyticus, three superoxide dismutases (VP2118, VP2860 and 431
VPA1514), four ahpC/F factors (VPA1683, VP0580, VPA1684 and 432
VPA1681) and two katG-homologous genes (katG1 and katG2) may 433
compensate for the deletion of catalase genes in these mutants (ΔkatE1, 434
ΔkatE2) (32, 33). Catalases and AhpC scavenge endogenous H2O2 that is 435
generated by aerobic metabolism (34, 35), whereas AhpC is the primary 436
detoxifier in Bacillus abortus (33) and E. coli (36). katE2 and ahpC genes 437
may have alternate or compensatory role in the △katE1 (Figs. 2 and 4). 438
Another feature of these catalase genes is the influence of incubation 439
temperature. The sensitivity of the ΔkatE1 to extrinsic H2O2 was 440
increased as the incubation temperature was reduced below 37oC (Figs. 3 441
and 4). A similar effect of incubation temperature on the protective 442
function of the ahpC genes of V. parahaemolyticus and its colony size 443
has been demonstrated elsewhere (23). Low temperature also impairs the 444
growth of the catalase mutant in Listeria monocytogenes (37). In the cited 445
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
25
investigations, the more ROS may be produced as the temperature falls, 446
increasing the need for a functional catalase. The accumulation of ROS 447
may be attributed to the expression, stability and activities of catalases 448
and AhpCs. The critical function of katE1 under extrinsic H2O2 stress at 449
22oC was also supported herein by the high expression of this gene in the 450
parent strain (Fig. 5A) and much greater expression of the compensatory 451
genes in △katE1 at 22oC than at 37oC (Fig. 5C). 452
The expression of the aforementioned genes may be regulated by 453
controlling the incubation temperature as has been demonstrated in 454
Yersinia pestis (38). The thermal regulation of the expression and 455
function of these antioxidative factors may involve rpoS, oxyR, toxRS and 456
other regulatory factors. The OxyR (VP2752) regulon is known to 457
regulate the expressions of catalase genes and ahpC genes, which exhibit 458
compensatory patterns in several bacteria (32), whereas the rpoS 459
(VP2553) is a general regulator of stress responses (39). Nevertheless, the 460
regulation of various catalase genes or other antioxidative factors in V. 461
parahaemolyticus has not been investigated. 462
In conclusion, this work demonstrates that the katE-homologous 463
genes, katE1 and katE2, are not critical for the aerobic growth of V. 464
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
26
parahaemolyticus in a rich medium, but katE1 was the most important 465
required detoxifier under extrinsic H2O2 stress during logarithmic growth. 466
The sensitivity of the ΔkatE1 to H2O2 increased as the incubation 467
temperature was lowered below 37oC, and katE2 and ahpC genes may 468
have alternate or compensatory roles in this mutant. 469
470
ACKNOWLEDGMENTS 471
472
The authors would like to thank the Ministry of Science and 473
Technology of the Republic of China for financially supporting this 474
research under Contracts Nos. NSC100-2313-B-031-001-MY3 and 475
MOST103-2313-B-031-001-MY3. Ted Knoy is appreciated for his 476
editorial assistance. 477
478
479
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
27
480
REFERENCES 481
482
1. Kim JS, Sung MH, Kho DH, Lee JK. 2005. Induction of 483
manganese-containing superoxide dismutase is required for acid 484
tolerance in Vibrio vulnificus. J Bacteriol 187:5984-5995. 485
2. Rosche TM, Smith DJ, Parker EE, Oliver JD. 2005. RpoS 486
involvement and requirement for exogenous nutrient for osmotically 487
induced cross protection in Vibrio vulnificus. FEMS Microbiol Ecol 488
53:455-462. 489
3. Gabbianelli R, Signoretti C, Marta I, Battistoni A, Nicolini L. 490
2004. Vibrio cholerae periplasmic superoxide dismutase: isolation of 491
the gene and overexpression of the protein. J Biotechnol 492
109:123-130. 493
4. Al-Maghrebi MA, Benov LT. 2001. Polyphosphate accumulation 494
and oxidative DNA damage in superoxide dismutase-deficient 495
Escherichia coli. Free Radic Biol Med 31:1352-1359. 496
5. Switala J, Triggs-Raine BL, Loewen PC. 1990. Homology among 497
bacterial catalase genes. Can J Microbiol 36:728-731. 498
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
28
6. Jung IL, Kim IG. 2003. Transcription of ahpC, katG, and katE 499
genes in Escherichia coli is regulated by polyamines: 500
polyamine-deficient mutant sensitive to H2O2-induced oxidative 501
damage. Biochem Biophys Res Commun 301:915-922. 502
7. Visick JE, Clarke S. 1997. RpoS- and OxyR-independent induction 503
of HPI catalase at stationary phase in Escherichia coli and 504
identification of rpoS mutations in common laboratory strains. J 505
Bacteriol 179:4158-4163. 506
8. Hofmann B, Hecht HJ, Flohe L. 2002. Peroxiredoxins. Biol Chem 507
383:347-364. 508
9. Imlay JA. 2008. Cellular defenses against superoxide and hydrogen 509
peroxide. Annu Rev Biochem 77:755-776. 510
10. Stead D, Park SF. 2000. Roles of Fe superoxide dismutase and 511
catalase in resistance of Campylobacter coli to freeze-thaw stress. 512
Appl Environ Microbiol 66:3110-3112. 513
11. Lin C, Yu RC, Chou CC. 2004. Susceptibility of Vibrio 514
parahaemolyticus to various environmental stresses after cold shock 515
treatment. Int J Food Microbiol 92:207-215. 516
12. Chiang ML, Chou CC. 2008. Expression of superoxide dismutase, 517
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
29
catalase and thermostable direct hemolysin by, and growth in the 518
presence of various nitrogen and carbon sources of heat-shocked and 519
ethanol-shocked Vibrio parahaemolyticus. Int J Food Microbiol 520
121:268-274. 521
13. Lai WB, Wong HC. 2013. Influence of combinations of sublethal 522
stresses on the control of Vibrio parahaemolyticus and its cellular 523
oxidative response. Food Control 33:186-192. 524
14. Diaz JM, Hansel CM, Voelker BM, Mendes CM, Andeer PF, 525
Zhang T. 2013. Widespread production of extracellular superoxide 526
by heterotrophic bacteria. Science 340:1223-1226. 527
15. Hebrard M, Viala JP, Meresse S, Barras F, Aussel L. 2009. 528
Redundant hydrogen peroxide scavengers contribute to Salmonella 529
virulence and oxidative stress resistance. J Bacteriol 191:4605-4614. 530
16. Visick KL, Ruby EG. 1998. The periplasmic, group III catalase of 531
Vibrio fischeri is required for normal symbiotic competence and is 532
induced both by oxidative stress and by approach to stationary phase. 533
J Bacteriol 180:2087-2092. 534
17. Wang H, Chen S, Zhang J, Rothenbacher FP, Jiang T, Kan B, 535
Zhong Z, Zhu J. 2012. Catalases promote resistance of oxidative 536
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
30
stress in Vibrio cholerae. PLoS One 7:e53383. 537
18. Wong HC, Ting SH, Shieh WR. 1992. Incidence of toxigenic 538
vibrios in foods available in Taiwan. J Appl Bacteriol 73:197-202. 539
19. Nair GB, Ramamurthy T, Bhattacharya SK, Dutta B, Takeda Y, 540
Sack DA. 2007. Global dissemination of Vibrio parahaemolyticus 541
serotype O3:K6 and its serovariants. Clin Microbiol Rev 20:39-48. 542
20. Makino K, Oshima K, Kurokawa K, Yokoyama K, Uda T, 543
Tagomori K, Iijima Y, Najima M, Nakano M, Yamashita A, 544
Kubota Y, Kimura S, Yasunaga T, Honda T, Shinagawa H, 545
Hattori M, Iida T. 2003. Genome sequence of Vibrio 546
parahaemolyticus: a pathogenic mechanism distinct from that of V 547
cholerae. Lancet 361:743-749. 548
21. Lin LC, Lin GH, Wang ZL, Tseng YH, Yu MS. 2015. Differential 549
expression of catalases in Vibrio parahaemolyticus under various 550
stress conditions. Res Microbiol 166:601-608. 551
22. Chung CH, Ma TY, Fen SY, Wong HC. 2014. Activity of alkyl 552
hydroperoxide reductase subunit C1 and C2 of Vibrio 553
parahaemolyticus against different peroxides. Appl Environ 554
Microbiol 80:7398-7404. 555
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
31
23. Wang HW, Chung CH, Ma TY, Wong HC. 2013. Roles of alkyl 556
hydroperoxide reductase subunit C (AhpC) in viable but 557
nonculturable Vibrio parahaemolyticus. Appl Environ Microbiol 558
79:3734-3743. 559
24. Okada N, Iida T, Park KS, Goto N, Yasunaga T, Hiyoshi H, 560
Matsuda S, Kodama T, Honda T. 2009. Identification and 561
characterization of a novel type III secretion system in trh-positive 562
Vibrio parahaemolyticus strain TH3996 reveal genetic lineage and 563
diversity of pathogenic machinery beyond the species level. Infect 564
Immun 77:904-913. 565
25. Huycke MM, Abrams V, Moore DR. 2002. Enterococcus faecalis 566
produces extracellular superoxide and hydrogen peroxide that 567
damages colonic epithelial cell DNA. Carcinogenesis 23:529-536. 568
26. Seaver LC, Imlay JA. 2001. Hydrogen peroxide fluxes and 569
compartmentalization inside growing Escherichia coli. J Bacteriol 570
183:7182-7189. 571
27. Yu, SC. 2014. Characteristics of catalase gene in Vibrio 572
parahaemolyticus. Master thesis, Soochow University. 573
28. Uhlich GA. 2009. KatP contributes to OxyR-regulated hydrogen 574
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
32
peroxide resistance in Escherichia coli serotype O157:H7. 575
Microbiology 155:3589-3598. 576
29. Park KJ, Kang MJ, Kim SH, Lee HJ, Lim JK, Choi SH, Park SJ, 577
Lee KH. 2004. Isolation and characterization of rpoS from a 578
pathogenic bacterium, Vibrio vulnificus: role of sigmaS in survival of 579
exponential-phase cells under oxidative stress. J Bacteriol 580
186:3304-3312. 581
30. Zeller T, Klug G. 2004. Detoxification of hydrogen peroxide and 582
expression of catalase genes in Rhodobacter. Microbiology 583
150:3451-3462. 584
31. Dubbs JM, Mongkolsuk S. 2012. Peroxide-sensing transcriptional 585
regulators in bacteria. J Bacteriol 194:5495-5503. 586
32. Charoenlap N, Eiamphungporn W, Chauvatcharin N, 587
Utamapongchai S, Vattanaviboon P, Mongkolsuk S. 2005. OxyR 588
mediated compensatory expression between ahpC and katA and the 589
significance of ahpC in protection from hydrogen peroxide in 590
Xanthomonas campestris. FEMS Microbiol Lett 249:73-78. 591
33. Steele KH, Baumgartner JE, Valderas MW, Roop RM. 2010. 592
Comparative study of the roles of AhpC and KatE as respiratory 593
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
33
antioxidants in Brucella abortus 2308. J Bacteriol 192:4912-4922. 594
34. Dubbs JM, Mongkolsuk S. 2007. Peroxiredoxins in bacterial 595
antioxidant defense. Subcell Biochem 44:143-193. 596
35. Cosgrove K, Coutts G, Jonsson IM, Tarkowski A, Kokai-Kun JF, 597
Mond JJ, Foster SJ. 2007. Catalase (KatA) and alkyl 598
hydroperoxide reductase (AhpC) have compensatory roles in 599
peroxide stress resistance and are required for survival, persistence, 600
and nasal colonization in Staphylococcus aureus. J Bacteriol 601
189:1025-1035. 602
36. Seaver LC, Imlay JA. 2001. Alkyl hydroperoxide reductase is the 603
primary scavenger of endogenous hydrogen peroxide in Escherichia 604
coli. J Bacteriol 183:7173-7181. 605
37. Azizoglu RO, Kathariou S. 2010. Temperature-dependent 606
requirement for catalase in aerobic growth of Listeria 607
monocytogenes F2365. Appl Environ Microbiol 76:6998-7003. 608
38. Han Y, Geng J, Qiu Y, Guo Z, Zhou D, Bi Y, Du Z, Song Y, Wang 609
X, Tan Y, Zhu Z, Zhai J, Yang R. 2008. Physiological and 610
regulatory characterization of KatA and KatY in Yersinia pestis. 611
DNA Cell Biol 27:453-462. 612
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
34
39. Hulsmann A, Rosche TM, Kong IS, Hassan HM, Beam DM, Oliver 613
JD. 2003. RpoS-dependent stress response and exoenzyme 614
production in Vibrio vulnificus. Appl Environ Microbiol 615
69:6114-6120. 616
40. Simon R, Priefer U, Puhler A. 1983. A broad host range 617
mobilization system for in vivo genetic engineering: transposon 618
mutagenesis in gram negative bacteria. Biotechnology 11:784-791. 619
41. Philippe N, Alcaraz JP, Coursange E, Geiselmann J, Schneider D. 620
2004. Improvement of pCVD442, a suicide plasmid for gene allele 621
exchange in bacteria. Plasmid 51:246-255. 622
623
624
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
35
TABLE 1 625
Bacterial strains and plasmids used in this study 626
Strain/
plasmid
Characteristics/sequence Source/
Reference
V. parahaemolyticus
KX-V231 Wild type, serotype O3:K6, KP+,
clinical isolate
This study
ΔkatE1 KX-V231 ΔkatE1 (VPA1418) This study
ΔkatE2 KX-V231 ΔkatE2 (VPA0305) This study
ΔkatE1E2 KX-V231ΔkatE1ΔkatE2 This study
ΔkatE1/katE1 KX-V231 ΔkatE1/ pSCB01-katE1 This study
ΔkatE2/katE2 KX-V231 ΔkatE2/ pSCB01-katE2 This study
ΔahpC1 KX-V231 ΔahpC1 (VPA1683) (23)
ΔkatE1-ahpC1 KX-V231ΔkatE1ΔahpC1 This study
KX-V231V KX-V231 containing pSCB01 This study
E. coli
XL1 blue
recA1 endA1 gyrA96 thi-1 hsdR17
supE44 relA1 lac [F´ proAB lacIq
Z∆M15 Tn10 (Tetr)]
Stratagene
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
36
SM10λ-pir thi thr leu tonA lacY supE
recA::RP4-2-Tc::Mu λ pirR6K; Kmr
(40)
Plasmid
pGEM T-easy Cloning vector, Apr Promega
pDS132 R6K ori, mobRP4, sacB, Cm r (41)
pSCB01 Derived from pBR328 and pDS132,
mobRP4, Apr, Cmr, Tcr
(23)
pSCB01- katE1 pSCB01 with katE1 This study
pSCB01- katE2 pSCB01 with katE2 This study
627
628
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
37
TABLE 2 629
Primers used in cloning experiments 630
Target Primer Sequence, 5’ 3’
VPA0305
VPA0305-1 CGGCGTTGAAGTGGTGTTGG
VPA0305-2 CCGTATTCTTTGTCTGCACGATTTTG
CGCCTGTAGAGATGTG
VPA0305-3 CACATCTCTACAGGCGCAAAATCGT
GCAGACAAAGAATACGG
VPA0305-4 GCGAACGTCTTCAAGTCGAG
VPA0305-0 GGTCAGATTTATCCTTCGTC
VPA0305-5 GTGATTGTGAATCTAGCTGC
VPA0305-C1 CAGTGTAATCACTCTCGCCA
VPA0305-C2 CAGAGCTGAGCAAGAATACG
VPA1418 VPA1418-1 CATTAAAGAGCCGAACTCGATGC
VPA1418-2 TTGGTAAGCGTGGGTGACGTGGACA
TCTTGTAGGAGTTGAGGG
VPA1418-3 CCCTCAACTCCTACAAGATGTCCACG
TCACCCACGCTTACCAA
VPA1418-4 CAGAACTTGCTGTGGAACTGG
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
38
VPA1418-0 CAGGAGCCATGACTGAATACTTG
VPA1418-5 GTTGGTAATGATAACGACGTACG
VPA1418-C1 CATTAAAGAGCCGAACTCGATGC
VPA1418-C2 TTATTTCGCTAAACCTAACGCCAG
631
632
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
39
TABLE 3 633
Primers used in RT- qPCR experiment 634
Designation Sequence Target Amplicon,
bp
q16SrRNA-F
q16SrRNA-R
TCCCTAGCTGGTCTGAGA
GGTGCTTCTTCTGTCGCT
16SrDNA 222
VP0580-F
VP0580-R
CGACAACCGTCTAGCTGA
AGCAACACCTGCTTCTGG
ahpC2 202
VPA1683-F
VPA1683-R
CTACCCAGCAGACTTCAC
CTTCACGCATCACACCGA
ahpC1 227
VPA0305-F
VPA0305-R
AGAGTTGTGCACGCTCGT
CCCTACCAGATCCCAGTT
VPA0305
228
VPA1418-F
VPA1418-R
TACGACCGTTGCTGGTGA
TTCTGGCAGCGATGTCCA
VPA1418
235
VPA0453-F
VPA0453-R
TGCATGGCTCCATGACCA
CGCATGCCATGACATACG
VPA0453
257
VPA0768-F
VPA0768-R
GTGGTCATACCGTGGGTA
GGCTCTTCTTCAGTTCCC
VPA0768
237
635
636
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
40
Figure Captions 637 638
Fig. 1. Effect of catalase gene mutation on growth of Vibrio 639
parahaemolyticus in competition with Escherichia coli in shaken culture. 640
V. parahaemolyticus wild-type and mutant strains and E. coli that 641
harbored cloning vector pDS132 were cultured separately (control) or 642
co-cultured in TSB-1% NaCl at 37oC and shaking at 160 rpm. A, V. 643
parahaemolyticus wild-type; B, △katE1; C, △katE1E2; D, 644 △katE1/katE1. ●, V. parahaemolyticus strain in co-culture; ○, E. coli in 645
co-culture; ▼, V. parahaemolyticus strain in separate culture; Δ, E. coli in 646
separate culture. 647
648
Fig. 2. Growth of Vibrio parahaemolyticus strains under challenge of 649
extrinsic hydrogen peroxide in a static culture at 37oC. Panel A, Effect of 650
concentration of H2O2 on growth of wild-type strain (KX-V231); ●, 0 μM; 651
○, 175 μM; ▼, 200 μM. Panel B, Effect of 175μM of H2O2 on growth of 652
different strains; ●, wild-type; ○, ΔkatE1; ▼, ΔkatE2; Δ, ΔkatE1E2 653
double mutant. Panel C, Effect of 175μM of H2O2 on growth of wild-type 654
and complementary strains; ●, wild-type; ○, ΔkatE1 with complementary 655
katE1 gene; ▼, ΔkatE2 with complementary katE2 gene; Δ, wild-type 656
with cloning vector. 657
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
41
Fig. 3. Growth of Vibrio parahaemolyticus strains under challenge of 658
extrinsic 175μM hydrogen peroxide in a static culture at 22oC. Panel A, 659
for mutant strains ; ●, wild-type; ○, ΔkatE1; ▼, ΔkatE2; Δ, ΔkatE1E2 660
double mutant; , ΔahpC1; □, ΔkatE1-ahpC1 double mutant. Panel B, for 661
complementary strain; ●, wild-type with cloning vector; ○, ΔkatE1with 662
complementary katE1 gene. 663
664
Fig. 4. Growth of Vibrio parahaemolyticus strains under challenge of 665
different concentration of extrinsic hydrogen peroxide in a static culture 666
at 12oC. Panel A, 70 μM of H2O2; B, 100 μM of H2O2; C, 175μM of H2O2; 667
●, wild-type; ○, ΔkatE1; ▼, ΔkatE2; Δ, ΔkatE1E2 double mutant. 668
669
Fig. 5. Expression of antioxidative genes in wild-type and △ΔkatE1 670
strains of Vibrio parahaemolyticus under H2O2 stress. A, expression of 671
antioxidative genes in wild-type strain incubated at 22 or 37oC under 672
challenge of extrinsic 175μM of H2O2; B, expression of different genes in 673 △ΔkatE1 incubated at 22 or 37oC without extrinsic H2O2 stress; C, 674
expression of different genes in △ΔkatE1 incubated at 22 or 37oC under 675
challenge of extrinsic 175μM of H2O2. Expression of genes in the 676
exponential phase culture with or without the challenge of H2O2 was 677
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
42
determined by RT-qPCR; level of expression relative to the 678
corresponding gene of wild-type at each point without H2O2 challenge 679
was calculated, and values at 22 and 37oC were analyzed by t-test. * and 680
** designate significantly different values at p<0.05 or p<0.01, 681
respectively. 682
683 684
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
43
685
686
687
Fig. 1. 688
689
690
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
44
691
Fig. 2. 692
693
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
45
694
Fig. 3. 695
696
697
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
47
700
Fig. 5. 701
on June 8, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
Recommended