2011 UNC Asheville Men's Soccer Media Guide

Preview:

DESCRIPTION

2011 UNC Asheville Men's Soccer Media Guide

Citation preview

11

General InformationMedia Information ..................................................................................................................2Primary Media Outlets ..........................................................................................................3

Season PreviewOutlook ................................................................................................................................. 4-5

PlayersLassi Hurskainen.......................................................................................................................8Nick Stemkowski .....................................................................................................................9Kye Grooms ............................................................................................................................10Branden Lassen .......................................................................................................................11Bryan George..........................................................................................................................12J.J. Morrow ...............................................................................................................................13Jake Hagedorn .........................................................................................................................14Bryan Bartels ...........................................................................................................................15Eli Morrow ...............................................................................................................................16David Wood .............................................................................................................................17David Parra ..............................................................................................................................18Bobby Castro ..........................................................................................................................19Sam Rossabi .............................................................................................................................20Kenneth Lingerfelt ..................................................................................................................21Hans Lohmeyer ......................................................................................................................22Tim Kynast ...............................................................................................................................23Newcomers ......................................................................................................................24-28

Coaching StaffHead Coach Matt Kern .......................................................................................................29Assistant Coach Joe Burnette ............................................................................................30Assistant Coach Shane Weems ...........................................................................................31

Records Section2010 Season Stats .................................................................................................................342010 Big South Final Standings ..........................................................................................35 Big South Tournament History ..........................................................................................36Game Records ........................................................................................................................37Team Records .........................................................................................................................38Year-by-Year Leaders .............................................................................................................39All-Time Letterwinners ..................................................................................................40-41All-Time Results ...............................................................................................................42-45UNC Asheville Hall of Fame ................................................................................................46The Big South Conference .............................................................................................47-48 The Big South Network .......................................................................................................49

UNC AshevilleThe University of North Carolina Asheville .............................................................50-53Dr. Anne Ponder, Chancellor ...............................................................................................54Janet R. ConeDirector of Athletics/Senior Administrator for University Enterprises .............55-56Support Staff ....................................................................................................................57-58Head Coaches .......................................................................................................................59Rocky .......................................................................................................................................60NCAA .....................................................................................................................................61The Bulldog Athletics Association .....................................................................................62

Bulldog Coaching StaffHead Coach..................................................................Matt Kern

............................................................................ (Hartwick, 1988)

Overall/years ............................................... 4-13-1/Second Year

at Asheville ...................................................153-90-20/19 years

Conference ............................................................................2-6-0

Assistant Coach ........................................................ Joe Burnett

............................................................ (UNC Greensboro, 2009)

2010 Team Information2010 Record ....................................................................... 4-13-1

2009 Big South Record/Finish ................................... 2-6-0/8th

Home Record .......................................................................2-4-0

Away Record .........................................................................1-6-1

Neutral Record ....................................................................1-3-0

Starters Returning/Lost ........................................................ 8/3

Letterwinners Returning/Lost ............................................ 17-4

Soccer Support StaffAthletic Trainer ............................................Megan Hammonds

Athletics Communication ........................................Mike Gore

Greenwood FieldCapacity ................................................................................. 1,000

Press Box Phone ............................................... (828) 545-1121

Message To MediaThis edition of the 2011 UNC Asheville Soccer media guide has been prepared for you as you cover the Bulldogs during the season. For additional information, photographs, interviews with players and coaches, please contact Matt Pellegrin or Mike Gore in the Athletics Communication Offi ce.

CreditsEditorMike GoreDesigner:Matt PellegrinContributors:Everett Hutto, Nic BowmanPhotographers:Brett Whitsell, Rebecca Nelms Keil, Matt Pellegrin and Blake Madden

UNC Asheville is a selective, public liberal arts institution. UNC Asheville’s Intercollegiate Athletics Program refl ects the attitudes and values underlying the University’s overall mission: academic excellence, diversity, equity, integrity, service, and accomplishment. The UNC Asheville athletics program contributes to this liberal arts culture in two ways. First, athletics programs foster a sense of community and pride by fi elding NCAA Division I teams and developing talented student-athletes who successfully represent UNC Asheville in competition and refl ect the University’s commitment to overall excellence. Accordingly, the athletics program encourages an atmosphere of respect for self and others through the development of ethical conduct, sportsmanship, leadership, and citizenship and provides equitable opportunities for all students and staff, including women, minorities and indivduals of all sexual identities. Second, the program provides an additional campus experience for capable students to grow and develop academically, personally, socially, and athletically. This experience promotes institutional commitment and pride on the part of students, faculty, staff, and alumni.

UNC ASHEVILLE MISSION STATEMENT

22

Athletics Media Communications

Mike Gore Associate Athletics Director for

External Affairs / Soccer ContactOffi ce Phone: (828) 251-6923Cell Phone: (828) 215-6387

Email: mgore@unca.edu

Matt PellegrinDirector of Athletics Media Communication

Offi ce Phone: (828) 251-6931Cell Phone: (828) 545-1121Email: mpellegr@unca.edu

Offi ce Fax: (828) 251-6386Web Site: www.uncabulldogs.com

Mailing Address:One University Heights

Justice Center, CPO #2600Asheville, N.C. 28804

COVERING THE BULLDOGSThe Offi ce of Athletics Communication produces stories, pertinent notes about upcoming games, and cumulative statistics, all of which are available at www.uncabulldogs.com, the on-line home of Bulldog athletics.

Press Passes: Please contact the UNC Asheville Athletics Communication Offi ce as early as possible for press passes. Passes will be mailed if time permits.

Broadcasts: There are no phone lines at the Greenwood Field for radio and internet broadcasts. If you would like to broadcast a game please call well in advance to see what arrangements can be made.

Photographers: Photo passes are limited to working press photographers. All photo requests should be made as early as possible to the Offi ce of Athletics Communication.

Services: The UNC Asheville Offi ce of Athletics Communication will provide programs, notes and updated statistics at every home soccer match. After the match, each media member will receive a box score of the match.

Interview Policy: The UNC Asheville Offi ce of Athletics Communication and the women’s soccer coaching staff are eager to assist the media with player and coach interview requests. Please contact the Offi ce of Athletics Communication for all player interviews. On the road, please make coach interview arrangements through the Athletics Commincation representative for that sport. Players will not be available for interviews on days of games until the completion of the contest. Your cooperation is appreciated.

Media Guides: UNC Asheville will not print media guides to assist in the department’s cost-containment efforts. The Athletics Communications Offi ce will provide the same material it has in the past through on-line supplements and enhanced notes packages.

Video Streaming: UNC Asheville will once again video stream all of its home soccer matches live on www.bigsouthsports.com. This is a pay per view service. Archives of each broadcast will be available the day after each match. For match highlights or more information video of matches please contact Matt Pellegrin

MEDIA INFORMATION

33

NEWSPAPERS

Asheville Citizen-TimesPO Box 2090Asheville, NC 28802828/232-5867800/800-4204Fax: 828/251-0585

Hendersonville Times-NewsPO Box 490Hendersonville, NC 28739828/692-0505Fax: 828/692-2319

The MountaineerPO Box 129Waynesville, NC 28786828/452-0661Fax: 828/452-0665

The Charlotte ObserverPO Box 32188Charlotte, NC 28232704/379-6448Fax: 704/379-6506

WIRE SERVICEAssociated Press219 South McDowell St.Raleigh, NC 27602800/662-7075Fax: 919/834-1078

TELEVISION

WLOS-TV110 Technology DriveAsheville, NC 28803828/651-4563Fax: 828/651-4618

WSPA-TVPO Box 1717Spartanburg, SC 29304864/576-7777Fax: 864/587-5430

WYFF-TV505 Rutherford Rd.Greenville, SC 29602864/242-4404Fax: 864/240-5305

RADIO STATIONS1310 WISE Radio1190 Patton Ave.Asheville, NC 28804828/253-1310

WWNC RadioPO Box 6447Asheville, NC 28816828/253-3835

WCQS Radio70 Broadway St.Asheville, NC 28801828/253-6875

Location: Asheville, North CarolinaEnrollment: 3,700Founded: 1927Nickname: BulldogsAffi liation: NCAA Division IConference: Big SouthColors: Royal Blue and WhiteArena (Capacity): Greenwood Field (300)Chancellor: Dr. Anne PonderFaculty Representative: Dr. Herman HoltDirector of Athletics: Janet R. ConeAssociate Athletics Director of Internal Affairs and Compliance: Terri BrneDirector of Development and Alumni Relations: Ken Hogue Athletics Business Manager: Judith BohanDirector of Marketing: Erin Punter SpenceTicket Manager: Harmon TurnerTicket Offi ce Phone: (828) 251-6904

PRIMARY ATHLETICS LOGO

SECONDARY ATHLETICS LOGOS

44

With a solid senior class coming back and a talented group of new-comers coming in, the UNC Asheville Bulldogs are looking for a much-improved 2011 season. A year ago, Asheville competed hard and battled in every match but just couldn’t get over the hump in a lot of matches as the Bulldogs fi nished with a 4-13-1 overall record. Second-year coach Matt Kern believes Asheville can be better in 2011. “We have a veteran team coming back plus some new guys who we think can help us right away,” commented Kern. “We’re a little more athletic in the midfi eld than we were last season and I think everyone is ready to take the next step with our program. “A key for us is improving our collective defending,” added Kern. “We would like to decrease the number of shots on goal our opponents average per match. “I believe we have a chance to be quite good on the counter at-tack,” Kern also said. “If we can score between 25-to-30 goals on the season and have our goals against average less than 1 per match, we have a chance to have a pretty good season.”

GOALKEEPER

The Bulldogs will be led in goal this year by one of the best in the region, senior Lassi Hurskainen. Asheville had a tough season in 2010 but Hurskainen still earned second team All-Conference honors for his play. “We would love to see Lassi earn All-Region and All-American honors this year because he’s that good of a goalkeeper, but we’re going to have to help him,” declared Kern. “We can’t ask him to make 10 saves every match and expect to win. Lassi really improved as a communicator last spring, and our defensive cohesion was better. “Lassi is a tremendous shot stopper,” added Kern. “He’s very quick and an outstanding distributor of the ball. Having Lassi on the fi eld is like having an 11th fi eld player.” Backing up Hurskainen is talented freshman Dan Jackson. The Cha-pel Hill native played at a high level in both high school and club. “Dan is an able back-up to Lassi,” admitted Kern. “We’re going to try to get him some experience in the pre-season in case we need him if Lassi gets hurt. He’s very quick with his feet and is a good athlete.”

DEFENSE

The Bulldogs bring back a nice blend of experience and depth in the back. Heading up the returnees is senior tri-captain J.J. Morrow. The talented Morrow has been a leader and a starter for Asheville since his freshman year. He enjoyed an excellent spring and during the summer he played on an Under-23 team that won the national championship. He did suffer an injury that may sideline him early in the season. “J.J. is a great ball-winning central defender who just knows how to play the game,” stated Kern. “He’s a terrifi c leader and will be one of our top players in 2011.” Also returning in the back is J.J.’s brother, Eli Morrow. The senior will provide depth in the back. “Eli won our Bulldog Award last spring for his play,” commented Kern. “He’s a versatile player who can play both in the midfi eld and in the back. Eli does everything we ask him to do, and I know he’ll be ready to play in 2011.” Junior David Parra went through a transition year in 2010 but moved to the back late in the season and then enjoyed a great spring season.

Lassi Hurskainen “We moved David from a central midfi elder spot to the back and he really blossomed,” said Kern. “He will be a key player for us in the back this season. David is a tremendous athlete, and we’re looking for-ward to seeing him back there this year.” Sophomores Bobby Castro and Hans Lohmeyer earned valuable experience in 2010. That experience should pay off for the Bulldogs in 2011. “Bobby was moved to the back at the end of last season and he did a great job,” explained Kern. “He’s turning into a fi ne player for us plus emerging as a leader in the back. “Hans got better with each week as a freshman,” added Kern. “He does things simply and gets the job done. The more you watch him play the more you like him.” Kern and the Bulldogs will have four freshmen vying for playing time on defense this season. All four have enjoyed standout prep and club careers and could earn playing time. Alex Chu joins the Asheville program from Charlotte. “Alex is a smart, tactical player,” admitted Kern. “He’s a hard work-er who has played at a high level during his career.” A.J. Iiames comes to the Bulldog program from Raleigh. “A.J. is tall at 6-1 and is a real presence when he’s on the fi eld,” stated Kern. “He’s very good in the air and we expect him to contribute right away.” Freshman Quentin Reynolds is also from the Raleigh area (Apex) and comes highly regarded. “Quentin is very athletic and is an excellent one-on-one defender,” declared Kern. “He can play anywhere in the back. Quentin just needs to make the transition to college soccer.” Inaki Uriz is from Durham and played at Jordan HS plus the Triangle Futbol Club. “Inaki reads the game quite well and is a hard worker,” stated Kern. “He’s also quick and knows how to battle.”

2011 ASHEVILLE MEN’S SOCCER:

55

Jake Hagedorn

MIDFIELD

Heading up the returnees in midfi eld is senior tri-captain Jake Hagedorn. He scored three goals for the Bulldogs last season and has six in his career. “Jake is a true two-way midfi elder,” said Kern. “He likes to get for-ward but is willing to get back and track on defense. Jake is a wonderful leader and I look for a big year from him in 2011.” Senior Kye Grooms has gotten better with each season and is ex-pected to contribute this year. “Kye has developed into one of our best passers,” commented Kern. “He had an excellent spring. We look for him to be heavily involved with our set pieces and would not be surprised if he ended the season as our assist leader.” Sophomore Kenneth Lingerfelt is moving to midfi eld after playing up front as a freshman. He played well as a striker and earned Big South All-Freshman honors for his play. “Kenneth has a goal-scoring mentality,” stated Kern. “He’s not afraid to shoot and can take a defender on one-on-one. We believe he’ll be a real help to us in midfi eld.” Junior David Wood moves to the midfi eld in 2011. “David is a terrifi c server and gets the ball where it needs to be,” Kern pointed out. “He had a solid spring, and I believe he’ll be effective for us in the midfi eld.” Senior Nick Stemkowski is a player who has steadily earned more and more playing time as his career has progressed. “Nick is an exciting player who we look to give us some important minutes throughout the season,” said Kern. “He will give us some expe-rienced depth at midfi eld.” Sophomore Sam Rossabi worked hard as a freshman and should be rewarded with some more playing time in 2011.

“We moved Sam to an outside midfi elder, and he gives us some real energy there,” stated Kern. “He’s a player who should benefi t from some experience learned last year.” Sophomore transfer Rob May should give the Bulldogs some real experience in midfi eld. May is an Asheville native who prepped at Rober-son HS and enjoyed a sensational career. May began his collegiate career at Charlotte but only played in three matches in two years. “Rob can play a variety of positions and has an unbelievable fi rst-touch,” said Kern. “We’re happy to have him here at UNC Asheville. He was a member of a very good Charlotte program and even though he didn’t play much he got some great experience.” Three freshmen are going to compete for playing time here in 2011. They include Asheville native Paul Egle, Joey Cutting and Patrick Phillip. Egle played locally at Roberson HS and scored a lot of goals for the Rams program. “Paul enjoyed a great career at Roberson and on the club level. He has played at an extremely high level and had success against that kind of competition,” commented Kern. “Paul can play anywhere on the fi eld and knows how to fi nd the ball. We’re looking quite forward to watching him play for the Bulldogs.” Cutting is another local product as he played at nearby Tuscola HS in Haywood County. “Joey just needs experience with the college game,” stated Kern. “He is a good technical player who moves well with the ball.” Phillip is a product of Dripping Springs HS in Houston. “Patrick gets up-and-down the fl ank quite well,” commented Kern. “He has good service and is another freshman who just needs experi-ence.” Freshman Stabler Cochrane will probably red-shirt this season as he has some injuries coming into the year. “We’re probably going to rest Stabler this year and make sure he’s 100 percent,” admitted Kern. “He’s a two-way central midfi elder who will get his minutes once he adjusts to the college game.”

FORWARD

The Bulldogs bring back nothing but experience up front in 2011 as three seniors and a sophomore return. Senior Bryan Bartels scored two goals and had fi ve points in 2010. He is a talented striker who should be ready to have a big senior cam-paign. “We’re looking for Bryan Bartels to have a breakthrough season in 2011,” declared Kern. “He is capable of scoring a lot of goals. We need to do our part by giving him high-quality service into the box and let him score. Bryan’s a hard-worker and is ready to have a big year.” Senior Branden Lassen has been a consistent player for the Bull-dogs up front during his career. “Branden is the most technically gifted player we have on our team,” explained Kern. “He is a fun player to watch when he has the ball. We hope to get him the ball a lot this season.” Senior Bryan George has seven career goals and has been a threat up front for Asheville since his freshman season. “Bryan is a natural goal-scorer who can score in a lot of different ways,” said Kern. “He’s an electrifying player who can score with his head or his feet.” Sophomore Tim Kynast came on strong for Asheville down the stretch. “At 6-4, Tim’s height makes him terrifi c in the air,” stated Kern. “He has a year under his belt which will make him a better player.”

YEAR TWO OF THE KERN ERA

66

77

88

LASSI HURSKAINENGK • 6-1 • SR • JOENSUU, FINLAND

Overview: One of the top goalkeepers in the region and has enjoyed a tremendous career for UNC Asheville...fi rst player from Finland to ever play for Bulldog program...earned Big South All-Rookie honors in 2008 and was one of the top goalkeepers in the Big South...earned second team All-Conference in 2010...last name is pronounced her-skah-nen...Mass Communications major...created trick-shot video last winter that is on You-Tube and has close to three million views...enters the 2011 season with eight career shutouts which tied his for fourth all-time on the school’s career shutout list with Al Winston...second all-time at Asheville in saves with 281.

2010: For the second time in his career, he played every minute of every match...produced three shutouts, including back-to-back blankins of Eastern Illinois (9-5) and Brevard College (9-8)...made Kentucky Invitational All-Tournament team...posted shutout of Big South foe Winthrop (11-3)...made season-high 11 saves at High Point (11-16)...also made fi ve saves against the Panthers in Big South Tournament (11-11) and earned spot on Big South All-Tournament team...led Big South in saves with 96...stopped nine shots in 1-1 overtime at Longwood (10-2).

2009: Earned all-tournament honors at Hyatt Place Select Tour-nament in Nashville as he helped lead to the Bulldogs to their fi rst tournament title in more than 20 years...stopped an amazing 25 shots in the two matches with 15 vs. Lipscomb (9-18) and then 10 more vs. Belmont (9-20)...Bulldog won both matches 2-1...earned two shutouts on the year with 1-0 victory over ETSU (9-29) and 1-0 triumph at Radford (10-10)...made 108 saves on the year...had nagging injuries throughout the season that caused him to miss three matches.

2008: Played every minute of every match and posted a 1.20 goals against average with three shutouts...earned a shutout against Kentucky (9-27), Big South champion Winthrop (10-25) and Liberty (11-8)...allowed one goal or less in 12 different matches...stopped fi ve shots and allowed just one goal in 1-1 vs. Southern Conference champion UNC Greensboro (9-14)...made season-high ninesaves in win over Winthrop (10-25)...most goals he allowed were three in 3-1 loss at Lipscomb (9-21)...had a 0.94 goals against average in eight regular-season Big South Con-ference matches...made all-tournament at Elon Invitational.

1

99

NICK STEMKOWSKIMF • 5-10 • SR • CHARLOTTE, N.C.

Overview: Midfi elder from Charlotte who will battle for playing time as a senior...hard worker who gives the Bulldogs some real energy off the bench.

2010: Played in nine matches and earned fi ve starts.

2009: Competed in 12 matches...took one shot during the year and that came at Radford (10-10)

2008: Played in six matches, including fi ve straight late in the season.

Before UNC Asheville: Played at East Charlotte HS and helped lead school to 17-9-2 overall record as a senior...was team cap-tain as senior.

4

1010

KYE GROOMSMF • 5-10 • SR • ASHEVILLE, N.C.

Overview: Local product who played at Reynolds HS and HFC club program...midfi elder who has done a solid job for the Bull-dogs his fi rst three years...should compete for more playing time as a junior...played in North Carolina High School East-West All-Star Game in July of 2008 at Greensboro...fi rst name is pro-nounced Kie.

2010: Played in two matches and earned two starts...started at Longwood (10-2) and at High Point (10-11)....took two shots during the season and one came at Longwood and High Point.

2009: Played in 11 matches and started twice...started in 3-0 vic-tory over Brevard (9-4) and at Davidson (9-11)...took one shot during the season and that came at Belmont (9-20).

2008: Played in fi ve matches, including Big South Tournament game against Gardner-Webb (11-13).

Before UNC Asheville: Three-year starter and four-year letterman at Reynolds...senior year scored 14 goals with 21 assists...junior campaign tallied eight goals and 14 assists...was named 3-A/4-A Western North Carolina Player of the Year in an Olympic sport following senior year...named team MVP and also made fi rst team all-conference, all-region and All-South team...one of just eight players in the state of North Carolina to make All-South team...All-America nominee...helped lead Reynolds to conference championship in 2005 and 2006...Clash of the Caro-linas selection...2007 NW4A Conference and Regional Player of the Year.

6

1111

BRANDEN LASSENF • 5-11 • SR • HOUSTON, TX

Overview: Striker from Texas who has done a solid job for the Bulldogs during his career...will be counted on heavily in 2011.

2010: Appeared and started in all 18 matches for Asheville...tied for third on team in shots taken with 19...scored fi rst goal of the season for Bulldogs against IUPUI (9-3)...took three shots in IUPUI match...had four shots vs. Belmont (9-19).

2009: Started in 17 matches for the Bulldogs up front and had four points on the year...scored one goal and had two assists...only goal of the season was a game-winner in a 3-0 victory vs. Brevard College (9-4)...had an assist vs. VMI (10-17) and Win-throp (10-24)...fi red 11 shots during the year.

2008: Played in 18 matches and produced one goal and three points...started 12 times...scored fi rst career goal in 3-2 victory at Belmont (9-19)...added an assist in 2-1 home loss to Gardner-Webb (10-15)...took eight shots on the year.

Before UNC Asheville: Four-year starter at Langham Creek...second team all-district as a freshman and sophomore and fi rst team all-district as a junior and senior...served as a captain junior and senior year...named to all-region team as a senior and All-America nominee...third leading scorer senior year in the district and 13th in the Houston area...junior year helped lead school to 23-1-4 overall record and trip to regional semi-fi nals...was all-state and all-region nominee as a junior...named Rookie of the Year following his freshman season...played club soccer for the Texas Heatwave...was both a striker and a midfi elder during his prep and club career...helped lead club team to 2007 South Texas State championship and quarterfi nals in Regional III.

9

1212

BRYAN GEORGEF • 5-9 • SR • NEWTON, N.C.

Overview: Exciting striker who has been a great contributor to the Dogs during his career...should be one of the top forwards in the Big South...played for 2-A state champion Newton-Conover as a senior.

2010: Tied for fourth in scoring with two goals, one assist and fi ve points...scored fi rst goal of season at Belmont (9-19)...talked game-winning goal in 1-0 upset of Winthrop (11-3)...earned an assist in 3-0 blanking of Eastern Illinois (9-5)...took 18 shots with a career-high of fi ve vs. Belmont (9-19).

2009: Played in 19 matches and started 15 times...scored one goal and added assist for three points on the year...second on team in shots taken with 32...scored lone goal of the season at Winthrop (10-24)...delivered an assist in 2-2 tie vs. Presbyterian College (10-4)

2008: Played in all 19 matches and started 11 times...fourth on team in goals scored with three...tallied his fi rst career goal in 3-2 victory against Longwood (9-16)...scored the game-winning goal in 3-2 victory at Belmont (9-19) when he tallied in the 79th min-ute...scored fi nal goal of year in 2-1 loss against Big South rival Gardner-Webb (10-15)...fi red 16 shots during the year.

Before UNC Asheville: Led Newton-Conover in scoring se-nior year with 22 goals and eight assists...named to all-state, all-conference and all-region team as a senior...junior year earned all-conference and all-region honors as he scored tallied eight goals and produced 10 assists.

11

1313

J.J. MORROWD • 6-3 • SR • PITTSBORO, N.C.

Overview: Outstanding defender who has been a starter for the Bulldogs the past three seasons...named to the Big South All-Rookie team in 2008...played last two years with his brother Eli and got to play with older brother Alex in 2008...excellent student who has made the Big South All-Academic team for three straight years and earned a perfect GPA the last three semesters...played for the Carolina RailHawks U-23 team this past summer and helped lead team to national championship in Bowling Green, Ky.

2010: Appeared and started in all 18 matches...picked up an as-sist at Belmont (9-19)...took seven shots on the season with two coming vs. High Point in Big South Tournament (11-11)...had two shots at USC Upstate (9-22)...anchored a defense that posted three shutouts on the season.

2009: Started and played in 18 matches...scored fi rst career goal in exciting 1-0 victory at Radford (10-10)...earned a spot on Big South All-Tournament team.

2008: Started and played 18 matches last year and helped an-chor a defense that allowed only 24 goals and eight goals in eight league matches...part of a defense that posted three shutouts and only allowed one opponent to score more than two goals in 19 games.

Before UNC Asheville: MVP of Northwood HS team the past two years...tallied 27 goals senior year where he earned all-con-ference and all-region honors...junior year scored 15 points and was all-conference, all-region and all-state...named Northwood’s Most Valuable Defender as a sophomore...captain of two state championship teams (Triangle Futbol Club Navy ‘90) (2008 and 2010)...started for a third state championship team inTriangle Fu-tbol Club Navy ‘89 in 2009.

14

1414

JAKE HAGEDORNMF • 5-11 • SR • BREVARD, N.C.

Overview: One of the top midfi elders in the Big South...has been a starter for most of his career...should compete for all-conferenced and all-region honors in 2011...enjoyed a spectacu-lar career at Brevard HS where he played for his father, Dale...also played club soccer for former Bulldog head coach Steve Cornish.

2010: Bulldogs’ second-leading scorer with three goals and six points...scored two goals for fi rst time in his Asheville career in 3-0 victory over Eastern Illinoi (9-5) at Kentucky Invitational...earned spot on all-tournament team with his performance in the two matches in the tourney...scored next goal in 3-0 triumph over Brevard College (9-8)...second on club in shots taken with 21...had four shots at USC Upstate (9-22).

2009: Played in all 20 matches and started 19 games...tied for the team lead in goals with three and third in points with six...scored fi rst goal of the year in 2-1 victory at Belmont (9-20)...earned a spot on the Hyatt Place Select All-Tournament team as he helped lead the Bulldogs to victories over Lipscomb and Belmont and help program win its fi rst tournament title in more than 20 years...scored game-winning goal in 1-0 victory over ETSU (9-29)...tallied tying goal in 2-2 vs. Presbyterian College (10-6)...tied for third on team in shots taken with 25.

2008: Played in all 19 matches and started 12 times...took 10 shots on the year...had three shots in win over Belmont (9-19).

Before UNC Asheville: Sensational career at nearby Brevard HS in Brevard...led Blue Devils to 19-4 overall record and confer-ence championship...scored an incredible 40 goals and had six as-sists in 23 games as a senior...was named Asheville Citizen-Times Player of the Year...named to all-conference team and was named Western Athletic Conference Player of the Year...solid junior year with 18 goals and 16 assists.

20

1515

BRYAN BARTELSF • 6-1 • SR • FAIRVIEW, N.C.

Overview: Local product who has enjoyed a productive career for the Bulldogs...will be counted on to be one of the top strikers in the Big South as a senior...attended Carolina Day School and played for Highland Football Club...went to IMG Soccer Academy before enrolling at UNC Asheville.

2010: Earned 15 starts and played in 18 matches...fourth on team in goals and points with two goals, one assists for fi ve points....both of his goals were game-winners...scored game-winner in 3-0 victory over Eastern Illinois (9-5) and then tallied the game-winner vs. Brevard (9-8)...lone assist came on game-winning goal vs. Winthrop (11-3)...led team in shots taken with 32.

2009: Played in all 20 matches and started 12 times...fourth on team in goals scored with two and points with four...led team in shots taken with 36...scored game-winning goal in 2-1 victory at Lipscomb (9-18) in fi rst round of Hyatt Place Select Tourna-ment...tallied second goal of the season in 3-1 loss to national power Kentucky (9-27).

2008: Played in 18 matches and started seven times....scored one goal and added an assist as a rookie...took 23 shots on the year...scored fi rst career goal in Big South Tournament win over Gard-ner-Webb (11-13)...fi rst career assist came on game-winning goal vs. Wofford late in the season (11-1).

Before UNC Asheville: Great career at Carolina Day where he was all-conference and the program’s leading scorer sopho-more, junior and senior seasons...named to all-state team junior and senior...earned Coaches Award junior year and team MVP as a senior...helped lead Carolina Day to two conference titles and a runner-up fi nish...took team to state semi-fi nals as a sophomore and junior...played from 2004-07 for Highland Football Club and led team to state semi-fi nals in 2006...at IMG Soccer Academy he led squad to Tampa Sun Bowl championship with fi ve goals.

23

1616

ELI MORROWMF • 6-1 • SR • PITTSBORO, N.C.

Overview: Red-shirt junior who will once again team up with his brother J.J. who is a senior...older brother Alex fi nished his career with the Bulldogs in the fall of 2008.

2010: Participated in 10 matches with fi ve starts...earned one assist on the season and that came at Presbyterian College (10-5)...took fi ve shots with two coming at Longwood (10-2) and Presbyterian College (10-5).

2009: Played in 18 matches and started 14 times...tallied three points on the year with a goal and an assist...scored fi rst career goal vs. USC Upstate (9-16)...earned an assist vs. High Point (10-4)...took four shots during the year.

2008: Red-shirted

Before UNC Asheville: Graduated from Northwood HS in Pittsboro...played for head coach Russ Frazier...earned all-confer-ence and all-region honors as senior...played club ball for Triange Futbol Club Navy team that won state championships in 2008 and 2009.

25

1717

DAVID WOODF • 5-9 • JR • ASHEVILLE, N.C.

Overview: Junior from nearby Carolina Day School...striker who gave the Bulldogs a real lift on the fi eld in 2009 and 2010.

2010: Competed in 12 matches and earned three starts...took seven shots on the year...had career-best three shots at High Point (10-16)...fi red two shots vs. VMI (10-23)...started vs. IUPUI (9-3), Radford (10-9) and VMI.

2009: Played in all 20 matches and earned seven starts...took 13 shots...picked up one assist during the season and that came at Kentucky (9-27)...started the fi nal four matches of the season...took four shots against Georgetown (9-13).

Before UNC Asheville: Excellent prep career at Carolina Day where he scored 15 goals as a senior...earned all-conference hon-ors and was an all-state selection.

7

1818

DAVID PARRAMF • 6-1 • JR • THE WOODLANDS, TX

Overview: Talented junior midfi elder from Houston who made an immediate impact for the Bulldogs in 2009...earned a spot on the Big South All-Freshman team...attended the same high school, The Woodlands, as former Bulldog assistant coach Greg Garri-son...fi rst name is pronounced Dah-vead...enjoyed an excellent spring and should be ready to have a big junior year.

2010: Played in six matches and started one time...started fi rst match of season vs. IUPUI (9-3).

2009: Played in all 20 matches and started 17 times...scored goal vs. High Point (10-3)...fi red 15 shots on the season.

Before UNC Asheville: Earned second team all-district honors as a junior and senior at Woodlands...led team to district and area championship plus berth in regional title game as a senior...also played for Texas Rush Soccer Club where he was captain of the team last season...helped lead Texas Rush to three champion-ships during his career.

21

1919

BOBBY CASTROD • 5-8 • SO • CARY, N.C.

Overview: Talented sophomore from Cary, N.C....enjoyed an excellent freshman year and made key contributions throughout the season.

2010: Earned eight starts and appeared in 18 matches...took 16 shots...tallied fi rst career goal vs. VMI (10-23)...had three shots at Longwood (10-2)...started fi nal fi ve matches of the season.

Before UNC Asheville: Enjoyed a standout career for Middle Creek where he was named All-Conference and All-Region as a senior...team MVP as a senior...scored seven goals and had two assists senior season...earned All-Conference honors as a sopho-more...helped lead Middle Creek to state playoffs three times during his career...helped lead club team to 32-5-6 record in 2009-10...92 TFC Navy was a North Carolina fi nalist in the spring and was the regular-season champion in the Premier League...ranked sixth in the Premier League in scoring with fi ve goals and 13 points.

2

2020

SAM ROSSABIMF • 5-8 • SO • CARY, N.C.

Overview: Sophomore midfi elder who played very well for the Bulldogs in 2010...should be even better in 2011.

2010: Played in 14 matches and earned 11 starts...took three shots on the season with one against Belmont (9-19), USC Up-state (9-22) and one in home loss to Wofford (10-30).

Before UNC Asheville: Attended Green Hope HS and as a senior helped lead team to state championship game...played club ball for TFC Navy and that team advanced to state fi nals last spring.

3

2121

KENNETH LINGERFELTF • 6-0 • SO • WEAVERVILLE, N.C.

Overview: Sophomore from nearby Asheville HS who really provided the Bulldogs a lift as a freshman...earned a spot on Big South All-Freshman team...will be counted on heavily by UNC Asheville in 2011.

2010: Played in all 18 matches and started 11 times...scored game-tying goal at ETSU (9-25)...fi red 19 shots on the season...had two shots in fi ve different matches.

Before UNC Asheville: Earned all-conference honors in 2009 for Asheville after scoring 20 goals and dishing out 14 assists...helped lead the Cougars to 17 wins and berth in the 3-A state playoffs...named to all-state and all-region team...was the 2008 Asheville-Citizen Times Player of the Year.

10

2222

HANS LOHMEYERD • 5-11 • SO • GIBSONVILLE, N.C.

Overview: Versatile player who can play in the back or as a mid-fi elder...earned valuable playing experience in 2010 and should be ready to make a bigger contribution in 2011.

2010: Appeared in six matches and started fi nal three games of the season...took two shots during the year.

Before UNC Asheville: Played at Page HS where he helped lead school to 4-A state championship as a senior...tallied seven goals and had 13 assists senior season...earned all-conference honors...junior year played in back and scored seven goals...played club soccer for Developmental Academy in Greensboro where he scored fi ve goals in 2010...led Development Academy to state championship game in 2009.

22

2323

TIM KYNASTF • 6-4 • SO • ASHEVILLE, N.C.

Overview: Local product from Asheville Christian Academy who should compete for playing time up front as a sophomore.

2010: Appeared in eight matches...took one shot during the sea-son and it came at High Point (10-16).

Before UNC Asheville: Enjoyed an outstanding career at ACA...earned all-conference and all-state honors as a junior and senior...in his senior season, he scored 20 goals and led team to conference championship and berth in the state title game...served as captain both junior and senior year...junior season scored 14 goals and helped lead ACA to quarterfi nals of state playoffs.

24

2424

ALEX CHUD • 5-11 • FR • CHARLOTTE, N.C.

Overview: Highly-touted freshman defender from Charlotte who will battle for playing time as a freshman.

Before UNC Asheville: Played his soccer at South Mecklen-burg High School under head coach Jim Lynch...named to the SW 4A All-Conference team and the All-Region team in his senior season...played for Charlie McGinty and the Charlotte Soccer Academy.

12

STABLER COCHRANEMF • 5-11 • FR • WINSTON-SALEM, N.C.

Overview: Freshman midfi elder from Winston-Salem who will compete for playing time in 2011.

Before UNC Asheville: Enjoyed a standout career at West Forsyth HS where he played for head coach Scott Bilton...earned All-Conference, All-Region and All-County honors his senior year...played his club soccer for Scott Brittsan and a successful NC Fusion Elite team.

13

2525

A.J. IIAMESD • 6-0 • FR • RALEIGH, N.C.

Overview: Freshman defender who will battle to play as a rook-ie...enjoyed standout prep career at Broughton HS in Raleigh...brother Ben plays at Big South school Campbell.

Before UNC Asheville: Played for Izzy Hernandez at Brough-ton...senior year scored eight goals and had 10 assists...junior campaign had four goals and eight assists...helped lead Broughton to four consecutive conference tournament championships and three straight regular-season titles...led team to 16-8-2 record.

15

JOEY CUTTINGMF • 5-10 • FR • MAGGIE VALLEY, N.C.

Overview: Local product from Tuscola High School...freshman midfi elder who could make an impact right away.

Before UNC Asheville: Played under head coach Erik Melville and was the team MVP and Haywood County Player of the Year in 2010..voted to the AAC All-Conference team and All Region WNC team his junior and senior seasons.

16

2626

INAKI URIZMF • 5-8 • FR • DURHAM, N.C.

Overview: Versatile player who can play both in the back or in the midfi eld.

Before UNC Asheville: Played for Steve Turner at Jordan High School and was one of the captains that helped lead the school to the 4-A state championship in fall of 2010...member of the 92 Triangle Futbol Club Navy team, under Michael Brady and helped leam team to regional semifi nals in 2010.

17

DAN JACKSONGK • 5-11 • FR • CHAPEL HILL, N.C.

Overview: Possible goalkeeper of the future for the Bulldogs...had an excellent prep and club career...will back up senior goal-keeper Lassi Hurskainen this year.

Before UNC Asheville: Went to East Chapel Hill HS and played for head coach Zach Haines... All Conference player his sopho-more, junior, and senior seasons...earned All- Region honors ju-nior and senior seasons...played his club soccer for Jeff Negalha and the Triangle United 93 Gold team...was selected to play in the East-West All-Star Game in Greensboro and the Clash of the Carolinas in Charleston, S.C.

18

2727

PAUL EGLEF • 6-1 • FR • ASHEVILLE, N.C.

Overview: Freshman striker from nearby T.C. Roberson who enjoyed a great career for the Rams.

Before UNC Asheville: Played for four years at Roberson under head coach Rob Wilcher...named Asheville Citizen-Times All-WNC Soccer Player of the Year in 2009...also named to the NCSCA All Region and All State teams three out of four years of his high school career, once with a 3A school (2008) and twice with a 4A school (2009, 2010)...played for Craig Conger and the North Mecklenburg U.S. Development Academy Team.

19

QUENTIN REYNOLDSD • 6-0 • FR • APEX, N.C.

Overview: Rookie defender who played for very good prep and club program in Raleigh area.

Before UNC Asheville: Joins the Asheville program from Holly Springs HS where he played for head coach Davi Lanuti...played for the highly competitive FVAA Flash and Henry Gutierrez at the club level.

26

2828

PATRICK PHILLIPMF • 5-10 • FR • HOUSTON, TX

Overview: Freshman midfi elder from Texas who will compete for playing time in his rookie season.

Before UNC Asheville: A three-year varsity player at Dripping Springs HS in Texas..earned honorable mention All-District hon-ors as a junior, and was named to the All-District Second Team and the Academic All-District Team as a senior.

27

The 2011 Senior Class

2929

MATT KERNHEAD COACH • SECOND SEASON

HARTWICK, 1988 Matt Kern, a former assistant coach for the UNC Asheville men’s and women’s soccer program, is in his sec-ond year as head coach with the Bulldog men’s program.

Kern, who has worked as a head coach at the Univer-sity of the South and Wofford College, was hired in June of 2010 after spenting two years working in Asheville. He assisted both the Bulldog men’s and women’s soccer teams as their Goalkeeper Coach and was the Special Programs Director of Coaching with the Asheville Buncombe Youth Soccer Association.

He succeeded long-time men’s head coach Steve Cor-nish, who stepped down in the spring of 2010 to accept a coaching and teaching position at Shattuck-St. Mary’s Acad-emy in Minnesota.

“We are very pleased to announce the hiring of Matt Kern as our new head men’s soccer coach,” declared UNC Asheville Director of Athletics Janet Cone upon Kern’s hir-ing. “Matt’s experience as a head coach plus his ties to the local soccer community made him the perfect choice to lead our program.”

“I want to thank Chancellor Ponder, Director of Ath-letics Janet Cone and the search committee for giving me the opportunity to be the head coach at an outstanding in-stitution such as UNC Asheville,” stated Kern. “I also want to thank Steve and Michele Cornish for allowing me to be a part of their programs the last two years.”

Kern coached at Wofford College for six seasons from 2002 to 2007. The Terrier program steadily improved under his guidance and set a school record for wins in Division I in 2007. He left the program in good hands as Wofford won the Southern Conference championship in 2009. All 11 starters for the Terriers’ championship team were play-ers Kern brought into the program.

He coached for 11 years at The University of The South (Sewanee) before going to Wofford. He was named South-ern Collegiate Athletic Conference Coach-of-the-Year af-ter the 2000 and 2001 seasons. Kern led the school to the 2001 SCAC championship and a trip to the NCAA Divi-sion III Tournament. The Tigers went 31-6-1 under Kern in his fi nal two years at Sewanee. He also coached the golf team and was Director of Intramurals during his tenure.

The Maryland native was an assistant coach at Spring-fi eld College for one year and helped the program set a school record for wins and a national ranking.

He enjoyed a standout collegiate career at Hartwick College from 1984-87. Kern was a four-year starter and helped lead the school to two Final Fours, three Elite Eight appearances and four Sweet 16’s. He graduated from Hart-wick in 1988.

His wife Chapman is the Director of Athletics at Asheville School. They have two children, Brooks (16) and Emerson (11).

3030

JOE BURNETTASSISTANT COACH • SECOND SEASON

UNC GREENSBORO, 2008 Former UNC Greensboro standout Joe Burnett is in his second year as an assistant soccer coach with the UNC Asheville men’s program.

Burnett, a native of Winston-Salem, N.C., helped lead the Spartans to three appearances in theNCAA Tour-nament and was named the 2008 Southern Conference Tournament’s Most Valuable Player.

“We are really excited to have Joe Burnett as part of the UNC Asheville soccer family,” said Kern. “He did a great job for us in his fi rst year with us last year. We’re lucky to have him as a part of our program.

The Spartans won three SoCon tournament titles during Burnett’s tenure (2005, 2006, 2008), along with two regular season titles in 2005 and 2006. UNCG reached the SoCon tournament fi nal in 2007, but fell to Furman in overtime of the championship game.

During Burnett’s senior season he started in 22 of 23 contests, logging 1,713 minutes of playing time. That season the Spartans defeated Duke University 2-0 to advance past the fi rst round of the NCAA tournament. UNCG then defeated Loyola (Md.) 2-1 to advance to the Final 16 before falling to South Florida on penalty kicks.

In his fi rst two seasons, UNCG fi nished ranked 18th in the county by the National Soccer Coaches Associa-tion of America compiling a 32-14-2 record over those two years. For his career the Spartans amassed 53 victo-ries overall with a 16-10-1 record in conference.

Burnett spent the 2009 season as an assistant coach at West Forsyth High School in Clemmons, N.C.

Joe Burnett at UNC Greensboro

3131

SHANE WEEMSASSISTANT COACH • SECOND SEASON

COLLEGE OF CHARLESTON, 1994 Shane Weems, the Director of Coaching for Asheville-Buncombe Recreation Soccer Association, enters his sec-ond season as a volunteer assistant coach with Matt Kern and the Bulldogs’ men’s soccer program.

Weems, a former College of Charleston team captain, started four years for the Cougars and earned All-Trans-Atlantic Conference honors during his junior and senior campaigns. After fi nishing his collegiate career, Weems played professionally for the Charleston Battery and the Hampton Roads Mariners before suffering a career-ending injury. The Battery reached the Sizzling Nine Champion-ships in 1994, his fi rst season with the club.

He started his coaching career with the Hungryneck Soccer club while also working with the Mount Pleas-ant Youth Soccer Association, all while attending CofC. Weems came to Asheville in 1998 and began coaching with the Highland Football Club (HFC).

In 2005, the HFC and ABYSA merged and Weems was named to his current position with the association. Cur-rently he oversees the recreation soccer program, coach-es competitive level youth teams in various age groups and works with the academy program.

Weems also coaches the 97 Boys for the North Car-olina Olympic Development Program. He has previous experience working with South Carolina’s ODP as well. As a youth he was selected to the United States Youth Soccer Association’s Region III ODP team in 1987.

He currently holds a United States Soccer Federation Class A coaching license, a National Soccer Coaches As-sociation of America Advanced National Diploma and a USSF National Youth License.

A 1994 graduate of the College Charleston, he and his wife Dawn have one son, Ricky (10).

Shane Weems at Greenwood Field

3232

3333

CCOOOONNFFERREENNCCEEE //// RRRRREEEEEEEEECCCCOOORRRRDDDSSSS

3434

2010 ASHEVILLE SEASON

## Name GP-GS G A Pts Sh Sh% GW PK-ATT 17 HOLZINGER, Connor 18-17 1 5 7 10 .100 0 0-020 HAGEDORN, Jake 18-16 3 0 6 21 .143 0 0-010 PASCHALL, Colton 18-6 3 0 6 19 .158 1 0-023 BARTELS, Bryan 18-15 2 1 5 32 .062 2 0-011 GEORGE, Bryan 17-10 2 1 5 18 .111 1 0-012 LINGERFELT, Kenneth 18-11 1 0 2 19 .053 0 0-0 9 LASSEN, Branden 18-17 1 0 2 19 .053 0 0-0 5 CASTRO, Bobby 18-8 1 0 2 16 .062 0 0-0 8 SIDES, Jake 17-15 1 0 2 12 .083 0 0-0 14 MORROW, J.J. 18-17 0 1 1 7 .000 0 0-0 25 MORROW, Eli 10-5 0 1 1 5 .000 0 0-0 15 KOSLICK, Alex 10-4 0 0 0 8 .000 0 0-0 7 WOOD, David 12-3 0 0 0 7 .000 0 0-0 3 ROSSABI, Samuel 14-11 0 0 0 3 .000 0 0-0 22 LOHMEYER, Hans 6-3 0 0 0 2 .000 0 0-0 18 ODUM, Zachary 15-3 0 0 0 2 .000 0 0-0 6 GROOMS, Kye 9-2 0 0 0 2 .000 0 0-0 24 KYNAST, Tim 8-0 0 0 0 1 .000 0 0-0 21 PARRA, David 6-1 0 0 0 0 .000 0 0-0 4 STEMKOWSKI, Nick 9-5 0 0 0 0 .000 0 0-0 Total 18 15 9 39 203 .074 4 0-0 Opponents 18 31 29 91 271 .114 13 1-2

RECORD: OVERALL BIG SOUTH HOME AWAY NEUTRALALL MATCHES 4-13-1 2-6-0 2-4-0 1-6-1 1-3-0

TEAM STATISTICS AVL OPP

SHOT STATISTICS Goals-Shot attempts 15-203 31-271 Goals scored average 0.83 1.72 Shot pct .074 .114 Shots/Game 11.3 15.1 Assists 9 29CORNER KICKS 92 111PENALTY KICKS 0-0 1-2PENALTIES Yellow cards 23 12 Red cards 1 0ATTENDANCE Total 1180 3371 Dates/Avg Per Date 6/197 8/421 Neutral Site #/Avg 4/296

2010 RESULTSDATE OPPONENT W/L SCORE ATTSep 03 vs IUPUI L 1-3 -Sep 05 vs Eastern Illinois W 3-0 -Sep 08 BREVARD COLLEGE W 3-0 213Sep 17 at Lipscomb L 0-2 611Sep 19 vs Belmont L 1-2 111Sep 22 at USC Upstate L 0-1 367Sep 25 at ETSU LO2 1-2 419*Sep 29 GARDNER-WEBB L 0-3 241Oct 02 at Longwood TO2 1-1 200*Oct 05 at Presbyterian College WOT 2-1 167*Oct 09 RADFORD L 1-4 -*Oct 13 at Coastal Carolina LO2 0-1 257*Oct 16 at High Point L 0-3 943*Oct 23 VMI L 1-2 345Oct 30 WOFFORD L 0-2 234*Nov 03 WINTHROP W 1-0 147*Nov 06 at LIBERTY L 0-2 407Nov 11 vs High Point L 0-2 1071

|-GOAL AVERAGE-| |-SAVES-|## GOALTENDERS GP Minutes GA Avg Sv Pct W L T Sho 1 HURSKAINEN, Lassi 18 1669:54 31 1.67 96 .756 4 13 1 3.0 Total 18 1669:54 31 1.67 97 .758 4 13 1 3 Opponents 18 1669:54 15 0.81 57 .792 13 4 1 8

GOALS BY PERIOD 1st 2nd OT OT2 TotalUNC Asheville 5 9 1 0 15Opponents 14 15 0 2 31

SHOTS BY PERIOD 1st 2nd OT OT2 TotalUNC Asheville 89 103 9 2 203Opponents 137 126 6 2 271

SAVES BY PERIOD 1st 2nd OT OT2 TotalUNC Asheville 56 41 0 0 97Opponents 23 33 1 0 57

CORNER KICKS 1st 2nd OT OT2 TotalUNC Asheville 45 46 0 1 92Opponents 55 52 3 1 111

FOULS 1st 2nd OT OT2 Total UNC Asheville 98 83 2 1 184Opponents 84 95 5 0 184

3535

BIG SOUTH OVERALLTeam W L T Pts Pct W L T Pct Home Road Neu L10 Streakx-High Point 8 0 0 24 1.000 16 4 1 .786 10-1-1 5-2-0 1-1-0 8-2-0 L1y-Coastal Carolina 5 2 1 16 .688 12 8 2 .619 5-2-0 5-5-2 2-1-0 6-3-1 L1Gardner-Webb 5 3 0 15 .625 8 11 0 .421 5-4-0 2-5-0 1-2-0 5-5-0 L1Liberty 5 3 0 15 .625 10 7 1 .583 4-3-0 5-3-0 1-1-1 5-5-0 L1Radford 4 3 1 13 .562 7 9 3 .447 4-0-1 2-8-1 1-1-1 3-6-1 L1Winthrop 3 5 0 9 .375 5 12 1 .306 3-5-0 1-6-1 1-1-0 2-7-1 L3VMI 3 5 0 9 .375 3 12 2 .235 2-5-1 1-6-1 0-1-0 3-6-1 L1UNC Asheville 2 6 0 6 .250 4 13 1 .250 2-4-0 1-6-1 1-3-0 2-7-1 L2Presbyterian College 0 8 0 0 .000 2 13 1 .156 2-4-0 0-8-1 0-1-0 1-9-0 L5

x-Regular Season Champion y-Tournament Champion

2010 BIG SOUTH STANDINGS

FIRST TEAM ALL-CONFERENCEKaro Okiomah, F, High Point

Darren Amoo, F, LibertyIyiola Awosika, F, Radford

Ross Kelly, MF, Coastal CarolinaFejiro Okiomah, MF, High Point

Philip Aseweh, MF, LibertyShawn Sloan, MF, High Point

Alex Russell, D, Coastal CarolinaJon Ole Reinhardsen, D, Gardner-Webb

Uriah Bentick, D, LibertyJames Leith, D, Radford

Michael Chesler, GK, High PointScott Rojo, F, High Point

SECOND-TEAM ALL-CONFERENCENicolas Wrobel, F, Gardner-Webb

Amir Shihata, F, VMIMiquel Casajuana, F, Winthrop

Justin Portillo, MF, Coastal CarolinaRomeo Kabanda, MF, Gardner-Webb

Brian Harding, MF, VMIMatt Stinson, MF, WinthropRyan Bennett, D, High Point

Todd Ray, D, High PointWill Stewart, D, High Point

Ayao Sassou, D, VMILassi Hurskainen, GK, UNC AshevilleScott Angevine, GK, Coastal Carolina

ALL-FRESHMAN TEAMPedro Ribeiro, F, Coastal Carolina

Justin Portillo, MF, Coastal CarolinaNicolas Wrobel, F, Gardner-Webb

Chris Davis, F, Gardner-WebbAdam Sewell, MF, High PointAlex Martinez, MF, High Point

Harrison Russell, MF, PCBernardo Ulmo, MF, Radford

Luis Grande, MF, RadfordKenneth Lingerfelt, F, UNC Asheville

Matt Stinson, MF, WinthropTinotendo Chibharo, MF, Winthrop

ACADEMIC ALL-CONFERENCEMatt Horn, WinthropPhillip Aseweh, Liberty

Adam Hatem, High PointJake Sides, UNC Asheville

Romeo Kabanda, Gardner-WebbAlex Russell, Coastal Carolina

Logan Huff, Presbyterian CollegeAnthony Payne, Radford

Sonny Landry, VMI

PLAYER OF THE YEARMKaro Okiomah, High Point

FRESHMAN OF THE YEARAdam Sewell, High Point

SCHOLAR-ATHLETE OF THE YEARMatt Horn, Winthrop

COACH OF THE YEARDustin Fonder, High Point

BIG SOUTH MEN’S SOCCER CHAMPIONSHIP

Thursday, Nov. 11 - Quarterfi nals#3 Gardner-Webb 2 .......... #6 Winthrop 0#2 Coastal Carolina 1 .................. #7 VMI 0#5 Radford 2 ............................#4 Liberty 1#1 High Point 2 .........#8 UNC Asheville 0

Friday, Nov. 12 Semifi nals#2 Coastal Carolina 1 #3 Gardner-Webb 0#1 High Point 1 ..................... #5 Radford 0

Sunday, Nov. 14 Finals#2 Coastal Carolina 3 .....#1 High Point 1

ALL-TOURNAMENT TEAMRoss Kelly, Coastal Carolina (MVP)

Joe Anderson, Coastal CarolinaScott Angevine, Coastal CarolinaAlex Russell, Coastal CarolinaFejiro Okiomah, High PointKaro Okiomah, High PointShawn Sloan, High PointLuis Grande, Radford

Brendan Shaffer, RadfordRomeo Kabanda, Gardner-Webb

Jon Ole Reinhardsen, Gardner-WebbMatt Stinson, Winthrop

Brian Harding, VMIChris Osborne, Liberty

Lassi Hurskainen, UNC Asheville

3636

BIG SOUTH SOCCER RECORDS

Regular Season Championships

2001

The 2001 Big South Conference Regular-Season Champion, UNC Asheville Bulldogs compiled a 5-2-0 conference record.

Big South Tournament ResultsYear Opponent Round Score W/L Site 1984 Radford Quarterfi nals 0-9 L Radford, Va.1985 Winthrop Quarterfi nals 1-3 L Conway, S.C.1986 Winthrop Quarterfi nals 2-3 (OT) L Rock Hill, S.C.1988 Radford Semifi nals 0-2 L Buies Creek, N.C.1989 Coastal Carolina Semifi nals 1-2 L Asheville, N.C.1990 Augusta Quarterfi nals 5-0 W Asheville, N.C.1990 Coastal Carolina Semifi nals 1-2 (OT) L Asheville, N.C.1991 Davidson Quarterfi nals 1-0 W Davidson, N.C.1991 Winthrop Semifi nals 1-1 (9-10, PK) T Conway, S.C.1992 Charleston Southern First Round 0-3 L Charleston, S.C.1995 UMBC Quarterfi nals 1-3 L Conway, S.C.1996 Liberty Quarterfi nals 0-1 L Greensboro, N.C.1998 Liberty Quarterfi nals 0-4 L Radford, Va.1999 Coastal Carolina Quarterfi nals 0-0 (4-2, PK) T Conway, S.C.1999 Radford Semifi nals 0-1 L Conway, S.C.2000 Radford Quarterfi nals 2-3 L Lynchburg, Va.2001 High Point Quarterfi nals 0-2 L Rock Hill, S.C.2002 Radford Quarterfi nals 3-4 L Rock Hill, S.C.2003 Winthrop Quarterfi nals 1-5 L Radford, Va.2004 Winthrop Quarterfi nals 2-1 W Birmingham, Ala.2004 Coastal Carolina Semifi nals 0-1 L Birmingham, Ala.2005 Birmingham-Southern Quarterfi nals 0-2 L High Point, N.C.2006 Coastal Carolina Quarterfi nals 1-2 L Radford, Va.2007 Liberty Quarterfi nals 1-2 L Rock Hill, S.C.2008 Gardner-Webb Quarterfi nals 4-2 W Conway, S.C.2008 Coastal Carolina Semifi nals 0-1 L Conway, S.C.2009 Liberty Quarterfi nals 0-1 L Lynchburg, Va.2010 High Point Quarterfi nals 0-2 L High Point, N.C.

Big South Tournament Record By Round Win Loss Tie PctFirst Round 0 1 0 .000Quarterfi nals 4 14 1 .225Semifi nals 0 6 1 .000Finals 0 0 0 .000

Big South Tournament Record By Opponent Win Loss Tie .PctAugusta 1 0 0 1.00Birmingham-Southern 0 1 0 .000Charleston Southern 0 1 0 .000Coastal Carolina 0 5 1 .100Gardner-Webb 1 0 0 1.00Davidson 1 0 0 1.00High Point 0 2 0 .000Liberty 0 4 0 .000Radford 0 5 0 .000UMBC 0 1 0 .000Winthrop 1 3 1 .300Totals 4 22 2 .231

3737

Game RecordsGoals: 4, Mike Kachan vs. Warren Wilson, (8/30/02)Assists: 4, Mark Magee vs. Carson Newman (1988)Points: 10, Mark Magee vs. Carson Newman (1988)Shots: 11, Mat Lis vs. Toccoa Falls (1982) 11, Aytekin Yildiz vs. King (1982)

Season RecordsGoals: 20, Aytekin Yildiz (1982)Assists: 16, Mark Magee (1987)Points: 46, Aytekin Yildiz (1982)Saves: 126, Larry Cook (1986)Shutouts: 10, Larry Cook (1083)

Career RecordsGoals: 53, Aytekin Yildiz (1981-84)Assists: 42, Mark Magee (1985-88)Points: 126, Aytekin Yildiz (1981-84)Shots: 269, Mark Magee (1985-88)Saves: 408, Larry Cook (1986)Shutouts: 20, Larry Cook (1983)

Season Top 10Goals:1. Aytekin Yildiz 20 19822. Aytekin Yildiz 16 1983 Pat Britz 16 19884. Jimmy O’Neill 15 1984 Dan Dougherty 15 19906. Dan Dougherty 14 19897. Mark Magee 11 1986 Mike Neilson 11 19879. Scott Mosier 8 1991 Mark Aquista 8 1995 Kane Lawson 8 2000 Mike Kachan 8 2001 Barrett Locke 8 2002

Assists:1. Mark Magee 16 19872. Jonathan Alexander 15 19893. Jimmy O’Neill 11 1983 Craig Kwiatkowski 11 19885. Ulrich Dietrich 9 1984 Mark Magee 9 1985 Jon Alexander 9 1991 8. Mike Eichner 8 1986 Dan Dougherty 8 199010. Colin Barnes 7 2000 Greg Yelverton 7 2004

Points:1. Ayetkin Yildiz 46 19822. Ayetkin Yildiz 40 19833. Pat Britz 39 19884. Dan Dougherty 38 19905. Dan Dougherty 37 19896. Jimmy O’Neill 36 19847. Mark Magee 32 19878. Mark Magee 29 19869. Scott Mosier 23 199110. Mark Aquista 22 1995 Kane Lawson 22 2000 Barrett Locke 22 2002

Saves:1. Larry Cook 126 19862. Al Winston 125 19873. Sean Gorbell 107 1994

4. Larry Cook 106 19845. Season Kelly 101 1982 Bill Owen 101 19897. Michael Pereira 96 20058. Al Winston 94 19889. Chris Williams 93 199210. Larry Cook 92 1985

Career Top 10Goals:1. Aytekin Yildiz 53 1981-842. Patrick Britz 37 1987-903. Mark Magee 35 1985-884. Dan Dougherty 29 1989-905. Jimmy O’Neill 25 1983-84 Kane Lawson 25 1997-20007. Mark Aquista 24 1993-968. Mike Kachan 23 2000-03 Barrett Locke 23 2002-06 Scott Szymanski 23 2005-08 Assists:1. Mark Magee 42 1985-882. Ulrich Dietrich 37 1981-843. Jonathan Alexander 30 1989-924. Patrick Britz 28 1987-905. Chip Pensa 25 1982-856. Aytekin Yildiz 20 1981-207. Matt Lis 18 1982-838. Jimmy O’Neill 17 1983-84 Dan Dougherty 17 1989-9010. Mike Eichner 16 1985-88

Points:1. Aytekin Yildiz 126 1981-842. Mark Magee 112 1985-883. Patrick Britz 102 1987-904. Dan Dougherty 75 1989-905. Jimmy O’Neill 67 1983-846. Mark Aquista 62 1993-96 Kane Lawson 62 1997-20008. Chip Pensa 53 1982-859. Mike Kachan 52 2000-0310. Mike Nielsen 51 1985-87

Saves:1. Larry Cook 408 1983-862. Sean Gorbell 269 1993-953. Al Winston 260 1985-884. Andrew Heath 249 1999-20025. Todd Cecchini 233 1977-806. Michael Pereira 178 2004-077. Lassi Hurskainen 173 2008-8. Phillip Horner 127 2004-079. Mark Robinson 123 1993-96

Shutouts:1. Larry Cook 20 1983-862. Andrew Heath 12 1999-20023. Sean Kelly 10 1980-824. Al Winston 8 1985-885. Ben Betsalel 7 2000-036. Sean Gorbell 6 1993-95 Lassi Hurskainen 6 2008-8. Mark Robinson 5 1993-969. Michael Pereira 4 2004-0710. Phillip Horner 2 2004-07

ASHEVILLE RECORDS

3838

ASHEVILLE TEAM RECORDSGoalsGame: 4, (3x) last by Mike Kachan vs. Warren Wilson, 8/30/02Season: 64, 1983

AssistsGame: 4, (3x) last by Mark Magee vs. Carson Newman, 1988Season: 97, 1983

PointsGame: 10, Mark Magee vs. Carson Newman, 1988Season: 46, Aytekin Yildiz, 1982

ShotsGame: 11, (2x) Mat Lis vs. Toccoa Falls, 1982, Aytekin Yildiz vs. King, 1982Season: 80, Aytekin Yildiz, 1982

WinsSeason: 14, 1984Consecutive: 5, 5x last 1996Conference: 5, 2001Consecutive: 3, 2001 and 2004

LossesSeason: 16, 1989, 1992Consecutive: 10, 2005Conference: 8, 1998Consecutive: 8, 1998

Ties4, 1974, 2008Season Winning Percentage.682 (14-6-2), 1984

Fewest Goals AllowedSeason: 15, 1982

Most Goals AllowedGame: 17, vs. Central Wesleyan, 1979Season: 84, 1981

Miscellaneous RecordsShutouts in a Season11, 1983

Largest Margin of Victory15, vs. Mars Hill, , 2003

Largest Margin of Defeat17-0, vs. Central Wesleyan, 1979

Consecutive Games With At Least One Goal14 games, 1984

Consecutive Shutout Minutes670, 1982

Longest Unbeaten Streak10, 1984

Most Consecutive Home Wins7, 2000-01

Most Consecutive Shutouts7, 1982

Best Goals Against Average0.67, 1983

GoalKeeper RecordsSeasonMost Minutes: 2,012, Larry Cook (1984) Most Saves: 233, Todd Cocchini (1977)Best Goals Against Avg.: 0.70, Larry Cook (1983) Most Shutouts: 10, Larry Cook (1983)

CareerMost Minutes: 7,035, Larry Cook (1983-86)Most Saves: 408, Larry Cook (1983-86)Best Goals Against Avg.: 1.47, Larry Cook (1983-86)Most Shutouts: 20, Larry Cook (1983-86)

Pat Britz (left) is UNC Asheville’s all-time DI leading scorer and was inducted into the UNC Asheville Hall of Fame in 2007.

3939

Year Goals Assists Points Saves1982 Aytekin Yildiz (20) Matt Lis (9) Aytekin Yildiz (46) Sean Kelly (101)1983 Aytekin Yildiz (16) Jimmy O’Neill (11) Aytekin Yildiz (40) Larry Cook (84)1984 Jimmy O’Neill (15) Ulrich Dietrich (9) Jimmy O’Neill (36) Larry Cook (106)1985 Mark Magee (6) Mark Magee (9) Mark Magee (21) Larry Cook (92)1986 Mark Magee (11) Mike Eichner (11) Mark Magee (29) Larry Cook (126)1987 Mike Neilson (11) Mark Magee (16) Mark Magee (32) Al Winston (125)1988 Pat Britz (16) Craig Kwiatkowski (11) Pat Britz (39) Al Winston (94)1989 Dan Dougherty (14) Jonathan Alexander (15) Dan Dougherty (37) Bill Owen (101)1990 Dan Dougherty (15) Dan Dougherty (8) Dan Dougherty (38) Eric Partin (90)1991 Scott Mosier (8) Jonathan Alexander (9) Scott Mosier (23) Steve McCullough (89)1992 Tony Kuster (5) Jonathan Alexander (3) Tony Kuster (10) Chris Williams (93) Greg Ives (3)1993 Glenn Nocik (7) Glen Nocik (6) Glen Nocik (20) Sean Gorbell (86)1994 Mark Acquista (5) Brad Northington (5) Mark Acquista (12) Sean Gorbell (107)1995 Mark Acquista (8) Mark Acquista (6) Mark Acquista 22) Sean Gorbell (75)1996 Joe Granack (6) Joe Granack (5) Joe Granack (17) Mark Robinson (72)1997 Kane Lawson (7) Kyle Payne (4) Kane Lawson (17) Jerry Hancock (73)1998 Kane Lawson (4) Colin Barnes (3) Kane Lawson (10) Jerry Hancock (81)1999 Kane Lawson (6) six players tied (2) Kane Lawson (13) Andrew Heath (57) 2000 Kane Lawson (8) Colin Barnes (7) Kane Lawson (22) Andrew Heath (56)2001 Mike Kachan (8) Colin Barnes (5) Mike Kachan (18) Andrew Heath (63)2002 Barrett Locke (8) Jordan Holthouser (5) Barrett Locke (22) Andrew Heath (73) Greg Yelverton (5)2003 Mike Kachan (5) Greg Garrison (4) Mike Kachan (12) Ben Betsalel (87) Jordan Holthouser (4) Greg Yelverton (4) 2004 Jordan Holthouser (5) Greg Yelverton (7) Jordan Holthouser (12) Michael Pereira (65)2005 Scott Szymanski (5) Daniel Bandoly (6) Daniel Bandoly (12) Michael Pereira (96)2006 Barrett Locke (6) Andrew Klerekoper (3) Barrett Locke (13) Phillip Horner (67)2007 Scott Szymanski (9) Ryan Haupt (3) Scott Szymanski (20) Phillip Horner (68) J.W. Gallagher (3)2008 Scott Szymanski (5) Caleb Alexander (3) Scott Szymanski (11) Lassi Hurskainen (77) Nate Neal (3)2009 Jake Hagedorn (3) Connor Holzinger (4) Connor Holzinger (10) Lassi Hurskainen (108) Connor Holzinger (3) Zachary Odum (3)2010 Jake Hagedorn (3) Colton Paschall (3) Connor Holzinger (5) Connor Holzinger (7) Lassi Hurskainen (96)All-Conference PerformersFirst TeamJonathan Alexander (1990)Colin Barnes (2000, 2001)Kyle Britton (2001)Andrew Delizio (1991)Dan Dougherty (1989, 1990)Greg Garrison (2001)Arin Glass (1999)Sean Gorbell (1995)Mike Kachan (2001)Kane Lawson (2000)Mark Magee (1986, 1988)Adam Stein (1995)Greg Yelverton (2003, 2004)

Second TeamAnthony Cameron (1993)Andrew Heath (2001)Kane Lawson (1997, 1998, 1999)Barrett Locke (2003)Mike Mosley (1987)Brad Patterson (2003)Bernd Reichart (1998)Nick Sands (2001)Jeremy Shrader (2002)

Adam Stein (1996)Jeremy Wisdo (1999, 2000)Greg Yelverton (2002)Edwin Wotortsi (2006)Barrett Locke (2006)Scott Szymanski (2007, 2008)Edwin Wotortsi (2007)Patrick Tate (2008)Lassi Hurskainen (2010)

All-Tournament (Big South)Dan Dougherty (1989, 1990)Joe Granack (1998)Andrew Heath (1999)Craig Kwiatkowski (1990)Kane Lawson (1999, 2000)Barrett Locke (2002)Rodney Levy (1996)Scott Mosier (1991)Michael Pereira (2004)Joe Srebalus (2004)Grant Gilmore (2005)Scott Szymanski (2007)Patrick Tate (2008)Alex Morrow (2008)Lassi Hurskainen (2010)

Big South Scholar Athlete Of The YearMike Roach (2001)Jeremy Shrader (2002)

Big South Coach of the YearSteve Cornish (1995, 2001)

Big South Rookie of the YearJoe Granack (1996)Kyle Britton (2001)

All-District Academic All-AmericanMike Roach (2001)

First Team Academic All-AmericanMike Roach (2001)

Big South All-Rookie TeamMichael Periera (2004)Daniel Bandoly (2004)Scott Szymanski (2005)Lassi Hurskaine (2008)J.J. Morrow (2008)David Parra (2009)Zachery Odum (2009)Kenneth Lingerfelt (2010)

YEAR-BY-YEAR LEADERS

4040

•A•Mark Acquista 1993-96 Caleb Alexander 2005-08Jonathan Alexander 1989-92 Cameron Allison 2003-05 J. Bruce Anderson 1978

•B•Daniel Bandoly 2004-07Mike Balsamides 1984 Frank Balentine 2000 Colin Barnes 1998-01Gilbert Barrus 1976Bryan Bartels 2008-David Basile 1997-98 David Bass 1987-88 Ben Batsalel 2000-04Tony Becvinovski Jaime Belmont 1993Bryan Benak 1985Jason Blanton 1993Mike Blanton 1976Robert Booth 1993-96 John Boshart 1986-88 John Bowman 1987 David Boyd 1994-96 Tim Branson 1980Enrique Breceda 1988Brett Breitschwerdt 2000-03 Kyle Britton 2001Pat Britz 1987-90Weston Brown 2008-Andrew Bumgarner 2008Christopher Burn 2005-06Judson Byers 1998-99 Nicholas Baud 2004-07

•C•Ken Cagle 1980,84Anthony Cameron 1993-94Barry Campbell 1985Bobby Castro 2010-David Cave 1994-96Todd F. C. Cecchini 1978Sean Chambers 1993-94William Chamberlain 1978John Chapuis 2003-04 Scott Chesna 1993 Mark Collins 1997 Brent Connor 1978Larry Cook 1983-86John M. Councell 1976-78Shawn Culbertson 1994-96

•D•Jeff Dean 1988-89Mark DelPezzo 1982 Ulrich Dietrich 1982-84 Andrew DiLizio 1991Brian Domby 1998-2000J.J. Dore 2001-02

Dan Dougherty 1989-90 Derick Dubard 1991-92

•E•Amyt Eckstein 1979Mike Eichner 1985-88 Scott Eisenbraun 1990-91 Austin Englert 2001Josh Epstein 1999-00Rick Evans 1993-95 Brandon Eagle 2002-03

•F•Brian Fairchild 1996-99 Brad Falk 2000Hassan Farazian 1976 David Farren 1990-93 Craig Fiore 1987-90 Doug Fleck 1976

•G•Robert E. Gach 1976J.W. Gallagher 2006-08Greg Garrison 2000-03Jimmy Gentry 1987-89 Bryan George 2008-Shelby Gibson 1990,92 James Gisborne 1997 Arin Glass 1997-00Aaron Glugover 1987 Nick Goodman 1998 Sean Gorbell 1993-95Joe Granack 1996-99Blake Griffi n 1998-2000Jim Grigsby 1976Grant Gilmore 2002-05Toby Grohne 1992Kye Grooms 2008-Karl Gunther 1984-85

•H•Jake Hagedorn 2008-Wondwossen Haile 1978Mike Hammett 1983 Pete Hammett 1982-84Jerry Hancock 1997-98Marc Harding 1987Keith Harris 1976Aaron Harcz 2005Josh Hartmann 1997-00Ryan Haupt 2005-08John Hillman 2004-07Reagan Havens 1986Andrew Heath 1999-02Ryan Henry 1990John Heppler 1988-91Spencer Hines 1999Danny Holcomb 1989,91Walker Holcomb 1982 Norman Holland 1976Ben Hoskin 1989

Kevin Howard 1989-92 George Hudson 1980 Rodman Hughes 1978-80Lassi Hurskainen 2008-Jeff Husel 1992Russell Hutchins 1976Jordan Holthouser 2002-04Conner Holzinger 2008-10Phillip Horner 2004-07

•I•Hasan Inan 1980-83Greg Ives 1991-95

•J•Reid Jackson 1992-94Matt Jacobs 2001-02Alex James 1983-85Cory Jarrett 1999Eric Johnson 1986Maynard Johnson 1978Harry Johnston 1978J.J. Jones 1982Nathan Jones 2006-07

•K•Mike Kachan 2000-03Frank Keller 1976-78 Max Keller 1994Seth Keller 1993Andrew Klerekoper 2004-06Alex Koslick 2010Joe Kuhn 1983-86Dan Kurtz 1987-88Tony Kuster 1992Steve Kurzer 1982 Chris Kwiatkowski 1989-92 Craig Kwiatkowski 1988-91D.J. Kwiatkowski 1994 Ryan Kohler 2003Tim Kynast 2010-

•L•Yon Joseba Larrea 1976Branden Lassen 2008-Chris Lawrence 1995-96Judd Lawrence 2006Kane Lawson 1997-00Kelsey Lenhardt 2005 George Lepper 1976 Rodney Levy 1995-96Kenneth Lingerfelt 2010-Andrew Linton 1978John Linton 1978Matt Lis 1982-83Jonathan London 2005Jonathon Long 2000-03Brad Lopez 1997-98Chance Lord 2005Cal Lovin 1990-93Jeff Low 1980

ALL-TIME LETTERWINNERS

4141

Barrett Locke 2002-06Hans Lohmeyer 2010-

•M•Mark Magee 1985-88Steve Magoon 1982-85 Keith Maney 1985 Ed Manning-Tano 1992-93Rico Martin 1992Alex Martin-Smith 2009 Will Matthews 2000-03 Mark Mays 1985 1987-89Benjamin Meyer 2005-08Tom C. McCartney 1978Steve McCullough 1991Doug McCurry 1976-78Thomas McMahon 1978Colby Miller 1993Alex Morrow 2006-08Eli Morrow 2010-J.J. Morrow 2008-Scott Mosier 1989-91Mike Mosley 1984-87James Mulder 1993-95John Murdoch 1982-84

•N•Michael Neilson 1985-87Andy Nicolson 1983-84Swan Nicolson 1984-86Patrick Noblitt 1992Glen Nocik 1993Brad Northington 1994-97Nathan Neal 2004-08Joseph Nixon 2002-03

•O•Zachary Odum 2009-10Robert Oetting 1989-91Jimmy O’Neill 1983-84Bill Owen 1989-90

•P•Keith Painter 1999-02Francisco Palalez 1987-89Paul Parce 1976-78Chris Parham 1992-94David Parra 2009-Eric Partin 1990-91Colton Paschall 2008-10Pete Paschall 1992-93Brad Patterson 2000-03Kyle Payne 1997-98Chip Pensa 1982-85Michael Pereira 2004-07David Pieniazkewicz 1996-97James Platt 1992John Pope 1982, 1984Jenkins Powell 1995-97Douglas Price 1978-80Kyle Proctor 2005

•R•Bobby C. Ransey 1978 Chris Ramsey 1976 Bernt Reichart 1998Tom Reynolds 1982 Neal Rhoades 1982-84Tyler Ridout 1996-97 Mike Roach 1999-01Matt Robbins 1999 Mark Robinson 1993-96Scott Rodriguez 1991 Markus Roeders 1987-88Chad Roland 1993Sam Rossabi 2010-Andy Rouse 1989 John Rudel 1993-96

•S•Gregg Sadelson 1982-83Nick Sands 1998-01 Trent Savidge 1987 Ben Saylor 2000-04 Steve Scheidon 1980 Jeremy Schrader 1999-01Adam Schwartz 2003-04Matt Scovil 2002-04 Frank Seidle 1982-84 Tieg Selburg 1995-97 Taylor Shanklin 2006-07David Sharpe 1976Jake Sides 2008-10 Clay Sills 1995-97Jose Siqueira 1983 Steve Sloan 1982-84Alex Smith 1982 Collin Smith 1986-88 Robbie Smith 1992 Andy Smitley 1989-92Dennis Snyder 1978-80 Jim Spratling 1987-88 John Spratling 1983-86Joe Srebalus 2002-04Jim Stahl 1978Brian Stamey 1992Adam Stein 1993-96Nick Stemkowski 2008-Jeff Stewart 1976Shane Sullins 1986Scott Szymanski 2005-08

•T•Patrick Tate 2006-08Mike Taylor 1990Trent Thomas 1978Lance Thompson 1976Tracy Tymko 1993-96

•V•Pablo Vaca 1982David Verga 2004-07Marc Villegas 1995-99Damir Vrbljancevic 1995

•W• Brian Wade 1985Neal Wagner 1985-88Hardy Ward 1983-84Tye Warren 1991Brendan Wilbur 1994-96Chris Williams 1992-93Todd Williams 1997-98Ian Willmot 2005-06Al Winston 1985-88Jeremy Wisdo 1999-00Stephen Wiseman 1985David Wood 2009-Steve Woody 1982-84Edwin Wotortsi 2006-07Greg Wynn 1982-83

•Y•Sho Yamagishi 2005-06Yenigan 1980Aytekin Yildiz 1982-84C. Rick Young 1978Greg Yelverton 2002-04

Current players in BOLD

4242

YEAR-BY-YEAR RESULTS SINCE 1988 1988 • Overall: 8-11-1 Big South: 3-3-09/1 at Duke L 0-89/3 at Winthrop* L 1-39/7 at Clemson L 1-89/10 at VMI L 2-59/17 Gardner-Webb W 9-19/18 Lenoir-Rhyne T 2-2 (OT)9/22 at Appalachian State L 0-29/24 Campbell* W 1-09/28 Milligan W 3-110/1 at Furman L 1-510/2 Jacksonville L 0-1 (OT)10/5 Warren Wilson W 3-010/8 Carson-Newman W 7-010/11 at Augusta* W 2-110/15 at North Georgia W 4-010/17 at The Citadel L 1-310/19 at Baptist* W 2-110/22 at Coastal Carolina* L 0-1 (OT)10/27 Radford* L 0-411/3 vs. Radford^ L 0-2 *Big South Matches^Big South Tournament Match

1989 • Overall: 6-16-0 Big South: 3-3-09/2 at Furman L 0-39/4 at Georgia State L 2-59/9 Catawba L 0-49/13 at UNC Greensboro L 1-79/16 at Davidson L 1-39/23 at USC Spartanburg L 1-29/24 Wofford L 0-39/30 at Western Kentucky L 1-510/1 vs. Central Michigan L 0-210/4 Appalachian State L 3-410/7 Coastal Carolina* L 0-310/10 at Mars Hill W 3-010/14 VMI W 6-110/15 Winthrop* W 3-010/18 at Campbell* L 1-210/21 at Baptist* W 5-110/22 The Citadel W 1-010/25 at Augusta* W 3-210/28 at Radford* L 0-210/29 at James Madison L 0-411/2 Coastal Carolina^ L 1-211/16 at Charleston L 1-2*Big South Matches^Big South Tournament Match

1990 • Overall: 9-9-2 Big South: 4-2-09/1 at Catawba L 1-29/2 Davidson W 2-19/7 vs. Morehead State W 7-19/8 at Liberty L 0-19/12 Georgia State L 0-29/15 Erskine L 1-49/19 at Appalachian State W 2-19/22 Campbell* L 1-69/26 at Augusta* W 6-39/30 at Winthrop* W 2-110/3 at Coastal Carolina* L 0-310/6 Baptist* W 2-010/7 UNC Greensboro L 2-310/10 at UNC Charlotte W 1-010/17 Charleston T 2-2 (OT)10/20 at Wofford L 1-310/23 Radford* W 2-110/24 Furman T 1-1 (OT)10/30 Augusta^ W 5-011/3 Coastal Carolina^ L 1-2 (OT)*Big South Matches^Big South Tournament Match

1991 • Overall: 9-11-1 Big South: 1-5-09/7 at Erskine L 0-29/9 Butler L 0-19/11 at Furman L 0-19/15 at Charleston L 0-19/18 at Radford* L 0-19/21 Liberty W 6-29/27 District of Columbia W 3-0 9/29 Winthrop* L 0-210/2 Appalachian State W 2-1 (OT)10/5 Coastal Carolina* L 0-210/8 at Belmont-Abbey L 0-1 (OT)10/10 at Gardner-Webb W 4-010/12 at Charleston Sou.* L 1-2 (OT)10/13 at The Citadel W 2-1 (OT)10/19 at Davidson* L 0-210//22 at Campbell* W 2-110/26 at UNC Greensboro L 2-410/28 at Georgia State W 3-211/3 Western Kentucky W 1-011/6 at Davidson^ W 1-011/9 vs. Winthrop^ T 1-1 (Winthrop wins PK’s 10-9)*Big South Matches^Big South Tournament Match

1992 • Overall: 4-15 Big South: 0-89/5 UMBC* L 0-39/7 Charleston L 1-29/12 Furman L 0-39/16 at Coastal Carolina* L 0-119/19 Campbell* L 0-29/23 at Appalachian State L 0-39/27 at Winthrop* L 0-210/1 Erskine W 2-110/3 Gardner-Webb W 2-010/4 vs. Georgia State W 2-110/7 vs. South Alabama L 0-810/10 Charleston Southern* L 1-210/11 Radford* L 1-310/16 Towson State* L 1-2 (OT)10/18 at Vanderbilt L 0-410/21 at Butler L 1-310/24 at Mercer L 1-410/28 at Liberty* L 0-411/5 Marshall W 3-1*Big South Matches

1993 • Overall: 6-12-0 Big South: 1-8-0 9/4 Appalachian State W 1-09/6 at Erskine L 3-49/11 UNC Greensboro* L 0-39/15 The Citadel W 5-19/18 at Georgia State W 3-09/19 vs. Georgia Southern W 2-19/26 Vanderbilt W 2-19/29 at Campbell* L 2-410/2 Mercer L 0-210/6 at Charleston Sou.* W 4-010/9 Liberty* L 0-210/13 Coastal Carolina* L 1-310/16 at Towson State* L 0-110/18 at UMBC* L 0-610/20 at Furman L 0-710/23 vs. Kentucky L 1-310/27 at Radford* L 0-110/31 Winthrop* L 2-3*Big South Matches

1994 • Overall: 4-12-1 Big South: 1-6-19/3 at Appalachian State L 0-19/5 Kentucky L 1-39/10 at Liberty* L 0-2

9/14 Georgia State W 3-09/17 Stetson L 0-39/21 Carson-Newman W 2-19/28 at UNC Greensboro* L 0-210/1 Towson State* W 3-110/3 UMBC* T 1-110/5 Charleston Southern* L 2-310/8 at Coastal Carolina* L 0-510/11 at North Carolina L 0-710/15 Radford* L 0-210/19 at N.C. State L 2-610/23 Lenoir-Rhyne W 3-110/26 at Clemson L 0-410/29 at Winthrop* L 1-3*Big South Matches

1995 • Overall: 9-11-0 Big South: 3-4-09/2 UNC Wilmington W 2-19/4 at Kentucky L 1-29/10 Wofford W 3-19/16 Coastal Carolina* W 2-19/20 Appalachian State W 1-09/23 at Stetson W 5-49/24 at Georgia Southern W 2-09/27 UNC Greensboro* L 0-19/30 at VCU W 1-010/2 at UMBC* L 1-210/7 at Radford* L 0-110/9 at Charleston Sou.* W 3-210/11 Liberty* L 0-210/14 Marshall L 3-410/16 at East Carolina L 0-210/17 at North Carolina L 0-410/21 Catawba L 1-310/25 at Georgia State L 1-210/28 Winthrop* W 1-011/2 vs. UMBC^ L 1-3*Big South Matches^Big South Tournament Match

1996 • Overall: 8-7-3 Big South: 2-2-39/1 at Clemson L 1-119/4 Georgia State L 0-29/9 Montreat W 8-09/15 Georgia Southern W 3-29/18 at Citadel W 3-29/20 East Carolina W 2-19/25 at Wofford W 4-29/28 at Coastal Carolina* L 0-210/2 North Carolina L 0-210/5 Charleston Southern* W 3-010/9 at Appalachian State W 3-110/11 Radford* W 1-010/15 at UNC Greensboro* L 2-510/19 UMBC* T 1-1 (OT)10/23 at UNC Charlotte L 0-110/27 at Winthrop* T 3-3 (OT)11/2 at Liberty* T 1-1 (OT)11/8 vs. Liberty^ L 0-1*Big South Matches^Big South Tournament Match

1997 • Overall: 6-11-0 Big South: 2-5-08/29 at Georgia State W 2-19/2 at Wake Forest L 0-19/6 vs. Cleveland State L 0-49/7 vs. Bradley L 2-3 (OT)9/13 Mars Hill L 1-49/16 Citadel W 4-09/19 South Alabama* L 2-49/27 Liberty* L 1-310/1 at North Carolina L 0-210/4 Coastal Carolina* W 2-1 (OT)

4343

10/7 at Radford* L 0-310/10 Appalachian State W 1-010/13 Wofford W 3-210/18 at UMBC* L 0-210/22 at Charleston Sou.* L 1-310/25 Winthrop* W 1-010/29 at East Carolina L 0-1*Big South Matches

1998 • Overall 3-15-0 Big South 0-6-09/1 North Carolina L 0-39/5 at UNC Wilmington L 0-39/8 at Citadel L 2-39/16 at Appalachian State L 0-19/18 South Alabama* L 2-49/20 Georgia Southern L 0-59/16 at Liberty* L 0-39/30 East Carolina W 1-010/3 Radford* L 1-2 (OT)10/6 at Wake Forest L 0-710/10 Charleston Southern* L 2-310/13 Belmont-Abbey W 2-010/17 at Coastal Carolina* L 0-210/21 at High Point L 0-110/24 Elon W 1-010/28 at UNC Charlotte L 0-410/31 at Winthrop* L 0-211/5 vs. Liberty^ L 0-4*Big South Matches^Big South Tournament Match

1999 • Overall: 5-11-3 Big South: 1-5-19/4 at Wofford W 3-19/8 Warren Wilson W 4-09/11 at Evansville L 0-39/12 at Kentucky L 0-39/15 Georgia State L 0-49/22 Belmont-Abbey W 2-1 (OT)9/15 at VMI L 0-1 (OT)9/30 Appalachian State W 2-1 (OT)10/2 at Elon* W 2-1 (OT)10/6 High Point* L 0-110/9 Liberty* L 0-110/13 at Charleston Sou.* L 0-110/16 Coastal Carolina* L 0-110/20 North Carolina L 0-410/23 East Carolina T 0-0 (OT)10/27 Winthrop* L 1-310/30 at Radford* T 2-2 (OT)11/4 vs. Coastal Carolina^ W 0-0 (PK)11/5 vs. Radford^ L 0-1 (OT)*Big South Matches^Big South Tournament Match

2000 • Overall: 8-11-0 Big South: 3-4-09/3 at East Carolina L 1-2 (OT)9/4 Kentucky L 0-39/8 Warren Wilson W 7-09/10 VMI W 2-010/13 at Georgia State L 2-3 (OT)10/16 Charleston Southern* L 0-110/20 Citadel L 0-310/23 at Coastal Carolina* L 1-210/30 Elon* W 3-010/2 Belmont-Abbey W 4-110/4 at High Point* L 0-110/7 at Liberty* W 1-010/10 at Wake Forest L 0-710/14 Gardner-Webb W 4-110/18 Wofford W 2-110/21 at Georgia Southern L 3-4 (OT)10/25 at Winthrop* L 1-310/28 Radford* W 1-0

11/1 vs. Radford^ L 2-3 (OT)*Big South Matches^Big South Tournament Match

2001 • Overall: 9-8-0 Big South: 5-2-0 • Big South Regular Season Champs •8/31 Warren Wilson W 7-19/2 Evansville W 2-19/7 Army L 1-29/9 at Kentucky L 0-49/19 at Appalachian State L 0-59/25 at North Carolina L 0-39/29 BSC* W 6-110/3 at Wofford W 2-110/6 Liberty* W 2-110/9 at Gardner-Webb L 2-3 (OT)10/13 Coastal Carolina* W 3-110/20 at Winthrop* L 3-4 (OT)10/27 at Radford* W 2-010/31 High Point* W 4-011/3 at Charleston Sou.* W 1-011/6 at Elon* L 0-111/15 vs. High Point^ L 0-2*Big South Matches^Big South Tournament Match

2002 • Overall: 6-10-2 Big South: 3-4-18/30 Warren Wilson W 6-19/1 at Evansville L 0-29/6 vs. Western Kentucky L 0-29/8 at Louisville L 1-39/16 Gardner-Webb T 1-1 (OT)9/28 at BSC* L 3-410/4 at Liberty* W 2-1 (OT)10/6 at VMI W 2-010/9 at Furman L 0-210/12 at Coastal Carolina* L 1-2 (OT)10/14 Appalachian State L 0-310/19 Winthrop* L 2-310/23 at High Point* W 1-010/26 Charleston Southern* T 2-2 (OT)10/30 Elon* W 2-011/2 Wofford W 1-011/7 Radford* L 1-311/14 vs. Radford^ L 3-4*Big South Matches^Big South Tournament Match

2003 • Overall: 8-9-2 Big South: 4-3-08/29 at Wofford W 2-09/5 East Carolina T 1-1 (OT)9/7 Kentucky L 0-39/10 at Elon W 3-19/16 at Appalachian State L 0-29/19 Furman T 0-0 (OT)9/24 at Winthrop* L 0-29/27 at UNC Wilmington L 0-210/1 Coastal Carolina* W 2-110/4 at VMI* W 3-2 (OT)10/7 at Radford* W 1-010/10 BSC* L 0-310/12 Belmont L 0-110/18 Long Island W 2-1 (OT)10/23 Longwood W 1-0 (OT)10/29 Liberty* L 1-211/5 High Point* W 1-0 (OT)11/8 at Campbell L 2-3 (OT)11/13 vs. Winthrop^ L 1-5*Big South Matches^Big South Tournament Match

2004 • Overall: 7-10-2 Big South: 3-4-09/1 at Gardner-Webb W 2-0 9/4 Elon T 1-1 9/10 at Kentucky L 1-3 9/15 Radford* W 3-2 9/19 at East Carolina L 0-3 9/22 at High Point* W 3-1 9/26 UNC Wilmington L 0-2 9/28 at Coastal Carolina* W 2-1 10/6 at North Carolina L 0-3 10/9 VMI* L 0-2 10/16 at BSC* L 1-2 10/20 at Duke L 0-2 10/26 Winthrop* L 0-4 10/29 at Liberty* L 1-3 10/31 at Longwood W 1-0 11/3 Wofford W 4-1 11/6 Appalachian State T 1-111/11 vs. Winthrop^ W 2-111/13 vs. Coastal Carolina^ L 0-1*Big South Matches^Big South Tournament Match

2005 • Overall: 2-15-1 Big South: 1-6-09/9 Belmont T 2-2 (OT) 9/11 Lipscomb L 1-2 9/18 at UNC Wilmington L 3-6 9/21 at Appalachian State L 2-3 9/25 Birmingham-Southern* L 1-3 9/28 at Wofford W 1-0 10/1 at Charlotte L 0-3 10/5 High Point* W 3-0 10/8 at Radford* L 1-3 10/12 at Davidson* L 1-2 10/15 at VMI* L 1-2 (OT) 10/17 Campbell L 1-3 10/22 Coastal Carolina* L 0-1 (OT) 10/25 at Clemson L 0-5 10/29 Liberty* L 0-2 11/2 at Winthrop* L 0-4 11/5 Gardner-Webb L 0-211/10 vs. Birmingham-Sout.^ L 0-2*Big South Matches^Big South Tournament Match

2006 • Overall: 5-13-0 Big South: 2-5-08/25 Charlotte L 1-29/2 at Campbell L 1-39/6 Wofford W 5-09/9 Kentucky L 0-59/15 at Belmont L 0-39/17 at Lipscomb W 2-09/20 Appalachian State W 2-19/23 at Elon L 1-29/26 at Coastal Carolina* L 0-19/30 Radford* W 2-110/4 Winthrop* L 1-2 (OT)10/10 at High Point* L 2-3 (OT)10/14 at Liberty* L 0-210/18 at Clemson L 1-310/21 VMI* W 1-010/23 at Gardner-Webb L 0-110/28 at Birmingham-Sou.* L 0-111/2 vs. Coastal Carolina* L 1-2 *Big South Matches^Big South Tournament Match

4444

2007 • Overall: 4-12-1 Big South: 0-6-08/31 vs. IUPUI W 4-39/2 at Kentucky L 0-39/16 at Furman L 0-59/19 Elon L 0-29/22 Campbell L 1-2 (2OT)9/25 Presbyterian T 3-3 (2OT)9/29 High Point* L 0-1 (OT)10/3 Coastal Carolina* L 0-510/6 at VMI* L 0-210/9 Clemson W 2-1 (2OT)10/13 at Radford* L 0-210/15 at Wofford L 0-110/18 Liberty* L 0-210/31 at Winthrop* L 1-2 (OT)11/4 at Appalachian State W 2-111/7 Gardner-Webb W 4-011/15 vs. Liberty^ L 1-2*Big South Matches^Big South Tournament Match

2008 • Overall: 7-8-4 Big South: 3-3-29/6 Appalachian State L 0-19/12 at Elon L 0-1 (OT)9/14 vs. UNC Greensboro T 1-1 (2OT)9/16 Longwood W 3-29/19 vs. Belmont W 3-29/21 at Lipscomb L 1-39/27 Kentucky T 0-0 (2OT)9/30 at North Carolina L 1-210/4 VMI* W 2-1 (OT)10/7 at Presbyterian* W 2-110/11 Radford* L 1-210/15 Gardner-Webb* L 1-210/22 at Coastal Carolina* L 0-110/25 Winthrop* W 1-010/28 at High Point* T 1-1 (2OT)11/1 Wofford W 2-111/8 at Liberty* T 0-0 (2OT)11/13 vs. Gardner-Webb^ W 4-211/14 at Coastal Carolina^ L 0-1*Big South Matches^Big South Tournament Match

2009 • Overall: 6-12-2 Big South: 2-5-19/1 at #1 North Carolina L 0-5 9/4 BREVARD W 3-0 9/7 at Wofford T 0-0 (2OT)9/11 at Davidson L 0-2 9/13 vs Georgetown L 0-2 9/16 USC Upstate L 1-2 9/18 vs Lipscomb W 2-1 9/20 vs Belmont W 2-2 (2OT) 9/27 at #20 Kentucky L 1-3 9/29 ETSU W 1-0 9/03 HIGH POINT* L 1-2 10/6 PRESBYTERIAN* T 2-2 (2OT)10/10 at Radford* W 1-0 10/17 at VMI Keydets* W 2-1 10/24 at Winthrop* L 1-3 10/28 at Gardner-Webb* L 1-2 10/31 COASTAL CAROLINA* L 1-2 11/3 at Appalachian State L 0-2 11/7 LIBERTY* L 1-2 11/13 vs LIBERTY^ L 0-1 *Big South Matches^Big South Tournament Match

2010 • Overall: 4-13-1 Big South: 2-6-09/3 vs IUPUI L 1-3 9/5 vs Eastern Illinois W 3-0 9/8 BREVARD COLLEGE W 3-0 9/17 at Lipscomb L 0-2 9/19 vs Belmont L 1-2 9/22 at USC Upstate L 0-19/25 at ETSU L 1-2 (2OT) 9/29 GARDNER-WEBB* L 0-3 10/2 at Longwood T 1-1 (2OT) 10/5 at Presbyterian College* W 2-1 (OT) 10/9 RADFORD* L 1-4 10/13 at Coastal Carolina* L 0-1 (2OT) 10/16 at High Point* L 0-3 10/23 VMI* L 1-2 10/30 WOFFORD L 0-2 11/3 WINTHROP* W 1-0 11/6 at LIBERTY* L 0-2 11/11 vs High Point^ L 0-2 *Big South Matches^Big South Tournament Match

Branden Lassen

4545

ALL-TIME RESULTSTeam W L T Last MeetingAppalachian State 7 11 1 Nov. 3, 2009 Army 0 1 0 Sept. 7, 2001 Augusta 4 0 0 Nov. 1990 Belmont 2 3 1 Sept. 19, 2010 Belmont Abbey 3 0 0 Oct. 2, 2000 Birmingham-Southern 1 6 0 Oct. 28, 2006 Bradley 0 1 0 Sept. 7, 1997 Brevard 2 0 0 Sept. 8, 2010Butler 0 1 0 Oct. 1992 Campbell 1 7 0 Sept. 22, 2007 Carson-Newman 2 0 0 Sept. 21, 1994 Catawba 0 3 0 Oct. 21, 1995 Central Michigan 0 1 0 Oct. 1989 Charleston, College of 0 2 1 Sept, 1992 Charleston Southern* 6 6 1 Oct. 26, 2002 Charlotte 1 4 0 Aug. 25, 2006 Citadel 3 2 0 Oct. 20, 2000 Clemson 1 5 0 Oct. 9, 2007Cleveland State 0 1 0 Sept. 6, 1997 Coastal Carolina 5 21 1 Oct. 13, 2010 Davidson 1 2 0 Sept. 11, 2009 Duke 0 2 0 Oct. 20, 2004 East Carolina 2 3 2 Sept. 19, 2004 East Tennessee State 1 1 0 Sept. 25, 2010Eastern Illinois 1 0 0 Sept. 5, 2010 Elon 5 4 1 Sept. 12, 2008 Erskine 1 1 0 Oct 1, 1992 Evansville 1 2 0 Sept. 1, 2002 Furman 0 5 1 Sept. 16, 2007 Gardner-Webb 6 6 1 Sept. 29, 2010 Georgetown 0 1 0 Sept. 13, 2009Georgia Southern 2 2 0 Oct. 21, 2000 Georgia State 3 6 0 Oct. 13, 2000 High Point 5 9 1 Nov. 11, 2010 IUPUI 1 1 0 Sept. 3, 2010Jacksonville 0 1 0 Oct. 2, 1988 James Madison 0 1 0 Oct. 29, 1989 Kentucky 0 10 1 Sept. 27, 2009

Team W L T Last MeetingLenior-Rhyne 1 0 1 Oct. 23, 1994 Liberty 3 17 2 Nov. 6, 2010 Lipscomb 2 3 0 Sept. 17, 2010Long Island 1 0 0 Oct. 18, 2003 Longwood 3 0 1 Oct. 2, 2010 Louisville 0 1 0 Sept. 8, 2002 Marshall 1 1 0 Oct. 14, 1995 Mars Hill 1 1 0 Oct. 13, 1997 Mercer 0 1 0 Oct. 1992 Milligan 1 0 0 Oct. 1988 Montreat 1 0 0 Sept. 9, 1996 Morehead State 1 0 0 Sept. 1990 North Carolina 0 8 0 Sept. 1, 2009 North Carolina State 0 1 0 Oct. 19, 1994 North Georgia 1 0 0 Oct. 1988 Presbyterian 2 0 2 Oct. 5, 2010Radford 8 16 1 Oct. 9, 2010 South Alabama 0 3 0 Sept. 18, 1998 Stetson 1 1 0 Sept. 23, 1995 Towson State 1 1 0 Oct. 1, 1994 UMBC 0 4 2 Oct. 18, 1997 UNC Greensboro 0 5 1 Sept. 14, 2008 UNC Wilmington 1 3 0 Sept. 26, 2004 USC Upstate^ 0 3 0 Sept. 22, 2010 Vanderbilt 0 1 0 Oct. 1994 Va. Commonwealth 1 0 0 Sept. 30, 1995 VMI 7 5 0 Oct. 23, 2010 Wake Forest 0 3 0 Oct. 10, 2000Warren Wilson 5 0 0 Aug. 30, 2002Western Kentucky 0 2 0 Sept. 6, 2002Winthrop 7 15 1 Nov. 3, 2010 Wofford 11 4 1 Oct. 30, 2010

Bold indicates 2009 Opponents

*Formally Baptist College^Formally USC Spartanburg

4646

UNC Asheville’s Athletics Hall of Fame was established in 2003 and has had fi ve classes inducted. A total of 24 athletes and administrators have been enshrined. Of those 24 inductees, three are former men’s soccer players: Ulrich Dietrich, Patrick Britz, and Aytekin Yildiz.

Ulrich Dietrich (1981-84)Inducted in 2005

Ulrich Dietrich was a four-year letterman on the men’s soccer team from 1981-84. He was a starter in the midfi eld his entire career and helped lead the Bulldogs to three straight winning seasons. Dietrich was an All-South and All-District performer for three years and was a NAIA All-American nominee. He fi nished his career second all-time in assists with 37 and ninth in points with 51.

Patrick Britz (1987-90)Inducted in 2007

Patrick Britz was a four-year letterman for the men’s soccer team and is UNC Asheville’s Division I leader in goals with 37 and points with 102. He was nationally ranked in goals scored (16) and points (39) in 1988. Britz was an all-conference selection as a sophomore and was a Big South All-Academic selection for four consecutive years. He was an Academic All-American nominee for three years. Britz is currently the commissioner of the South Atlantic Conference.

Aytekin Yildiz (1982-84)Inducted in 2008

Aytekin Yildiz is UNC Asheville’s all-time offensive leader for men’s soccer with 53 goals and 126 points. He holds the single-season record for goals with 20 and points with 46. He was an NAIA All-District selection in 1982 and 1983 and helped lead the Bulldogs to the District 26 title game in 1984. Yildiz is a Hotelier and Hospitality Specialist in the Charlotte area.

UNC Asheville Hall of Fame Herb Coman, Football Coach/ADBob Hartman, MBB CoachJim McElhaney, Men’s BasketballSheila Ford Duncan, WBB BasketballIlona Fekete Thimmer, VolleyballEd Harris, Men’s Basketball CoachJerry Green, Men’s Basketball CoachKim Duncan, Women’s BasketballBrian Shehan, BaseballTom Hunnicutt, Athletics DirectorJenee Cross Daniely, Women’s TennisUlrich Dietrich, Men’s SoccerMickey Gibson, Men’s BasketballMike Grace, Men’s BasketballPatrick Britz, Men’s SoccerDanielle Meyer Harrison, VolleyballJill Young Booth , Women’s SoccerPaul Allen, Men’s BasketballDave Hart, ContributorElissa Mount, VolleyballRebecca Gallaher, Track and FieldBamford Jones, Men’s BasketballTrish Wyatt, Women’s BasketballAytekin Yildiz, Men’s SoccerMarc Rosenbalm, BaseballJosh Pittman, Men’s BasketballLorelee Smith, VolleyballHelen Carroll, Women’s BasketballGeorge Gilbert, Men’s BasketballMackenzie McCoy, Women’s SoccerTy Wiggington, Baseball

UNC ASHEVILLE HALL OF FAME

A

A

A

4747

Since its founding in 1983, the Big South Conference has matured into a competitive leader in college athletics, actively pursuing excellence on the fi eld of play and in the classroom. The League’s growing presence as an NCAA Division I athletic conference is evident by athletic accomplishments on the national stage, innovative marketing and media partnerships, increased television packages, and quality athletic competition while intentionally fostering the academic, personal, social, athletic and leadership development of each student-athlete. This has evolved into the Conference’s mission of “Developing Leaders Through Athletics.”

The Big South Conference was formed on August 21, 1983, when Charleston Southern (then Baptist College) Athletic Director Howard Bagwell and Augusta President George Christenberry began recruiting members into the Big South, receiving initial commitments from Augusta, Charleston Southern, Campbell, Coastal Carolina and Winthrop. One month later, Dr. Edward M. Singleton was selected as the League’s fi rst Commissioner and continued to solicit new members. His efforts led to the additions of Armstrong State, Radford and UNC Asheville, giving the Big South more than the required six members to constitute an offi cial conference. The Big South’s fi rst year of competition was in the Fall of 1984, and in September 1986, the Big South Conference was granted full-fl edged NCAA Division I status.

During its infancy and prior to securing automatic bids to NCAA Championships, the Big South made early strides in earning at-large berths in several national postseason events, including volleyball, women’s basketball and women’s golf. In 1989, George F. “Buddy” Sasser replaced the retiring Dr. Singleton as Commissioner, and in 1990, the League received its fi rst automatic bid -- receiving an automatic qualifi er to the NCAA Baseball Championship. Under Sasser’s seven years of leadership, the Conference implemented its public relations and compliance programs, and introduced its fi rst-ever men’s basketball television package, featuring the Big South competing among some of the fi nest teams in the nation.

In August 1996, Kyle B. Kallander replaced Sasser as the League’s third Commissioner, and in his 15 years at the helm of the Big South, Kallander has been instrumental in aggressively promoting the Conference to new heights. The Conference has enjoyed record levels in marketing revenue during the past several years, he has brought television coverage to Big South women’s basketball, baseball and softball for the fi rst time in Conference history, as well as increased national television exposure to the League as a whole through aggressive and unique television packages.

Under Kallander’s leadership, the Big South developed and initiated its fi rst long-range strategic plan, re-affi rming the League’s vision as a distinctive athletic Conference committed to the quality of institutional life through athletic competition. He also spearheaded the efforts to add football as a championship sport, which came to fruition in 2002, and oversaw the additions of men’s and women’s indoor track & fi eld in 1997. The Conference’s 19th championship sport -- women’s lacrosse, will begin play in 2012-13 with seven members. At the same time, Kallander has solidifi ed Conference membership, as an all-time high 11 member institutions comprise the 28-year League in 2011-12. Recent additions include High Point, Gardner-Webb and Presbyterian College, plus the return of charter member Campbell University this year. Kallander’s long range vision has also included technological advancements, as the Conference introduced its fi rst live event video streaming in 2005 and has since expanded its video offerings to more than 700 events annually through a partnership with the member institutions, as well as the creation of several online and social media platforms.

In the last 15 years alone, the Big South Conference has experienced monumental growth and success in nearly every sport. During this time, the Conference has had an individual National Champion six times, more than 240 All-Americans, has reached the “Sweet 16” in men’s soccer, women’s basketball and baseball, has received national Top 25 rankings in football, men’s soccer, men’s basketball, women’s basketball, baseball, men’s outdoor track & fi eld, and men’s golf, had an individual selected to play in the NCAA Singles Championship six times in addition to the fi rst men’s tennis doubles at-large selection, had the fi rst women’s golf program advance to the national fi nals, had the No. 1 ranked men’s golfer in the country, has had the nation’s top scoring men’s basketball team fi ve consecutive years as well as the national men’s basketball scoring leader twice, received an at-large playoff berth in the Football Championship Subdivision in 2006, has had four NFL Draft picks, and had an institution fi nish fi fth in the NCAA Men’s Golf Championships - the Conference’s highest-ever team fi nish in an NCAA event.

In 2006-07, the Big South was the only Conference nationwide to have an at-large participant in the football playoffs (Coastal Carolina), a team in the Second Round of the NCAA Men’s Basketball Tournament (Winthrop) and a No. 1 seed in the NCAA Baseball Regionals (Coastal Carolina). In fact, Coastal Carolina’s baseball program has been a No. 1 seed four out of the last seven years - including a national seed for the fi rst time in 2010, while the Chanticleers’ FCS playoff berth in 2006 came in just the fi fth-year of the Big South’s football existence. The 2009-10 season saw Liberty’s Sam Chelanga win two NCAA National Championships (cross country, 10,000-meter run), Coastal Carolina’s baseball team reach the Super Regionals for the second time in three years as well as being ranked No. 1 in the national RPI and as high as No. 3 in the national polls; and three women’s basketball teams reach the postseason for the fi rst time in Conference history. Last season, Chelanga won two more NCAA National Championships (cross country, outdoor 5,000-meter run), the Big South had its fi rst automatic bid recipient in football (Coastal Carolina), UNC Asheville reached the Second Round of the NCAA Men’s Basketball Tournament, Coastal Carolina’s women’s golf team was the fi rst in Conference history to advance to the NCAA Championship out of Regional play, and a League-record 18 baseball players were drafted in the 2011 MLB First-Year Player Draft.

Several former Big South student-athletes have also reached national prominence in recent years. Coastal Carolina’s Amber Campbell made the 2008 U.S. Olympic Team - one of fi ve former Big South athletes to compete in the Games; VMI’s Reggie Williams reached the NBA with the Golden State Warriors in 2010, UNC Asheville’s Ty Wigginton was named an American League All-Star in 2010, and Coastal Carolina’s Dustin Johnson has won four PGA Tour events since departing the Big South Conference in 2007 and tied for runner-up at the 2011 Open Championship.

The Conference’s tagline, “Developing Leaders Through Athletics” was unveiled in 2008-09 in conjunction with the Conference’s 25th Anniversary. The League also honored its heritage with the Top 25 “Best of the Best” moments in League history from 1983-2008, with Liberty University’s 10-year women’s basketball championship run from 1996-2007 being crowned the No. 1 moment in the Big South’s fi rst 25 years. The Conference’s on-fi eld accomplishments have been duplicated in the classroom. Annually, more than 40 percent of Conference student-athletes are named to the Big South’s Presidential Honor Roll for maintaining a cumulative 3.0 grade-point average, and the League has had more than 95 Academic All-Americans in its 27 years of existence. Furthermore, the Big South has a record number of NCAA Public Recognition Awards for APR progress the last two years.

THE BIG SOUTH CONFERENCE

4848

BIG SOUTH CONFERENCE7233 Pineville-Matthews Road, Suite 100

Charlotte, NC 28226Phone: (704) 341-7990

Fax: (704) 341-7991www.BigSouthSports.com

Founded 1983

PresidentPenelope W. Kyle, Radford University

Vice PresidentDr. Frank Bonner, Gardner-Webb University

SecretaryDr. Anne Ponder, UNC Asheville

CommissionerKyle B. Kallander

Associate CommissionerDawn Turner

Assistant Commissioner - Public RelationsMark Simpson

Assistant Commissioner - MarketingChad Cook

Director of Multimedia DevelopmentMark Bryant

Director of Administration & FinanceNancy Perkins

Assistant Director of MarketingTBA

Assistant Director of Public RelationsNic Bowman

Assistant Director of ComplianceSherika McLean

Marketing Assistant InternCaitlin Munchel

Public Relations Assistant InternBrittany Hill

Administrative Assistant InternTBA

Coordinator of Football Offi cialsDoug Rhoads

Coordinator of Men’s Basketball Offi cialsJoe Forte

Coordinator of Women’s Basketball Offi cialsCharlene Curtis

Coordinator of Baseball UmpiresTony Thompson

Coordinator of Volleyball Offi cialsDaniel Leake

Coordinator of Men’s Soccer Offi cialsPaul James

Coordinator of Softball UmpiresBetsy Kidd

Full-Time Member Institutions (11): Campbell University, Charleston Southern University, Coastal Carolina University, Gardner-Webb University, High Point University, Liberty University, Presbyterian College, Radford University, UNC Asheville, Virginia Military Institute, Winthrop University.

Associate Members: Stony Brook University (football), Bucknell University (women’s golf), College of the Holy Cross (women’s golf).

Geographical Breakdown (3 states): North Carolina (4) – Campbell University, Gardner-Webb University, High Point University, UNC Asheville; South Carolina (4) – Charleston Southern University, Coastal Carolina University, Presbyterian College, Winthrop University; Virginia (3) – Liberty University, Radford University, Virginia Military Institute.

Championship Sports (19): Baseball, Men’s Basketball, Women’s Basketball, Men’s Cross Country, Women’s Cross Country, Football, Men’s Golf, Women’s Golf, Men’s Soccer, Women’s Soccer, Softball, Men’s Tennis, Women’s Tennis, Men’s Indoor and Outdoor Track & Field, Women’s Indoor and Outdoor Track & Field, Volleyball, Women’s Lacrosse (2012-13)

Council of Chief Executive Offi cers: Jerry Wallace, Campbell; Jairy C. Hunter, Jr., Charleston Southern; David DeCenzo, Coastal Carolina; Frank Bonner, Gardner-Webb; Nido Qubein, High Point; Jerry L. Falwell, Jr., Liberty; John V. Griffi th, Presbyterian College, Penelope W. Kyle, Radford; Anne Ponder, UNC Asheville; J.H. Binford Peay III, VMI; Anthony J. DiGiorgio, Winthrop.

BIG SOUTH QUICK FACTS

4949

5050

5151

Fiske Guide Gives High Marks to UNC Asheville and its Environmental Studies ProgramFiske Guide Gives High Marks to UNC Asheville and its Environmental Studies Program

UNC Asheville is once again ranked among the nation’s top colleges in the 2011 edition of the “Fiske Guide UNC Asheville is once again ranked among the nation’s top colleges in the 2011 edition of the “Fiske Guide to Colleges” published in July. The Fiske Guide calls UNC Asheville “one of the best educational bargains in the to Colleges” published in July. The Fiske Guide calls UNC Asheville “one of the best educational bargains in the country.”country.” “This public liberal arts university offers all the perks that are generally associated with pricier private “This public liberal arts university offers all the perks that are generally associated with pricier private institutions: rigorous academics, small classes, and a beautiful setting,” says the Fiske Guide, noting that UNC Asheville institutions: rigorous academics, small classes, and a beautiful setting,” says the Fiske Guide, noting that UNC Asheville provides all this for a fraction of the cost of a private college.provides all this for a fraction of the cost of a private college. In addition, for the seventh consecutive year, UNC Asheville’s Environmental Studies Program was named In addition, for the seventh consecutive year, UNC Asheville’s Environmental Studies Program was named to the Fiske Guide’s list of pre-professional programs with unusual strength in preparing students for careers. to the Fiske Guide’s list of pre-professional programs with unusual strength in preparing students for careers. Students in UNC Asheville’s program learn to address environmental issues through a multidisciplinary approach that Students in UNC Asheville’s program learn to address environmental issues through a multidisciplinary approach that includes biology, ecology, geology, chemistry, physics, economics, public policy, and other natural and social sciences. includes biology, ecology, geology, chemistry, physics, economics, public policy, and other natural and social sciences. Undergraduate research is an important feature of the curriculum, and the Environmental Studies Department Undergraduate research is an important feature of the curriculum, and the Environmental Studies Department stresses on-the-job internships in organizations involved with environmental issues. stresses on-the-job internships in organizations involved with environmental issues. The Fiske Guide also fi nds plenty to appreciate in UNC Asheville’s “picturesque mountain location in one of the The Fiske Guide also fi nds plenty to appreciate in UNC Asheville’s “picturesque mountain location in one of the most liveable small cities anywhere.” According to the Fiske Guide, “whether it’s the lush environment or the money most liveable small cities anywhere.” According to the Fiske Guide, “whether it’s the lush environment or the money you’re saving, the University of North Carolina at Asheville will have you seeing green.” you’re saving, the University of North Carolina at Asheville will have you seeing green.”

UNC Asheville Ranked Among Nation’s Best Colleges by U.S. News & World Report UNC UNC Asheville received high marks in the 2011 edition of U.S. News & World Report’s “Best Colleges” rankings released on August 17. UNC Asheville ranked fi fth among National Liberal Arts Colleges in “The 2011 Up-and-Comers” list, which highlights schools with “the most promising and innovative changes.” This select list leads the overall rankings in the 2011 edition of the U.S. News & World Report “Best Colleges” guidebook, which will be available on-line August 17 and on newsstands August 24. UNC Asheville was also one of only 25 universities in the nation to make the U.S. News & World Report list of “stellar” schools for undergraduate research/creative projects. UNC Asheville, Duke, and UNC-Chapel Hill are the lone North Carolina representatives on this list. UNC Asheville, which founded the National Council for Undergraduate Research more than 20 years ago, has made this roster annually since it began nine years ago. In addition, UNC Asheville was included on the list of 39 National Liberal Arts Colleges with the strongest commitment to undergraduate teaching. U.S. News & World Report’s overall rankings include a number of factors, including fi nancial support from alumni, grades and test scores of incoming freshmen and admissions selectivity along with the quality of instruction and curriculum. UNC Asheville was ranked sixth among public institutions in the National Liberal Arts Colleges category and number 158 in the category overall. Again this year, UNC Asheville was recognized by U.S. News & World Report for affordability as measured by student debt. The university ranked 14th among National Liberal Arts Colleges for least debt among graduating students. This is consistent with fi ndings from other leading college rankings services. The 2011 edition of the “Fiske Guide to Colleges,” issued in July, called UNC Asheville “one of the best educational bargains in the country.” In January, Princeton Review named UNC Asheville to its “Best College Values for 2010” list.

UNC Asheville Named One of the 50 “Best Value” Public Colleges in the U.S. by Princeton Review

Rising costs in today’s challenging economy has pushed up the price of everything from gas to groceries. But there are still great values to be found in higher education, according to “Best Value Colleges for 2010” ranking released today from the Princeton Review. UNC Asheville was among just 50 institutions nationwide named to the “Best Value” Public Colleges list. The Princeton Review also published a 50 “Best Value” Private Colleges list, for a total of 100 colleges in all. UNC Asheville was the only college or university in Western North Carolina to make the list. This is the fourth year that UNC Asheville has been selected by the Princeton Review as one of the 50 best value public colleges in the country. According to the Princeton Review, the schools that made the “Best Value” list are “fi rst-rate institutions offering outstanding academics at a relatively low cost of attendance and/or generous fi nancial aid.” The Princeton Review praised UNC Asheville’s growing national academic reputation, noting that the University provides “students a private school experience at a public school cost.” It also favorably notes the University’s numerous academic options, small class size and strong focus on the liberal arts. The ranking applauds UNC Asheville’s accessible faculty and the diverse offering of student activities both on and off campus. The Princeton Review selected the top 100 institutions as its “Best Value” choices for 2010 based on its surveys of administrators and students at more than 650 public and private colleges and universities. The selection criteria covered more than 30 factors in three areas: academics, costs of attendance, and fi nancial aid, using the most recently reported data from each institution for the 2008-09 academic year.

UNC Asheville consistently ranks as one of the nation’s best values in higher education. It has made the Fiske Guide to Colleges’ “Best Buy” list for the past 16 years and is among the Kiplinger’s Personal Finance magazine’s 100 best value public colleges and universities. And according to U.S. News & World Report’s current college rankings, UNC Asheville is among the top 25 liberal arts colleges in the nation whose students graduated with the least debt in 2008.

WHAT OTHERS ARE SAYING WHAT OTHERS ARE SAYING

5252

WWWWWiWWiWiWiWWWWiWiWiWiW hhhhththththh a a a aaabobobobobobbbobboboboboboobobobooututututuu 3 333,7,7,700000 sstututudededeeeennntntntntttnts s ss sss frfrfrfrf omomomomomm 4 4 4 44 4422 2 2 2 ststststatatatatatesesese aaaa aaandndndndndndndndndndndndndndndnddndndndndnddndndndnn 11 9 9 cocococoooooococoocooooooooooooc uuunununuunuuuuunnnuunttrtrtttrtrt iieieies,s, UU UUUUNCNCNCNCNCNCCCCCCNCNCCNCCCCCNNCCCCCCCCCCCCCCCCCCC AAA A AA AAA AAAA A AAAA AAAAAAAAAAAAAAAAAAAAAAshshshshhshshshshshsshshhhshs eveveveveeveveeveeeeeeeeve ilililililillillli leeleeeeee is ononoonnne off tthhhehe nnnnnnnatatiiooo ’n’n’n’’n’nn sssssssssssstototototototototototottottotoooopp ppppppp p pp p p p pp ppp pp pupupupupupppupupupupuuupppppppppp blblbblicicicic l l llibibibibibbbbbbibbbbiberererererererereererererereerralalalalalaaaaaaa a artrttsss s unununununu ivivvivererererrsisisisisis titititititiesesee a aandndnddnd o oooneneneee o o o offfff f ffffffff ththtthththththe ee ee 171717717 iiinsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnn ttititittttttttitututt titions in t t t ttttttttt tttttttttttheheheheheheheheheheheheheheheheheheehehhheeeheeh U UU UU U UUUUUUU UUUUUUUUUUUUUUUUUUUUnininininnnininininininininininnnininnnininn vvevevevevevevevvevevevvevvvvvevvevvversrsrsrsrsrsrsrsrssssssssittitititttty y yyyyyyyy yyyyyyyyyyyyyyyyy ofofff NN NN NNN NNNNNNNNNorrrthhthhthtt CCCCCCCCCCCCCarrrrrrrrrrrolinaaaaasyssysysysyssssyystttttttttsttttstsssteememmmmmmm. . UNUNUNUUNUNUUNUNUNUNUUUNUNUNUNUNUUNUNUNUNUUUNUUUUUUUUUUUUNC C C C CCCCCCCCCC AsAsAshehehevviviviviviviviviviivviviilllllllllllllllllllllllle ee eeee ee ofofofofoffefefefeersrsrsrsrs m mmmororororre e ththhhhhananann 333 3 3 333 33333330 00000000000 0000 mmmmmmmamm jooojojojorsrsrsrsrsrsrs l l ll l lllleaeaeaeaeae dddididididdidididiiidddiidididid nnnnngnggnnnnnnnnnnnnnngggggg t to o ththe babababababababababababbabbabbbbbbachchchchchchchelelelelelllelelelelellelelelllle ororoorooororororororororororooroorrororrororrorr oooo oo oooooooooooooofffff f ff ff ff ff fffff f f fffff f f arararararararararararararararrrarrarrarararaarra tststststststststststststststssssssss, , , , , , , ,,, bababababaabababababbbababaabababbbbbabbachchchchchchchchchchhchchhchchchchchchchchcchchhchhcchhcchchhcccchhheleeeeeeeeeee or ooooooooooof ff ff fffffffffffffffffffff scscscscscscsssscscsccieieeieieieieei ncnceeeaaanananaand d d d mamamamaaaasttstststststtereeeeereeeeeeeeeeeeee ooooo of fffff ffffffffffff lilililililililillililiiiiiiiiiiibebebebbebebebbebebebebebeeebebbebbbebbbbbbbb rararararararrrr l l lllll l ararartstststststststsstss dd ddd egegegegegrereeesesssss.....

HHHeHeHeHHerererere a aa arerere a a a f f fewewewe m m mororore eeeee ee e fafafactctctssssss s ssssss aaanananaaaaaa d dd fi fi gugureeeeeereress.s.ss.s.s.s.s.s.s.s

AcAcAcAcAcAAcAcAcAcAcAAcAcAcA adadaddddadaaaaaaaaa ememememmmememmmmmicicicicicii sssssAAvAvAverereeeragagaaagge e ClClClCCClCClClCllCllasasasasaaaaaaaaaaa s s s s SiSiSiSizezezeeeezezee::: ::::: 1919191919191919

MoMoMoststst PP Popoppuulululaaaarararaaa M M MMaaaaaajaaaajajorororss sss s bbbbybybybybb E E EEEEEEEEEEEEEnrnrrrrrrrrroloollmlmenent:t: P PPPPPPPPPPPPPPPPsysyssysyyyysyyyyyyysyychchchhchhchhc oooololoololooolooolololoooolooloolo ogogogogooggogoogoogggogyyy,y,y,y,yy,yy L L L LLLLititittittererererereere atatatturururureeee,e,ee,e, EEEEEE EEEEEEEEEEnvnvnvnvnvvnvvvvvvvvvvnvvvviririrrrrrrononononnnnnnnonononnnnonnnnnnnnnno mmmemememeeeeeememeeemeeeem ntntntntntnntntntnntnntnnnnnnnntnntnn alalaalalalalalalaallllalallallalaaaaaa SSSSS SSSSSSSSSSSSSS S S S Stututututututututututtuutuututututututututututututututtuuutuuuudididdidididididdidddididdidididididididddddidid esesesesesesessesesesesssesessseseesssessessseeseessssseesss, , , ,, ,,,,,,,ArArArArAAArt ttt anand d HiHiHiHiHHiHHiiiiiistsstssssssss oroory y y

FuFuFulblblblbbriririighghghghght t t t AAAAwwwwwwwwarararardsdsdsdssssss:: :: ::::::::::::: 3434343444343434343434344334444444444 s s ssttututututtt ddddeeeeeeeeeeenttttntntntntntnntntntnts s s hahahahavevevev reeeeececceceeeee eeieieieiieieiiiveveveveveveeveveed d ddd d d dddddddd thththhththhhhthththhee prprprpresesesestitit gigig ououuuus ss s s sss s awawawawaaawawawawawawawaaawwwaaawawawwaaaaaaaa aaaaaaaarararaaaaraaaaaaaaaaa dddddddddddd

UnUnUnUnnnnnnnnnnnnUnnUnUnUnU ddddedededdddddddddd rgrgrgrgrgggggrgggrggggraraaaaaaaaadduuuuuuaatatate e e ReReReReReRReRRRRReeRRRReRRRReRReRReesseseseseseseeeseeseseseesesesesesearaararrrararchchchch:::::: : : MoooMM rerer t thahan hhhahahhahahaaahhhahhahhalflflfflffffflff ooo oo o offff f f fffff ststststststuuuuuududuuuuu eeneenenennenee tttsttstststststststs ccc c cc c comomomomplplplpleeeeeteettettteeeteteteete eeeee e ee eeeeeeee ee oorooooorrrrooorrorrorooooooooo igigggggggggggggininininininininininnnaaaalalaaaaaaaaa rrrrrrrrr reeeeeeeseseeseeeee eaeaeaeaeaeaeaaaeaaeaaeeaeaeeaeee rcrcrccrcccccchhhhhh hhhhh hhhhhhh ininininininnninnniinnininiinnn ttttt t t tttttttttthhehheheheeheehehehehehehehehhehhhehhehhhhhehhhheiriririririiirir fi fififi fififi fifi ee ee e eldldldldlddlddd ooo o o oof f f f ffff stsstststststss udududududyyyyythththththhthht rrorororoororoororrorororouguguguggugggugugguggguggghhhhhh h hhh ththhhhthhhhe e eeeeee UnUnUnUnUnUnUnUnivivivivivviiverererererersisisisitytytytytyyyyy’s’s’s’s nn aaaatata ioionanan lllllly yy rrerererereerrrrrecococococooooocogngngngnnngngngnnnnng iziziizizzeeededddedededde UUUUUUndnddddndndddddndndnddddddddddeeeeerererereeeeeeee grgrgrgradadadadaa uauauuuauauauauaaaaaaauauauuauaaaauauattteteteteteeeteteteeeee R RRRRR RRReeseseseseseseseseeseseeese eeeeeaeaeaeaeeaeeeee rcrcrcrcrcrccrcrcrcrcrcrcrrrrcr h h hhhhhhhhh PrPrPrPPrPPrPrPrPrPPPPP ogooooogogogogogoogggooo rarrrararrararraraarrrararrrrarrrrrarrararrrarrrrarrrararamm.m.mmm.mmmmmm.m.m.m.mmmm.mmmmmmmmmmmm UU UUUUU NCNCNCNCNCNCNCCN A A AAAshsshshshshshs evevevevevevevvvililililillilllleleleleleleefofofounundedeed dd ththhhhhthhhhhhhheeeeeeee eee e NaNaNNaNaNaNaNaNaNaNaNNaNaatititittitititittiiitiononononononononnononnalalalalalalaaaa C C C Coooouuuuuuuooouuuoo ncncncncncnncncncililil f f fororor U UUUndddddnddndddddererrrrreerrrrgrgrggrgrgrgggggg adadadadaddaadadadaadadaddaduauauaauauaauauaauau teteteteeeteeeeetettetetett RR RRRRRRRR RRR RRRR RRR RR RRRRRRRRRResesesesesesessessesssesseesseeesesesesseseesssessse eeaeeaeaeaeaeaeeaeaeeaeaeeaeeeaeaeae rcrcrcrcrcrrch hh h hhhh momomommomomomoomomommomoooomooooooomoorererererererererererererrereerererererere t thhhahahahahahhaaahahahahaaahahahahhahahahaahhaaaaahaannnnnn n nnnn nnnnnnnnnnn n 22225252525525255225252555252522255252555 y yyyyy y yyy yyyyy y yyyyyyyyy yy yyyyyyyyyyyyeaeaeaeaeaeaeaeaeaeaeaeeeaeaeaeeaeaaeee rsssssrsssssssssssssrsssssssssssssrss a a aaa aaa aa gogogogogggooogoogogogogogogoogoggogoggoggogggogogggogogoggogggggogggg .. . .... . ..

SSStStStStStStStSStSSStStSStStStttudududuuuuuuuuuu y y y yy yyyy AbAbAbroroaaaadaddda a aaaaaaaaaaaaaandnddndndndndndnddndndndndndnddnddddnd SS S S S SSSSSSSSS SSSStutttututututututututtututttttutt ddydydydydyddydyddddddy A A AAA A AAAAAwwaway:y:y: 1 1 7 7 7 pepepeeeeeeercrcrcrrcrceeeneneenenene tt tt fofofoff s sssssssstututututuuutuuuuuuuudedededddddddededededddddededddddddddddd ntntnntnnnnntntnttntnnnntnnnnnnnnntttn ss s ssssss s ss sssssssssss ttatatatatatttatatatattatatatataatatatatattatakkekekekkekekekekekekkkkekekkkekkke a aaaa aa a aaa aaa aaadvdvdvdvdvddddvdvddvvdddvdvvvvvvananananannnannnananannnnannnnnnnnnnnnnttataattatagegeeggeegeegegegeeegeeeeegeeeeeegeeeeee o oo o o o o o oooooffffffff f f lelelelelleleeleeararararararararrararaararrarraarnininninininiininingngngngngngngngngngnngngnn ooooo oooooo oooo ooooooo ooooppppppppppppppppppppppppppp ortutunin titiiesesess i iiinnnnnnnotototoootototototthehheheheheheheehhhhh r rrrrrrrr rrrrrrr ststsss atatesesesesesssesesese aaanndddddddddndddddddddddddd ccccccc cc c cccc ccouououoouououououooououuuoouoouoouuuuouounntntntntnttnntntntntntntntnnntririririrrrirrrrrrrrr esessesesss www wwhihilele e eenrnrroolollolllllleleeleddddd d d ddddd atatattattt U U U U NCNCNNNNCNCNCCCCNCNCCNC A AAAA AAAAAAAAAAAAAAAAAAAAAAAAAshshshshhhhhhhshhhhhhhhhhhhhhhevevevvvvvvvevvevvvvvvvvvvvvvvevvvvviilillllii lellllllelelelllllelell .. . .

StStStStStSttududududu enenenene ttttt t ttt AtAtAtAtAtAtAAtAttAAAthlhlhlhhlhlhhhletetttttteee eeeeeeeeee GrGGrGrGrGrGrGrGGGrGGrG adddduauauauauauaauattiiititt onononnoon R R RRatatatate:e:ee: U UUUNCNCCCC AAAAshshhshevevevvilililililillelleell ss ssssssstuttuudededdennnnnntnntntnntntnnnnntnn -a---a-a-aththhleleeleteetetetet sss s ss ssss hahahahaahahahahahahaaahhaahahahavevevevvevevvveveve oooo oonnenenneneee o oo ooooooooooooooooff fffff ff ffffffffffffff thtttththththththththththttheeeee e hihhihihihihhihhhii hghhghghhghgheseseeeestt grr daduauaaatititionononnrarar tetess s s inininininninn t t t t tthheheeeeehe NNNNN N NNNNNCCCACAACAACAACAACAA.AA.A.AA.AAA. O OOOOOOOOOururururururururruurrururru s s ss s stututututttutudddeeeeeeeededeeedededeeeeedeennnnnnttttntnntnnnnntnntnnt aaa-a-athththththtththhthleleleleleleeletetetetetetetesssss s onononononon aaaa a aaththhtthhththllleleleelll tititit c scsssssscssssssssssssschohooooooooolallalalaalalalaaaaalalalal rsrsrsrsrssrsrsrsrsrsrsrssshihhihhihihihihihihhihihihhhihihiihihhihhihippspspspspspspspspspspspsspspspsppspspspspspspspsppsp w w wwwwwwwwww wwww ww ww wwhhhhohhohohhohohohohohhhho ppllalall y y lala l l fof urur y yyeaearsrsrsrssrsrss aaaaaa aat tttt tt UUNUNUNUNCCCCAAsAsAsAAAAAAAsAAsheheehheheheh viviiiviiivivivilllllllllllll e e e e ee hhhahahahahaveeeve aaa aaaaa 9999 9 999999999 99 pepepepepepepercrcrcrcrcrccenenenenenennntttttt t t grgrgrgrgrgradadadadadddaduuauauauauaatitititititit ononnoo rrratattatte.e..ee

FaFFaFacucucucucucultlttltlty:y:yy:y:yy: 222 2 222 211111111111 fff ff fulululuu l-l-l-l titititimemememee p prororooofefefesssssssorororororororoo s,s,sss,ssss 8 888885%5%5%5%5%%5%% ww w w ww wwwitititititititth h hhhhhh tetettettermrmrrrmrmmrminnnininnalalalalllaaal ddddddd d ddegegegegegegeggeggrerererererereeerr esesesesesesesesessessssess

COCCOCCCOCOPLPLPLPLACACACCAC::: UNNUNUNUNCCCCC AAsAAsAAsAsAsheheheheehevivivivillllllllleee e iiiiisisississ ttttttt t thhhhhehehhhhheeh nnnn newewewewew hhhhhhhhh heaeaeaeaeaddddqddqdqdquaauauaartrtrtttttrterereererersssss ffffofffofofoforrrrr thththththee ee CoCCCoCCoCoCoCoCoCoununununun iiicicicicicilllllll offofofofof PPPP P P bubbbbbububububu lilillililililiccccc c LiLLLLiLiLLLiLiLiLiLibbbbbebebbebbbeberararalllll AArAAAAAAAAArArArArtttststststs CCCCCCC C llollolololllleleeegegeges, a2525-member r ororgaganinizazatitionon of ff sts atte-e susupppporortetedd lililibebeberaral l artsts c c lolllelegeges s thaatat rrrecececooognize theh impmporortance offff lilibeberarall arartsts aa dnd sssccicienee cecc s education for succeess s innn a complex gloobbaball societetety.y.

CaCaCaaaaaaaaaaaaaaaampmmmmmmmmmmm us LifeRRRRReReReReRRReRReRReRR sisisisiss dedededededeeeeedeeencnnnnnnnnn e Halls: AAbooutt one-third of ststududenentsts l livive e on campus, whileeeeeeeeeeeeeee aa a a a a a a a a a aa aaaa aaa aaaanononononononnonononononononoonononooonononnonon ththththththththththththhththhthththththththththhthherererrerrrrrrrr t t tttt ttt ttttttttttt thihihihihihihihihihihihiihiihihihiihihihhihihhh rdrdrdrdrdrdrdrdrdrdrdrdrdrdrdrdrdrrdrdrdrdrddrdrddddddr lll l l l l lllivivivivivivivvvivivvvivvvvvvve withthinin a a one-milleerararrrarararaaaddididiididd usususususususus o oo o oo o oofffffff ffff f ff f cacccccccc mpmpusus.

AtAtAtAtAtAtAtAttA hlhlhlhlhlhlhletetetetetetticicicicicci ss:s:s:s:s:s:s: 11 11111444444 444 4 44444 NNNNNCNCNNNNNNNNNNNNN AAAA DDivvision 1 1 tetetetettettetetttttteet amamamamamamammammmamammmmmmmmms s ssssssssss

StStStSStStStStStSSStStStSStudududdudududuuududuuudenenenenneneneeenenent t ttt tttttt GrGrGrGrGrGGrGrGrGrGGrououououououououououo pspspspspspspspspsps:::: :: :: MoMoMoMoMoMoMMMoMMMMMMoooooooooMM rereeee t hah n 606006006006000600060006000000 c c cccccc c c c cccccccccccc clululululululululululuulullululululllulululululuuuubsbsbsbsbsbsbsbsbsbsbbsbssbsbbsbssbbsbbsbbs aandnd o ooorgrrrrrr annizizatatioonsns, raaaaaaaaaaaaaaaaaangngngngngnngngngngngngngngnggngnggngngngngnngnggininininininininininninininninnininnnninnnnnng ggg g gg g g g gg gggggggggggg frfrfrfrfrfrfrfrfrfrfrfrfrfrfrrfrfrfrrfrfrrromomomomomomomomomomomomomomomomomomomoomomomoomomoomomoommomoom h h h h hhh hhhhh hhhhhhhhhhhhhhhhonoooononononononononononononononoonoonoonoonnooonnnnnnoooroooorooooorooorororoorororooroooor s s s s s sococococoocieieieieietitititit esesesese ttttttttttto o ooo oooooo iniinininnnninnnntttttrttrtrtrtrtrtrtrttrttrrttrtt amamamamamamamaaamamaamaaaaaa uurururuuurururururuurrrrrruuuuu alaalalalalalalalalaaalalalalaaalaallaspspspsppspspspspspspororororororororororrtstststsstststststststststs

InInInInInInnIInnnInInIIntettttettetetetetetercrcrcrcrcrcrcuullulullullulululu ttttuttuttuturaaaaaararall l CeCCeCeCCeC ntntnttttttttttttterererererererererererererererrerre :: : : :: :::::: :: :: ThThThThThThThThThThThThThTTT e e eeee ee eeeee neneneeeeneennnneewwwwwwww wwwww InInInInInInntercultural Center houses coomfffffmfffffforororororororororooorortatatatatatatatatattatablblblblblblbblblbbblblbb eeeeeee ee spspspspspspsspspspsppacacacacacaa esesesese ffffoororrrrrrrrrrr m m m m m m m m m mmeeeeeeeeeeeeeeeeeeeeeeeetitititititittitittitingngngngngngngngngngngngs,s,s,s,sss s sss sssssssssssssssssssssococococococooocococococoocococooooocooocoococoococoococoocociaiaiaiaiaiaiaiaiaiaiaaaiaaiaiaiaiaiaaiaaaiaaaaiaiaai lllllllllllllllllllllllevevevvvvvvenennne tstsss a aaaaaaaandnndndndndnnd pp p p ppppppppppprorororororooogggrgrgrggggggggg amamamamamamammamamamamamamammms sssssssssssss inininnininiinininininninnninnvovovovovovovovovovovovovov lvlvlvlvvlvlvlvvlvlvlvlvlvininininninini g gggggggggg sussusuususssuchchchchccch dddddddivivivvviviviverererererererersesesesesesesesesse gg g gggg g g gggroroorororooorororor upupupupupuupuupuupupupuppsss ssssss ss s asasasasasasasasasasaassass AA AAAAAAAAAAAAAllllllllllllllllllllllliaiaiaaiaiaiiaaiaiaiancnncncncncncnncnccnncncnnnccce,e,e,e,e,e,e,e,e,e,eee, B B B B B B B B B Blaack Studddededdedededentntntntnnnnttttssss sss ss AsAsAsAAsAssAsssssssosososososososososoosocicicicicicicccc atatatatatioioioiioionn,n,n,n,n,n,n,nn, IIIIII III IIntntntntntntntntntnnn eeereererrrrrrrrrrreeerrrerrnanananananananananaanananannaanananaaanananananan ----------------------iiiitititititititittiititttitiionooononoonnnonoonnoonononnaaaalalallllalalalalal SS SSSSSSSSSS SStttututututuuttuudeeddddededdedededeenntntnnnttt AA A A AAAssssssssssss ococococcococococoocococococococcciaiaiaiaiaiaiaiaiaiaiaiaaiaiaiaatitititititititttititittittitionononoononononononononononononononon, ,,,,,, ,AsAsAsAsAsAsAsAAAAsAsAAAsAsAsA iaiaiaaiaiaiaiaiaiaiaiaiann nnnnnnnn nnnnnnn StStStStStSStSttS uudu entsss iin n n nnAsAsAsAsAshehehehehehehevivivivivivivilllllllllllllee,ee,e,eeeeeee HHHererererere mmmaaaammananananas ss s ssss OrOOOrOOOOrOOOOO guguggguuuuuuguulllllllllllllllllllllllllllosososososososososososososoososo osososososososososososo e ee ee e e eennnnnnnnnn LaLaaLaaLaLaaLaLaLaas sssAmA errrriiiciciiicicicicasasasasasasasasasasas ( (( ((((((((( (HOHOHHOHOHOHOHOHHHH LLLLALALALALALALALALALALALALALLALLLALAALALALALAALALALLAAALALALLA)))))))))))))))))))))))))))))))))))))

aannnnnnaaanna d ddd d d dd HHHiiiHH llllllllleleleleleeeeele . . . .

CCCCeCeCeCCeCeCeCeeC ntntnteeerrrereeee ffffororororr JJJJ ewewewewewewewewisisisisssssssisisi hh hh StStStStStStStStStStStStStSttS ududududududududududududududududieieieieieieieieieieieieieieieieees:s:s:s:ss:s:s:s:sss:s:s:s:s TT T T TT T T TT TTT TTTThehehehehehehehehehehehehehehehehee 2 2 222222222222266-6-6-6----666-6666666 yyeyeyyeyeeeeaarararararararar o o ooooooooooldldddddddddddd U U U U U U U U UUU UU UUUUUUUUNCNCNCNCNCNCNCCNCNCNCCNCCNCNNNNCNNNNN A A A A A AAAAAAAAAAsshsshshshshshsssshs evevevevvveveve ilililllelelelelee C C CCCCCCCCCCCCCCCeeneneenenennnnennneeenenentttttttteteeteeteteteteteter r rr r r r rrrrrrr ffffofofofofofofofofoffoffofofoff r rrrrrrrrrr r JeJJJJeJeeJeJeeeeeeeeeJeeeewiwwwiwwiwiwwwiiwiiwwwwww shhshshshshshshhsshsh S SSS tututututuudidididd eeesesesesseseseeeesssessesss p p p ppp p ppp pp pprrrrrorororrrrrrror vivividededeessss s sssssss aaaaaa a aaaaaaaaaa rereeeeeerere----------sosososososssssososoosososoururururururururururcecececececececcece f ff fffffffffffforororororororororor J J JJ JJ J JJJJeweweweweweweweweewwissisisisisisisi h hh h hhhh stststststststststststststs ududududdududududududdududududenenenenneneneenenentstststtstststsststs a aaaaaa aaaaas s sss ssssss wewewewewewewewewewewewelllllllllllllllllllllll a a aa aa aa aaaasssssssss sss hhhhohooststininnng g gg lelelectttururururesesesesesesssessessese ,,,, , fifi fi fifififififififififififififillmlmlmlmmllmmlmlm sssssssss ssssss sereerererererererrererererereeereerereeererrieieieieiieieieieieieeieieieieieieieeiei sss ss s sss s sssssssss ananananananananananananannaanaannndd dd d d dddddddddd otootototototototootototottoo hehhhhhehhhh rrr r rr r spssppppececececiiiaaaaaaaaaaaaial l l ll ll eveveveveveevevevvevvevevvvvvevvvvevvenenenentstststs f fff ororooorororrrrror tttthheheheheheheheheheeheheheeheheeheheheheeeheheeheeeAsAsAsAsAAsAAAAshehehhh viviv lllllle e cococommmmmmunununuu itittitititity.y.y.y.y.y.

5353

KKuKuKuKKKKuKKuKuKuKKKuKuKKuKuKuKKKuKuKuKuKuKKKuKuKKuKKuKuKuuKudodododododododododododododododdodododdddoododdddododododossssssssssssssUUNUNUNUNUNUNUNUNUUNUUUNUNUUNNUNNNNUNUUU C CC CCCCCCCCCCCC AsAsAsAAAAAsAsAsAssAsAssAsAAssssheheheheheheheeeheheeeeeeeeeeevivivivivivivivivivivivivvivivivvvvvv lllllllllllllllllllll ee e e eeeeeeeeeeee isisisisisisisisiisisiis ““ “ “ononononononononononononononnononnonoonoo e ee ee e e ee eeeeeeeeee ofoofoofofofofofofoofoofoofoffffoof ttt tt tttttttttthehehehehehehehhhhhheeeee b b bb bbbbbbbbbbeseseseseseseseseesesessesest t t tttttt ttttttt edededededededdededdeddddducucucuccucucucucucucuuucuuuu atatatatattatatatatatatatataa ioioioiooioioioioioiooiooioioiooooonanananaanannaananananannnaanaaaaal ll l llll bababababababaabababaababbaargrgrgrgrgrgrgrgrgrrgrgrggrgrgrgggggaaiaiaiaiaiaiaiaiaiaiaiaaaaaa nnsnsnsnsnsnsnssnnnn iiiiiiiinnnnn nnnnn nnnn thththtthhhhtththtththtthhthhe ee e ee e e eeeee e eee cococococococococooocococooooocococouununununununununuunuunuunuunununuuuntrtrtrtrtrtrtrtrttrrry.y.y.y.yyy.y.yyyy.y...” ”” ” ” ””””””””” -- -- - - FiFiFiFiFiFFiiiFiFiFiFiFiFiFiskskskskskkksksksksksksksksskkeeee ee eeee e e eeeeee GuGuGuGuGuGuGuuGuGuGuGuGuuuGuuGGGGGG ididididididdidiidddddddidddddddddee e ee eee eeee ee e eee ttttototototottttt CCCololollo leleeeleeeeeeegegegeggegeggeegegeggegegeeegeggggg s,s,s,sss, 2 2201010001000100 11111111

FoFoFFoFoFFoF r rr rr r sseseseseseseeseseeeseeseeseseseeeseevevevevevevvvvevvven nn nn n n cococococococococoooonnsnsnsnnsnsnsnsssnsnsnsnnnsnssnnsnnnn ececeecececeecececececececececececeececeeeecutututtututtuttttuttu ivivivivivivvivivivvvvvveee ee eee ee e eee yeyeyeyeyeyeyeyeyeyeyeeeeyeeeeyyeeyeyy aararararss,ss,, U UUU NCNCNCNCNCNC AA A AAA hshshshhss evevevvililillillelelele’ssssss EE E EEnvvnvnvnvirriririronoonononno memmemememm ntntntntnn alalalallal SSS S S Stututututtuudididididididiesseseseseses PPP PP Prorororororoooogrgrggrgrgrgrgrgrgrggggggg amamamamammmmm hhh hh hhassasasasaaa b b b bb beeeeeeeeeeeeeeeeeeeeeennnnnn nnnnn nananannanananaananamememememememmeddddd d totottotootototoo tttt t t t tthehhehehheeehehehe lilililililiistststststststtststststtsttsttt o ooooo ooooooooooo oof f fff fffffffff pprprpprprprprprrrre-e-e-e-e-e--e---e---ee prprprprprprprpprprprofofofofofoooooofoofofofofoooffofffofoofooooo eseseseseseseseseeeseeseeeseseseseseseesssesee sisisisissisisisisisissisisisiississss onononononononononononnonononononononoonnoonnonnonalalalaaalaalalalaa p p p pppp ppp pp pppproororoororogrgrgrgrgrgrgramamamamam wwww ww wwwiiiititttitiitttiitti hhhhhhhhhhhhh hhh h h unununuunu ususususuu uauauauauallllllllll ll ttttstssstststs rererererengngngngng hthhthhthhhthhthththtththhthth iiiiiiii ii innnnnn n prrprprprprp epepeepepeppparrararariiiiiiinininini gggg g tttststststs ddddddddddududududenenenenttttststststss ffffffffffff forororor ccc carararareeeeeeeersrrsrsr . . - FiFiFFiFiFiiFiFiFiiFiFiF kkkkkkkskskskkeeee GGGGGGGGGGGGGGGuGuGuGuGuididiidididddddddididididideeee etotototototttttottototo C C C CCCCCCC CC CCoololooololooololleleeleeleleeeeleeeeelegegegegegeegeegegegegeggggggggg sssssssssssssss

UNUNNUNUNNUNUNUNUNUNUNUNUNNUU C CCCCCCCCCCCCCCCCC AsAAsAsAAAsAsAAssAssAssAsAsAAAAssAssAsAAAAshehehehheheeheheehehhehhhehheeeeh vivivvvvivivivivivvvvvivivvvivvviviviiillllllllllllllllllllllllle eeeeee e iiisiisisiisisisisisisisisisssssss o o oo ooooooooooooooooooooneneneeeeeene o o oo oooofffff ffff thththe ee nannn titit onon’ss 1000000000 b besst t vavaavavavalullll eses in n pupublblicciccc ccolo leeleeegegeg s. -- - - -- - KiKiKiKiKiKiKiKKKKiplplplplplplppplpp ininnininniiniinnnnnnnnnnnngegegegeegeggegggggegegeggegggggggggg r’r’r’r’’’’’r’r’r sss s ssssssssss PePePPePePePePePePePePePPePPePePeePePeeePePP rrrrrrrsrsrsssssrrrrr ooooononnonoononnoo alalalallaalllaaaa FFF F F FFFFFiiinnnnninnnnanannnnnnnnnnana cececececececececeececeeee MMMMMMM MMMM M MMMM MMMagagagagagagagagggagaagaagagggazazaaazazazazazazazazazazzzza inininininininininininiinininii e,e,e,e,e,e,e,ee,eeee,e, 222 22 2 22222 222222220101010100101001000101010101010 0000000000000000000000

UUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUNNNNNCNNCCNCNNNCNNNNCNCNNCCCCNCNNCNN A AAAAA AAA A AAAAAAAAAshshshshshshshshshhhhhshshsshsheeevevevevvvvveeveeevvilililiililiiilililiiiililiiiiillllii lelleleleleleeeeeleleeee iiii i iiii sssss sss s s ss s ssssss aaamamamamamammamammaa ononoonoononnnnnnnonnno g g jujujujujuujujuststststsststst 5 5555555555550 0 00000000000 inininnnininininststsststststtstsststststs itititititititutututuuuuuutuuutututioioioioioiioonsnsnsnsnnssnsnsns nnnnn n natattttatatatattataatatttioioioioioioooioooiooonwnwwwnwnwnnwnwwwnwwnwwwidididddiddididde ee eeeeee nonoteted d d asasa a a “ “BeBeBeststst V V Vala ueuee” ” ” pupup blblicic c cololleleleeeeeeeleleeeeeeegegegegegegegegegegegegeegegegege. . .. ..- --- -- - PPrPrPrPrPrPrPP inininnnnnninnnninnnnnnnnnceccecececececcccetototootoooon nnnnnn ReeReReReReReRReReReReReReReReReReRReeRRReReRReeeviiiivivivivivviiviv ewewewewewewewwwewwwwwwewwewwww,, , , 20202020202020200202020002020202022020202202222020011111000001

NUNNUNNNNC CCCCCC AsAshehevvvvvviviviviiivivvivvvvvvviv llllllleeeeee e eee isis t thehe ooooooooooooooonlnlnlnlnnnnnnnnlnlnnnlnlyyyy yy yyyyyyyy NoNoNoNNNooNorrtrtrthh h CaCaarorooolilinanaaaaaa i iinsnnsnn tititututitioonoo listeeeeed d d amamonong g NaNaN titiononnnalal L Libibereralala A AArtrts s CoCoC llllllllllllegegegegegegegesesesesesesses whwhosose e ststududddddddddddddddddenenenenenttttststtttttttttt g graraduduatate eeeeeeee wiwiw thththh tt hehheehe llllllllleaeastst aaamomooununnnt t fffofof ddddd d d bebbbbbbebebebe t.tttttttttt. - - UUUUUUUUUUUUU UU UU SSSSSSSSSS.S.SSSSSS. . NeNeNeNeNeNeNNeNeNeeeNeNeNeNeNewswswswswswswwswwswswswwsws &&&&&&&&& &&&& & && WWWWWWWWWWWWW W W WW Worororoorororooororoorooorldlddldldd RRRRR R RR RR RRRRRRepepepeepepeeepepepepeepeeppport’s s “AAmem rir caca’s’s BeBeBeBBBestst C Colleegegegegeggegegeegeeeegegggegegeeees,s,ssss,s,ss ”””” ”””””””””””” 20220202020202020220202022022000020202020202022202010101010011010101010000000101010000

ThThe e UNUNCC AsAsheheheeheehevivvivivivivivivivvvvviv lllllllllllllllllllllll eeeeeeeeeeeeeeee eeee “f“f“ff“ffffffffffffffacacacacacaaaacacaacacacacacaaacculllululuulluuuluuuluuluululultytytytytyttytytyytytyttyt hhhhhhhhhhhhhhhhhh hhhasasasasasasaaasasasasasaasaaasss a a aaaaaaa aaaannnnnnnnn n nnn unuuununununununununuunununununu ususuuuususususuusususususususssussuauauauauauuauauuaauauauauauuauuuau llllllllllllllllllllllllllyyyyyyyyyyyyyyyyy y stststtsttttstststsststttttrororrorororoorororoorororoorororongngngngngnngngngngngngngggnggg c c ccccccomomomomomomomommmmmimimmimmimim tmtmtmtmtmtmttmmeneneneenent t t ttt tototototototottt u uu uuuuuuuuuuuundndnnndndnndnndddddderererereeeeee grggrgrgg adadadaadaduauaauaauaaatetetetetetetetttte t ttt tt t ttteaeaeaeaeaeaeae hhhchchchhhhhchhchhhchhhchhhc iniinininininniiinininggggg.ggg.gg.g.gg” ”” ” ”””””””””””” - - - U.U.UUUUUUUUU S.S.SSS NeNews & & W Worldd R Repeeporort’t’s s “A“Amemeriricaca’s’s B Besest t CoCollllegegeses,”,” 2 20100100

UNNC C AsAshevillee is the onlly y pup blic liberall arts colleggee nonotted asa aa ““ToTop p UpUp-aandnd-C-Comomining g ScSchohoolol” ” amamonong g NaNaN tional Libeeral AArtrts Collllegges. UNNC Asheville is rrannkeed d fi fth h inin t thhis distinguisishehed d cac tegog ry. - UU.SS. NeN ws & Wororldd R Reporrt’t s “AAmeriricac ’s Best Colleges,”, 2201100

UUNC Ashevillle’s UnUndergrgradduate Reseearch Program haas bbeeeen ranknkeded aamom ng theh bbesest t inin tthehe n natatioion n fof r rnnine conseccutivee y yeaearrs. - - U.U S.S. N Newews & WoW rld Report’ss “AmAmerica’s Best Colleges,”” 200100

UUNC AsAsAsAsAsssshheheheheheeevivivivivivvilllllllllllleee eee isisisisisss aaaa a amoomomomomonngngngngngggg jj j j jjjjjusususuuuu t tt 212121 s s smamamallllll ss stattatatatetetete ss sschchchchchoooooooooooolslslslsls o ooonnnn nnnnn ththhhhhthththeee ee “““C“CCCoolo lllelegegegg AAA AAAA-LLisist”t”t” forrrrr offfffferrrriinining ggggg a aaa “a bbbbigigigigigg-leaguee eeducatioion.n.nn.n.nn””””””-- PaParararararararararaarr dedededeedededeedede m m m mm m mmmagagagggazzzzazazzazazazazazininininninininine,e,e,e,, 222 2 20101010 00000000

UNUNUNUNUNUNUNUNUNNUNNUNNCCCCC C CCCCC C AsAsAsAsAsAsAAsAsAsA hehehehehhhehehhhhhh vivivivvivivvivillllllllllllllle eeeeeeee isisisisisisisis o oooooo o o o oonenenenenenenennenneeenen oo oooooooff ff fff ththththththththththht ee e e eeee totototototopppp p p ppppp grgrgrrrrrrrggrreeeeeeeeeeeee nnn n nnn cococcooccc lllllllegegegegeeeeegegegegesesesesesesessse ii iiii i i innnnnn nn nn thhhhtht e eee SoSoSoSSooooooSoS ututututututututututhhhheeehehhhehhh aasaast.t.tt.t.ttt. -- -- Blueeee eeeeee RiRiRiRiRiRiRRiRiR dgdgdggdgdgdgdgdgdge OOuuuuuuuttdtdtdtddoooooooooooorsrsrsrsrsrsrsr ,, , , , , 20202002222 100000

UNUNUNUNUNUNUUNUNUNUUUNUNNCCCC CCCC C CC C AsAsAsAsAsAAsAsAAsAsAsAAAAshehehehheheheheeheheheheheheeeeevivivivivivivivivivivivivivvvv llllllllllllllllll e is lissteted d aammononnooononononononnnngggggggggg ggg jjjujujujujujustst 228686 UU.S.S. . cococococococoooccooollllllllleeeegegegeggegee eseseseseeeeseseseses a aaaaa aaaaa ddndndndnn uu uu inininininivevevevevvvvevv rsrsrsrssrsititititittieieieieieessss s thththhthtttt atatatatatt hhh hhavavavavavvaa eeeee eee dededededeedd momomomomoonsnsnsnsnsssn trtrtrtrtrrrratatatatatataatatttedededededededeeededeeee “ ““ “ anananaananaanananaa exexexexxxxxxxemememeeeeeeeemplplplplplplplplpllpplpppp aaarrrrararrararararraraaaaaa yyyyyyy yyyyyyyy cococococommmmmmmmmmmiiititititititititmememmemeememmeeemm ttntntntntnntntntntnnt ttt ttt tt ttoo ooooooo suuuusuusuusus stststst iiiiiaiiiaiaiaiinanaaaaanaannabibibbibibibbibibibbbibiib lililililillililililiillittytytytytyytytytytyt ”””””””.””.””. - - ---- “““ “ ““““ThThThThThThTThThThThTThhThThTT ee ee ee eeeee PrPrPrPrPrPrPrPrPrPrPrPPrPPP iniinninnnncecccetttooooonn n ReReeeReee iviviiivivivvv eewewewewewewwwewee ’’’sssss GGGGG GGG G GGGuiuiuiuiuiuiuiuiuiuuuiuuuuidededededededddedededdededde tt tttt t t oo oo ooo 2828228288282828282822822822 6 666 66 6 6666 GrGrGGGGrGrGrrGreeeee nnnn nn n CoCoCoCoCoCoooCoCCooooooollllllllllllllllllllllllllllegegegegegegggeseseseseeses””,,, 20202020200000202010101010010001000000010101001010100101010

AdAdAdAdAdAdAdAdAAAdAddmmimimimiimmmmimmiim ssssssssssssssssssssssssssssiioioooioooioioooioiooioi nsnsnsnsnsnsnsnnsnsnsnsnsnsnsssMiMiMiMiMiMiMiMiMiMiMMMiiddddddddddddddddddddddddddddd leleleelelleleleleeeeeeee 55555 55555555 555 550%0%0%0%0%0%%00%0%0%%0%0%0%0%0%0%%%%0%0%00%00%00000%0 o o ooooo ooooooooofffffffffffffff fffffffff ininininininiinnnninnnnnnnnncccococococococccccccococococcococcoocccccccccc mimimmimimiimimimmmimiiinnngnngngngngngggnnngnngnnnngnnggnggggg fff f fffff ffffrrereereererererererrererrererereererrrrr shshhshsshsssssshshhshhhshhhshsssss mmememememememememmememennnnnnnnnnnnnnn nnn n SASASASAASAASASASASASASASASASASAAASASASASASASASAAASSAAAATTTT TTTTTTTTTTTTTT TTTTTT TTTTTTT sssscscccscscss orororororrrrrrorrrrrorrrrrrrrrrrooree:e:ee:ee:ee:e:e:e:e:eeeee 1 1 111 111111111111111111111110-0-000-0-0-0-0-000-000-0-0-0-0-0-0-00000 12111222122222211112212121212212211212909090909090900090900909000909090990090909999999090000

AnAAAAAAAnAAnAAAnAnAnAnAnAAAAA nnnnnunuuunuunuuuuuuuuuaaalalalalaaaaaaaaaa II IIIIIIIn-n-n-nnn-nn-nnnnn StStStStStStStStttStttS atatatattatte eeeeee eee eeeeeee ee TuTTuTuTTuTuTuTuTuTuTTTuTuTuuitittititiii iioioioionnnnnn n nnn anannaaaaanaaaaaaaaa dddddddddddddd dddd FeFeFeFFeFFeFFeFeFeFeFeFeFeFeFeeeeseeeseseseseseseseeeseseeeese :::: : $4$4$4$44$ ,7,77,7,777777,777777777777772722772727272777277272727777727777 (((((( ( ((((((( (((((202020202020202020202020202222222 10101010101010100100000100100--1111-1-1-1-1-1-1-1-- 1)1)1)1)11))))11)1)1))

AnAnAnnnAAnnnnnnAnnnnnnuununuununununnnunnuunn aala OOOOOOOOOOOOuuututututututuuutut-o-of-f-f-f-StStStSttStS atatttttatattttttteeeeeee e eee TuTuTTuTuTuuTuuTTuuTTuTuTTuuTuTTTuTTuuTTuTuuuT ititttiittititioioiooioioioion n n aaanaananananaaaaannnnnd d FeFeeeesesesesssesessseses:::::::: $1$1$1$$1$1$1$1$$1$1$$$$$$1$$$1$$$$$$1$1$1$1$$ 7777777777,7777777777,7,554545454455454545545455545454545455545544555554444454445554545444444444444 4444 4 444444444444 (((2(2(2(2(2(2(2(2(2001010111000-0-0-0-0-000-000-0000 111111111111))))))))))))) ))) )

AvAAAAAvererererererraaggggagagagagaaaagagagggee e eeee e HHoHoHoHooousususuuuuu inininnnnnininnnnnnnnnnnnnnnnnnnnnnnngggg ggggggggg anand ddd MeMeMeeMeeaalalalalalala PPPPPPPPPPPPPPPP PPPP alllaaaaaaaaaaaaaalalaaaaalannnnnnn nn n FeFeFeFeFeFeFeFeFeFeFeFeeFeFeFFFeFeeeseseseseeeeeeee : : $7$7$7$7$7777777 00000000,0,04044040404040400440404040 (((( (((((((((( ((((2222020202022222 11010101 ---1111- 1)11)))1)1)1)1))))111

FiFiFFFFFFFiFFiFiFFFiFiFiFinananananannanananannannncncncnccccccccccccnccciiiaiiiiiiiiaiall l AAiAiAiAiAiAiiAAiAAid:d:d:d:d:d:d:dd:ddd:d:dd MMMMMMM MMMMororee ththanan h hallllllllllla ffffffff f ofofofofofofofofoffo ss sss s sstutuuuttt dddddedededdeedd ntntntntttts s ss sss rerererererereeeeeeerer cccceceeeeeceeececceeeeecec iviviivivivvvvvvvivvivivvviviivi eee eee eeeeeeeee fi fi fifi fi fi fifififififififififififi fi nnnnnanananann ncnciaial l aiaiiid,dd,d,d w w wwwwitiitititittittthhhhhhh hhhh hh h momomomomoomorerererererereeee t tthahahhahhhahahahahahahhhahh nn n 8555585858555 pp ppppppereerererereeee ccccececececccecececececeeentntntntntntntntntnnn ooo ooooffff fff stststttstudududududududududududududududdddudeneneneneeneneneeeneneneneneennnttttststststttststts’ ’’ fi fifi nannn ncnccccccccciaaiaiaiaiaiai l ll neneeeneneneenenenen edededededededddded m m mmmmmmmmmmmmmmmmeteteteteet..

5454

Dr. Anne Ponder became the sixth Chancellor of the University of North Caro-lina Asheville in October 2005.

Chancellor Ponder is a native of Asheville and a lifelong educator. She earned her bachelor’s, master’s and doctoral degrees in English from the University of North Carolina-Chapel Hill. She began her academic career at Elon College (now Elon University) in North Carolina, where she was the fi rst woman and fi rst pre-tenure professor to receive the Daniels-Danieley Award for Excellence in Teaching. During her nine years at Elon, she taught English and communications, and founded the college’s Honors Program.

She later joined Guilford College in North Carolina, where she was an associate professor of English and interdisciplinary studies and served as associate academic dean. At Kenyon College in Ohio, she served as professor of English and drama, academic dean, adding ‘vice president for information technology’ to her portfolio.

In 1995, she was selected to become president at Colby-Sawyer College, a private liberal arts college in New London, N.H., where she would serve for ten years.

At UNC Asheville, Chancellor Ponder has led a campuswide collaboration resulting in a fi ve-year Strategic Plan and then imple-mented an administrative reorganization that focuses University resources on the Strategic Plan’s highest priorities. As part of that strategy, the UNC Asheville campus now serves as the new na-tional headquarters for the Council of Public Liberal Arts Col-leges.

Chancellor Ponder is a nationally known expert on institu-tional effectiveness, strategic planning, and fundraising and re-source development. She has been a frequent faculty member of Harvard University’s Institutes for Higher Education, and has writ-ten a chapter on strategic planning for the book “Leading Ameri-ca’s Branch Campuses,” edited by Samuel Schuman and published by the American Council on Education.

In addition to serving the University, Chancellor Ponder is a member of the Mission Hospitals Audit Committee and the Asheville Area Chamber of Commerce Board of Directors. She also serves as a member of the Asheville Community and Eco-nomic Development Alliance.

Chancellor Ponder is the daughter of the late Herschel and Eleanor Ponder, both of whom traced their Asheville family roots back to the 1780s. She is married to Christopher Brookhouse, an award-winning writer and publisher previously on the English faculty at UNC Chapel Hill.

DR. ANNE PONDERCHANCELLOR

UNIVERSITY OF NORTH CAROLINA ASHEVILLE

5555

Janet R. Cone is in her eighth year as Director of Athletics at UNC Asheville. She also serves as the school as Senior Administrator for University Enterprises. Last year, Cone saw the UNC Asheville men’s basketball team win the Big South Conference championship and advance to the second round of the NCAA Tournament. In addition, the Bulldog women’s indoor track and fi eld squad fi nished in third place, the highest fi nish in school history. Senior sprinter Natalie Pearson made her second appearance in the NCAA National Outdoor Track and Field meet.

Two years ago, Chancellor Anne Ponder appointed Cone to the newly-created position of Senior Administrator for University Enterprises. In this position, Cone oversees the Wilma Sherrill Center, manage specifi c community relationships and serve as a member of UNC Asheville’s fundraising team. She continues as a member of the Chancellor’s Senior Staff and assists Chancellor Ponder in more closely aligning the university with the North Carolina Center for Creative Retirement.

In 2009, Cone created the Asheville Sports Commission to help bring athletic events to the Asheville area. Her leadership helped land the Southern Conference

men’s and women’s basketball tournament to return to Asheville starting in 2012.

Student-Athletes have excelled in the classroom under Cone’s leadership. In 2004, she created the Athletic Director’s 3.0 + Club that recognizes all student-athletes who make a 3.0 or better grade point average each semester. More than 700 student-athletes have made the club during Cone’s six years, and in 2009-10, a record number of student-athletes earned that distinction.

During that same time period, more than 600 student-athletes have been named to the Big South Presidential Honor Roll, and in 2009-10 more than 60 percent of UNC Asheville’s student-athletes have earned this impressive academic distinction. The Department of Athletics has also successfully hosted two Big South Conference Tournaments that produced revenue for the school.

Cone has overseen construction projects that has dramatically improved the facilities in which UNC Asheville’s Bulldog student-athletes compete and train. (1) The Wilma Sherrill Center for Health and Wellness/Kimmel Arena was fi nished last spring and is being used this semester. Funded partly through a $35 million state appropriation, Cone helped raise more than seven million dollars in private funds to construct the Kimmel Arena, a major convocation space that will accommodate larger group events than the campus has been able to host before. Among other things, this will allow the university to host its own graduation on campus, attract major venue speakers and performances, and will secure a future home for men’s and women’s basketball teams.

The inaugural game in Kimmel Arena will be against UNC Chapel Hill on Nov. 13 and that game will be nationally televised by ESPNU. (2) Renovation and repairs to the Karl Straus Track began in the spring of 2009. Cone helped raised more than one million dollars in private funding for the track project. (3) Cone negotiated a partnership with Crowne Plaza Hotel and Resort for construction of a new Bulldog tennis facility which has indoor courts, composition courts and six hard courts that was completed n the fall of 2009. The facility has been the home of Bulldog men’s and women’s tennis for the past two seasons and this spring will host the Big South Conference men’s and women’s tennis tournaments for the fi rst time in school history.

Highlights of the 2007-08 year included the men’s basketball team being co-regular season champions of the Big South Conference and earning a bid to the National Invitational Tournament, making UNC Asheville the fi rst men’s basketball team in Big South history to receive a bid to the NIT. Cone helped the department successfully host the Big South Conference Men’s Basketball Tournament and Women’s Basketball Tournament in back-to-back weekends.

In October of 2007, Cone was named the 2007 Division I-AAA Administrator of the Year by the National Association of Collegiate Women Athletic Administrators. UNC Asheville Chancellor Anne Ponder was delighted to see Cone receive the award. “Janet Cone’s inspirational leadership has set a very high standard for our student-athletes and our coaches, all of whom continue to be winners both on and off the fi eld,” stated Ponder. “We are thrilled that she is being recognized in this way for her vision, her energy, and her tenacity, qualities our University benefi ts from each and every day.”

JANET R. CONEDIRECTOR OF ATHLETICSSENIOR ADMINISTRATOR FOR UNIVERSITY ENTERPRISES

5656

In 2006-07, three different teams UNC Asheville teams won Big South Conference championships and advance to the NCAA Tournament. In May of 2006, the Bulldog baseball team completed an amazing run with their fi rst ever championship and a trip to Clemson for the NCAA Regional. In the fall of 2006, the women’s soccer team became the fi rst women’s team in school history to qualify for the NCAA Tournament when the Bulldogs won the league title and earned a spot against top-seed UNC Chapel Hill in the College Cup. In March of 2007, the UNC Asheville women’s basketball team won its fi rst ever Big South Conference championship. Asheville advanced to the NCAA Tournament for the fi rst time where it took on Final Four-bound LSU.

The South Carolina native has promulgated a signifi cant increase in corporate sponsorships and Bulldog Athletic Association donations, critical to an organization that is not allowed to receive state funds of any kind. She has also overseen a new partnership with the Asheville City and Buncombe County Parks and Recreation Departments, an improved Athletics web-site, and the implementation of internet broadcasts and video-streaming for six different sports.

Cone has been tapped by the NCAA and the Big South Conference to serve on several key committees. In the Big South, she is on the committees for Budget, Compliance, Ad Hoc Committee on Publicity and Promotions, Baseball, Men’s and Women’s Basketball and Men’s Soccer and Tennis. In the spring of 2006, Cone was named to the NCAA Women’s Basketball Issues Committee. In September of 2008, she began a four-year term on the NCAA Division I Leadership Council. In July of 2006, the Summerville, S.C. native was one of just 14 female athletic administrators to be picked by the NCAA/NACWAA to attend The Institute of Athletics Executives in Denver. In September of 2008, she began a four-year term on the NCAA Division I Leadership Council.

Other highlights of Cone’s tenure include the development of a new Athletics Logo and a partnership with the Asheville City and Buncombe County Parks and Recreation Departments.

In the spring of 2006, she was named as an Outstanding Executive Manager by the Asheville-Buncombe Excellence in Public Service.Cone has been tapped by the NCAA and the Big South Conference to serve on several key committees. In the Big South, she is on the Budget, Compliance, Ad Hoc Committee on Publicity and Promotions and the Baseball, Men’s and Women’s Basketball and Men’s Soccer Committees. In the spring of 2006, Cone was named to the NCAA Women’s Basketball Issues Committee. Starting in September, she will begin a four-year term on the NCAA Division I Leadership Council. In July of 2006, the Summerville, S.C. native was one of just 14 female athletic administrators to be picked by the NCAA/NACWAA to attend The Institute of Athletics Executives in Denver.

Cone is extremely active in the community, and in the summer of the 2006, she helped lead a group of community leaders to bring the Big South Conference Women’s Basketball Tournament to UNC Asheville’s Justice Center in 2007 and 2008. Cone also initiated the “Our Turn to Play” women’s luncheon for local business, civic, and community leaders the past two years. In addition, Cone was recognized as one of 10 Women to Know in Western North Carolina.

Cone came to Asheville from Samford University where she served as the fi rst head women’s basketball coach in 1996. She coached the Bulldogs for fi ve seasons and, in 1999-2000, the team posted a 19-10 record. Cone was named Assistant Athletics Director before being promoted to Associate Athletics Director in 2003.

Prior to Samford, Cone served as the fi rst full-time Assistant Athletics Director, and the head women’s basketball and volleyball coach at Saint Leo University in Florida. She also directed basketball programs at Western Carolina University and Mars Hill College. Cone began her career as a teacher and coach in Gilbert, South Carolina. She coached against UNC Asheville eight times in her career and had a 5-3 record against the Bulldogs.

Cone was born and raised in Summerville, South Carolina. She was a four-year letterwinner on the basketball team and was an all-conference performer at Summerville HS for two years. Cone was inducted into that school’s Hall of Fame last fall. She graduated magna cum laude from Furman University in 1978 and was named Physical Education Student of the Year while lettering in basketball and fi eld hockey as an undergraduate. While earning her Master’s from the University of South Carolina in 1986, she completed her studies with a perfect 4.0 grade point average.

A life-long learner, Cone is a 2003 graduate of the NACWAA/HERS Institute of Administrative Advancement. She is a member of NACDA, NACWAA, NCAA Division I-AAA Athletics Directors Association, Women’s Sports Foundation, and the Fellowship of Christian Athletes.

5757

TERRI BRNEASSOCIATE DIRECTOR OF ATHLETICS OF INTERNAL AFFAIRS / SENIOR WOMEN’S ADMINISTRATOR

Terri Brne begins her sixth year at UNC Asheville. She serves as Associate Athletics Director of Internal Affairs and is also the athletic department’s Director of Compliance and Sport Oversight. Brne came to UNC Asheville in the fall of 2006. She is responsible for the interpretation of rules by the NCAA and Big South Conference. Brne is the department’s liaison with Admissions, Financial Aid, Registrar and the Big South Conference. She educates UNC Asheville’s student-athletes and staff on all of the NCAA rules and regulations. In addition, Brne is the administrator for men’s and women’s soccer and baseball. She also serves as the Game Administrator for women’s basketball. The Illinois native was an assistant basketball coach at both South Dakota State and St. Andrews Presbyterian College. While at St. Andrews, she assisted in NCAA Compliance in NCAA Compliance. Brne earned a Bachelor of Science degree in physical education from Illinois State. She earned her Master’s degree at Tarleton State in Exercise and Sports Studies and is currently completing a doctorate in Sports Administration.

MIKE GOREASSOCIATE DIRECTOR OF ATHLETICS FOR EXTERNAL AFFAIRS

Mike Gore is in his 25th year of service to the UNC Asheville Athletics Department. He currently serves the school as an Associate Athletics Director for External Affairs. In his post, Gore is the liaison with the media, handling all media-related activities concerning the athletic department. He also assists with game management and sport oversight. In 2004, Gore served as the school’s Interim Athletics Director for six months prior to the hiring of Janet Cone. He is the chairman of the school’s Athletics Department Hall of Fame and the Big South Conference Hall of Fame committee. The Buffalo native has been a longtime contributor to the Asheville Citizen-Times , Hendersonville Times-News and has written for Blue Ribbon Basketball Magazine. For the past 13 years, Gore has been the offi cial scorer for the Class A Asheville Tourists baseball team. In 2005, Gore was honored with the fi rst ever Mike Gore Bulldog Service Award at UNC Asheville’s Athletics Banquet. Gore is a 1984 graduate of Appalachian State University with a bachelor’s degree in communications. His wife Lisa is an Assistant District Attorney for the 28th Judicial District.

UNC ASHEVILLE SUPPORT STAFF

5858

Judith BohanBusiness Manager

Linda MarshallAssistant

Business Manager

Ken Hogue Director of

Development

Megan HammondsAssistant

Athletic Trainer, ATC

Harmon TurnerTicket Manager

Tim WhiteHead

Athletic Trainer, ATC

Kellen PetroneAssistant Volleyball

Coach

Mary CaseyAssistant Women’s

Soccer Coach

Dr. Herman HoltFaculty AthleticsRepresentative

Rebecca Nelms-KeilDirector of Student

Athlete Affairs

Erin Punter-SpenceDirector of Marketing

and Promotions

Matt PellegrinDirector of Athletics

Media Communications

ASHEVILLE SUPPORT STAFF

Aaron RembertAssistant Baseball

Coach

Andrea KaufmanAthletic Trainer, ATC

Brett CareyAssistant Men’s

Basketball Coach

Aaron SandersDirector of Sherrill

Center

Joe Burnette Assistant Men’sSoccer Coach

Tom HandAssistant

Tennis Coach

Curtis MettenAssistant Women’s Basketball Coach

Lauren PowellAssistant Women’sBasketball Coach

Nick McDevittAssistant Men’s

Basketball Coach

Joel WilliamsAssistant Track & Field

Coach

Adam PuettAssistant Cross Country Coach

Tiffany GwynnAssistant Women’sBasketball Coach

Donna PeekAdministrative

Assistant

5959

Betsy BloseWomen’s Basketball

10th year as head coach

Michele DemkoWomen’s Soccer

2nd year as head coach

Matt KernMen’s Soccer

2nd year as head coach

Tom SmithBaseball

3rd year as head coach

Jesse NormanCross Country/Track

5th year as head coach

Omar AhmadStrength and Conditioning

1st year as head coach

Lise GregoryTennis

5th year as head coach

Eddie BiedenbachMen’s Basketball

16th Year as head coach

Frederico SantosVolleyball

1st year as head coach

ASHEVILLE HEAD COACHES

6060

Since UNC Asheville fi rst fi elded athletics teams in the 1930s (then known as Biltmore College), the bulldog has been its mascot. Early students chose the bulldog for its fi erce and tenacious reputation. In the decades that have followed, the bulldog has become a beloved symbol of our University.

In 1948, “Puck,” arrived on campus and began a tradition of live bulldog mascots that lasted into the 1980s. Puck, named after the character in Shakespeare’s A Midsummer Night’s Dream, was followed by Puck II and in the 1960s by Chug-a-lug. In the 1980s the campus welcomed Winston, named after British Prime Minister Winston Churchill, both for his bulldogged resolve as well as his appearance. Winston appeared for only a year and the tradition of a live mascot fell out of use. In 2009 thanks to a group of student organizers, UNC Asheville welcomed a new bulldog mascot to the University community. “Rocky I” made his fi rst public appearance at halftime of UNC Asheville’s homecoming basketball game on Feb. 21, 2009. Alumni couple, Alexis Johnson (’97) and Ed Johnson (’96), also a member of the math faculty, are his keepers.

The name “Rocky” was suggested by staff member Nancy Williams during a naming contest sponsored by the Athletics Department in 1995. Though the rumor has often been that the name came from Sylvester Stallone’s famous character, Rocky Balboa, which is based on the American prize fi ghter Rocky Marciano, the name was chosen because it means steadfast, much like the mountains that surround campus. Ironically, the name “Rocky,” which is of English origin, is a derivation of the name “Roch” (also Rocco and Roque) after St. Roch, the Patron Saint of Dogs.

In addition to the live bulldogs, the UNC Asheville mascot has also been depicted by an army of costumed students. Since the 1960s, students dressed as the bulldog have rallied the fans at thousands of games in support of Bulldog Athletics. The present incarnation of Rocky was introduced during the 2006-2007 season and is the fi rst to accurately refl ect the logo image of the bulldog used on signs and in print publications. That image, introduced during the 2004-05 season is the fi fth offi cial incarnation of the UNC Asheville bulldog logo.

In the late 1990s, the image of the bulldog, or “Rocky,” was immortalized in aluminum through a gift by the Class of 1998. Sculpted by Matt West (‘00) and modeled after a canine friend of the University, Pete “Bubba” McGill, the statue of Rocky stands in front of the Justice Center as a sentinel over campus. Careful observers will note a chipped tooth and a torn ear, signs of his ferocity. Despite his tough outward appearance, the statue of Rocky is beloved by fans. Continuing a tradition begun by the Class of 1998, each year, during convocation and commencement, freshman and seniors rub his head for good luck before going to the ceremonies. Seniors are also often spotted getting their picture made riding Rocky in the days leading up to graduation.

UNC Asheville is proud of its bulldog heritage. Today, Rocky, in all of his forms serves as a rallying point for fans far and wide.

1990-2003

2004-Present

ROCKY

6161

Important NCAA Terms

A prospective student-athlete is a student who has started classes for the ninth grade. In addition, a student who has not started classes for the ninth grade be-comes a prospective student-athlete if the institution provides such an individual (or the individual’s relatives or friends) any fi nancial assistance or other benefi ts that the institution does not provide to prospective students generally. An indi-vidual remains a prospective student-athlete until one of the following occurs (whichever is earlier):

(a) The individual offi cially registers and enrolls in a minimum full-time program of studies and attends classes in any term of a four-year collegiate institution’s regular academic year (excluding summer); or(b) The individual participates in a regular squad practice or competition at a four-year collegiate institution that occurs before the beginning of any term; or (Revised: 1/11/89, 1/10/90)(c) The individual offi cially registers and enrolls and attends classes during the summer prior to initial enrollment. (Adopted: 4/28/05, Revised: 1/17/09)

Contact: A contact is any face-to-face encounter between a prospective student-athlete or the prospective student-athlete’s parents, relatives or legal guardians and an institutional staff member or athletics representative during which any dialogue occurs in excess of an exchange of a greeting. Any such face-to-face encounter that is prearranged (e.g., staff member positions himself or herself in a location where contact is possible) or that takes place on the grounds of the prospective student-athlete’s educational institution or at the site of organized competition or practice involving the prospective student-athlete or the prospective student-athlete’s high school, preparatory school, two-year college or all-star team shall be considered a contact, regardless of whether any conversation occurs. How-ever, an institutional staff member or athletics representative who is approached by a prospective student-athlete or the prospective student-athlete’s parents, relatives or legal guardians at any location shall not use a contact, provided the encounter was not prearranged and the staff member or athletics representative does not engage in any dialogue in excess of a greeting and takes appropriate steps to immediately terminate the encounter.

Contact Period: A contact period is that period of time when it is permissible for authorized athletics department staff members to make in-person, off-campus recruiting contacts and evaluations.

Evaluation: Evaluation is any off-campus activity designed to assess the academic qualifi ca-tions or athletics ability of a prospective student-athlete, including any visit to a prospective student-athlete’s educational institution (during which no contact occurs) or the observation of a prospective student-athlete participating in any practice or competition at any site.

Evaluation Period:An evaluation period is a period of time when it is permissible for authorized ath-letics department staff members to be involved in off-campus activities designed to assess the academic qualifi cations and playing ability of prospective student-athletes. No in-person, off-campus recruiting contacts shall be made with the prospective student-athlete during an evaluation period.

Quiet Period: A quiet period is a period of time when it is permissible to make in-person recruiting contacts only on the institution’s campus. No in-person, off-campus recruiting contacts or evaluations may be made during the quiet period.

Dead period: A dead period is a period of time when it is not permissible to make in-person recruiting contacts or evaluations on or off the institution’s campus or to per-mit offi cial or unoffi cial visits by prospective student-athletes to the institution’s campus. The provision of complimentary admissions to a prospective student-athlete during a dead period is prohibited, except as provided in Bylaw 13.7.2.5 for a prospective student-athlete who visits an institution as part of a group. During a dead period, a coaching staff member may not serve as a speaker at or attend a meeting or banquet at which prospective student-athletes are in at-tendance, except as provided in Bylaw 13.1.8.1, and may not visit a prospective student-athlete’s educational institution. It remains permissible, however, for an institutional staff member to write or telephone a prospective student-athlete during a dead period.

Initial Eligibility: A student-athlete who enrolls in a member institution as an entering freshman with no previous full-time college attendance shall meet specifi c NCAA academic requirements, as certifi ed by the NCAA Eligibility Center, as approved by the Executive Committee, and any applicable institutional and conference regulations, to be considered a qualifi er and thus be eligible for fi nancial aid, practice and competition during the fi rst academic year in residence. For further information please visit, www.eligibilitycenter.org.

Frequently Asked Questions

What is the National Letter of Intent (NLI)?The NLI is a contract between a prospect and an institution. By signing a NLI, a prospect agrees to attend UNC Asheville for at least one academic year. In exchange, UNC Asheville must provide athletic fi nancial aid for one academic year. The NLI early signing period for Basketball, Baseball, Tennis and Volleyball is November 10-17, 2010. The regular signing period for Basketball is April 13 - May 18, 2011. The regular signing period for Baseball, Tennis and Volleyball is April 13- August 1, 2011. The NLI signing period for Soccer and Track is February 2-August 1, 2011. The NLI regular signing period for all other sports is April 13-August 1 2011. For more information, visit the NLI website: http://www.ncaa.org/wps/wcm/connect/nli/nli.

What is the difference between an offi cial visit and unoffi cial visit?After opening day of classes of the prospect’s senior year, the prospect may take fi ve offi cial visits to different Division I or II schools. Before the visit, the prospect must present a high school transcript, proof of SAT, ACT, PACT, PSAT test to UNC Asheville, register with the NCAA Eligibility Center, and be placed on the Institution’s IRL. An offi cial visit may not occur if the prospect is not registered with the NCAA Eligibility Center. Offi cial visits are paid in part and extended by UNC Asheville coaches only. All visits must be comparable to normal student life.

Prospects may make unlimited number of unoffi cial visits and may visit UNC Asheville anytime except during a dead period. Prospects are solely responsible for all expenses of unoffi cial visits. However, prospects may receive three com-plimentary admissions to any home athletic contest, excluding Big South Confer-ence Post Season Tournaments.

What is the NCAA Eligibility Center?It is the agency that certifi es both a prospect’s academic and amateur eligibility for Division I and II. A prospect should register with the NCAA Eligibility Center at the beginning of their senior year in high school. Visit the NCAA Eligibility Center website for registration information.

This is a brief summary of regulations which outlines the basic recruiting rules to help prospective student-athletes and parents better understand the recruiting process. UNC Asheville is committed to recruiting and conducting its athletics program with the highest level of integrity. If you have any questions about NCAA rules, please contact Terri Brne, Associate Athletics Director, at 828-251-6930.

THE NCAA

6262

For over 30 years, the Bulldog Athletics Association has been the athletics scholarship fundraising arm of the UNC Asheville Athletics Department, but in its simplest terms, the Bulldog Athletics Club is YOU. Construction workers, doctors, teachers, lawyers, bankers, manufacturers, brokers, and technicians who are friends, fans, alumni, and countless combinations of others from Asheville, Weaverville, Arden, Hendersonville, …and places all over North Carolina, the United States, and the world. They all have one thing in common—a passion for Bulldog Athletics. While we have high expectations for conference and NCAA competition, we also have high expectations for outstanding graduation rates, personal growth, and community involvement. As a member of the Bulldog Athletics Association, you become a critical part of a successful athletics program with a tradition of developing a student-athlete. We must raise funds not only to increase the amount of scholarship money we can offer but also to offset the rising costs of a college education. The confi dence of knowing your investment will be maximized is one reason supporting UNC Asheville Bulldog Athletics is a great investment. UNC Asheville Athletics receives no state funding for scholarships, so 100 percent of your gift will enable UNC Asheville to recruit and retain student-athletes who will succeed in the classroom, athletics arena, and the community – following our motto:

Champions in Athletics, Leaders in Life.

For more information about the Bulldog Athletics Association, please contact us:UNC Asheville Athletics

Justice Center, CPO #2600One University Heights

Asheville, NC 28804Phone: (828) 251-6459

Fax: (828) 251-6386www.uncabulldogs.com

“UNC Asheville is a point of pride for this community, as an alumnus and business owner. We are proud to support the athletics department and student-athletes as they represent our community and bring attention to WNC.”

--Rich Davis ’93, Jan Davis Tire Store

“The athletics scholarship I received from UNC Asheville allowed me to focus solely on my academics and soccer, without being concerned about how to pay for school. I donate to the Bulldog Athletics Club now so that current and future student-athletes can enjoy the same experience I did. Being a student-athlete at UNC Asheville was one of the best experiences of my life and the values and lessons I learned have helped me in my professional career and my personal life. Go Bulldogs!”

--Pat Britz ’90; former men’s soccer player

BULLDOG ATHLETICS ASSOCIATION