View
1
Download
0
Category
Preview:
Citation preview
Page 1
Candida albicans uses multiple mechanisms to acquire the essential 1
metabolite inositol during infection 2
3
Ying-Lien Chen1, Sarah Kauffman
2 and Todd B. Reynolds
1* 4
1,2 Department of Microbiology, University of Tennessee, Knoxville, TN 37996, USA 5
6
*Corresponding author: Todd B. Reynolds 7
Mailing address: Department of Microbiology, University of Tennessee, F321 Walters Life 8
Sciences Building, Knoxville, TN 37996 9
Phone: 865-974-4025, FAX: 865-974-4007, Email: treynol6@utk.edu 10
11
12 ACCEPTED
Copyright © 2008, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Infect. Immun. doi:10.1128/IAI.01514-07 IAI Accepts, published online ahead of print on 11 February 2008
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 2
ABSTRACT 12
Candida albicans is an important cause of life-threatening systemic bloodstream infections in 13
immunocompromised patients. In order to cause infections C. albicans must be able to 14
synthesize the essential metabolite inositol or acquire it from the host. Based on its similarity to 15
Saccharomyces cerevisiae it was predicted that C. albicans may generate inositol de novo, import 16
it from the environment, or both. The C. albicans inositol synthesis gene INO1 and inositol 17
transporter gene ITR1 were each disrupted. The ino1!/ino1! mutant was an inositol auxotroph, 18
and the itr1!/itr1! mutant was unable to import inositol from the medium. Each of these 19
mutants were fully virulent in a mouse model of systemic infection. It was not possible to 20
generate an ino1/ino1! itr1!/itr1! double mutant suggesting that in the absence of these two 21
genes C. albicans could not acquire inositol and was inviable. A conditional double mutant was 22
created by replacing the remaining wild-type allele of ITR1 in an ino1!/ino1! itr1!/ITR1 strain 23
with a conditionally expressed allele of ITR1 driven from the repressible MET3 promoter. The 24
resulting ino1!/ino1! itr1!/PMET3::ITR1 strain was found to be inviable in medium containing 25
methionine and cysteine (which represses the PMET3 promoter), and it was avirulent in the mouse 26
model of systemic candidiasis. These results suggest a model in which Candida albicans has two 27
equally effective mechanisms for obtaining inositol while in the host. It can either generate 28
inositol de novo through Ino1p, or it can import it from the host through Itr1p. 29
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 3
INTRODUCTION 30
Candida albicans is a dimorphic yeast that can exist in a human host as either a harmless 31
commensal, or as an opportunistic pathogen when the host’s immune system is impaired (5). In 32
patients that are neutropenic, Candida species are associated with severe and deadly systemic 33
bloodstream infections with a high mortality rate (31.8%) (27). In fact, Candida species are the 34
fourth most common cause of catheter-related blood stream infections in hospitalized patients in 35
the intensive care unit, and C. albicans is the most commonly isolated species from these 36
infections (4). 37
The ability of any pathogenic microbe to cause an infection depends on the organism’s 38
ability to acquire or generate essential nutrients during residence within the host. There are 39
several examples of auxotrophies that compromise virulence in C. albicans (16). The most 40
notable example is the defect in uracil biosynthesis caused by a mutation in URA3. Homozygous 41
URA3 mutants (ura3!/!) block the ability of C. albicans to grow without uridine 42
supplementation and lead to avirulence. In fact, the level of URA3-encoded orotidine 43
5'-monophosphate decarboxylase activity can be correlated with growth and virulence (20). 44
Homozygous mutations in the ADE2 gene, which blocks the ability of C. albicans to grow in 45
minimal medium or serum in the absence of exogenous adenine also diminish virulence (10). In 46
addition, homozygous mutations in the HEM3 gene leading to heme auxotrophy compromise 47
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 4
virulence (16). 48
In contrast to these results, auxotrophies for a number of amino acids including serine, 49
lysine, leucine, histidine, and arginine do not appear to compromise virulence (23, 32, 40). For 50
example, Noble and Johnson (32) demonstrated that C. albicans his1!/!, his1!/! leu2!/!, and 51
his1!/! arg4!/! auxotrophic mutants exhibited wild-type virulence in a mouse model of 52
systemic candidiasis, whereas his1!/! leu2!/! arg4!/! triply auxotrophic strains were only 53
mildly attenuated in virulence compared to the wild-type. These results suggest that there are 54
some metabolites such as amino acids that C. albicans can scavenge from the host during an 55
infection, while there are other metabolites that it must make de novo such as uracil, adenine, and 56
heme. 57
Myo-inositol (referred to here as inositol) is essential for the growth of all eukaryotes, and is 58
needed by some bacteria (12). Inositol is involved in many intracellular processes including 59
growth regulation, membrane structure, osmotolerance, signal transduction, and the formation of 60
glycosylphosphatidylinositol (GPI)-anchored proteins, which are themselves essential (3, 7, 33, 61
41). Inositol has been implicated in the pathogenicity of C. albicans because it is an essential 62
precursor for phospholipomannan, a GPI-anchored glycolipid on the cell surface of Candida 63
which is involved in pathogenicity (26). 64
There are three potential sources of inositol available to C. albicans based on work that has 65
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 5
been done in the related yeast S. cerevisiae: 1) de novo biosynthesis, where glucose 6-phosphate 66
is converted to inositol 1-phosphate by the inositol-1-phosphate synthase enzyme; 2) inositol 67
import from the extracellular environment by an inositol transporter; and 3) recycling of inositol 68
from the dephosphorylation of inositol polyphosphate products (7, 30, 41). 69
In S. cerevisiae, de novo inositol biosynthesis and import have both been well studied. The 70
S. cerevisiae inositol 1-phosphate synthase is encoded by the INO1 gene (9). The Ino1p enzyme 71
converts glucose-6-phosphate to inositol-1-phosphate, and then a second enzyme, inositol 72
monophosphatase, encoded by the INM1 gene, dephosphorylates inositol-1-phosphate to create 73
inositol (22). S. cerevisiae carries two distinct inositol transporter genes, ScITR1 and ScITR2, 74
which are both capable of importing inositol, but at different efficiencies (31). 75
C. albicans carries a putative homolog of INO1 based on sequence similarity which was 76
identified and sequenced by Klig et al (Genbank accession #L22737) (17, 18). C. albicans INO1 77
shows 64% identity to S. cerevisiae INO1 at the amino acid level (18). In addition, it has been 78
shown that C. albicans has a potent inositol transporter activity (15). It was demonstrated that the 79
inositol transporter in C. albicans has an apparent Km value of 240±15 µM, which appears to be 80
active and energy-dependent (15). C. albicans inositol transport activity differs in substrate and 81
cotransporter specificity from the human inositol-Na2+
transporter. However, the inositol 82
transporter gene in C. albicans was not identified in this previous study. 83
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 6
Recently, the importance of inositol biosynthesis in some human infectious agents was 84
demonstrated by reports in two unrelated pathogens, Mycobacterium tuberculosis and 85
Trypanosoma brucei. In T. brucei its INO1 homolog was shown to be necessary for inositol 86
biosynthesis, efficient GPI synthesis, and growth in vitro (24, 25). In M. tuberculosis, it was 87
found that its INO1 homolog was required for de novo inositol biosynthesis and full virulence in 88
a mouse model of infection (29). 89
It is unknown what roles inositol import or biosynthesis play in the virulence of C. albicans. 90
This fungus may be able to both synthesize and import inositol. It became of interest to 91
determine if C. albicans would behave like M. tuberculosis and T. brucei and require INO1 92
function for virulence/viability, or if in contrast to these pathogens, C. albicans would be able to 93
utilize either de novo synthesis or inositol import to support virulence. 94
95
MATERIALS AND METHODS 96
Strains and growth media 97
C. albicans strains used in this study are shown in Table 1. Media used in this study include 98
YPD (yeast extract-peptone-dextrose, 1% yeast extract, 2% peptone, 2% glucose) (42), defined 99
medium 199 (M199, Invitrogen), yeast carbon base-bovine serum albumin (YCB-BSA) (39), and 100
minimal medium (MM, 0.67% Difco yeast nitrogen base without amino acids, 2% glucose) (42). 101
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 7
MM medium was supplemented with 75 µM inositol for supporting the growth of the C. albicans 102
ino1!/! mutant and 2.5mM methionine and cysteine for MET3 promoter shutoff assays (6). 103
Inositol-free media (42) was made for testing the phenotype of the ino1!/! mutant. Agar plates 104
were solidified with 2% agar (granulated, Fisher) for YPD and with 2% BactoAgar (contains no 105
residual inositol) for MM and inositol-free media. 106
107
Strain construction 108
The C. albicans INO1 gene (INO1) was disrupted by using the CaNAT1-FLP cassette (39), 109
whereas, the C. albicans ITR1 gene (ITR1) was disrupted by using the SAT1 flipper (35). 110
For the INO1 disruption construct, the 564 basepair (bp) 5’ non-coding region (NCR) of 111
INO1 was amplified with primers JCO39 and JCO40 (Table 3), which introduced KpnI and ApaI 112
restriction sites, and was cloned into pJK863 5’ of the CaNAT1-FLP cassette (Fig 1A). The 113
583bp 3’ NCR of INO1 was amplified with primers JCO41 and JCO42 which introduced SacII 114
and SacI sites, and was cloned into pJK863 3’ of the CaNAT1-FLP cassette (Fig 1A). This 115
created the INO1 knock out construct plasmid pYLC94 (Table 2, Fig 1A), which was cut with 116
KpnI and SacI to release the disruption construct which was transformed into the wild type 117
SC5314 strain by electroporation as described previously (8, 35). The disruption construct was 118
used to sequentially disrupt both alleles of INO1 as previously described (39). The INO1 119
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 8
reconstitution construct was made by amplifying a 2.1 Kb fragment containing the INO1 ORF 120
and 5’ NCR from SC5314 genomic DNA using primers (JCO39 and JCO47) that introduced 121
KpnI and SalI sites. This fragment was ligated into the pRS316 vector along with a 1.7 Kb 122
fragment containing the NAT1-3’INO1NCR
amplified from plasmid pYLC94 using primers 123
JCO50 and JCO42 which introduced SalI and SacI sites. This resulted in the INO1 reconstitution 124
plasmid pYLC119 (Table 2, Fig 1B). The 3.8Kb KpnI-SacI fragment from pYLC119 was 125
transformed into the ino1!/! mutant (YLC113) in order to create the reconstituted 126
ino1!/!::INO1 strain (YLC120). 127
A similar approach was used to knock out ITR1 with the SAT1 flipper plasmid pSFS2A (35). 128
Approximately 500 bp 5’ and 3’ NCRs from ITR1 were amplified using the primer pairs 129
JCO89-JCO90 and JCO93-JCO94, respectively, each of which introduced restriction sites into 130
the corresponding fragments. The ApaI-XhoI 5’ITR1NCR
and NotI 3’ITR1NCR
fragments were 131
ligated into pSFS2A resulting in the ITR1 knock out construct plasmid pYLC164 (Table 2, Fig 132
2A). The 5Kb ApaI-SacII fragment from pYLC164 was electroporated into SC5314 and used to 133
disrupt both copies of ITR1 by sequential disruptions (28, 35). For the reconstituted construct, 134
JCO89 and JCO111 primers, which added ApaI and EcoRI sites, were used to amplify a 2Kb 135
fragment containing the 5’ITR1NCR
and ITR1 ORF region, which was used to replace the 136
ApaI-EcoRI fragment (containing 5’ ITR1NCR
-PMAL2-FLP) in the pYLC164 plasmid resulting in 137
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 9
pYLC208 (Table 2, Fig 2B). The 5Kb ApaI-SacII fragment from pYLC208 was used to 138
reconstitute ITR1 in the itr1!/! mutant (YLC196) strain creating the itr1!/!::ITR1 strain 139
(YLC211). 140
The ITR1 conditional mutant was made as follows. Using SC5314 genomic DNA as 141
template, primers JCO118 and JCO119 (introduced PstI and NotI sites) were used to amplify a 142
1362bp fragment containing the CaMET3 promoter (6), and primers JCO120 and JCO121 143
(introduced NotI and SacII sites) were used to amplify the ITR1 ORF. These fragments were 144
used to replace the PstI-SacII fragment in pYLC164, which deleted the 3’ flanking FRT site, 145
resulting in the conditional ITR1 expression construct plasmid pYLC229 (Table 2, Fig 2C). The 146
7.6 Kb ApaI-SacII fragment from pYLC229 was transformed into the ino1!/! itr1!/ITR1 strain 147
(YLC184) to create the ino1!/! itr1!/PMET3::ITR1 conditional strains (YLC261 and YLC266). 148
149
Northern blot analysis 150
Northern blotting for ITR1 expression was performed as described (36) with the following 151
exceptions. Strains grown in liquid medium 199 at 37°C for 2 hrs were collected for total RNA 152
extraction by the hot phenol method (36). A PCR product containing bps 24-750 of the ITR1 153
ORF (primers JCO102 and JCO103) was used as a probe. Expression was normalized against C. 154
albicans ACT1 gene expression probed on the same membrane. The ACT1 probe was generated 155
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 10
with the primers JCO48 and JCO49. 156
157
Southern blot analysis 158
Hybridization conditions for the Southern blot analysis were similar to those for Northern 159
blot analysis, except that the Techne Hybrigene oven was set to 60°C for the incubation step, and 160
42°C and 60°C for washing steps. The cells were grown in liquid YPD at 30°C overnight. The 161
genomic DNA was extracted using the Winston-Hoffman method (13) and 20µg of genomic 162
DNA were subjected to Southern blotting. The genomic DNA of ino1 mutants was cut by AflII 163
and SphI restriction enzymes while the genomic DNA of itr1 mutants was cut by PstI. PCR 164
products containing the ~500bp 3’ NCR of INO1 (primers JCO41 and JCO42) and 3’NCR of 165
ITR1 (primers JCO93 and JCO94) were used as probes. 166
167
Inositol uptake assays 168
This protocol was adapted in part from Jin and Seyfang (15). The wild type, itr1!/ITR1, 169
itr1!/!, and itr1!/!::ITR1 strains were grown in YPD liquid cultures overnight at 30°C. Cells 170
were diluted to 1 OD600
in YPD, grown at 30˚C, and collected at 5 OD600
by centrifugation at 171
2,600g for 5 min. Cells were then washed twice with water at 4°C and resuspended in 2% 172
glucose to a final concentration of 2x108 cells/ml as determined by a hemacytometer. From this 173
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 11
time point on, cells were kept on ice until used for the actual assay. For the uptake assay, the 174
reaction mixture (250µl) contained 2% glucose, 40mM citric acid/KH2PO4 (pH5.5), 0.15"M 175
[2-3H] inositol (1 µCi/µl, MP Biomedicals), and 200"M unlabeled inositol (Alexis Biomedicals). 176
Equal volumes of the reaction and cell mixtures (60"l each) were warmed to 30°C and mixed for 177
the uptake assay which was performed for 10 minutes at 30°C. As negative controls, mixtures 178
were kept at 0°C (ice) during the 10 minute incubation. One hundred µl aliquots were removed 179
and transferred to pre-wetted metricel filters on a vacuum manifold. The filters were washed 4 180
times each with 1ml ice cold water. The washed filters were removed and added to liquid 181
scintillation vials for measurements on a Perkin Elmer TRI-CARB 2900TR scintillation counter. 182
The uptake of radiolabelled inositol over 10 minutes was calculated and plotted as a function of 183
incubation temperature. 184
185
Mouse infection studies 186
Five- to six-week-old male CD1 mice (18 to 20g) from Charles River Laboratories were 187
used in this study. Mice were housed at five per cage. For infection, colonies from each C. 188
albicans strain were inoculated into 20ml of YPD or MM media. Cultures were grown overnight, 189
washed twice with 25ml of sterile water, counted by hemacytometer, and resuspended at 107 190
cells per ml in sterile water. The cells were then plated on YPD to determine the viability. Mice 191
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 12
were injected via the tail vein with 0.1ml of the cell suspension (106 cells) (43), and the course of 192
infection was monitored for up to 30 days. Survival was monitored twice daily, and moribund 193
mice were euthanized. All experimental procedures were carried out according to the NIH 194
guidelines for the ethical treatment of animals. 195
196
Statistics 197
The statistical analysis was done using Prism 4.0 software (GraphPad Software). For the 198
mouse model of systemic infection, Kaplan-Meier survival curves
were compared for 199
significance using the Mantel-Haenszel log rank test. Tests for significance of differences 200
between inositol uptake strains were determined using the two-tailed unpaired t test. Statistical 201
significance was set at P < 0.05. 202
203
RESULTS 204
The INO1 gene in C. albicans is required for growth in the absence of exogenous inositol 205
The C. albicans homolog of the S. cerevisiae INO1 gene (ScINO1) identified by Klig et al 206
(18) was disrupted in order to determine if it was required for inositol biosynthesis in C. albicans. 207
The C. albicans INO1 homolog (orf19.7585, which we refer to as INO1 in this communication) 208
was disrupted by sequentially replacing both alleles of the gene with the NAT1-FLP cassette 209
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 13
which contains the nourseothricin resistance gene (39). The INO1 disruption construct is 210
diagrammed in Fig 1A. The INO1 gene was reintegrated into the INO1 locus of the homozygous 211
mutant (ino1!/!) using the construct shown in Fig 1B to verify linkage of any resulting 212
phenotypes with the genotype. Wild-type (INO1/INO1), heterozygous (ino1!/INO1), 213
homozygous (ino1!/!), and reconstituted (ino1!/!::INO1) strains were analyzed by PCR (data 214
not shown) and Southern blotting (Fig 1C) to confirm the deletion and reintegration of the 215
correct genes. The wild-type, ino1!/INO1, ino1!/!, and ino1!/!::INO1 strains were then 216
compared for growth on medium lacking inositol (42) to determine if an ino1!/! mutation would 217
compromise the ability of the strain to grow in the absence of inositol. The ino1!/! strain was 218
unable to grow on inositol free medium, while the wild-type, heterozygous, and reconstituted 219
strains grew equally well. As expected, the ino1!/! strain was able to grow as well as the 220
wild-type on identical solid or liquid media with inositol added (Fig 1D and data not shown, 221
respectively). 222
223
The INO1 gene is not required for virulence in C. albicans 224
The INO1 gene does not appear to be required for virulence in a mouse model of 225
disseminated candidiasis. The wild-type, ino1!/INO1, ino1!/!::INO1, and two separately 226
derived ino1!/! strains were tested for virulence in the mouse disseminated infection model (43). 227
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 14
These tests revealed no difference in virulence between the wild type and ino1 mutant strains 228
(Fig 5A). The ino1!/INO1 heterozygote behaved like the wild-type and is not shown. 229
230
The ITR1 gene is required for inositol transport in C. albicans 231
The fact that the ino1!/! mutant can grow on medium containing inositol supports previous 232
studies that have shown that C. albicans harbors an inositol transporter (15). A C. albicans 233
homolog of the S. cerevisiae ITR1 and ITR2 inositol transporters was identified by BLASTing 234
the ScItr1p and ScItr2p protein sequences against the Candida Genome Database (CGD, 235
http://www.candidagenome.org). This homolog was orf19.3526 and is referred to as HGT15 236
in the CGD, but its alias in CGD is ITR2 . This gene has never been characterized functionally. 237
Based on our BLAST search using CGD, C. albicans orf19.3526 is the closest homolog to 238
ScITR1 and ScITR2 and is 51% identical based on amino acid sequence to both S. cerevisiae 239
transporter genes over its full length (data not shown). C. albicans orf19.3526 also contained the 240
critical inositol transporter motif (D/E)(R/K)"GR(R/K) (38). Based on the results described 241
below we will refer to orf19.3526 as ITR1 for the rest of this paper. 242
Both alleles of the ITR1 gene were sequentially disrupted by replacing each ORF with the 243
nourseothricin resistance cassette from the SAT1 flipper (35). The itr1! disruption construct is 244
diagrammed in Fig 2A. The ITR1 gene was reconstituted in the itr1!/! strain using the 245
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 15
reconstitution construct shown in Fig 2B. Gene deletions and replacements were checked for 246
accuracy using PCR (data not shown) and Southern blotting (Fig 2D). As a further test, Northern 247
blotting revealed that the ITR1 transcript could only be detected in wild-type (ITR1/ITR1), 248
heterozygous itr1!/ITR1, and reconstituted itr1!/!::ITR1 strains, but not in the itr1!/! strain 249
(Fig 2E). Expression was lower in the itr1!/ITR1 and itr1!/!::ITR1 strains presumably because 250
they contain only one allele of the gene. 251
Analysis of inositol uptake in the wild-type, itr1!/ITR1, itr1!/!, and itr1!/!::ITR1 strains 252
revealed that ITR1 is required for inositol uptake (Fig 3). Inositol uptake was not very low at 0˚C 253
((15) and Fig 3), hence this was used as a control. Inositol uptake was 58-fold higher at 30˚C 254
than at 0˚C in the wild type. In contrast, inositol uptake in the itr1!/! mutant was only 4-fold 255
higher at 30˚C than at 0˚C, but a two-tailed paired t test analysis revealed that there was no 256
significant difference in uptake between these two temperatures (P=0.34). The itr1!/ITR1 mutant 257
showed decreased inositol import compared to the wild type, and the ITR1 reconstituted strain 258
restored inositol import to a level similar to that seen in the wild-type. 259
Inositol uptake in the wild type strain in 200"M inositol was found to be 288 pmol per 5x107 260
cells during a 10 minute uptake period. Jin and Seyfang showed approximately 60 pmol per 5 x 261
107 cells during a single minute uptake (15). The difference between their data and ours is 262
probably due to saturation of uptake over a 10 minute time course (15). 263
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 16
264
The ITR1 gene is not required for virulence in C. albicans 265
The itr1!/! strain does not appear to be any less virulent than the wild type in a mouse 266
model of systemic candidiasis. The wild-type, itr1!/ITR1, itr1!/!, and itr1!/!::ITR1 strains 267
were compared in the mouse model for disseminated infection. There was not a significant 268
difference between the virulence of the wild-type and the itr1!/! strains (Fig 5B, P=0.95). The 269
similarity in virulence between wild-type and itr1!/! strains was born out in two separate 270
infection experiments. The itr1!/ITR1 mutant behaved like the wild-type (Fig 5B) as well. In 271
the reintegrated strain (itr1!/!::ITR1) only half of the mice succumbed to the infection. This 272
may be due to technical error during the injection or an uncharacterized mutation within the 273
strain. The fact that the wild-type, itr1!/ITR1, and itr1!/! strains were all similarly virulent 274
strongly indicates that a lack of ITR1 does not impair virulence. 275
276
The INO1 and ITR1 genes show synthetic defects in growth and virulence 277
Although neither ITR1 nor INO1 were required for virulence in a mouse model of systemic 278
candidiasis, it was possible that each could compensate for loss of the other during infection 279
since it has been shown that rat serum contains 20-100µM inositol (14, 34) and mouse liver 280
contains approximately 100µM inositol (2). In order to test this hypothesis an attempt was made 281
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 17
to disrupt both genes simultaneously. One allele of ITR1 was disrupted in the ino1!/! strain. 282
However, it was not possible to disrupt the other allele of ITR1 suggesting that a double mutant 283
consisting of ino1!/! and itr1!/! was synthetically lethal. Therefore, in the ino1!/! itr1!/ITR1 284
strain the promoter of the remaining wild-type ITR1 allele was replaced with the CaMET3 285
conditional promoter (6) using the construct described in Fig 2C. When the CaMET3 promoter 286
(PMET3) is used to replace the promoter of a target gene, it represses transcription of that gene in 287
the presence of methionine and cysteine in the medium. The correct insertion of the PMET3::ITR1 288
allele into the chromosome was confirmed by PCR analysis (data not shown) and Southern 289
blotting (lane 7, Fig 2D). The resulting ino1!/! itr1!/PMET3::ITR1 strain was tested for growth in 290
minimal medium containing 75"M inositol and either 0 or 2.5mM methionine and cysteine. It 291
was found that unlike the wild-type or the ino1!/! itr1!/ITR1 strains, two separately derived 292
ino1!/! itr1!/ PMET3::ITR1 strains failed to grow in the presence of 2.5 mM methionine and 293
cysteine (Fig 4). 294
The ino1!/! itr1!/PMET3::ITR1 strain was tested to determine whether its virulence was 295
affected in a mouse model of systemic candidiasis. Previous work had indicated that the presence 296
of the PMET3 promoter on the essential gene CaFBA1 could compromise virulence (37). The 297
methionine in the mouse bloodstream is presumably able to prevent expression of the CaFBA1 298
gene sufficiently to compromise growth and virulence in the mouse. The wild-type, ino1!/! 299
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 18
itr1!/ITR1 and two ino1!/! itr1!/PMET3::ITR1 strains were compared in the mouse model of 300
systemic candidiasis. This experiment revealed that the ino1!/! itr1!/ITR1 strain was attenuated 301
for virulence, and the ino1!/! itr1!/PMET3::ITR1 strains were avirulent (Fig 5C). 302
303
DISCUSSION 304
The mechanism by which C. albicans acquires the essential metabolite inositol during an 305
infection has not been explored previously. We have found that C. albicans is able to generate 306
inositol de novo via the INO1 gene product or import inositol from the environment via the ITR1 307
gene product with efficiencies that allow it to establish an infection regardless of which 308
mechanism is employed. This conclusion only applies to bloodstream infections as this was the 309
only model tested. This result implies that the availability of inositol in mice is sufficient to 310
support an infection even if C. albicans must acquire inositol solely by importing it. Although 311
our search of the literature did not reveal the estimated inositol content of mouse serum, the 312
inositol levels found in rats is 20-100"M (14, 34) and may be comparable to mice and is similar 313
to that found in humans (61.0±12.4 µM) (19). 314
The results found with C. albicans are in contrast to what has been observed in two 315
important human pathogens, M. tuberculosis and T. brucei, which require de novo inositol 316
biosynthesis via INO1 homologs in order to be fully virulent (Mt) in mouse models or viable (Tb) 317
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 19
(25, 29). Both of these pathogenic microbes are capable of importing inositol, but in neither case 318
is import sufficient to allow viability in T. brucei or virulence in M. tuberculosis. In the case of T. 319
brucei, de novo synthesized inositol is used to make GPI-anchored proteins, while imported 320
inositol is used very inefficiently for this purpose (24). GPI-anchored proteins are required for 321
viability in T. brucei (21), so disruption of INO1 compromises viability. In the case of M. 322
tuberculosis the inositol transporter is too inefficient to import inositol from the host in order to 323
support infection (29). 324
Unlike either of these pathogens Candida albicans possesses an inositol transporter, 325
encoded by ITR1, that is capable of transporting inositol efficiently enough to allow full 326
virulence in a mouse model of systemic candidiasis even in the absence of de novo inositol 327
biosynthesis. In the case of both M. tuberculosis and T. brucei it has been suggested that the 328
development of selective inhibitors of Ino1p homologs might be an effective way to generate 329
antimicrobials (24, 29). The data reported in this communication indicates that this would not be 330
effective in C. albicans as it is fully virulent even in the absence of its Ino1 enzyme. As an 331
alternative approach, it has been suggested that toxic inositol analogs that are selectively taken 332
up by the C. albicans inositol transporter but not by the human inositol-Na2+ transporter, could be 333
effective drugs (15). This may be a possibility, although it needs to be determined which of these 334
two mechanisms, de novo biosynthesis or import, is used by wild-type C. albicans during an 335
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 20
infection. If import is used extensively, then this approach might work, however since C. 336
albicans is fully virulent in the absence of ITR1, the development of resistant mutants lacking 337
Itr1p transporter function could pose a problem. Nonetheless, a toxic analog might be useful in 338
combination with drugs affecting other targets such as an azole or polyene (1). 339
Based on our results it appears that Itr1p is the primary and perhaps sole inositol importer in 340
C. albicans both in vitro and during infection. Disruption of ITR1 greatly inhibits inositol uptake 341
in vitro (Fig 3), and in the absence of INO1 a strain carrying only the PMET3::ITR1 allele of ITR1 342
cannot grow in medium containing cysteine and methionine, even in the presence of 75 µM 343
extracellular inositol (Fig 4). The amount of methionine and cysteine in mouse serum is 344
apparently sufficient to decrease expression from the MET3 promoter as well, which is consistent 345
with results using a MET3 driven form of the C. albicans FBA1 gene (37). Our conclusion that 346
ITR1 is the primary or sole inositol transporter is consistent with a previous study of C. albicans 347
inositol transport which concluded that there was one inositol transporter in C. albicans that was 348
responsible for all, or at least the vast majority of, inositol transport activity (15). 349
The situation in C. albicans contrasts with S. cerevisiae, which has two inositol transporters 350
that are expressed at widely different levels (31). In S. cerevisiae, the ScItr1p transporter is the 351
most highly expressed of the two transporters and accounts for most of the transport activity. The 352
residual transport activity in S. cerevisiae is carried out by ScItr2p, which is expressed at much 353
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 21
lower levels. Based on BLAST searches of the Candida Genome Database using ScITR1 or 354
ScITR2 as queries, the C. albicans ITR1 gene was the closest homolog to the S. cerevisiae 355
inositol transporters showing 51% identity over the whole sequence (amino acids) to either 356
ScITR1 or ScITR2. C. albicans carries at least one other homolog of the S. cerevisiae inositol 357
transporters that is predicted to have 12 transmembrane domains and the (D/E)(R/K)øGR(R/K) 358
motif typical of inositol transporters. The predicted protein sequence of this gene (orf19.5447, 359
HGT19) bears 26% and 27% identity to ScItr1p and ScItr2p, respectively. It is possible that 360
orf19.5447 encodes an inositol transporter, but our results suggest that if so, this other transporter 361
is expressed at too low of a level to transport inositol efficiently or it is expressed in different 362
conditions than those tested in our experiments. Alternatively, it is a very low affinity transporter 363
like that seen in M. tuberculosis (29). 364
Taken together our results indicate that either Ino1p or Itr1p can supply the inositol 365
requirement during an infection, but a number of questions remain to be answered. For wild-type 366
C. albicans it is not known whether de novo inositol biosynthesis or import is utilized during an 367
infection or a combination of both are in operation. It may be variable depending on the 368
distribution of C. albicans cells within the host. In addition, it is not known whether de novo 369
synthesis or import is favored during growth in other host niches such as the gut, the oral mucosa, 370
and the vaginal tract. This again may be variable depending on the nutrient conditions of the 371
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 22
particular host niche and location of cells within those host sites. Further studies will be required 372
to answer these questions. 373
374
Acknowledgements 375
We gratefully acknowledge Dr. Jeffrey Becker, Dr. Michael Lorenz, and Dr. Pamela Small for 376
their critical review of this work. We thank Dr. Julia Köhler and Dr. Joachim Morschhäuser for 377
providing the CaNAT1-FLP cassette and SAT1 flipper, respectively. We are grateful to Dr. 378
Melinda Hauser and Li-Yin Huang for their assistance with the inositol uptake assay and animal 379
studies, respectively. We also thank all members of the Reynolds, Kitazono, and Becker 380
laboratories for many helpful discussions. This work was funded in part by grants 381
1R03AI071863 and AHA 0765366B. 382
383 ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 23
REFERENCES 383
1. Anderson, J. B. 2005. Evolution of antifungal-drug resistance: mechanisms and 384
pathogen fitness. Nature reviews 3:547-556. 385
2. Berry, G. T., S. Wu, R. Buccafusca, J. Ren, L. W. Gonzales, P. L. Ballard, J. A. 386
Golden, M. J. Stevens, and J. J. Greer. 2003. Loss of murine Na+/myo-inositol 387
cotransporter leads to brain myo-inositol depletion and central apnea. The Journal of 388
biological chemistry 278:18297-18302. 389
3. Betz, C., D. Zajonc, M. Moll, and E. Schweizer. 2002. ISC1-encoded inositol 390
phosphosphingolipid phospholipase C is involved in Na+/Li+ halotolerance of 391
Saccharomyces cerevisiae. European journal of biochemistry / FEBS 269:4033-4039. 392
4. Bustamante, C. I. 2005. Treatment of Candida infection: a view from the trenches! 393
Current opinion in infectious diseases 18:490-495. 394
5. Calderone, R. A. 2002. Candida and candidiasis. ASM Press, Washington, D.C. 395
6. Care, R. S., J. Trevethick, K. M. Binley, and P. E. Sudbery. 1999. The MET3 396
promoter: a new tool for Candida albicans molecular genetics. Molecular microbiology 397
34:792-798. 398
7. Chen, M., L. C. Hancock, and J. M. Lopes. 2007. Transcriptional regulation of yeast 399
phospholipid biosynthetic genes. Biochimica et biophysica acta 1771:310-321. 400
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 24
8. De Backer, M. D., D. Maes, S. Vandoninck, M. Logghe, R. Contreras, and W. H. 401
Luyten. 1999. Transformation of Candida albicans by electroporation. Yeast (Chichester, 402
England) 15:1609-1618. 403
9. Donahue, T. F., and S. A. Henry. 1981. myo-Inositol-1-phosphate synthase. 404
Characteristics of the enzyme and identification of its structural gene in yeast. The 405
Journal of biological chemistry 256:7077-7085. 406
10. Donovan, M., J. J. Schumuke, W. A. Fonzi, S. L. Bonar, K. Gheesling-Mullis, G. S. 407
Jacob, V. J. Davisson, and S. B. Dotson. 2001. Virulence of a 408
phosphoribosylaminoimidazole carboxylase-deficient Candida albicans strain in an 409
immunosuppressed murine model of systemic candidiasis. Infection and immunity 410
69:2542-2548. 411
11. Gillum, A. M., E. Y. Tsay, and D. R. Kirsch. 1984. Isolation of the Candida albicans 412
gene for orotidine-5'-phosphate decarboxylase by complementation of S. cerevisiae ura3 413
and E. coli pyrF mutations. Mol Gen Genet 198:179-182. 414
12. Haites, R. E., Y. S. Morita, M. J. McConville, and H. Billman-Jacobe. 2005. Function 415
of phosphatidylinositol in mycobacteria. The Journal of biological chemistry 416
280:10981-10987. 417
13. Hoffman, C. S., and F. Winston. 1987. A ten-minute DNA preparation from yeast 418
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 25
efficiently releases autonomous plasmids for transformation of Escherichia coli. Gene 419
57:267-272. 420
14. Isaacks, R. E., A. S. Bender, C. Y. Kim, and M. D. Norenberg. 1997. Effect of 421
osmolality and myo-inositol deprivation on the transport properties of myo-inositol in 422
primary astrocyte cultures. Neurochemical research 22:1461-1469. 423
15. Jin, J. H., and A. Seyfang. 2003. High-affinity myo-inositol transport in Candida 424
albicans: substrate specificity and pharmacology. Microbiology (Reading, England) 425
149:3371-3381. 426
16. Kirsch, D. R., and R. R. Whitney. 1991. Pathogenicity of Candida albicans auxotrophic 427
mutants in experimental infections. Infection and immunity 59:3297-3300. 428
17. Klig, L. S., B. Antonsson, E. Schmid, and L. Friedli. 1991. Inositol biosynthesis: 429
Candida albicans and Saccharomyces cerevisiae genes share common regulation. Yeast 430
(Chichester, England) 7:325-336. 431
18. Klig, L. S., P. A. Zobel, C. G. Devry, and C. Losberger. 1994. Comparison of INO1 432
gene sequences and products in Candida albicans and Saccharomyces cerevisiae. Yeast 433
(Chichester, England) 10:789-800. 434
19. Kouzuma, T., M. Takahashi, T. Endoh, R. Kaneko, N. Ura, K. Shimamoto, and N. 435
Watanabe. 2001. An enzymatic cycling method for the measurement of myo-inositol in 436
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 26
biological samples. Clinica chimica acta; international journal of clinical chemistry 437
312:143-151. 438
20. Lay, J., L. K. Henry, J. Clifford, Y. Koltin, C. E. Bulawa, and J. M. Becker. 1998. 439
Altered expression of selectable marker URA3 in gene-disrupted Candida albicans strains 440
complicates interpretation of virulence studies. Infection and immunity 66:5301-5306. 441
21. Lillico, S., M. C. Field, P. Blundell, G. H. Coombs, and J. C. Mottram. 2003. 442
Essential roles for GPI-anchored proteins in African trypanosomes revealed using 443
mutants deficient in GPI8. Molecular biology of the cell 14:1182-1194. 444
22. Lopez, F., M. Leube, R. Gil-Mascarell, J. P. Navarro-Avino, and R. Serrano. 1999. 445
The yeast inositol monophosphatase is a lithium- and sodium-sensitive enzyme encoded 446
by a non-essential gene pair. Molecular microbiology 31:1255-1264. 447
23. Manning, M., C. B. Snoddy, and R. A. Fromtling. 1984. Comparative pathogenicity of 448
auxotrophic mutants of Candida albicans. Canadian journal of microbiology 30:31-35. 449
24. Martin, K. L., and T. K. Smith. 2006. The glycosylphosphatidylinositol (GPI) 450
biosynthetic pathway of bloodstream-form Trypanosoma brucei is dependent on the de 451
novo synthesis of inositol. Molecular microbiology 61:89-105. 452
25. Martin, K. L., and T. K. Smith. 2005. The myo-inositol-1-phosphate synthase gene is 453
essential in Trypanosoma brucei. Biochemical Society transactions 33:983-985. 454
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 27
26. Mille, C., G. Janbon, F. Delplace, S. Ibata-Ombetta, C. Gaillardin, G. Strecker, T. 455
Jouault, P. A. Trinel, and D. Poulain. 2004. Inactivation of CaMIT1 inhibits Candida 456
albicans phospholipomannan beta-mannosylation, reduces virulence, and alters cell wall 457
protein beta-mannosylation. The Journal of biological chemistry 279:47952-47960. 458
27. Morrell, M., V. J. Fraser, and M. H. Kollef. 2005. Delaying the empiric treatment of 459
candida bloodstream infection until positive blood culture results are obtained: a potential 460
risk factor for hospital mortality. Antimicrobial agents and chemotherapy 49:3640-3645. 461
28. Morschhauser, J., S. Michel, and P. Staib. 1999. Sequential gene disruption in Candida 462
albicans by FLP-mediated site-specific recombination. Molecular microbiology 463
32:547-556. 464
29. Movahedzadeh, F., D. A. Smith, R. A. Norman, P. Dinadayala, J. Murray-Rust, D. 465
G. Russell, S. L. Kendall, S. C. Rison, M. S. McAlister, G. J. Bancroft, N. Q. 466
McDonald, M. Daffe, Y. Av-Gay, and N. G. Stoker. 2004. The Mycobacterium 467
tuberculosis ino1 gene is essential for growth and virulence. Molecular microbiology 468
51:1003-1014. 469
30. Nikawa, J., T. Nagumo, and S. Yamashita. 1982. Myo-inositol transport in 470
Saccharomyces cerevisiae. Journal of bacteriology 150:441-446. 471
31. Nikawa, J., Y. Tsukagoshi, and S. Yamashita. 1991. Isolation and characterization of 472
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 28
two distinct myo-inositol transporter genes of Saccharomyces cerevisiae. The Journal of 473
biological chemistry 266:11184-11191. 474
32. Noble, S. M., and A. D. Johnson. 2005. Strains and strategies for large-scale gene 475
deletion studies of the diploid human fungal pathogen Candida albicans. Eukaryotic cell 476
4:298-309. 477
33. Orlean, P., and A. K. Menon. 2007. Thematic review series: lipid posttranslational 478
modifications. GPI anchoring of protein in yeast and mammalian cells, or: how we 479
learned to stop worrying and love glycophospholipids. Journal of lipid research 480
48:993-1011. 481
34. Palmano, K. P., P. H. Whiting, and J. N. Hawthorne. 1977. Free and lipid 482
myo-inositol in tissues from rats with acute and less severe streptozotocin-induced 483
diabetes. The Biochemical journal 167:229-235. 484
35. Reuss, O., A. Vik, R. Kolter, and J. Morschhauser. 2004. The SAT1 flipper, an 485
optimized tool for gene disruption in Candida albicans. Gene 341:119-127. 486
36. Reynolds, T. B. 2006. The Opi1p transcription factor affects expression of FLO11, mat 487
formation, and invasive growth in Saccharomyces cerevisiae. Eukaryotic cell 488
5:1266-1275. 489
37. Rodaki, A., T. Young, and A. J. Brown. 2006. Effects of depleting the essential central 490
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 29
metabolic enzyme fructose-1,6-bisphosphate aldolase on the growth and viability of 491
Candida albicans: implications for antifungal drug target discovery. Eukaryotic cell 492
5:1371-1377. 493
38. Seyfang, A., and S. M. Landfear. 2000. Four conserved cytoplasmic sequence motifs 494
are important for transport function of the Leishmania inositol/H(+) symporter. The 495
Journal of biological chemistry 275:5687-5693. 496
39. Shen, J., W. Guo, and J. R. Kohler. 2005. CaNAT1, a heterologous dominant 497
selectable marker for transformation of Candida albicans and other pathogenic Candida 498
species. Infection and immunity 73:1239-1242. 499
40. Shepherd, M. G. 1985. Pathogenicity of morphological and auxotrophic mutants of 500
Candida albicans in experimental infections. Infection and immunity 50:541-544. 501
41. Strahl, T., and J. Thorner. 2007. Synthesis and function of membrane 502
phosphoinositides in budding yeast, Saccharomyces cerevisiae. Biochimica et biophysica 503
acta 1771:353-404. 504
42. Styles, C. 2002. How to set up a yeast laboratory. Methods in enzymology 350:42-71. 505
43. Warenda, A. J., S. Kauffman, T. P. Sherrill, J. M. Becker, and J. B. Konopka. 2003. 506
Candida albicans septin mutants are defective for invasive growth and virulence. 507
Infection and immunity 71:4045-4051. 508
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 30
509
510
511
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 31
511
Table 1. C. albicans strains 512
Strain Parent Genotype Source of
reference
SC5314 (wild-type) Clinical isolate Prototrophic wild type (11)
YLC100 SC5314 ino1#::NAT1-FLP/INO1 This study
YLC105 YLC100 ino1#/INO1 This study
YLC111 YLC105 ino1#/ino1#::NAT1-FLP This study
YLC113 YLC111 ino1#/ino1# This study
YLC120 YLC113 ino1#/ino1#::INO1-NAT1 This study
YLC101 SC5314 ino1#::NAT1-FLP/INO1 This study
YLC108 YLC101 ino1#/INO1 This study
YLC126a YLC108 ino1#/ino1#::NAT1-FLP This study
YLC176 SC5314 itr1#::SAT1-FLP/ITR1 This study
YLC185 YLC176 itr1#/ITR1 This study
YLC192 YLC185 itr1#/itr1#::SAT1-FLP This study
YLC196 YLC192 itr1#/itr1# This study
YLC211 YLC196 itr1#/itr1#::ITR1-SAT1 This study
YLC180 YLC113 ino1#/ino1# itr1#::SAT1-FLP/ITR1 This study
YLC184 YLC180 ino1#/ino1# itr1#/ITR1 This study
YLC261 YLC184 ino1#/ino1# itr1#/SAT1-PMET3-ITR1 This study
YLC181 YLC113 ino1#/ino1# itr1#::SAT1-FLP/ITR1 This study
YLC187 YLC181 ino1#/ino1# itr1#/ITR1 This study
YLC266b YLC187 ino1#/ino1# itr1#/SAT1-PMET3-ITR1 This study
a another separately derived ino1#/ino1# homozygous mutant. 513
b another separately derived ino1#/ino1# itr1#/PMET3::ITR1 conditional strain. 514
515
516
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 32
516
Table 2. Plasmids 517
Plasmids Characteristics Source of
reference
pJK863 CaNAT1-FLP cassette carrying nourseothricin resistance gene (39)
pSFS2A SAT1 flipper carrying nourseothricin resistance gene (35)
pYLC94 pJK863 flanked by 5’ and 3’ INO1NCR
for INO1 gene knock out This study
pYLC119 INO1 reconstitution construct This study
pYLC164 pSFS2A flanked by 5’ and 3’ ITR1NCR
for ITR1 gene knock out This study
pYLC208 ITR1 reconstitution construct This study
pYLC229 ITR1 conditional construct controlled by CaMET3 promoter This study
518
519
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 33
519
Table 3. PCR primers 520
Primer Use Sequence (5’ ! 3’)
JCO39 Disrupt INO1 AAAAAAGGTACCGGGATCAAACAATCTAGACTCAC
JCO40 Disrupt INO1 AAAAAAGGGCCCAGTTATTTGTTTGTGAAGGAGAT
JCO41 Disrupt INO1 AAAAAACCGCGGTGTTGCTTTATAGTAATATCGCT
JCO42 Disrupt INO1 AAAAAAGAGCTCCGACAGCCCATATATTTTAATCG
JCO47 Restore INO1 AAAAGTCGACTGATTATTTGAGAATTCTTTC
JCO50 Restore INO1 AAACGTCGACACTGGATGG
TRO369 Confirm ino1# GCACGTCAAGACTGTCAAGG
JCO105 Confirm ino1# TTATCTATTGTCAATTTCGCC
JCO106 Confirm ino1# TGGGAGTTTAGTGTTTGAGC
JCO89 Disrupt ITR1 AAAAAAGGGCCCCTCAACAAATTGTCGATTAT
JCO90 Disrupt ITR1 AAAAAACTCGAGTTCCCTCAAATCAATACACT
JCO93 Disrupt ITR1 AAAAAAGCGGCCGCCTCAGTCTAGTATACTAAAT
JCO94 Disrupt ITR1 AAAAAAGCGGCCGCTGAAATACTTGAACTGTGTGA
JCO95 Confirm itr1# GATTATTAGTTAAACCACTGC
JCO96 Confirm itr1# TGAAGGGGGAGATTTTCACT
JCO100 Confirm itr1# AAACCCCCACTTGAGTCTAA
JCO101 Confirm itr1# TTGATCATTTGACCTCGGCA
JCO111 Restore ITR1 AAAAAAGAATTCGAGCTATACGGTTGGTTTCGA
JCO118 ITR1 conditional construct AAAAAACTGCAGAAAACTACGAACAATTGTC
JCO119 ITR1 conditional construct AAAAAAGCGGCCGCGTTTTCTGGGGAGGGTATTT
JCO120 ITR1 conditional construct AAAAAAGCGGCCGCATGGGAAGTTCAACCAATAA
JCO121 ITR1 conditional construct AAAAAACCGCGGCTATACGGTTGGTTTCGATT
JCO102 ITR1 Northern blot probe ACAATCAAAAGCTACCCCCA
JCO103 ITR1 Northern blot probe TGGTGTATCTGGTAAAAACCA
TRO562 INO1 Northern blot probe GAAAACTCTGTTGTTGAAAAAGATG
TRO563 INO1 Northern blot probe TTGTTGGCACGTTCACTTTG
JCO48 CaACT1 Northern blot probe CCAGCTTTCTACGTTTCC
JCO49 CaACT1 Northern blot probe CTGTAACCACGTTCAGAC
521
522
523
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 34
Figure legends 524
Figure 1. The INO1 gene was disrupted in C. albicans. (A) Structure of the INO1 disruption 525
construct. Approximately 500 base pairs of non-coding DNA flanking the 5’ and 3’ ends of the 526
INO1 gene (5’-and 3’-INO1NCR
, respectively) were cloned onto either flank of the CaNAT1-FLP 527
construct (39). The thick dark arrows represent the FRT target sites of the FLP recombinase. 528
The ball and stick represents the ACT1 terminator (ACT1t) and the thinner arrow on a raised line 529
represents the SAP2 promoter (PSAP2). (B) The INO1-NAT1 construct used to reintegrate INO1 530
into the ino1!/! mutant. (C) Southern blotting was used to confirm the INO1 disruptions. Lane 1 531
(wild-type); lane 2 (ino1#::NAT1-FLP/INO1), lane 3 (ino1#/INO1); lane 4 (ino1#/#:: 532
NAT1-FLP); lane 5 (ino1#/#); lane 6 (ino1#/#::INO1). (D) The INO1 gene is required for 533
growth in the absence of exogenous inositol. The cells were streaked onto medium containing 534
either 0 or 75µM inositol and grown for 2 days at 30°C. 535
536
Figure 2. The ITR1 gene was disrupted in C. albicans. (A) Structure of the ITR1 disruption 537
construct. Approximately 500 base pairs of non-coding DNA flanking the 5’ and 3’ ends of the 538
ITR1 gene (5’-and 3’-ITR1NCR
, respectively) were cloned into the pSFS2A plasmid such that 539
they flanked the SAT1 flipper cassette. The thick dark arrows represent the FRT target sights of 540
the FLP recombinase. The ball and stick represents the ACT1 terminator (ACT1t) and the 541
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 35
thinner arrow on a raised line represents the MAL2 promoter (PMAL2). (B) The ITR1-SAT1 542
construct used to reintegrate ITR1 into the itr1!/! mutant. (C) The PMET3::ITR1 construct used to 543
replace the ITR1 allele in the ino1!/! itr1!/ITR1 strain to generate the ITR1 conditional allele. 544
(D) Southern blotting was used to confirm the ITR1 disruptions. Lane 1 (wild-type); lane 2 545
(itr1#::SAT1-FLP/ITR1); lane 3 (itr1#/ITR1); lane 4 (itr1#/#::SAT1-FLP); lane 5 (itr1#/#); lane 546
6 (itr1#/#::ITR1-SAT1); lane 7 (ino1!/! itr1!/PMET3::ITR1). The itr1!::SAT1-FLP band 547
(disrupted allele prior to “flipping out” the SAT1-FLP construct) and ITR1-SAT1 band 548
(reintegrated ITR1 marked with SAT1) ran together on the gel. (E) Northern blotting revealed 549
that the expression of ITR1 was lost in the itr1!/! mutant, but not the wild-type, heterozygous, 550
and reconstituted strains. Strains were grown in defined medium 199 for 2hrs at 37°C, and RNA 551
was isolated, Northern blotted, and probed for ITR1 expression. ITR1 expression was 552
normalized to ACT1 expression on the same blot. 553
554
Figure 3. The ITR1 gene is required for inositol transport in C. albicans. The inositol uptake 555
assay revealed that the ability to import 3H-myo-inositol was greatly reduced in the itr1!/! 556
mutant, whereas the wild-type, heterozygous, and reconstituted strains exhibited the ability to 557
import inositol. Each strain was assayed at 0˚C (white bars) and 30˚C (black bars). 558
559
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 36
Figure 4. The INO1 and ITR1 genes show synthetic growth defects on agar plates. The growth of 560
wild-type, ino1!/! itr1!/ITR1, and two separately derived ino1!/! itr1!/PMET3::ITR1 strains 561
were compared in 5-fold serial dilutions on minimal medium containing 75µM inositol ± 2.5mM 562
methionine and cysteine. 563
564
Figure 5. The INO1 and ITR1 genes show synthetic defects in virulence. The survival of mice 565
was monitored following intravenous challenge with 106 C. albicans blastospores. (A) Mice 566
were injected with INO1 mutant strains. Wild-type (n=10); ino1!/! (YLC113, n=10); ino1!/! 567
(YLC126, n=11); ino1!/!::INO1 (n=10). (B) Mice were injected with ITR1 mutant strains. 568
Wild-type (n=5); itr1!/ITR1 (n=5); itr1!/! (n=10); itr1!/!::ITR1 (n=6). (C) Mice were injected 569
with ino1!/! itr1#/PMET3::ITR1 conditional double mutant strains. Wild-type (n=10); ino1!/! 570
itr1!/ITR1 (n=10); ino1!/! itr1!/PMET3::ITR1 (YLC261, n=10); ino1!/! itr1!/PMET3::ITR1 571
(YLC266, n=10). Strains for experiments A and B were pre-grown in YPD before the injection 572
while strains for experiment C were pre-grown in minimal medium-meth-cys
plus 75µM inositol. 573
574
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
C
ino1!::NAT1-FLP
INO1-NAT1INO1
ino1!
1 2 3 4 5 6
B
3’ INO1NCRINO1
5’ INO1NCR
Kpn I Sac ISal I
NAT1
D
0 µM inositol 75 µM inositol
INO1/
INO1
ino1!/
INO1
ino1!/!ino1!/!
::INO1
Figure 1
A
3’ INO1NCRPSAP2 ACT1t5’ INO1NCR
FLP NAT1
Kpn I Sac IApaI Sac II
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
D
B
3’ ITR1NCR5’ ITR1NCR
Apa I Sac IIEco RI
ITR1 SAT1
1 2 3 4 5 6 7
PMET3::ITR1
itr1!
itr1!::SAT1-FLP &
ITR1-SAT1
ITR1
ITR1
ACT1
E
WT
itr1!
/ITR
1
itr1!
/ !itr
1!/!
::ITR
1
100% 48% 3% 29%
Figure 2
ACT1t 3’ ITR1NCRPMAL2
A
5’ ITR1NCR
FLP SAT1
Apa I Sac IIPst I
C
ITR15’ ITR1NCR PMET3
Apa ISac IIPst I Not I
PMAL2 ACT1t
FLP SAT1
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Figure 3
Inosi
tol
upta
ke
(pm
ol/
10m
in/4
x10
6 c
ells
)
WT itr1!/ITR1 itr1!/! itr1!/!::ITR1
°C Temp0 30 0 30 0 30 0 30
0
5
10
15
20
25
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Figure 4
ino1!/! itr1!/PMET3::ITR1 (YLC261)
ino1!/! itr1!/PMET3::ITR1 (YLC266)
0 mM methionine and cysteine 2.5 mM methionine and cysteine
2x10
5
4x10
4
8x10
3
1.6x
103
3.2x
102
WT
ino1!/! itr1!/ITR1
2x10
5
4x10
4
8x10
3
1.6x
103
3.2x
102
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
A
B
C
Figure 5
0 2 4 6 8 10 12 14
0
20
40
60
80
100
WT
ino1!/! (YLC113)
ino1!/!::INO1
ino1!/! (YLC126)
Days post-infection
0 2 4 6 8 10 12 14
0
20
40
60
80
100
WT
itr1!/ITR1
itr1!/!
itr1!/!::ITR1
Days post-infection
0 3 6 9 12 15 18 21 24 27 30
0
20
40
60
80
100
WT
ino1!/! itr1!/ITR1
ino1!/! itr1!/PMET3::ITR1 (YLC261)
ino1!/! itr1!/PMET3::ITR1 (YLC266)
Days post-infection
ACCEPTED
on January 13, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Recommended