View
0
Download
0
Category
Preview:
Citation preview
1
Auranofin resistance in Toxoplasma gondii decreases the accumulation of 1
reactive oxygen species but does not target parasite thioredoxin reductase 2
3
4
Christopher I. Maa, James A. Tirtorahardjob, Sharon Janb, Sakura S. Schweizera, Shawn 5
A. C. Rosario1, Yanmiao Du1; Jerry J. Zhanga, Naomi S. Morrissettec and Rosa M. 6
Andradea,b# 7
8
a Department of Medicine, Division of Infectious Diseases, University of California Irvine 9
b Department of Microbiology and Molecular Genetics, University of California Irvine 10
c Department of Molecular Biology and Biochemistry, University of California Irvine, 11
12
Running title: Auranofin resistance in T. gondii 13
Keywords: gold, repurposing, anti-parasitic, resistance, redox, Toxoplasma, auranofin, 14
superoxide 15
#Address correspondence to Rosa Andrade, rmandra1@uci.edu 16
17
Shawn Rosario, Yanmiao Du; Jerry Zhang contributed equally to this work. Author order 18
was determined on the basis of seniority. 19
20
21
22
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
2
ABSTRACT: 23
Auranofin, a reprofiled FDA-approved drug originally designed to treat rheumatoid 24
arthritis, has emerged as a promising anti-parasitic drug. It induces the accumulation of 25
reactive oxygen species (ROS) in parasites, including Toxoplasma gondii. We generated 26
auranofin resistant T. gondii lines through chemical mutagenesis in order to identify the 27
molecular target of this drug. Resistant clones were confirmed with a competition assay 28
using wild-type T. gondii expressing yellow fluorescence protein (YFP) as a reference 29
strain. The predicted auranofin target, thioredoxin reductase, was not mutated in any of 30
our resistant lines. Subsequent whole genomic sequencing analysis (WGS) did not reveal 31
a consensus resistance locus, although many have point mutations in genes encoding 32
redox-relevant proteins such as superoxide dismutase (TgSOD2) and ribonucleotide 33
reductase. We investigated the SOD2 L201P mutation and found that it was not sufficient 34
to confer resistance when introduced into wild-type parasites. Resistant clones 35
accumulated less ROS than their wild type counterparts. Our results demonstrate that 36
resistance to auranofin in T. gondii enhances its ability to abate oxidative stress through 37
diverse mechanisms. This evidence supports a hypothesized mechanism of auranofin 38
anti-parasitic activity as disruption of redox homeostasis. 39
40
41
42
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
3
INTRODUCTION 43
For more than 50 years, the mainstay of treatment for acute toxoplasmosis has 44
been a combination of a dihydrofolate reductase inhibitor and a sulfa antimicrobial. 45
While this is currently a critical therapeutic strategy, currently approved drugs cannot 46
eliminate latent parasites in cysts that are found in chronically infected individuals. 47
Moreover, these drugs have significant bone marrow toxicity, are suspected teratogens 48
and the emergence of resistance remains a potential threat to treatment. Repurposing 49
FDA-approved drugs will accelerate drug discovery for neglected parasitic diseases. 50
Most recently, auranofin, a reprofiled drug that is FDA-approved for treatment of 51
rheumatoid arthritis, has emerged as a promising anti-parasitic agent. It has 52
antiproliferative activity against Plasmodium falciparum (1) , Schistosoma mansoni (2), 53
Leishmania infantum (3) and Entamoeba histolytica (4) as well as other parasites with 54
public health significance (5-11). Despite this promising broad spectrum of anti-parasitic 55
activity, the molecular target of auranofin has only been indirectly implicated as 56
thioredoxin reductase. 57
Thioredoxin reductase enzymes are found in archaea, bacteria and diverse 58
eukaryotes and play a key role in reduction of disulfide bonds that is essential for cell 59
replication and survival. Inhibition of human thioredoxin reductase 1 induces expression 60
of heme oxygenase-1 to repress inflammation(12). We previously demonstrated that 61
auranofin reduces T. gondii infection of host cells in vitro and a single dose of auranofin 62
allows survival of chicken embryos infected with this parasite (13). It is hypothesized 63
that the anti-parasitic activity of auranofin comes from inhibition of the thioredoxin 64
reductase enzyme of these parasites, akin to its action on human cells (4, 8, 14). This 65
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
4
postulated mechanism of action explains why parasites treated with auranofin 66
accumulate ROS (4). Intriguingly, auranofin may improve infection outcome by 67
decreasing pathogenic host inflammatory damage in addition to its direct inhibition of 68
parasite replication. 69
In this paper we describe our work to investigate resistance to auranofin in T. 70
gondii parasites. This approach illuminates mechanisms of resistance that might arise 71
during its use as an anti-parasitic. In some circumstances, identification of resistance 72
mechanisms validates proposed drug targets (i.e.(15)). In this study, we found that 73
resistance was not associated with changes to the Toxoplasma thioredoxin reductase 74
gene and no other single locus emerged as a consistent site underlying resistance. 75
However, we observed that resistant clones accumulated less ROS than their wild type 76
counterparts, demonstrating that auranofin resistance enhances oxidative stress 77
responses. 78
79
MATERIAL AND METHODS 80
1. Host cell and parasite cultures: 81
Parasite clones and human foreskin fibroblasts (HFF) were grown and 82
maintained in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine 83
serum (Hyclone), penicillin and streptomycin (50 μg/ml each) and 200 μM L-glutamine. 84
We will refer to this complete medium as D10. T. gondii were maintained by serial 85
passage in HFF monolayers at 37°C in a humid 5% CO2 atmosphere, including RH 86
parasites (National Institutes of Health AIDS Reference and reagent Repository, 87
Bethesda, MD), RH tachyzoites expressing cytoplasmic yellow fluorescent protein 88
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
5
(YFP) (kindly provided by M.J. Gubbels, Boston College, Boston, Massachusetts) (16) 89
and Ku80 parasites knock-out parasites (ΔKu80, kindly provided by V. Carruthers, 90
University of Michigan Medical School Dexter, Michigan) (17, 18). 91
92
2. Generation of T. gondii clones resistant to auranofin: 93
We mutagenized T. gondii with ENU as previously described (19, 20). Briefly, 94
approximately 1.5x107 intracellular tachyzoites of wild-type RH strain T. gondii were 95
mutagenized with ENU (N-Ethyl-N-nitrosourea, N3385-1G, Sigma Aldrich; 100-200 96
µg/ml) in DMEM without FBS for 2 hours at 37°C. These parasites were washed and 97
transferred to a new confluent HFF monolayer for selection with auranofin (2.5 μM-3 98
μM) until normal pace of replication was observed (~2 weeks). Auranofin resistant 99
clones were single cell cloned by limiting dilution in 2 μM auranofin. Isolated clones 100
were propagated in D10 media with 1 μM auranofin to maintain selection pressure 101
without cytotoxic effects on host cells (data not shown). 102
We selected ten representative T. gondii clones from independent ENU-103
generated pools to investigate resistance. To assess auranofin resistance, we modified 104
a tachyzoite growth competition assay (21). Using wild-type YFP-expressing T. gondii 105
parasites as a control, confluent monolayers of HFF cells were inoculated with 106
approximately equal numbers (2x106; 1:1 ratio) of ENU-mutagenized parasites and 107
YFP- expressing wild-type RH parasites. Upon lysis, a new T25 flask with confluent 108
HFF was inoculated with 0.25 ml of lysed parasites. Another 0.25 ml of lysed parasites 109
was used for flow cytometry. The YFP fluorescence allowed us to differentiate wild-type 110
and AurR parasites in the mixed populations to track their growth over serial passages. 111
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
6
Host cell debris was removed by filtering of parasites with a 3 μm filter membrane. After 112
parasites were collected by centrifugation (400g for 10 min), the pellet was resuspended 113
in 1 ml PBS. The total number of parasites and the number of parasites expressing YFP 114
were quantified by flow cytometry using a FACSCalibur flow cytometer (Becton 115
Dickinson) and analyzed with Flowjo software (Tree Star). The result of three 116
independent experiments analyzing the replication fitness advantage between each 117
auranofin resistant clone and the wild-type parasites was analyzed with parametric 118
paired t-tests. A two-tailed p-value
7
gDNA was sheared to bp in size using a Covaris S220 ultrasonicator 135
(shearing conditions: duty Cycle 10%, Cycles/ burst 200 and treatment time 55 sec) 136
(Covaris, MA). The size and the quality of the resulting DNA fragments were analyzed 137
with an Agilent DNA High Sensitivity chip. Ten nanograms of each sample’ s 138
fragmented DNA was end-repaired, poly adenylated and ligated to a 6bp DNA barcodes 139
(Bioo Scientific NextFlex DNA barcodes) using a PrepX Complete ILMN DNA Library kit 140
(Takara Bio, CA). The genomic library was built using the Apollo 324 system (Takara 141
Bio, CA) to generate 520 bps inserts. To enrich the DNA libraries, 8 cycles of PCR 142
amplification using a Kapa library amplification kit was used (cycling conditions: 98°C for 143
45 s, 8 cycles of 98°C for 15 sec, 60°C for 30 s 72° C for 30 s and then 72°C for 1 min) 144
in an Apollo 324 system. The ultimate DNA concentration was calibrated using Qubit 145
2.0 dsDNA HS Assay kit and analyze with an Agilent DNA High Sensitivity chip. Before 146
sequencing, we quantified our DNA libraries using a KAPA Library Quantification kit for 147
Illumina platforms (Roche). Each library was normalized to 2nM and then pooled 148
equimolar amounts in the final multiplex library that was sequenced on the Illumina 149
HiSeq 4000. 150
The ten auranofin resistant T. gondii clones and wild-type RH T.gondii were 151
sequenced with HiSeq 4000 paired end 100 reads, quality analyzed, adapter and quality 152
trimmed before alignment with the annotated reference genome of GT1 strain from 153
ToxoDB.org (published 7/19/2013)(22). After initial quality control with FASTQC, reads 154
were trimmed using Illumina adapter sequences with the error probability of 0.05 and 155
reads shorter than 20 bases were discarded. Single Nucleotide Variant (SNV) calling for 156
the haploid genome had a coverage threshold of >5 fold. Each of the 10 mutant clones 157
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
8
were compared to wild-type RH variant track and shared variants were filtered out. Only 158
SNVs in the coding regions of the 10 mutant clones are reported. Only genes containing 159
SNVs with 100 % frequency and ≥50% of read count and read coverage were 160
considered in our final analysis. Genomic DNA from each mutant clone was used to 161
amplify the targeted SNV region of interest. The resulting amplicons ranged between 162
1.7-4.5kbp in size. PCR amplicons were purified prior to sequencing via a QiaQuick 163
PCR Purification Kit (Qiagen 28106). Amplicons were sequenced by Sanger 164
sequencing (Genewiz), using sequencing primers targeted to the SNV region (Table S1) 165
166
4. Generation of modified SOD2 lines: 167
We generated a T. gondii clone with a 3’ knock-in YFP tag to TgSOD2 using a 168
ligation independent cloning approach as previously described (17). The mitochondrial 169
distribution of our clone was confirmed by fluorescent microscopy using a Zeiss 170
Axioskop with Axiovision camera and software. We subsequently introduced the L201P 171
mutation into the TgSOD2-YFP line using a modified CRISPR plasmid generated using 172
plasmid pSAG1::CAS9-U6::sgUPRT as the scaffold (23); Addgene # 54467). Our 173
plasmid had an additional DHFR-TM marker for pyrimethamine selection derived from 174
pLoxP-DHFR-mCherry ((24), Addgene # 70147), and the two gRNA sequences were 175
replaced with CGGTATACCGGACAGATCCG and TAGTTTCGCCCAGTTCAAGG, 176
selected by the Benchling software (Benchling.com). 177
The DNA sequence used for homology directed repair (HDR) was amplified with 178
the primers GATAGTGTGTGAAGAGCAGC and CTGCCGTTACCAACATGG from the 179
LIC-YFP-SOD2 plasmid generated above. PCR amplicon contained the L201P mutation 180
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
9
(CTA->CCA) generated with Q5 Site-Directed Mutagenesis kit (New England Biolab), as 181
with the following modifications. To screen for positive CRISPR-Cas9 clones containing 182
L201P, two silent mutations were created to generate new and unique restriction 183
endonuclease sites close to Leucine 201: AflI on Leucine 180 (CTC->CTT, 62 bps 184
upstream of L201P) and XcmI on Serine 208 (TCA->TCT, 22 bps downstream of 185
L201P). The PCR amplicon contained two additional deletions corresponding to the 186
gRNA sites on endogenous SOD2 gene, in order to avoid SpCas9 protein cleaving the 187
amplicon for HDR. The sequence agagacccggcgg (including the PAM sequence cgg) 188
was deleted on the HDR sequence corresponding to gRNA #1, and sequence 189
cacttaacagagggtc (including the PAM sequence agg) was deleted on the HDR 190
sequence corresponding to gRNA #2. 191
The L201P point mutation was introduced into the TgSOD2.YFP line through 192
CRISPR-Cas9 (Figure S1). Transfection of the CRISPR-CAS9 plasmid and the HDR 193
DNA was carried out as published previously, with minor modifications (23). Briefly, 107 194
of freshly lysed parasites with SOD2-YFP were filtered and spun down at 400xg and 195
18⁰C for 10 min. The pellet was resuspended with Cytomix buffer (10 mM KPO4, 120 196
mM KCl, 5 mM MgCl2, 25 mM HEPES, 2 mM EDTA, 2µM ATP and 5µM glutathione) up 197
to 800µl, including 7.5µg of CRISPR plasmid and 1.5µg of HDR DNA. The mixture was 198
transfected using the ECM 630 Electro Cell Manipulator (BTX). Parasites were 199
incubated into T25 flasks after electroporation and switched to 2 μM pyrimethamine 200
selection 24 hours later. Transfected pools remained in pyrimethamine selection for 3 201
days, and then switched to D10 media without selection for one more day before single 202
cell cloning. The gDNA for isolated clones were collected by the DNeasy Blood and 203
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
10
Tissue kit (Qiagen) and used to PCR amplify SOD2 with either primers SOD2 F/AmpR 204
(for SOD2-YFP) or primers SOD E2/SOD R (for SOD2 only, Table S1). PCR amplicons 205
were digested with XcmI for screening and positive clones were sequence verified. 206
207
5. Measurement of ROS accumulation in T. gondii: 208
To expose our parasites to oxidative stress, we harvested freshly lysed parasites 209
and treated 5x104 parasites with 500 μM hydrogen peroxide (H2O2) for 30 min at 37⁰C, 210
5% CO2, with or without 1 μM auranofin After incubation, ROS was detected using 211
H2DCDFC (Invitrogen). Each sample was incubated with 1 µM of H2DCDFC and 212
examined under a Spectramax i5, (Molecular Devices California US; multimode 213
microplate reader SoftMax Pro 7.0.2 Software) multimode microplate reader (excitation 214
494 nm; emission 522 nm) at 37⁰C for 15 minutes. For excitation, a single flash from a 215
UV Xenon lamp was used for each well, and emission signals were recorded with a 216
sensitivity setting of 100. The values are presented as relative fluorescence units. We 217
compared ROS accumulation of each representative auranofin resistant T. gondii clone 218
to that of wild-type parasites by an unpaired t-test in three independent experiments. A 219
two-tailed p-value
11
RNR (PDB 3HND) (31). Clustal Omega was used to align the amino acid sequences 227
and EMBOSS was used to calculate percent identity and similarity. Information on MS 228
peptide coverage was obtained from the ToxoDB database (22). 229
230
RESULTS 231
1. AurR T. gondii lines have a growth advantage over wild type parasites: 232
To verify auranofin resistance of the selected clones, we adapted a previously 233
described competition assay (21). This was used in place of a normal dose-response 234
assay because at auranofin concentrations higher than 3 μM, the fibroblast monolayer 235
begins to disrupt (data not shown) making the plaque assays not feasible. To confirm 236
resistance to auranofin in the AurR T. gondii lines, we assessed their growth in 237
competition with YFP-expressing RH strain parasites in control media and in media with 238
2.5-3.0 μM auranofin. In competition assays, the inoculating parasite population is 239
composed of 50% YFP-expressing wild type (sensitive) parasites and 50% of an AurR 240
line verified by flow cytometry. The relative contribution of the individual populations was 241
measured after each cycle of lytic growth in serial culture. If a parasite line increases to 242
>50% of the population, it exhibits a growth advantage over the competing line. In the 243
absence of auranofin, AurR lines grew comparably or less well than the parental RH line 244
that does not express YFP (Figure 1A). However, in the presence of 2.5 μM auranofin, 245
all AurR lines displayed significant growth advantage over YFP-expressing wild-type RH 246
parasites (Figure 1B). The observations indicated that day 6 is the optimal day to 247
capture the growth advantage of resistant lines under auranofin selection because YFP-248
expressing wild-type parasites were eliminated from the culture. Given these results, we 249
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
12
measured the ability of a larger set of AurR lines to compete with wild-type YFP-250
expressing RH strain parasites in the absence or presence of auranofin by quantifying 251
their contribution to the culture at 6 days (Figure 2). These results show that 9 of the 10 252
AurR lines outcompete the sensitive YFP-expressing RH line in the presence of 2.5 μM 253
auranofin. Line 6 has a distinct profile: it grows slowly in both control and auranofin 254
media, suggesting that it may evade auranofin-mediated killing by protracted replication. 255
256
2. AurR lines do not harbor mutations in the thioredoxin reductase gene: 257
Considering that thioredoxin reductase (1-4) is the proposed target of auranofin, 258
we hypothesized that resistance in T. gondii would develop through mutations to the 259
parasite thioredoxin reductase gene (TgTrxR, TGGT1_309730). Therefore, we amplified 260
and sequenced the TgTrxR gene in 53 lines derived from parallel (independent) 261
selections (not shown). We did not detect mutations (SNVs) in the thioredoxin reductase 262
gene of any of the lines, indicating that auranofin resistance does not arise through 263
modifications to TgTrxR that directly influence auranofin binding or TgTrxR enzyme 264
activity. 265
266
3. AurR lines accumulate less ROS: 267
The anti-parasitic activity of auranofin relies on its ability to induce accumulation 268
of ROS in parasites (4). We exposed wild type RH strain parasites and four 269
representative AurR lines to hydrogen peroxide (H2O2) for 30 minutes before measuring 270
ROS accumulation with dichloro-fluorescein (H2DCDFC). All AurR lines displayed 271
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
13
decreased accumulation of ROS relative to the parental RH line in both the absence 272
and presence of auranofin (Figure 3). 273
274
4. AurR lines harbor diverse mutations that introduce point mutations: 275
Given that we did not observe mutations in T. gondii thioredoxin reductase, we 276
performed whole genome sequencing (WGS) analysis of 10 independent T. gondii AurR 277
lines. Our goal was to determine whether these T. gondii parasites harbor a common 278
mutation(s) that underlies resistance to auranofin. Analysis of coding sequences with 279
100% SNVs frequency and at least 50-fold coverage identified a variety of ~5 non-280
synonymous SNVs in the exons of each line. Selected SNVs observed in the WGS 281
were validated by PCR amplification and Sanger sequencing (primers in Table S1). We 282
chose to specifically investigate the AurR line 8 to consider which SNV was most likely 283
to underlie auranofin resistance. Line 8 has 12 SNVs that introduce amino acid 284
substitutions to diverse protein coding genes (Table 1). We used the community 285
annotated ToxoDB database and BLAST analysis to investigate these loci. In particular, 286
the availability of RNA-seq datasets permitted us to evaluate whether loci were 287
expressed in the tachyzoite stage. In order to assess the significance of expressed loci, 288
we used BLAST analysis to look for protein homologs and significant motifs and 289
collected RNA-seq values and CRISPR screen scores for available loci. This 290
information led us to focus on 2 of the loci (TGGT1_316330 and TGGT1_294640) as 291
most likely resistance conferring. These loci encode a superoxide dismutase (SOD2) 292
and the large subunit (R1) of ribonucleotide reductase (RNR). Both enzymes have 293
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
14
strong fitness conferring effects in the deposited CRISPR screen data and well-294
conserved metabolic roles. 295
RNR removes the 2'-hydroxyl group of the ribose ring of nucleoside diphosphates 296
to form deoxyribonucleotides from ribonucleotides which are used in DNA synthesis 297
while SOD inactivates damaging superoxide (O2−) radicals by converting them into 298
molecular oxygen and hydrogen peroxide. Since both TgRNR and TgSOD2 are 299
conserved proteins, we threaded the amino acid sequence onto homologous crystal 300
structures to locate the position of the amino acid substitutions. TgSOD2 is a Fe-type 301
SOD and was previously demonstrated to localize to the tachyzoite mitochondrion (32, 302
33). SODs form dimers with shared coordination of two iron (FeIII) cofactors. The L201P 303
mutation is located near to the key iron-coordinating residues: H111, E249 and H160 304
(Figure 4A) and is located in an α-helix. Substitution of a proline at this site likely causes 305
the helix to bend, perhaps altering SOD enzymatic properties. TgRNR aligns well with 306
human ribonucleotide reductase 1 (61.7% identity and 78.2% similarity). However, there 307
is a 59 amino acid N-terminal extension to the Toxoplasma protein, with the conserved 308
sequence beginning with M60 (Figure 4B). This leader does not represent mis-309
annotation of the N-terminus of the protein: there are MS peptides mapping to this 310
sequence, especially in samples that are from monomethylarginine and 311
phosphopeptide-enriched datasets in ToxoDB. This is particularly interesting as arginine 312
methylation is a modification associated with proteins that have roles in transcriptional 313
regulation, RNA metabolism and DNA repair. RNR use free-radical chemistry to convert 314
ribonucleotides into deoxyribonucleotides. Significantly, ribose reduction requires 315
generation of a free radical and RNR requires electrons donated from thioredoxin. 316
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
15
Moreover, superoxide has been shown to inactivate RNR and yeast lacking either 317
cytoplasmic or mitochondrial SODs have increased susceptibility to oxidative stress and 318
RNR inactivation. The L166Q mutation is in a solvent exposed loop (Figure 4C), that is 319
poorly conserved and not known to contribute to enzyme interactions. 320
321
4. Resistance to auranofin is not conferred by an isolated mutation in TgSOD2: 322
The anti-parasitic effect of auranofin appears to stem from its molecule of gold, 323
which is known to induce the accumulation of ROS in parasites (4, 34). Since we 324
hypothesized that a single mutation (SNV) suffices to generate resistance to auranofin, 325
we analyzed the effect of the TgSOD2 L201P mutation on auranofin sensitivity. SOD2 is 326
a bona fide enzymatic ROS scavenger and SOD2 is the sole mitochondrial superoxide 327
dismutase in tachyzoites. To analyze the role of mutant SOD2 in auranofin resistance, 328
we generated a T. gondii clone with a knock-in YFP tag for SOD2, that localizes to the 329
tachyzoite mitochondrion as previously reported (Figure 5A). Subsequently, we 330
generated two T. gondii SOD2.L201P lines: one lacking the YFP tag and one tagged 331
with a C-terminal YFP fusion (Figure S1). Both lines were corroborated by Sanger 332
sequencing. In the absence of Auranofin, both L201P lines grew less well than the 333
TgSOD2-YFP wild-type line but were more fit than AurR line 8 (Figure 5B). Previous 334
attempts to create SOD1 and SOD2 gene deletions failed (35) and SOD2 is a fitness-335
conferring locus in a genome-wide CRISPR/Cas screen (36). It is noteworthy that the 336
L201P mutation is associated with reduced fitness in the absence of superoxide stress 337
(control conditions). In the presence of auranofin, only line 8 grows well, indicating that 338
the single L201P mutation to TgSOD2 does not confer resistance. This may indicate 339
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
16
that this substitution does not influence superoxide metabolism at all or that auranofin 340
resistance also requires the mutant TgRNR enzyme. It is unlikely that these enzymes 341
directly interact, as RNR enzymes are cytosolic while TgSOD2 is in the mitochondrial 342
compartment. However, the SOD2.L201P T. gondii line accumulated ROS similarly to 343
wild-type parasites, consistent with its auranofin-sensitive growth (Figure 5C). 344
345
Discussion: 346
Auranofin, is an FDA-approved drug for treatment of rheumatoid arthritis. More 347
recently it has been proposed to be a promising anti-parasitic agent with activity against 348
diverse parasites with public health significance. We previously demonstrated that 349
auranofin decreases the parasite burden during a systemic infection with T. gondii using 350
a chicken embryo model of acute toxoplasmosis (13). Our preliminary observations 351
suggest that auranofin exerts a dual effect: it modulates both parasite proliferation and 352
host immunopathology. Thioredoxin reductase has been implicated to be the molecular 353
target of auranofin in parasites. Herein, we report isolation and characterization of 354
auranofin-resistant T. gondii lines. None of our resistant lines has mutations in the 355
thioredoxin reductase gene. This may indicate that this enzyme is not the molecular 356
target of auranofin in T. gondii; alternately, it may indicate that thioredoxin reductase 357
cannot tolerate resistance-conferring mutations or is not the sole significant target in this 358
organism. Each of our auranofin resistant T. gondii lines carry several mutations 359
(SNVs). Importantly, resistant lines accumulate less reactive oxygen species (ROS) 360
than wild-type parasites. 361
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
17
There are several approaches to target identification in drug discovery. In T. 362
gondii, chemical mutagenesis is a well-established and robust approach (i.e. (15, 19) to 363
identify the molecular targets of candidate anti-T. gondii drugs. This approach is also 364
relevant to anticipating mechanisms of drug resistance. We isolated auranofin-resistant 365
T. gondii lines derived from the RH strain. Resistant lines have increased replication 366
relative to wild type RH parasites in competition assays carried out in the presence of 367
auranofin. Lines with ≤5 accumulated SNVs (lines 1-4) appear to have a growth 368
advantage over wild-type parasites in the absence auranofin. This probably reflects a 369
fitness defect induced by expression of YFP in wild type parasites (21) ; these lines 370
likely grow comparably to non-YFP expressing wild type parasites without auranofin 371
present. In contrast, resistant lines that have >5 SNVs each compete poorly with wild 372
type parasites in the absence of selection, suggesting that accumulation of SNVs 373
comes at a cost to parasite fitness. An alternative explanation to the isolation of multiple 374
SNVs in each resistant clone is that auranofin interferes with many processes and 375
development of resistance requires alterations to more than one target. 376
Auranofin contains a molecule of gold in a 3,4,5-Triacetyloxy-6-sulfanyl-oxan-2-yl 377
methyl ethanoate scaffold and has been proposed to be a pro-drug (37) that delivers 378
gold to dithiol groups, like those found in proteins that bear thioredoxin-containing 379
domains (38). Although auranofin inhibits mammalian thioredoxin reductase (39), the 380
source of its anti-inflammatory activity remains ill-defined and may reflect inhibition of 381
multiple targets. For example, macrophages decrease production of nitric oxide and 382
pro-inflammatory cytokines in response to auranofin, which also inhibits 383
cyclooxygenase-2 -dependent prostaglandin E2 production (40). Previous studies using 384
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
18
the parasite enzymes trypanothione reductase and glutathione-thioredoxin reductase 385
incubated with auranofin demonstrated that co-crystals harbor gold bound to reactive 386
cysteines in these proteins (2, 3, 41) In addition, S. mansoni worms with decreased 387
expression of thioredoxin glutathione reductase (SmTGR) exhibit diminished parasite 388
viability upon exposure to auranofin. E. histolytica treated with auranofin upregulate 389
transcripts of a gene encoding a protein resembling an arsenite-inducible RNA-390
associated protein (AIRAP) (4). Interestingly, both arsenite and auranofin are inhibitors 391
of thioredoxin reductase, implying that EhTrxR is a target of auranofin. Studies in both 392
S. mansoni and E. histolytica corroborated the interaction of thioredoxin reductase with 393
auranofin by mobility shift assays or other in vitro measures (4, 14). In these cases, the 394
approach involved target validation guided by the chemical properties of gold rather 395
than target identification through genetic resistance. 396
It was surprising to not identify changes to the thioredoxin reductase gene, given 397
previous studies that implicate antioxidant enzymes containing thioredoxin or 398
thioredoxin-like domains as a target for auranofin in parasites. However, although S. 399
mansoni and E. histolytica thioredoxin reductase antioxidant systems are essential for 400
survival, a previous study indicates that T. gondii thioredoxin reductase is not essential 401
(42). It should be noted that infection with 106 TgTrxR knockout parasites increases 402
survival in mice by approximately 2 weeks relative to the parental RH line (42). In vitro, 403
the null line exhibits reduced antioxidant capacity, invasion efficiency, and proliferation. 404
These observations are in-line with the CRISPR fitness score for thioredoxin reductase 405
(-1.98) which places it as fitness-conferring but not essential. 406
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
19
Among the significant SNVs found in our auranofin resistant T. gondii clones, we 407
directed our attention at a point mutation to the superoxide dismutase 2 (SOD2) gene. 408
SOD2 is a bona fide enzymatic antioxidant system that catalyzes the dismutation of 409
superoxide anions into hydrogen peroxide and oxygen. The Toxoplasma genome 410
contains three SOD genes. TgSOD1 is expressed in the cytoplasm of tachyzoites and 411
TgSOD2 is located in the mitochondrion; TgSOD3 is specifically expressed in oocysts. 412
TgSOD2 is a critical enzyme for tachyzoite survival: previous efforts to generate a 413
TgSOD2 knockout line were not successful and its CRISPR fitness score for (-4.09) 414
indicates that it is strongly fitness conferring and likely essential (35). We hypothesized 415
that the L201P mutation in TgSOD2 might increase its capacity to convert superoxide 416
into hydrogen peroxide and oxygen to confer auranofin resistance. To test this 417
hypothesis, we generated several lines that harbor knock-in tag to wild type SOD2 and 418
engineered both YFP-tagged and untagged lines that bear the L201P mutation. 419
Consistent with previous characterization of TgSOD2 (32), both wild type and L201P 420
TgSOD2-YFP lines exhibit a mitochondrial distribution. However, neither the tagged or 421
untagged L201P TgSOD2 lines exhibit increased growth in 2.5 uM auranofin, indicating 422
that the single TgSOD2 mutation cannot confer resistance to this level of auranofin or 423
reduce accumulation of ROS in our assay. 424
In addition to the L201P TgSOD2 mutation, AurR line 8 harbors a mutation in the 425
large subunit of TgRNR, an essential enzyme which generates deoxyribonucleotides 426
that are required for genome duplication and parasite replication. TgRNR has a 59 427
amino acid N-terminal extension relative to other RNRs. Peptides from this extension 428
are represented in phosphorylated and monomethylated MS datasets, suggesting that 429
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
20
this domain may regulate RNR activity. RNRs perform free-radical chemistry, require 430
electrons donated from thioredoxin and are susceptible to superoxide inactivation. 431
Although the L166Q mutation is in an area that is not known to contribute to enzyme 432
interactions, it may play a role diminishing TgRNR susceptibility to superoxide 433
inactivation. While this mutation may indirectly contribute to resistance to superoxide, 434
RNR enzymes do not directly contribute to redox homeostasis and the observed 435
reduced accumulation of ROS in the AurR lines. 436
Our previous and current findings suggest that auranofin decreases T. gondii viability 437
through oxidative stress (13). AurR lines exhibit an increased ability to scavenge ROS. 438
The genetic studies presented here did not identify a consistent mechanism for 439
acquisition of resistance by point mutations to a specific protein target. Our future 440
studies will examine whether there are transcriptional, translational or post-translational 441
changes that contribute to auranofin resistance in these lines. For example, difference-442
gel electrophoresis and mass spectrometry have been used to identify differentially 443
expressed proteins in sulfadiazine-resistant T. gondii isolates. While it was 444
disappointing to not identify a single molecular target for auranofin in T. gondii in our 445
studies, this result likely indicates that an enhanced ability to scavenge ROS in the 446
presence of auranofin requires multiple changes to the parasite genome. Therefore, if 447
auranofin is repurposed as an anti-parasitic treatment, it would likely present an 448
increased threshold to resistance in clinical contexts. 449
450
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
21
REFERENCES 451
1. Sannella AR, Casini A, Gabbiani C, Messori L, Bilia AR, Vincieri FF, Majori G, 452 Severini C. 2008. New uses for old drugs. Auranofin, a clinically established 453 antiarthritic metallodrug, exhibits potent antimalarial effects in vitro: Mechanistic 454 and pharmacological implications. FEBS Lett 582:844-7. 455
2. Angelucci F, Sayed AA, Williams DL, Boumis G, Brunori M, Dimastrogiovanni D, 456 Miele AE, Pauly F, Bellelli A. 2009. Inhibition of Schistosoma mansoni 457 thioredoxin-glutathione reductase by auranofin: structural and kinetic aspects. J 458 Biol Chem 284:28977-85. 459
3. Ilari A, Baiocco P, Messori L, Fiorillo A, Boffi A, Gramiccia M, Di Muccio T, Colotti 460 G. 2012. A gold-containing drug against parasitic polyamine metabolism: the X-461 ray structure of trypanothione reductase from Leishmania infantum in complex 462 with auranofin reveals a dual mechanism of enzyme inhibition. Amino Acids 463 42:803-11. 464
4. Debnath A, Parsonage D, Andrade RM, He C, Cobo ER, Hirata K, Chen S, 465 Garcia-Rivera G, Orozco E, Martinez MB, Gunatilleke SS, Barrios AM, Arkin MR, 466 Poole LB, McKerrow JH, Reed SL. 2012. A high-throughput drug screen for 467 Entamoeba histolytica identifies a new lead and target. Nat Med 18:956-60. 468
5. da Silva MT, Silva-Jardim I, Portapilla GB, de Lima GM, Costa FC, Anibal Fde F, 469 Thiemann OH. 2016. In vivo and in vitro auranofin activity against Trypanosoma 470 cruzi: Possible new uses for an old drug. Exp Parasitol 166:189-93. 471
6. Hopper M, Yun JF, Zhou B, Le C, Kehoe K, Le R, Hill R, Jongeward G, Debnath 472 A, Zhang L, Miyamoto Y, Eckmann L, Land KM, Wrischnik LA. 2016. Auranofin 473 inactivates Trichomonas vaginalis thioredoxin reductase and is effective against 474 trichomonads in vitro and in vivo. Int J Antimicrob Agents 48:690-694. 475
7. Peroutka-Bigus N, Bellaire BH. 2019. Antiparasitic Activity of Auranofin against 476 Pathogenic Naegleria fowleri. J Eukaryot Microbiol 66:684-688. 477
8. Tejman-Yarden N, Miyamoto Y, Leitsch D, Santini J, Debnath A, Gut J, 478 McKerrow JH, Reed SL, Eckmann L. 2013. A reprofiled drug, auranofin, is 479 effective against metronidazole-resistant Giardia lamblia. Antimicrob Agents 480 Chemother 57:2029-35. 481
9. Bulman CA, Bidlow CM, Lustigman S, Cho-Ngwa F, Williams D, Rascon AA, Jr., 482 Tricoche N, Samje M, Bell A, Suzuki B, Lim KC, Supakorndej N, Supakorndej P, 483 Wolfe AR, Knudsen GM, Chen S, Wilson C, Ang KH, Arkin M, Gut J, Franklin C, 484 Marcellino C, McKerrow JH, Debnath A, Sakanari JA. 2015. Repurposing 485 auranofin as a lead candidate for treatment of lymphatic filariasis and 486 onchocerciasis. PLoS Negl Trop Dis 9:e0003534. 487
10. Debnath A, Ndao M, Reed SL. 2013. Reprofiled drug targets ancient protozoans: 488 drug discovery for parasitic diarrheal diseases. Gut Microbes 4:66-71. 489
11. Martinez-Gonzalez JJ, Guevara-Flores A, Alvarez G, Rendon-Gomez JL, Del 490 Arenal IP. 2010. In vitro killing action of auranofin on Taenia crassiceps 491 metacestode (cysticerci) and inactivation of thioredoxin-glutathione reductase 492 (TGR). Parasitol Res 107:227-31. 493
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
22
12. Kobayashi H, Takeno M, Saito T, Takeda Y, Kirino Y, Noyori K, Hayashi T, Ueda 494 A, Ishigatsubo Y. 2006. Regulatory role of heme oxygenase 1 in inflammation of 495 rheumatoid arthritis. Arthritis Rheum 54:1132-42. 496
13. Andrade RM, Chaparro JD, Capparelli E, Reed SL. 2014. Auranofin is highly 497 efficacious against Toxoplasma gondii in vitro and in an in vivo experimental 498 model of acute toxoplasmosis. PLoS Negl Trop Dis 8:e2973. 499
14. Kuntz AN, Davioud-Charvet E, Sayed AA, Califf LL, Dessolin J, Arner ES, 500 Williams DL. 2007. Thioredoxin glutathione reductase from Schistosoma 501 mansoni: an essential parasite enzyme and a key drug target. PLoS Med 4:e206. 502
15. McFadden DC, Tomavo S, Berry EA, Boothroyd JC. 2000. Characterization of 503 cytochrome b from Toxoplasma gondii and Q(o) domain mutations as a 504 mechanism of atovaquone-resistance. Mol Biochem Parasitol 108:1-12. 505
16. Gubbels MJ, Li C, Striepen B. 2003. High-throughput growth assay for 506 Toxoplasma gondii using yellow fluorescent protein. Antimicrob Agents 507 Chemother 47:309-16. 508
17. Huynh MH, Carruthers VB. 2009. Tagging of endogenous genes in a 509 Toxoplasma gondii strain lacking Ku80. Eukaryot Cell 8:530-9. 510
18. Fox BA, Ristuccia JG, Gigley JP, Bzik DJ. 2009. Efficient gene replacements in 511 Toxoplasma gondii strains deficient for nonhomologous end joining. Eukaryot 512 Cell 8:520-9. 513
19. Nagamune K, Moreno SN, Sibley LD. 2007. Artemisinin-resistant mutants of 514 Toxoplasma gondii have altered calcium homeostasis. Antimicrob Agents 515 Chemother 51:3816-23. 516
20. Pfefferkorn ER, Pfefferkorn LC. 1979. Quantitative studies of the mutagenesis of 517 Toxoplasma gondii. J Parasitol 65:364-70. 518
21. Ma C, Tran J, Li C, Ganesan L, Wood D, Morrissette N. 2008. Secondary 519 mutations correct fitness defects in Toxoplasma gondii with dinitroaniline 520 resistance mutations. Genetics 180:845-56. 521
22. Gajria B, Bahl A, Brestelli J, Dommer J, Fischer S, Gao X, Heiges M, Iodice J, 522 Kissinger JC, Mackey AJ, Pinney DF, Roos DS, Stoeckert CJ, Jr., Wang H, 523 Brunk BP. 2008. ToxoDB: an integrated Toxoplasma gondii database resource. 524 Nucleic Acids Res 36:D553-6. 525
23. Shen B, Brown K, Long S, Sibley LD. 2017. Development of CRISPR/Cas9 for 526 Efficient Genome Editing in Toxoplasma gondii. Methods Mol Biol 1498:79-103. 527
24. Long S, Wang Q, Sibley LD. 2016. Analysis of Noncanonical Calcium-Dependent 528 Protein Kinases in Toxoplasma gondii by Targeted Gene Deletion Using 529 CRISPR/Cas9. Infect Immun 84:1262-1273. 530
25. Benkert P, Biasini M, Schwede T. 2011. Toward the estimation of the absolute 531 quality of individual protein structure models. Bioinformatics 27:343-50. 532
26. Bertoni M, Kiefer F, Biasini M, Bordoli L, Schwede T. 2017. Modeling protein 533 quaternary structure of homo- and hetero-oligomers beyond binary interactions 534 by homology. Sci Rep 7:10480. 535
27. Bienert S, Waterhouse A, de Beer TA, Tauriello G, Studer G, Bordoli L, Schwede 536 T. 2017. The SWISS-MODEL Repository-new features and functionality. Nucleic 537 Acids Res 45:D313-D319. 538
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
23
28. Guex N, Peitsch MC, Schwede T. 2009. Automated comparative protein 539 structure modeling with SWISS-MODEL and Swiss-PdbViewer: a historical 540 perspective. Electrophoresis 30 Suppl 1:S162-73. 541
29. Waterhouse A, Bertoni M, Bienert S, Studer G, Tauriello G, Gumienny R, Heer 542 FT, de Beer TAP, Rempfer C, Bordoli L, Lepore R, Schwede T. 2018. SWISS-543 MODEL: homology modelling of protein structures and complexes. Nucleic Acids 544 Res 46:W296-W303. 545
30. Vedadi M, Lew J, Artz J, Amani M, Zhao Y, Dong A, Wasney GA, Gao M, Hills T, 546 Brokx S, Qiu W, Sharma S, Diassiti A, Alam Z, Melone M, Mulichak A, 547 Wernimont A, Bray J, Loppnau P, Plotnikova O, Newberry K, Sundararajan E, 548 Houston S, Walker J, Tempel W, Bochkarev A, Kozieradzki I, Edwards A, 549 Arrowsmith C, Roos D, Kain K, Hui R. 2007. Genome-scale protein expression 550 and structural biology of Plasmodium falciparum and related Apicomplexan 551 organisms. Mol Biochem Parasitol 151:100-10. 552
31. Fairman JW, Wijerathna SR, Ahmad MF, Xu H, Nakano R, Jha S, Prendergast J, 553 Welin RM, Flodin S, Roos A, Nordlund P, Li Z, Walz T, Dealwis CG. 2011. 554 Structural basis for allosteric regulation of human ribonucleotide reductase by 555 nucleotide-induced oligomerization. Nat Struct Mol Biol 18:316-22. 556
32. Pino P, Foth BJ, Kwok LY, Sheiner L, Schepers R, Soldati T, Soldati-Favre D. 557 2007. Dual targeting of antioxidant and metabolic enzymes to the mitochondrion 558 and the apicoplast of Toxoplasma gondii. PLoS Pathog 3:e115. 559
33. Brydges SD, Carruthers VB. 2003. Mutation of an unusual mitochondrial 560 targeting sequence of SODB2 produces multiple targeting fates in Toxoplasma 561 gondii. J Cell Sci 116:4675-85. 562
34. Adeyemi OS, Murata Y, Sugi T, Kato K. 2017. Inorganic nanoparticles kill 563 Toxoplasma gondii via changes in redox status and mitochondrial membrane 564 potential. Int J Nanomedicine 12:1647-1661. 565
35. Odberg-Ferragut C, Renault JP, Viscogliosi E, Toursel C, Briche I, Engels A, 566 Lepage G, Morgenstern-Badarau I, Camus D, Tomavo S, Dive D. 2000. 567 Molecular cloning, expression analysis and iron metal cofactor characterisation of 568 a superoxide dismutase from Toxoplasma gondii. Mol Biochem Parasitol 569 106:121-9. 570
36. Sidik SM, Huet D, Ganesan SM, Huynh MH, Wang T, Nasamu AS, Thiru P, Saeij 571 JPJ, Carruthers VB, Niles JC, Lourido S. 2016. A Genome-wide CRISPR Screen 572 in Toxoplasma Identifies Essential Apicomplexan Genes. Cell 166:1423-1435 573 e12. 574
37. Chircorian A, Barrios AM. 2004. Inhibition of lysosomal cysteine proteases by 575 chrysotherapeutic compounds: a possible mechanism for the antiarthritic activity 576 of Au(I). Bioorg Med Chem Lett 14:5113-6. 577
38. Saccoccia F, Angelucci F, Boumis G, Brunori M, Miele AE, Williams DL, Bellelli 578 A. 2012. On the mechanism and rate of gold incorporation into thiol-dependent 579 flavoreductases. J Inorg Biochem 108:105-11. 580
39. Gromer S, Arscott LD, Williams CH, Jr., Schirmer RH, Becker K. 1998. Human 581 placenta thioredoxin reductase. Isolation of the selenoenzyme, steady state 582 kinetics, and inhibition by therapeutic gold compounds. J Biol Chem 273:20096-583 101. 584
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
24
40. Yamashita M, Ashino S, Oshima Y, Kawamura S, Ohuchi K, Takayanagi M. 585 2003. Inhibition of TPA-induced NF-kappaB nuclear translocation and production 586 of NO and PGE2 by the anti-rheumatic gold compounds. J Pharm Pharmacol 587 55:245-51. 588
41. Parsonage D, Sheng F, Hirata K, Debnath A, McKerrow JH, Reed SL, Abagyan 589 R, Poole LB, Podust LM. 2016. X-ray structures of thioredoxin and thioredoxin 590 reductase from Entamoeba histolytica and prevailing hypothesis of the 591 mechanism of Auranofin action. J Struct Biol 194:180-90. 592
42. Xue J, Jiang W, Chen Y, Gong F, Wang M, Zeng P, Xia C, Wang Q, Huang K. 593 2017. Thioredoxin reductase from Toxoplasma gondii: an essential virulence 594 effector with antioxidant function. FASEB J 31:4447-4457. 595
596
597
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
25
FIGURES: 598
599
Figure 1. AurR lines have a growth advantage under selective pressure with auranofin. 600
(A) In the absence of auranofin, individual resistant lines grow as well or less well than 601
the parental RH strain. (B) In the presence of 3 µM auranofin, wild-type parasites are 602
eliminated by day 6 (red box). 603
604
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
26
605
606
Figure 2. Resistant T. gondii lines outcompete wild type parasites under auranofin 607
selection. AurR lines are represented as percentage of the total population of parasites 608
after 6 days in competition with YFP-expressing wild type (sensitive) parasites, no drug 609
media (white) and 2.5 uM auranofin (black). Mean difference between parasite 610
population in the absence of auranofin and in the presence of auranofin: 40.6; SD 14.6; 611
two-tailed unpaired t-test p
27
614
615
Figure 3. Auranofin-resistant T. gondii parasites accumulate less ROS. Freshly lysed 616
wild-type parasites were treated with 500 μM hydrogen peroxide (H2O2) for 30 min and 617
accumulation of reactive oxygen species (ROS) was assayed with dichloro-fluorescein 618
H2DCDFC. Auranofin-resistant clones accumulated less ROS after H2O2 treatment 619
compared to the wild-type RH parasites in the presence of H2O2 (white) or H2O2 + 1 µM 620
auranofin (black). (*) p
28
623
Figure 4. Location of substitutions in TgSOD2 and TgRNR. (A) SOD forms dimers that 624
coordinately bind to iron cofactors at their interface. The Toxoplasma amino acid 625
sequence was threaded onto a Plasmodium knowlesi protein structure (PDB 2AWP) to 626
create a model for TgSOD2. The mutation at position 201 (red) is near to the end of an 627
α-helix; substitution of a proline for leucine at this location likely causes the helix to 628
bend. This mutation is also proximal to key iron-coordinating residues H111, E249 and 629
H160. (B) Alignment of the Toxoplasma and human RNR sequences indicates that 630
TgRNR has a novel 59 amino acid N-terminal extension. MS peptides (yellow highlight) 631
in ToxoDB map to this sequence with S and T phosphorylated, and R monomethylated 632
(underlined). (C) The Toxoplasma amino acid sequence for RNR was threaded onto the 633
human RNR structure (PDB 3HND) to create a model for TgRNR. The L166Q mutation 634
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
29
is in a solvent exposed loop, that is poorly conserved and not known to contribute to 635
enzyme interactions. 636
637
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
30
638
639
Figure 5: A L201P mutation in TgSOD2 does not alter localization of TgSOD2 or 640
confer resistance to auranofin. (A) Wild type and mutant SOD2-YFP exhibit a 641
mitochondrial distribution. (B) Growth competition assays indicate that the L201P 642
mutation is associated with reduced fitness in the absence of auranofin (control 643
conditions, white bars). In the presence of auranofin (black bars), only line 8 shows 644
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
31
growth advantage, indicating that the single L201P mutation to TgSOD2 does not confer 645
resistance. (C) In the absence of auranofin, the SOD2.L201P line accumulated ROS 646
similarly to wild type parasites, consistent with its auranofin-sensitive growth; however, it 647
accumulated less ROS in the presence of auranofin 648
649
650
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
32
Table 1: SNVs in AurR line 8
Rank Mutation Locus Predicted protein CRISPR
*RNA-seq
Motif Index
1 L201P TGGT1_316330 Superoxide dismutase SOD2
-4.09 76.99 SOD motif 2.50
2 L166Q TGGT1_294640 Ribonucleoside-diphosphate reductase
-4.79 40.9 R1 subunit, ribonucleotide reductase
2.29
3 Y95C TGGT1_233460 SAG-related sequence SRS29B
-0.07 1809.46 Major surface antigen p30 2.10
4 Y637H TGGT1_268870 Tetracopeptide repeat-containing
-1.66 38.52 Predicted dehydrogenase 1.81
5 P1357-S1358Δ
TGGT1_310350 PGAP1 family protein -2.41 11.67 alpha/beta-hydrolase/PGAP1-like protein 1.45
6 D487G TGGT1_289820 TBC domain-containing protein
-1.14 15.49 Rab-GTPase-TBC domain 1.25
7 L606L TGGT1_271290 Hypothetical protein -2.02 8.1 Alternative splicing regulator 1.21
8 F424L TGGT1_234250 Hypothetical protein -2.02 6.39 SWAP/MAEBL 1.11
9 A574G TGGT1_290910 Hypothetical protein -1.39 7.63 No putative conserved domain 1.03
10 D1983del TGGT1_211310 Hypothetical protein -0.69 12.86 RCC1 repeat 0.95
11 F563S TGGT1_260490 Hypothetical protein -1.62 5.34 Herpes BLLF1 0.94
12 P66P TGGT1_225340 Hypothetical protein 0.73 24.06 No putative conserved domain
N/A
*Transcriptome Gregory series at 2 hrs RH (log 2 FPKM+1). FPKM= Fragments Per Kilobase Of Exon Per Million Fragments Mapped N/A: Not calculated due to dispensable (positive) CRISPR phenotype index index Formula=Sum of Log10 of (-CRISPR phenotype index)+log10 (RNAseq expression)
651
Table 1. SNVs in AurR line 8 652
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
33
653
SUPPLEMENTAL FIGURES 654
655
Figure S1: CRISPR-Cas9 strategy for generating the T. gondii SOD2.L201P line. TgSOD2-YFP parasites incorporating 656
the LIC plasmid (blue line) undergo CRISPR-Cas9 mediated homologous directed repair (HDR). The DNA amplicon used 657
for HDR contains the L201P mutation (gold vertical line in exon 3) and two silent and unique restriction sites AflI and XcmI 658
(black vertical lines in exon 3), which allow for screening of positive clones. Sequences corresponding to the two gRNA 659
were deleted from the DNA for HDR (Δg1 and Δg2, golden triangles). Each of the gRNA was present twice in TgSDO2-660
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
34
YFP parasites (g1a/b, g2a/b; red font), resulting in two T. gondii SOD2.L201P lines. For HDR after g1a/g2a cuts, a T. 661
gondii SOD2.YFP.L201P line is generated (lower left). For HDR after g1a/g2b cuts, a T. gondii SOD2.L201P line without 662
YFP or LIC plasmid (blue) is generated (lower right). Positive clones were screened with XcmI digest before sequence 663
verification. 664
665
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
35
Name Gene ID* Sequence Function
TrxR 12F 309730 GGACCTATGAGTTGCCTCTCTG TrxR amplification 5’ half TrxR R10 309730 GTCAAATCCCAATTCGCGGAG TrxR amplification, 5’ half TrxR For 8 309730 GTCTGCTCTCTCTGTTTCGCAAG TrxR amplification, 3’ half TrxR Rev 9 309730 CCTCCACATCCTCCAGAAGC TrxR amplification, 3’ half 5TrxR 1R 309730 CGAGTTTTCTAGAGCGTGTGC TrxR sequencing, 5' half, exon 1 5TrxR 1F 309730 CATCCCTGTGCACTTTCC TrxR sequencing, 5' half, exons 2-3 5TrxR 3F 309730 GTGGATACCCTCGTATAATATGC TrxR sequencing, 5' half, exons 4-5 TrxR For 8 309730 GTCTGCTCTCTCTGTTTCGCAAG TrxR sequencing, 3' half, exons 6-7 3TrxR 2F 309730 GCTTCGTTTGATTGCCTGTC TrxR sequencing, 3' half, exons 8-9 3TrxR 3F 309730 CATCTTGTTCCTCCAACCTCTG TrxR sequencing, 3' half, exon 10 3TrxR 4F 309730 GATGTCTGCTTTCGTCTTCC TrxR sequencing, 3' half, exon 11 SOD LIC3 316330 TACTTCCAATCCAATTTACGAAGGTGAGGAGCA
TTCG SOD2 amplification with LIC casette
SOD LIC5 316330 TCCTCCACTTCCAATTTTAGCGTTGCTTTCAAGTGCTTTCACC
SOD2 amplification with LIC casette
SOD2 RE Ins F 316330 TGATAAGCTAGCCAGTGATCT Site directed mutagenesis for NheI SOD2 RE Ins R 316330 TCTCCATCTCCCCCTGAT Site directed mutagenesis for NheI SOD2 SNP F 316330 TTTTCCAAACCAGCGGCAGGC Site directed mutagenesis for L201P SOD2 SNP R 316330 CTCATCCTTGAACTGGGC Site directed mutagenesis for L201P SOD Seq1 316330 CTTTCGAATCCTGAAACACC Validation of SOD2 SNV SOD Seq2 316330 GTCATGTGTGTTTGCCCCGTAG Validation of SOD2 SNV SOD2 F 316330 GCAGAGACTCTTCGCTTTCAC Amplification of SOD2.YFP CRISPR clone AmpR N/A CCTTGAAGAAGATGGTGCGC Amplification of SOD2.YFP CRISPR clone SOD E2 316330 GCTTCATTCAAGGCACACC Amplification of SOD2 in CRISPR clone SOD R 316330 CTATCCAGGGTTCACGACG Amplification of SOD2 in CRISPR clone CDS F 300120 GTGTGTCTGCATCGTTTCC Aminotransferase amplification CDS R 300120 GTTCCTCTGAAGCATGTTTCC Aminotransferase amplification CDS E1 300120 CTCTGTTTGGTGTCTTTGACC Aminotransferase SNV sequencing COR F 253120 CTCAGCAATGTGACATGCTAGC Mandelonitrile lysase amplification COR R 253120 GTTCGACGGTGAAATGTGCTC Mandelonitrile lysase amplification COR E8 253120 CTTGCTACCATTTCTCCTCG Mandelonitrile lysase SNV MBL F 234250 GTGAACTCAGTGAAACCGC MAEBL amplification MBL R 234250 GCACTCTCGAGTTTTACGC MAEBL amplification MBL E2 234250 GGAGGATCAGGTTTATGAGTGC MAEBL SNV sequencing NAD F 244700 CGTCTCCTTCTCTCGATGG NAD(+)/NADH kinase amplification 666
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
36
Table S1: Primers for SNV validation 667
668
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842
37
Acknowledgements 669
Special gratitude to Dr. Melissa Lodoen (UCI) for her advice and critical review of this 670
manuscript and to Edward Brignole (MIT) for his thoughts on the TgRNR mutation. RMA 671
was supported by NIHK08 5K08AI102989-04 and AMFDP RWJF 70642 (the views 672
expressed here do not necessarily reflect the views of the Foundation). This work was 673
made possible, in part, through access to the Genomics High Throughput Facility 674
Shared Resource of the Cancer Center Support Grant (P30CA-062203) at the 675
University of California, Irvine and NIH shared instrumentation grants 1S10RR025496-676
01, 1S10OD010794-01, and 1S10OD021718-01. 677
678
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted April 25, 2020. ; https://doi.org/10.1101/2020.04.23.058842doi: bioRxiv preprint
https://doi.org/10.1101/2020.04.23.058842Recommended