Alaska Business Monthly June 2015

OIL & GAS | CONSTRUCTION | WILD SALMON | WORKFORCE TRAINING | ECONOMY

June 2015 $3.95

Bob Hajdukovich, Ravn Alaska CEO

TransportationMaritime EconomyAnnual DirectoryRural Air Carriers Leadership Special Section begins on page 38

XTO Energy is proud to be part of Alaska’s growing economy.

You expect us to be responsible neighbors; we’re working hard to make sure we are.

XTO Energy Inc.

www.xtoenergy.com

52260 Wik Road, Kenai, Alaska 99611 907.776.8473

810 Houston Street, Fort Worth, Texas 76102 817.870.2800

4 Alaska Business Monthly | June 2015 www.akbizmag.com

From the Editor � � � � � � � � � � � � � � � � � � � � �7Right Moves� � � � � � � � � � � � � � � � � � � � � 116Inside Alaska Business � � � � � � � � � � � 118Agenda � � � � � � � � � � � � � � � � � � � � � � � � � 121Alaska This Month � � � � � � � � � � � � � � � 122Events Calendar � � � � � � � � � � � � � � � � � 124Market Squares� � � � � � � � � � � � � � � � � � 125Alaska Trends � � � � � � � � � � � � � � � � � � � 126Ad Index � � � � � � � � � � � � � � � � � � � � � � � � 130

ABOUT THE COVERRavn Alaska CEO Bob Hajdukovich on the tarmac in front of the company’s hangar at Ted Stevens Anchorage International Airport� The company’s story is part of the annual Transportation special section (begins on page 38)� Cover Photo: © Chris Arend Photography

J u n e 2 0 1 5T A B L E O F C O N T E N T S

ARTICLES

DEPARTMENTS

IconIc AlAskAns8 | Fran Ulmer

By Shehla Anjum

obItuAry12 | Alaska Loses Pioneer and Banking LeaderDaniel Hon Cuddy passed away in Anchorage May 12

Economy14 | North Dakota Pays Its Way with Much More Than Just Oil and Gas Taxes

By Larry Persily

busInEss succEssIon AgrEEmEnt bAsIcs18 | Cross Purchase, Stock Redemption, Wait & See… oh my! What does all this mean?

By Mel B. Bannon

lEgAl spEAk20 | Pass-Through and Disregarded Business Entities A tax advantage Alaskans should know about

By Andrea N. Canfield

InsurAncE34 | Protecting the Fleets in Alaska Waters Insurance critical for marine transportation, commercial fishing, and other maritime businesses

By Tracy Barbour

FInAncIAl sErvIcEs76 | CapEx FundingDemand is strong across the board

By Julie Stricker

FIshErIEs22 | Wild Alaska Salmon Advantages Go Beyond Taste and TexturePrice crash in 2000 led to industry inno-vations and superior product

By Will Swagel

26 | Patented Fish Grinder Designed in Alaska

By Russ Slaten

WorkForcE trAInIng30 | Alaska Process Industry Career ConsortiumDeveloping the framework to replace an aging workforce

By Mike Bradner

Daniel Hon Cuddy

Gaffing a wild salmon in Southeast Alaska.

© ASMI

Photo courtesy of First National Bank Alaska

12 22

Mustang Road on the North Slope.

© AIDEA 76

FNBAlaska.com

Jenny MahlenVice President

In Alaska, there’s no such thing as “business as usual.” From permafrost to daunting logistics and a changing economy, Alaska businesses face unique challenges.

Hard work, commitment, innovation. These are the hallmarks of Alaska business.

FFirst National Bank Alaska began as a small community business. We’re local bankers who understand your business and what it takes to succeed.

Learn how local knowledge and experience make the difference. Call 907-777-4362 or 1-800-856-4362.

We believe in Alaska business

ARTICLES

oIl & gAs80 | New Age of Air Support to Oil & Gas IndustryUnmanned aviation systems on Alaska’s North Slope

By Julie Stricker

Expanded in Digital Edition86 | Shell’s Extensive Arctic LogisticsKeeping vessels, crews, and the ocean safe

By Mike Bradner

88 | ‘Realizing the Promise’ of Alaska’s Arctic OCS NPC report shares key findings and recommendations

By Mike Bradner

vIsItor Industry112 | Business-Class Hotels in AlaskaComfort, convenience, and unbeatable views

By Kirsten Swann


J u n e 2 0 1 5T A B L E O F C O N T E N T S

special section

Transportation

Expanded in Digital Edition38 | Economy, Labor Shortages Big Issues for Trucking Industry

46 | Ravn AlaskaFlying everywhere, with anything

By Tasha Anderson

50 | Small Air Carriers Improve Rural Life

By Julie Stricker

Expanded in Digital Edition54 | Southeast Alaska Maritime Economy GrowsIndustries and jobs shift from forest to ocean

By Mike Bradner

62 | Alaska Business Monthly’s 2015 Transportation Directory

Community members are the ground crew unloading an Everts Air Cargo DC-6 in remote, rural Alaska.

Photo courtesy of Everts Air Cargo

special section

Building Alaska90 | Statewide Construction Project RoundupThousands working on projects worth billions

By Russ Slaten

Expanded in Digital Edition96 | Reaching Alaska’s ResourcesHeavy construction projects within natural resource sectors

By Kirsten Swann

102 | Partners in Safety Include OSHA and Insurance Agents

By Brian McKay

106 | Trusses on the TundraSustainable Housing Technologies in Southwest Alaska

By Molly Rettig, Cold Climate Housing Research Center

Integrated trusses ready for shipment down river to Bethel.

106Photo courtesy of CCHRC

DIGITAL EXCLUSIVEEntrEprEnEursWells Fargo and UAA College of Business Team Up to Support Alaska’s YouthLemonade Day Alaska growing the next generation of entreprenuers

By Samuel Callen

50

CorrectionWe incorrectly identified TSS, Inc., owned by Renee Schofield, Alaska Small Business Person of the Year 2015, in the May issue� Schofield

www.akbizmag.com June 2015 | Alaska Business Monthly 7

Volume 31, Number 6Published by

Alaska Business Publishing Co.Anchorage, Alaska

Jim Martin, Publisher1989~2014

EDITORIAL STAFF Managing Editor Susan Harrington Associate Editor Russ Slaten Associate Editor Tasha Anderson Art Director David Geiger Art Production Linda Shogren Photo Consultant Chris Arend Photo Contributor Judy Patrick

BUSINESS STAFF President Billie Martin Vice President & Jason Martin General Mgr� VP Sales & Mktg� Charles Bell Senior Account Mgr� Anne Campbell Senior Account Mgr� Bill Morris Account Mgr� Janis J. Plume Accountant & Melinda Schwab Circulation

501 W� Northern Lights Boulevard, Suite 100 Anchorage, Alaska 99503-2577

(907) 276-4373Outside Anchorage: 1-800-770-4373

Fax: (907) 279-2900www.akbizmag.com

Editorial email: [email protected]

ALASKA BUSINESS PUBLISHING CO., INC.ALASKA BUSINESS MONTHLY (ISSN 8756-4092) is published monthly by Alaska Business Publishing Co., Inc., 501 W. Northern Lights Boulevard, Suite 100, Anchorage, Alaska 99503-2577; Telephone: (907) 276-4373; Fax: (907) 279-2900, ©2014, Alaska Business Publishing Co. All rights reserved. Subscription Rates: $39.95 a year. Single issues of the Power List are $15 each. Single issues of Alaska Business Monthly are $3.95 each; $4.95 for October, and back issues are $5 each. Send subscription orders and address changes to the Circulation Department, Alaska Business Monthly, PO Box 241288, Anchorage, AK 99524. Please supply both old and new addresses and allow six weeks for change, or update online at www.akbizmag.com. Manuscripts: Send query letter to the Editor. Alaska Business Monthly is not responsible for unsolicited materials. Photocopies: Where necessary, permission is granted by the copyright owner for libraries and others registered with Copyright Clearance Center to photocopy any article herein for $1.35 per copy. Send payments to CCC, 27 Congress Street, Salem, MA 01970. Copying done for other than personal or internal reference use without the expressed permission of Alaska Business Publishing Co., Inc. is prohibited. Address requests for specific permission to Managing Editor, Alaska Business Publishing. Online: Alaska Business Monthly is available at www.akbizmag.com/archives, www.thefreelibrary.com/Alaska+Business+Monthly-p2643 and from Thomson Gale. Microfilm: Alaska Business Monthly is available on microfilm from University Microfilms International, 300 North Zeeb Rd., Ann Arbor, MI 48106.

Follow us on

and

FROM THE EDITOR

That’s the big takeaway I got from talking to transportation leaders about key issues facing the industry� Labor and the economy were the two main challenges and recruiting drivers is a big deal. There’s

not much I can do about the economy, so I thought I would try to help get the industry more drivers� At least twenty-one years old? Have a CDL? Drug free? Then show up and work� There is an enormous oppor-tunity for great wages and benefits for qualified drivers.

We’ve got an exceptional magazine again this month, and in the Trans-portation special section is the discussion with industry leaders (starts on page 38)� We talked for an hour and there wasn’t enough room for it all so I’ve included a bit of it here�

In addition to the economy and the dire shortage of truck drivers, an-other topic discussed was the recent crisis on the Dalton Highway, and its maintenance is at the top of the list of the Alaska Trucking Associa-tion’s Legislative Priorities.

When Harry McDonald, Terry Howard, Jimmy Boyle, and Aves Thomp-son showed up April 8 at the offices of Alaska Business Monthly the Dal-ton Highway had been closed due to flooding from overflow from the Sag River, which was quite compelling. The magnitude of the haul road shutdown is unfathomable from both the logistics nightmare it created and the sheer force of nature it displayed� The governor declared it a disaster�

Thompson brought up a very interesting point: A lot of people don’t know about the Dalton Highway� They don’t know where it is, or what it is, or how important it is� Here’s what he said about the Dalton Highway:

One of the other issues on our priority list was the maintenance of the Dalton Highway. And I think today is a perfect example of maintenance and the importance of the Dalton Highway. If you stop someone on the street tomorrow and say, ‘Where is the Dalton Highway?’ They would look at you with a blank stare—because they don’t know. There are a lot of people who should know that don’t know, they don’t know why it’s there, they don’t know what travels on that road.

We posted a three-minute video on our Facebook page that was taken by a driver going through that trouble—that flooded area up there—it took him more than an hour to get five miles. We got forty-five thou-sand views on our Facebook page. My daughter does a little bit of social media work and she sent me a text and said, ‘Hmmm, in the social media world we call this a success.’

We spent two hours with the Senate Transportation Committee two or three weeks ago [in March] talking about the Dalton Highway and what it means to the industry, what it means to the state, and what it means to the people in the state of Alaska. Then this [the flooding and closing of the Dalton Highway] just sort of drives that point home of how important it really is.

By April 8 it was necessary to fly fuel up to the North Slope to keep operations going and there were seven hundred to eight hundred loads back up in Fairbanks. Facebook.com/AlaskaTruckingAssociation has photos and commentary along with the video posted April 7, which by press time in May had 165,489 views. So check that out and check out the June issue of Alaska Business Monthly� The team has put together another really great magazine, enjoy!

—Susan Harrington, Managing Editor

Truck Drivers Wanted in AlaskaHigh wages to show up and work


Fran UlmerICONIC ALASKANS

Most would agree that Fran Ulmer is one of the most ac-complished Alaskans: Leg-

islative attorney, state government policy director, Mayor of Juneau, Lieutenant Governor, university think tank director, university chancellor, and now direc-tor of a respected federal research commission. What hasn’t Ulmer done?

And yet, at sixty-eight, she still seems young in her ca-reer, meeting new challenges in a presidential appointment as chair of the US Arctic Policy Research Commission.

Here are two Ulmer stories, both from her: When she was appointed Governor Jay Hammond’s legislative liaison in 1975 (the governor’s lobbyist), she found a gift in her desk drawer, left there by Alex Miller, who held her job under Governor Bill Egan.

It was a cigar, a Miller trademark. Ul-mer didn’t tuck it away as a keepsake. She lit up, put her feet up on Alex Mill-er’s former desk, and puffed away.

Another story that she takes quiet pride in was when she began her first Alaska job as a staff attorney for the Legislature in 1973 in Juneau. Ulmer unexpectedly set an example for pro-fessional women—that they didn’t have to adhere to an unspoken dresses-only code. Her decision to wear trousers, customary for professional women in Washington, D.C., sent a strong signal to other women in Alaska’s capital that they could choose to dress similarly, and they did.

Midwestern RootsUlmer grew up in the small Midwest-ern town of Horicon, Wisconsin, located between Madison and Milwaukee. Her parents owned the town’s furniture store

and funeral home and she helped with both, including singing for funerals.

Although neither parent attended col-lege, both Ulmer and her older sister did. Ulmer earned an undergraduate degree with a double major in economics and political science and a law degree, both from the University of Wisconsin.

Her choice of a career in public policy seems natural. But it wasn’t always so. As a child she wanted to be either a ballerina or a singer. As she grew older she realized that although “performing was exciting and demanding, it looked like an unstable lifestyle, so I opted for something much more predictable.”

Music, however, remained a constant in her life. Ulmer went on to sing in college musicals, performed in a USO tour to Greenland and Iceland, and af-

ter becoming an Alaskan, sang the Na-tional Anthem at the Kingdome to open Alaska Day at a Seattle Mariners game in 1994.

In the late 1960s, when Ulmer fin-ished her undergraduate degree, few women attended professional schools—medicine, engineering, and law. But things were changing.

Susan Davis, a college roommate who now runs a communications firm in Washington, D.C., remembers Ulmer’s desire to study law. “She was very fo-cused on a career in government and possibly politics and definitely wanted to be engaged in public service.” Ulmer’s parents, who were involved in commu-nity work, had passed along the desire for public service to their daughter.

Ulmer, too, knew a law degree would

By Shehla Anjum

“I decided law was the best path and an advanced degree would open more doors than just a bachelor’s degree. And I was right.”

© C

hris

Are

nd P

hoto

grap

hy


allow her to work and advance in the public sector. “I decided law was the best path and an advanced degree would open more doors than just a bachelor’s degree. And I was right.”

She got her juris doctorate in 1972 and went to work at the Federal Trade Commission in Washington, D.C. But her job as an anti-trust attorney wasn’t inspiring. She wanted a change and heard about Juneau and its rich outdoor life from a former boyfriend who had moved there.

An Alaska ChangeAlaska seemed just right. She had had a life-long interest in outdoor activi-ties, wildlife, and conservation. Her hometown was “next to the Horicon Marsh, a federal and state wildlife area with a freshwater marsh that attracted hundreds of thousands of migrating waterfowl every spring. I hiked, fished, canoed, and ice skated in this peaceful place, literally in my backyard.”

Soon after arriving in Juneau in 1973, Ulmer got her first Alaska job—as the first woman attorney in the state Leg-islature’s legal services division. In that nonpartisan position, she drafted bills, researched issues, and served as staff for the Senate Judiciary Committee when that committee met.

Those on the Capitol’s third floor, the governor’s office, noticed her work. In 1975, then-Governor Jay Hammond asked her to become his legislative li-aison. Two years later he appointed her director of the Division of Policy Devel-opment and Planning (DPDP).

The DPDP appointment came the same year that oil started flowing through the Trans Alaska Pipeline Sys-tem and communities on the North Slope began voicing concern about fu-ture oil and gas activity and its impact on their way of life. They found one avenue to voice their concern—a local coastal management program that op-erated in tandem with the state’s coast-al management program that Ulmer was setting up at DPDP.

“We approved the first local plans and coordinated the federal, state, and local efforts to align the programs so they complied with the federal and state laws and accommodated the con-cerns of communities,” Ulmer says. That program was very successful for

the first few decades in Alaska and al-lowed coastal communities a say in how oil and gas activities were conducted in their regions. It now no longer exists.

Balancing Work and FamilyIn 1977, the year that she started work at DPDP, Ulmer married attorney Bill Council. They had two children, Amy and Louis.

One of Ulmer’s closest friends is Jane Angvik, of Anchorage. Their friendship dates back to the Hammond days in the 1970s. “She was DPDP’s new director

and I was at the Alaska Public Forum [a citizen outreach program]. We have had a most joyful relationship. She was also having babies the same time that my husband and I adopted our daughter.”

Ulmer won Angvik’s admiration for the way she balanced her busy working and home lives. “People read a lot about Fran’s public service but few know that she was also a terrific parent.” Living in Juneau offered an advantage—it al-lowed Ulmer to combine a high profile job and still be home in time to make dinner, Angvik says.

alaskacargo.com

Built in Beaumont

Shipped from Houston

On the job in the morning.

Our name is Alaska. Our service is nationwide.

For over 83 years, we’ve built our reputation on outstanding customer service. After all that hard work, we’re not going to let you down.


Although Ulmer and her husband both had busy careers, they made time for family. “We never felt neglected and we were a close family. We went on trips together and ate sit down meals,” Louis Ulmer says.

PoliticsThe elected official phase of Ulmer’s career began in 1983, at age thirty-six, when she became Juneau’s mayor. In 1986 she won election to the Alaska House of Representatives as a Demo-crat. She served until 1994, becoming the House minority leader in her last year.

The move from local to statewide office came when Ulmer was elected lieutenant governor in 1994. She was not only the first woman elected to that post in Alaska but also the first to win a statewide office.

Alaska’s lieutenant governor’s chief responsibility is overseeing the state’s elections. Ulmer successfully transi-tioned the state to an electronic ballot counting system, led efforts to create the state’s first web pages, and made routine state services, such as renew-

ing motor vehicle licenses and fishing licenses, available online.

John Lindback, Ulmer’s chief of staff when she was lieutenant governor, credits her foresight in developing a modern voting system in Alaska. “We were using punch cards [before] and it was very clear to us that the system was antiquated. The machines were getting more and more difficult to maintain and it was time to move on,” he recalls.

“Fran supported the transition and un-derstood the need for it. We transitioned to optical scan voting in 1998. Alaska wasn’t the very first, but the first to do it on a statewide basis. That was two years before the 2000 election and the big con-troversy over punch cards in Florida” in the contested Al Gore vs. George W. Bush presidential election.

Lindback also complimented Ulmer’s ability as a gifted speaker. “She was one of the few politicians who was fully ca-pable of putting together a speech on her own.” She spoke in an almost ex-temporaneous fashion, which was “very unusual, but she could do that because her debating background helped her become articulate and good at thinking on her feet,” Lindback says.

Ulmer served eight years as lieuten-ant governor and ran for governor as the Democratic candidate in the 2002 gov-ernor’s race, but lost to Frank Murkows-ki. She may have not won, but earned a reputation for the way she campaigned, highlighting the realities of Alaska’s near-complete dependence on oil and the problems it would create in future years (a prediction now come true).

Reflecting on this, her son, Louis Ulmer, says: “My mother knew that not everyone agreed with her, and she respected that. But to this day when people find out that my mom is Fran Ulmer, people still comment how she should have been governor.”

AcademiaThe eighteen years as an elected rep-resentative at the local and state level built Ulmer’s reputation for being fo-cused and being able to get things done. She wasn’t idle for long after her race for governor. She returned from a fel-lowship at Harvard’s Kennedy School of Government in 2004 and joined the University of Alaska Anchorage as a visiting professor. In 2005 she became

director of UAA’s ISER (Institute of So-cial and Economic Research).

At ISER, Ulmer oversaw research on a variety of issues—status of Alaska Na-tives, the needs and problems of remote communities, and the costs of global warming on Alaska’s infrastructure.

She stayed at ISER for two years, un-til 2007, when the University of Alaska’s president Mark Hamilton appointed Ulmer UAA’s interim chancellor and then chancellor in spring 2008. It was a popular decision.

“The faculty, staff, and academic lead-ership were excited and enthusiastic for her leadership. Fran received a standing ovation at the faculty-staff convocation that fall,” says Beth Rose, assistant vice chancellor for development during Ul-mer’s years as UAA chancellor.

Working together as a team was im-portant to Ulmer, who “nurtured lead-ership and would freely give credit to others for their accomplishments,” ac-cording to Rose.

Ulmer’s deep commitment was to building a strong relationship between UAA and the community, Rose says, and those efforts helped the university raise funds for several projects.

For Ulmer it wasn’t just fundraising but rather the linkages to the commu-nity, “an alignment of values, purpose, and a sense that there were many great programs—from the award winning debate program to Alaska Native Sci-ence and Engineering Program—that people didn’t really know about.”

Funds raised during Ulmer’s tenure as chancellor paid for the construction of several new facilities at UAA: the health sciences building, parking ga-rage, and sports center. Contributions increased substantially, including a gift of $15 million from ConocoPhillips, the largest in the university’s history.

Appointments from AfarEven before she left the university in 2011, national leaders had noticed Ul-mer. As a state legislator she had served on the Special Committee on the Exxon Valdez Oil Spill Claims Settlement, a complex assignment to advise on envi-ronmental restoration issues. Experi-ence gained on that committee led to a presidential appointment in 2010 when President Barack Obama appointed her to a national assignment, the Commis-

Fran Ulmer at the Alaska Airlines Cen-ter on the UAA campus in Anchorage.

© Chris Arend Photography


climate change and to focus attention on Alaska.

Hard times are ahead for Alaska be-cause of the budget crisis due to falling oil prices. But Ulmer remains optimis-tic. “We have abundant resources—natural, human, and financial—that can be managed for our small popula-tion to do well for a long time,” she says.

She offered this assessment: “The bad news is our dependence on our state gov-ernment providing things for free: free roads, schools, troopers, resource man-agement—all of which cost money. But

the good news is our resilient population, which must now accept that taxes are necessary to assure a high quality of edu-cation, safety, and other public services.

“We must stop pretending that oil can pay for everything. We need much more engagement by citizens in prob-lem solving. Elected officials cannot take care of all the thorny issues with-out our help and support.” R

Writer Shehla Anjum is based in Anchorage.

sion on the BP Deepwater Horizon Oil Spill and Offshore Oil Drilling. The ap-pointment was in keeping with Ulmer’s role in shaping both public and envi-ronmental policy throughout her years in Alaska.

Although Ulmer left UAA as planned in May 2011, she didn’t actually retire. A few months before her departure, the president appointed her to another na-tional position—chair of the US Arctic Research Commission.

The Arctic research appointment came at a good time. State and national leaders are increasingly concerned about climate change. While global, such changes are more pronounced in the Arctic, where coastal villages are in danger of sliding into the oceans, roads are buckling, and glaciers are melting.

“Her work on the commission is a culmination of her forty years of ex-perience in Alaska,” Jane Angvik says. Besides chairing the Arctic Research Commission, Ulmer will also serve as the US Arctic science and policy advi-sor and will be involved with the Arc-tic Council, the group of eight Arctic nations formed in 1996 to work on is-sues of mutual interest. The council chairmanship rotates among the eight nations every two years and the United States became the chair in April 2015.

Jimmy Stotts, an Inupiaq from Bar-row and president of the Inuit Circum-polar Council Alaska, has long worked on Arctic issues. The Inuit Circumpolar Council is one of the six permanent participants of the Arctic Council, and Stotts regularly attends its meetings.

Stotts notes the disconnect between the state’s position, geared toward Arc-tic development, and that of the federal government, focused on environmental issues such as carbon dioxide reduc-tion. Stotts says he was glad that Ul-mer was chosen as the science adviser. “Fran is an Alaskan; she understands both the federal and the state’s position, and she will be a good conduit between the two.”

That Ulmer is also a member of the Nature Conservancy’s global board will help in that because it gives her credibil-ity with environmental organizations.

The next two years will be busy and challenging for Ulmer. They will also give her a chance to contribute to the important debate on Arctic issues and


OBITUARY

Editor’s Note: The team at Alaska Business Monthly joins the greater community of Alaska to pay tribute to Dan Cuddy. He graced the first cover of our magazine and we will remember his business insight and commentary throughout the years. He was a great man and he will be missed.

Alaskan pioneer Daniel Hon Cuddy passed away in Anchorage, Alaska on May 12, 2015 at the age of 94.

His was a life well lived. He was born on February 8, 1921 in Valdez, Alaska, a thriving community of nearly 500 resi-dents. His parents, Warren and Lucy Cud-dy, ventured north separately, but with the common goal of adventure. The couple met in Valdez in 1916, and quickly became an integral part of the growing territory. This spirit of adventure and commitment to being a productive part of community was instilled in Dan at an early age.

Dan had many adventures with his older brother, David and his parents. He, along with many other Alaskan legends such as Alaska’s first governor, Bill Egan, Alaska Permanent Fund Chairman, John Kelsey, judge and statehood proponent Anthony Dimond, and Anchorage Mayor George Sullivan all got their start in Valdez.

Warren was the US District Attorney for the territory, but was replaced when President Roosevelt was elected, and the politics changed. Warren moved his young family to Anchorage in 1933. A road to Anchorage did not exist, so Dan experienced his first plane ride with Bob Reeves as his pilot. Warren set up a law practice in Anchorage, a town of nearly 2,000 at the time. He began buying stock in the First National Bank of Anchorage, ultimately attaining controlling interest and assumed the role of president.

Dan attended Anchorage High School and was very involved in various school activities. Both he and his brother were

on the basketball team. Dan broke his nose during one of the games—when he ran into his brother’s head.

Dan and David continued their wild-life adventures, running a trap line along Ship Creek, duck hunting on the Cook Inlet mud flats, and sheep and moose hunting in the Chugach Mountains. As a young boy, Dan served as grounds keeper of the golf course at the Park Street and later as an employee of the Emard Pack-ing Company, rising quickly from the “slime line” to supervisor in 1938.

Dan attended Stanford University, but World War II interrupted his education. He was assigned to the 1255th Engineer Combat Battalion and advanced very quickly in rank, rising from private to captain in eighteen months. Dan fought in the Battle of the Bulge and assisted in the closing of the concentration camp at Buchenwald, Germany. Dan had tremen-dous respect for his fellow soldiers, and always referred to them as “The Heroes.”

Dan returned to Stanford after the War. He graduated with a bachelor’s degree in

Economics. Upon graduation, Dan went to law school at the University of Washington. While in law school, he agreed to a blind date with Betti Puckett. They were married the following year. Their honeymoon was a drive up the Alcan Highway, a trip where Betti naively thought she could talk this wild man from Alaska into settling down in Seattle. They continued on to Alaska. Once in Anchorage, they quickly set down deep roots. Dan clerked with Roger Cremo and Betti, new to the territory, jumped into the Anchorage community with both feet, equally leaving her imprint.

Dan’s early legal work focused on adoptions. He and Betti were a team, intent on creating the right match for the baby and parent. Dan worked in his father’s law firm until Warren’s death in 1951. Dan had to then make the tough decision of continuing his law practice or launching himself into the world of banking. He chose banking, and at age 30, Dan assumed the role of president. It is believed that Dan was the youngest bank president in the nation at the time.

Daniel Hon Cuddy passed away in Anchorage May 12

Alaska Loses Pioneer and Banking Leader


Whether it’s business as usual,

or business unusual,

Ravn Alaska can get you there. www.flyravn.com

Whatever your business, you can reduce travel costs with FlyAway

Rewards. Earn free travel quickly, to anywhere Ravn Alaska flies—from Anchorage to Atqasuk or from Kodiak to Kaktovik.

Sometimes you need boots on the ground...

...or sneakers, or Xtra tuffs, or crutches...

Dan enjoyed banking because he said, “he liked helping people, serving the com-munity, and helping it grow.” Dan grew the bank from $25 million in assets to its current size of over $3 billion. In all that time he often remarked, “he had never received a promotion!” During his tenure at the bank, he helped build businesses, rebuilt businesses after the 1964 Good Friday earthquake, witness the historic North Slope oil lease auction, and the fol-lowing boom and bust of the pipeline era.

Dan became a private pilot shortly after he and Betti married. They thor-oughly enjoyed flying to remote areas. Dan loved Alaska and respected those who chose to live and thrive in this State. He loved his family, he loved his Bank, he loved to fish and hunt, and he taught his family to share his loves.

Civic and industry organizations gave formal recognition to Dan through the years, bestowing such awards as the Anchorage Chamber’s Gold Pan award for individual achievement in 1965. In 2002, a statewide committee of civic leaders selected him Alaskan of the Year. In 2006 the Alaska State Chamber awarded him the William A. Egan Out-standing Alaskan Award.

In 2007 the Armed Services YMCA of Alaska dedicated its Welcome Center on Elmendorf Air Force Base in his name, and most recently in 2009 the Associated General Contractors of Alaska bestowed its coveted Hard Hat Award to Dan.

Dan is preceded in death by his parents, Warren and Lucy, his brother, David, his wife, Betti, and his granddaughter Nikki. He is survived by his six children and their spouses, fourteen grandchildren and their spouses, and three great grandchildren.

A memorial service was to be held at the Wendy Williamson Theater, with a recep-tion immediately following at the Lucy Cuddy Center at the University of Alaska.

In lieu of flowers, donations may be made to the Betti Cuddy Foundation by making checks payable to Betti Cuddy Foundation and mailed to the Foundation c/o Raymond James, 3401 Denali Street, Ste 103, Anchorage, AK 99503. Contri-butions may also be made in memory of D.H. Cuddy to the University of Alaska Foundation in support of the Cuddy Hall Renovation Project fund, sent to the Uni-versity of Alaska Foundation, 1815 Bragaw St., Suite 203, Anchorage, AK 99508. R

—First National Bank Alaska


ECONOMY

North Dakota Pays Its Way with Much More Than Just Oil and Gas Taxes

By Larry Persily

Many Alaskans want their state to be more like North Dako-ta—for all that oil production

that moved the northern Great Plains state ahead of Alaska as the nation’s second biggest oil producer.

But be like North Dakota for personal taxes?

Thinking about buying a new car or truck in North Dakota? Add in $1,500 for the 5 percent state tax on a $30,000 pickup truck. And you’ll owe state in-come tax on the wages you earn to pay for that new truck (used trucks, too).

You’ll also see the tax difference when you fill up at the pump. North Dakota collects twenty-three cents a gallon on gasoline and diesel. Alaska’s rate is just eight cents a gallon—it was the same eight cents back in 1961.

Prefer flying your own plane to driv-ing? There is a 5 percent state tax on the purchase price or market value of air-craft registered in North Dakota (just 3 percent if the plane is used for agricul-tural purposes).

It may surprise Alaskans to know that North Dakota’s general fund—the same kind of discretionary money that Alaska legislators, the governor, and the public battle over every year—gets far more of its revenue from sales tax, personal income tax, and motor fuel tax than it does oil and gas production and extraction taxes. Most of North Dakota’s oil and gas revenue goes into savings or designated spending ac-counts: a larger percentage than Alaska deposits into its Permanent Fund.

North Dakota’s diversified income stream helps protect public services from painful budget cuts when oil prices are low.

To fully understand, let’s start at the wells and work our way to the dollars.

A PrimerAlaska North Slope producers are ex-pected to pump an average 508,000 barrels of crude per day in the state fiscal year ending June 30, according to the Department of Revenue’s spring forecast. That means the trans-Alaska oil pipeline is three-quarters empty from its peak flow in 1988.

More than 2,100 air miles to the southeast, the Bakken Shale oil and gas

play in North Dakota is booming, remi-niscent of Alaska’s heydays of the 1970s and 1980s. In January of this year, North Dakota produced an average 1.2 million barrels of oil per day—almost 13 percent of total US production—according to the US Energy Information Administration. Only Texas produces more.

Though painfully low oil prices have idled drilling rigs—leading the energy information agency to predict Bakken production will slip backward just a bit, at least through May—North Dakota is still counting a lot more oil and gas dol-lars than Alaska.

The Peace Garden State—named for the border park it shares with the Ca-nadian province of Manitoba—collects 5 percent tax on the gross value of oil production and a 6.5 percent extraction tax, also on the gross. The state website explains the production tax “is imposed in lieu of property taxes.”

Like Alaska, North Dakota has its share of tax incentives. Some wells can qualify for a 4 percent extraction tax rate

Though painfully low oil prices have idled drilling rigs— leading the energy information agency to predict Bakken production will slip backward just a bit, at least through May—North Dakota is still counting a lot more oil and gas dollars than Alaska.

SOU

RCE:

Sta

te o

f Nor

th D

akot

a “E

xecu

tive

Budg

et 2

015-

2017

Bie

nniu

m”

How the State of North Dakota allocates collected oil and gas taxes.


and some wells in the Bakken can get a 2 percent rate. The reductions and/or ex-emptions can apply to new wells, work-over wells, stripper wells, inactive wells brought back to life, horizontal re-entry wells, and enhanced-recovery wells.

The production tax on natural gas varies, and is set each year depending on prices. It’s at about ten cents per thousand cubic feet for the state fiscal year ending June 30. That’s even lower than the kindly production tax rate charged on Alaska’s Cook Inlet gas.

The state royalty share is not the is-sue in North Dakota that it is in Alaska, since the 39th state generally doesn’t own the subsurface rights to oil and gas like we do in the 49th state.

With its 1.2 million barrels of oil per day, plus substantial gas production—even though North Dakota producers are still flaring more than one-quarter of their gas due to a lack of processing and pipeline capacity to get the fuel to market—the state in January predicted it would average more than $2 billion a year in total oil and gas tax revenues for the 2015-2017 two-year budget cycle.

That’s similar to Alaska’s total state

take. North Dakota state officials based their January forecast on oil averaging $45 to $65 a barrel the next two years, also similar to Alaska’s spring forecast of almost $57 for next year.

And just as Alaska’s unrestricted general fund oil and gas revenues fell by more than half from fiscal 2014 to 2015 as oil prices plummeted, North Dakota’s projected revenues for 2015 to 2017 fell by almost half from earlier es-timates based on oil in the $80 range.

But while the Alaska legislature and governor are cutting spending—and talking of more cuts in the future—North Dakota Governor Jack Dalrym-ple in December 2014 proposed a 5.4 increase in state general fund spending for 2015 to 2017. The governor proposed additional funding for roads, law en-forcement, school construction, state parks, early childhood education, and housing, although all that was based on oil in the $74 to $82 range and a forecast of a big jump in sales tax dollars.

Certainly, North Dakota legislators were not likely to approve all of the gov-ernor’s requests by their end-of-April adjournment deadline, especially with

low oil prices. But with a more diver-sified state revenue stream, their task likely was easier than the budget-cut-ting stress endured at the same time by Alaska legislators.

North Dakota’s ‘Other’ Tax Revenue

Just how much does North Dakota earn from income and sales taxes, and how much do residents pay?

Let’s say residents living in North Dakota earn the median household income of almost $54,000 a year. They would pay a state income tax of 1.22 percent on the first $30,000 to $60,000, depending whether they are single or married. The next tax bracket would cost 2.27 percent of their taxable in-come, working up to the 3.22 percent bracket when they near $400,000.

At $54,000 a year, single, standard deduction, an individual’s income tax would be about $650. If he or she is married, filing jointly, with a combined taxable income of $100,000 a year, the tax bill would be over $1,600. Pull in $150,000 a year in taxable income and a married couple could owe almost $2,900.

Alyeska Resort is Alaska’s favorite place to meet. Just 40 miles south of Anchorage, Alyeska offers an unmatched meeting experience without leaving home. With a

301-room hotel, over 13,000 square feet of function space and dedicated cateringand conference services team, Alyeska Resort will leave you inspired.

©K

enG

raha

mPh

otog

raph

y

Alyeska invites corporate meetingplanners for a personal property site tour. Please contact the Sales team for details.Director of Sales – LenElla [email protected] | 907-754-2211

AlyeskaResort.com 800-880-3880


Perhaps not surprising, considering the state’s oil wealth, a legislator this year proposed setting the income tax rate at zero. If he had succeeded, North Dakota would have been the first state to do that since Alaska eliminated its personal income tax in 1980 as oil dol-lars gushed into its treasury.

North Dakota has had an income tax since 1919. The chair of the state Sen-ate Finance and Taxation Committee, commenting on the legislation and the state’s history of income tax, sales tax, and energy taxes, said he wasn’t sure if the state would be stable “on a three-legged tax stool that has one less leg.”

The North Dakota Office of Manage-ment and Budget estimated—before the oil-price collapse—almost $430 million a year for the 2015 to 2017 budget cycle from personal income taxes, almost 16 percent of state general fund revenues.

But that’s dwarfed by the state’s sales and use tax. At 5 percent on most goods and some services, the state expects to earn about $1.5 billion a year in the next budget cycle from sales tax—more than half of its general fund revenues.

That’s 5 percent on most of what is bought each day, including communi-cation services. And there is no cap or maximum. It’s 5 percent on a $1 pen and 5 percent on that $30,000 truck.

Municipal and county sales taxes are on top of the state rate. The city tax rates fall between 1 percent and 3 percent.

More than one hundred Alaska cit-ies and boroughs collect a general sales tax, but not the state’s two largest cit-ies (Anchorage and Fairbanks) and not the state. The highest rate in Alaska is 7 percent in Wrangell, with ten munici-palities tied for second at 6 percent.

Like Alaska, property taxes belong to municipalities in North Dakota, be they counties, cities, townships, school dis-tricts, and other taxing districts. And, as in Alaska, property taxes can be con-tentious in North Dakota, where voters in 2012 were asked in a ballot measure if they wanted to amend the constitu-

tion to eliminate property taxes, filling the gap with oil dollars and state sales tax dollars. The measure failed by more than a 3-to-1 margin.

The state chamber of commerce presi-dent told reporters after the vote that he wasn’t surprised by the wide margin of de-feat. “It’s a very conservative state and we like it that way … It’s just the culture here.”

Oil and Gas RevenueAnd where does oil and gas fit into North Dakota’s general fund revenue stream? Just $150 million a year will go into the general fund out of an estimat-ed $2 billion a year in total oil and gas revenues the next two years. That $150 million is just a few percentage points of ongoing state expenditures. It’s the law.

“It is important to remember that our ongoing general fund spending is limit-ed to $300 million [per two-year budget cycle] in oil and gas tax revenues as pre-scribed in state law,” Governor Dalrym-ple said in his December 3, 2014, budget address to lawmakers. That helps shield ongoing general fund spending from the volatility of oil prices.

“The remainder of oil tax revenues … is dedicated to a number of special purposes as required by the constitu-tion and state statute,” the governor ex-plained. Here again, Alaska is different, in that its constitution bans dedicated funds—except for those that already existed at statehood and the Permanent Fund, approved by voters in a 1976 con-stitutional amendment.

In North Dakota, oil and gas dollars are diverted to several funds, includ-ing income-producing endowments and designated accounts for ongoing government programs. They’re just not part of the general fund.n The Legacy Fund is a constitution-ally protected savings account similar to the Alaska Permanent Fund—but without the dividends.

Approved by voters in a 2010 consti-tutional amendment—as Bakken Shale dollars were starting to gush—the

Legacy Fund receives 30 percent of all production and extraction tax dollars. That looked to be $1.8 billion for the 2013-2015 budget cycle, according to the state’s March 2015 forecast. If that forecast is accurate, the fund would end the fiscal cycle on June 30 with about $3.5 billion. The fund is invested in stocks, bonds, and real estate, just like Alaska’s oil-wealth savings account. Re-vised lower-oil-price projections show it still could grow to $5 billion by the end of the 2015-2017 budget.

The Alaska Permanent Fund, which has been receiving a share of the state’s royalty take—not production taxes—since 1977, was at almost $55 billion as of April 16.

Rules for SharingThe other key difference between the two states’ savings accounts—besides the size and Alaska’s individual divi-dends—is what to do with the money in the future. The North Dakota consti-tution says the principal and earnings of the fund may not be spent until after June 30, 2017. After that date, earnings on the fund are automatically trans-

ferred to the state general fund, but any expenditure of principal after that date requires a vote of at least two-thirds of the members of each legislative cham-ber. And if lawmakers want to with-draw money, the constitution limits them to not more than 15 percent of the principal in a two-year budget cycle. n The Strategic Investments and Im-provements Fund was created by the Legislature in 2011 and is funded with a portion of production and extraction taxes, varying each year with oil prices and revenues to the state. In December 2014, before the oil-price collapse had really messed up budget projections, the fund was estimated to end the fiscal cycle on June 30, 2015, with $1.1 billion.

The governor in December proposed a massive program of increased spending for roads, streets, airports, water systems, flood control, and even a $300 million loan fund for new school construction

In North Dakota, oil and gas dollars are diverted to several funds, including income-producing endowments and designated accounts for ongoing government programs.

They’re just not part of the general fund.


ernor, would be shared 30 percent for the Legacy Fund; 29 percent for politi-cal subdivisions (counties, cities, school districts and tribes); 19 percent to con-stitutionally dedicated accounts; al-most 17 percent to statutorily dedicated accounts; and 3.6 percent to the state general fund.

North Dakota carves up its oil and gas revenues into special accounts much more than Alaska. But like Alaska, the plains state will have to cut back on the carving board as oil prices shrink the size of the meal. R

Larry Persily is a former federal coordinator for Alaska North Slope natural gas pipeline projects; a former deputy commissioner at the Alaska

Department of Revenue; a former longtime journalist; and currently working as a special assistant to the mayor of the Kenai Peninsula Borough for oil and gas issues.

in rapidly growing districts. “Economic growth cannot be sustained without stra-tegic investments in infrastructure,” the governor said in his budget address.

But low oil prices may curtail those investments. Whereas the state expects the Strategic Investments and Improve-ments Fund will collect about $1 billion in the two-year budget ending June 30, in March it predicted just $200 million in deposits in the 2015-2017 cycle.n The Common Schools Trust Fund dates back to statehood, when the feder-al government granted North Dakota 2.5 million acres for the support of schools.

Much of the land was sold over the years, but income from the remaining land (which includes oil lease and roy-alty revenues from trust land), plus a percentage of oil extraction tax dollars, plus a share of the state’s slice of the na-tionwide tobacco litigation settlement, has put about $3 billion away for safe-keeping. The principal cannot be spent. Instead, 5 percent of the five-year aver-age of the fund is appropriated each year to help pay for schools in North Dakota.

There also are several other funds that share in oil and gas tax dollars:

A Property Tax Relief Fund, which the governor proposed using in the 2015-2017 budget to reduce county property taxes by 12 percent.

The Resources Trust Fund, approved by voters as a constitutional amendment in 1990. The fund helps pay for water projects and energy conservation initiatives.

An Oil and Gas Research Fund receives 2 percent of the state’s oil extraction tax revenues, up to a maximum of $10 million per budget cycle.

An Oil and Gas Impact Grant Fund, created by the Legislature in 1998 to help areas most heavily impacted by development.

In addition, a big share of production tax dollars are distributed to counties, cities, townships, and school districts—recently, several hundred million dol-lars a year.

Tribes also receive a share of produc-tion tax and extraction tax dollars.

In total, oil and gas tax revenues for 2015 to 2017, as proposed by the gov-


Ajax Engineering, Inc. was owned equally by Matt and Jeff, both in their mid-forties. Shortly after

celebrating the tenth anniversary of the firm, Jeff left for a fall hunting trip with some of his college buddies. He never re-turned. A tragic accident occurred dur-ing the hunt, killing Jeff instantly. Matt suddenly had lost his longtime business partner. What’s more, after Jeff’s estate was settled, Matt found himself with a new co-owner, Jeff’s wife.

Absolute chaos resulted. Jeff’s wife had no training or experience in engi-neering, let alone in running a firm. She was focused on income for living ex-penses and upcoming college education expenses for her three children. How-ever, Jeff’s assets were virtually all tied up in the business and it was the income from his work product and business profits that was providing family life-style income. He had few assets outside his business interest and little life insur-ance. Unfortunately, they were left with little choice but to sell the company on short notice for just a fraction of what it was really worth as a going concern.

Both this business and family trag-edy could have been avoided. A buy-sell agreement and proper funding could have saved their business while pro-viding needed income for Jeff’s family after his death. Buy-sell agreements lay out how ownership will change hands and how the transfer will be paid for in case of a co-owner’s death, disability, or retirement. Typically, the agreement provides for the purchase of the depart-ing shareholder’s stock by the surviving shareholders or the company itself.

Properly designing and funding a buy-sell agreement may achieve the following objectives: Avoid liquidation of the business Replace lost income to a deceased

owner’s family Set a purchase price that fixes the

estate tax value of the decedent’s stock

Indicate the continued stability of the firm to customers and creditors

Life Insurance FundingThe first step, of course, is designing and drafting the agreement. However, the agreement in and of itself will have lim-ited practical benefit unless the purchas-er can afford to buy the deceased own-er’s shares. Life insurance is often used as the preferred source of cash. When a business owner dies, the policy proceeds are received tax-free and in turn used to buy the shares from the deceased owner’s estate at a price set forth in the agreement. The “cost” of the purchase is not the purchase amount, but the sum of premiums paid, a fraction of the ac-tual amount of money transferred. There are two basic types of buy-sell arrange-ments: the “cross-purchase” agreement and the “stock redemption” agreement. Life insurance can be used to fund both.

Cross-Purchase AgreementIn Matt and Jeff’s situation, each of them buys (and is the owner and bene-ficiary of) a life insurance policy on the other. Upon Jeff’s death, Matt receives the policy’s death benefit, which he uses to purchase Jeff’s shares from Jeff’s es-tate. In turn, that cash payment gives Jeff’s family needed income to offset the loss of his earnings.

Cross-purchase plans have several advantages. For example, the surviving shareholder receives a “step up” in the income tax basis for the stock bought

from the deceased’s estate. This could reduce income taxes when the surviving shareholder subsequently sells the stock. Additionally, with cross-purchase agree-ments, the insurance proceeds are not subject to the corporate AMT, or alter-native minimum tax, nor to the claims of corporate creditors. A disadvantage of these plans is that they can be hard to administer if there are many owners. Since the shareholders individually own policies on the lives of their fellow share-holders, multiple policies would be re-quired in a situation where there are sev-eral shareholders. For example, if there were four shareholders, twelve separate insurance contracts would be needed.

Stock Redemption AgreementIn this situation, Ajax Engineering, Inc. buys and owns insurance policies on the lives of Matt and Jeff. When Jeff dies, the corporation buys his stock with the insurance proceeds. The stock is subse-quently retired as “treasury stock” (ab-sorbed back into the company). Stock redemption plans may make sense when there are multiple owners of the corporation, there are large differences in age and ownership levels among the owners, or the corporation is in a lower tax bracket than the owners. Two poten-tial drawbacks to these plans: the death proceeds received by the corporation may be subject to the corporate AMT and the surviving shareholders do not get the benefit of an increase in the in-come tax basis of their shares when the corporation redeems the stock.

Hybrid Agreement— ‘Wait & See’—Buy-Sell

This agreement is structured much as it says—shareholders can wait and see whether to use the cross-purchase ap-proach or the stock redemption approach until a trigger event such as death or disability occurs. It is basically an agree-ment with a first right of refusal. The first option to purchase is extended to the sur-viving shareholder(s). If this option were to be exercised, the transaction would oc-cur under the cross-purchase scenario. If this first option were not exercised by the surviving shareholder(s), the company would be required to purchase the busi-

BUSINESS SUCCESSION AGREEMENT BASICS

Cross Purchase, Stock Redemption, Wait & See… oh my! What does all this mean?By Mel B. Bannon


Mel B. Bannon, CLU, ChFC, RFC, CA Insurance License #0412338, is a registered representative of Lincoln

Financial Advisors Corp. Securities offered through Lincoln Financial Advisors, Corp., a broker/dealer (Member SIPC). Investment advisory services offered through Sagemark Consulting, a division of Lincoln Financial Advisors Corp., a registered investment advisor. Insurance offered through Lincoln Marketing and Insurance Agency, LLC and Lincoln Associates Insurance Agency, Inc. and other fine companies. 31111 Agoura Rd., Ste. 200, Westlake Village, CA 91361 (818) 540-6967. This information should not be construed as legal or tax advice. You may want to consult a tax advisor regarding this information as it relates to your personal circumstances. CRN-1139488-030315

ness interest from the deceased share-holder’s estate. This transaction would amount to a stock redemption.

Minimize TaxationNot knowing what the future may hold for corporate vs. individual tax rates, step-up in basis rules, AMT legislation, or capital gains tax rates, having the flexibility to define the sales transaction as a cross purchase or stock redemption often provides the best of both worlds. Whichever approach best fits the share-holders’ needs, based on the facts and circumstances when the sale transac-tion occurs, can be used, thus minimiz-ing taxation and providing for a seam-less transition of business control.

Buy-sell agreements can help protect your business and your family. Seek the guidance of a professional financial adviser who can identify the various is-sues and considerations that will help determine what type of buy-sell agree-ment makes the most sense for you. R

Good people make great lawyers.

To be a great lawyer in Alaska, you first need to understand Alaska.We’re part of this state, and the business and public entities thatwork for its people. Whether it’s mergers and acquisitions, realestate, government, Native Corporations or finance, business is our business. n We have the talent you’re looking for in anattorney, and the experience you need to succeed. Simply put, we know Alaska.

Anchorage 907.276.5152

LBBLawyers.com

A l a s k a n O r e g o n

Bob HumeAlaska Native and Business Law

Simply Great Lawyers.

Landye_Hume_AKBusMon_2013_Layout 1 12/20/12 10:50 AM Page 1


Pass-Through and Disregarded Business Entities

A tax advantage Alaskans should know about

Legal Speak By Andrea N. Canfield

Every business—regardless of the size, the number of employees, or the industry—is subject to

state and federal tax. For this reason, all business owners at some point will ask the same question: how can my business pay less in taxes? Surprisingly, the answer may be as simple as using Alaska residency as part of their tax planning strategy.

Alaska, after all, is one of only two states in the Union that offer both no income and no state sales tax to its resi-dents. Additionally, Alaska’s overall tax burden ranks among the lowest in the country at about 7 to 7.5 percent annu-ally. These tax advantages, which gen-erally benefit the individual taxpayer, can also be used to benefit businesses as well.

Pass-Through EntitiesConsider the tax implications of the four main types of business entities: corporations (which can be taxed as either C corporations or, under cer-tain circumstances, S corporations), sole proprietorships, partnerships, and limited liability companies (LLCs). For both federal and state income tax pur-poses, the C corporation is a separate entity from its shareholders, the own-ers of the corporation. As a result, the profits of a C corporation are subject to double taxation: first at the corporate level when income is earned and again at the individual shareholder level when profits are distributed or stock is sold. In contrast, S corporations, sole proprietorships, partnerships, and LLCs are not automatically treated as separate entities for federal or state in-come tax purposes. The profits realized

by any of these four types of entities can pass to the individual owners without first being taxed at the corporate level. Thus these entities, commonly referred to as “pass-through entities,” offer the advantage of avoiding the double taxa-tion that applies to C corporations. This tax advantage is even more valuable to Alaska resident business owners who can also escape owner-level income tax.

It is relatively easy to form a pass-

through entity. If a company operates as a partnership, sole proprietorship, or LLC, the default is to treat that compa-ny as a pass-through entity. A domestic LLC with more than one owner can, however, ignore the default and elect to be treated as a corporation. In contrast, the owners of an S corporation must af-firmatively elect pass-through status. Fortunately, the election process is rela-tively simple.

Accounting for the income of a pass-through entity is not as simple. The owner of a pass-through entity must prepare and file a separate income tax return despite the fact that business in-come will be reported on the individual owners’ tax return.

Disregarded EntitiesJust as corporations are owned by shareholders, LLCs are owned by mem-bers. A multi-member LLC is, as dis-cussed above, a pass-through entity unless it elects to be treated as a corpo-ration. If the entity is a single-member LLC, however, the default is to treat the entity as disregarded.

Disregarded entities are in some re-spects very similar to pass-through entities. Both types of entities are pass-through entities insofar as they are not themselves subject to federal and, in

Andrea N. Canfield

Alaska, after all, is one of only two states in the Union that offer both no income and no state sales tax to its residents. Additionally, Alaska’s overall tax burden ranks among the lowest in the country at about 7 to 7.5 percent annually. These tax advantages, which generally benefit the individual taxpayer, can also be used to benefit businesses as well.


Andrea N. Canfield is an attorney with Stoel Rives LLP whose practice focuses on counseling Alaska-based clients in general commercial transactions and mergers and acquisitions. Contact her at [email protected].

Alaska, state entity-level income tax. The Alaska resident owner of a pass-through or disregarded entity can avoid owner-level income tax. Both types of entities can be formed easily with the use of the applicable election or default tax treat-ment. Finally, and perhaps most impor-tantly, both entities provide liability pro-tection to their owners. If, for example, a pass-through or disregarded entity is sued, the owners are not personally li-able for any liabilities of the entity. De-spite these similarities, however, several distinctive characteristics have enabled disregarded entities to grow in popular-ity among business owners.

As a disregarded entity, for instance, the assets and income of the entity are treated as the assets and income of the member. The member essentially owns every item that is purchased, sold, or acquired by the entity. Additionally, unlike owners of pass-through enti-ties, the sole member of a disregarded entity generally is not required to file a separate tax form. The income tax con-sequences related to the operation of a disregarded entity are accounted for on the tax return of the owner.

ConclusionWith increased pressure to cut costs and improve efficiency, business owners are constantly searching for simple ways to save money. Many business owners have found the tax advantages provided by pass-through and disregarded enti-ties to be the perfect solution. This is certainly true in Alaska, where over 70 percent of the new or newly regis-tered businesses in 2014 claimed pass-through or disregarded status. This statewide popularity is arguably due to the added benefit pass-through and disregarded entities provide Alaska resident business owners. R

Disclaimer: This article is limited in scope and in detail. Please consult a professional before choosing a business entity.

www.AlaskaSleepDoctor.com

Helping Alaskans get safe and sound sleep for over 30 years

Everyone deserves a good night sleep. Snoring could be sign of sleep apnea where you stop breathing briefl y or a lot. A simple home sleep test done in the comfort of your home is the fi rst step for diagnosis of a sleep disorder and required by insurance companies.

Our sleep technologists use the latest CPAP/APAP machines for treatment and advanced wireless technology allows us to monitor our patient’s progress. We also work with healthcare providers across Alaska. Call the AlaskaSleepDoctor today to be on your way towards the best sleep you’ve had in a long time!

CONDITIONS AT RISK FOR SLEEP APNEA

Anchorage: 907-743-8987 • Juneau • Wasilla • Toll Free : 888-503-8131

Obese/OverweightHigh Blood Pressure Heart DiseaseCoronary Artery Disease Atrial FibrillationHeart IrregularitiesStroke

DiabetesDepressionAnxietyMood DisordersFatigueSleepinessInsomniaMemory Diffi culties

...ZZZZ...ZZZZ...ZZZZ...ZZZZ......ZZZZ...ZZZZ...ZZZZ...ZZZZ......ZZZZ...ZZZZ...ZZZZ...ZZZZ...ZZZZ...ZZZZ...ZZZZ...ZZZZ...ZZZZ...ZZZZ...ZZZZ...ZZZZ...ZZZZ...ZZZZ...ZZZZ...ZZZZ...

SNORE NO MORE! CALL THE SLEEP DOCTOR – DR. JOHN KREHLIK TODAY!

ZZZZ...ZZZZ...ZZZZ...ZZZZ...ZZZZ...ZZZZ...ZZZZ...ZZZZ...ZZZZ...ZZZZ...ZZZZ...ZZZZ...

Dr. John Krehlik -the AlaskaSleepDoctor

At Alaska Spine Institute our goal is to getour patients back to life, work & play.

alaskaspineinstitute.com

(907) 563-8876 (866) 637-3422

• Sports Medicine• Back and Neck Pain• Physical Therapy

• Pain Management• Physical Medicine• Electrodiagnostic Studies

Our services include but are not limited to:

Our Sta�:• Dr. Larry Levine • Dr. Michel Gevaert• Dr. Shawn Johnston• Dr. Sean Taylor• Dr. Erik Olson• Dr. Jared Kirkham• Shawna Wilson ANP-C


FISHERIES

Troll caught salmon in Southeast Alaska.

© Chris Miller / Courtesy of Alaska Seafood Marketing Institute

Wild Alaska Salmon Advantages Go Beyond Taste and Texture

Wild Alaska Salmon Advantages Go Beyond Taste and Texture


Most people agree that competi-tion is good for any industry, leading to innovation and ef-

ficiency. But try telling that to a glum-faced Alaska salmon fisherman circa 2000; it’d be a tough sell.

In the 1990s, Atlantic salmon raised on fish farms flooded the retail market and the price of Alaska wild salmon crashed. The fish farms could offer a fresh whole fish or custom fillets, butchered and shipped immediately and available on de-mand. While the Alaska wild product was intrinsically superior, Alaska processors could offer only frozen product or fresh product available just part of the year.

The situation grew dire when Alaska’s wild salmon runs underperformed and ceded even more market share to the

farmed fish that were streaming into the United States from Norway, Scot-land, Chile, Canada (via British Colum-bia), and other coastal nations.

“The growth of the salmon farms was prolific,” says Tyson Fick, communica-tions director for the Alaska Seafood Marketing Institute (ASMI). “That real-ly culminated into desperate times for the wild salmon market in late 1990s and early 2000s.” During that time, the industry lost more than half of its fish-ermen and processing companies.

Alaska’s fishermen, processors, mar-keting boards, and the state and federal government responded to the economic emergency and have achieved an al-most complete turnaround. Today, the industry enjoys high prices for both fish and fishing permits. Although farmed salmon dominates today’s market worldwide, the market for wild Alaska salmon is healthy and growing. The Alaska product fetches premium prices.

Fishermen have embraced such tech-nical innovations as chilled seawater holds and consistent bleeding and icing of fish at sea. Processors have developed consumer-friendly products and packag-

ing and have greatly improved the qual-ity of their fresh and frozen offerings.

Eric Jordan, a salmon troller in Sitka, remembers receiving only about $1 per pound for “beautiful, troll-caught king salmon” in 2002–2003.

In the winter of 2014–2015, he scored $11 per pound for king salmon that was shipped fresh. “We can hardly afford to eat our own fish,” Jordan says.

Charity Begins at HomeThe story of Kodiak-based purse seiner Bruce Schactler illustrates some of the changes in marketing Alaska wild salm-on. Schactler says he started as a “simple salmon fisherman” who also was reeling from the low prices he was paid for his catch. Today, Schactler is the director of ASMI’s Global Food Aid Program.

In the mid-1990s, Schactler joined an ASMI program that sent a small army of Alaskan fishermen to supermarkets in the Lower 48 to offer samples of their salmon to customers. Schactler was sent to stores in Cincinnati and Dayton, Ohio. While the fishermen told stories to customers, cooks sautéed coho fillets on a portable cooktop.

Price crash in 2000 led to industry innovations and superior productBy Will Swagel


“They couldn’t cook fast enough, there was always a line,” Schactler says. “The customers wanted to hear the sto-ries and sample the fish.” He says the store demonstrations were backed up by radio interviews and articles and ads in local newspapers.

“[The promotion] was quite success-ful,” he says. “It was the beginning of a new type of marketing effort for the state. At the time, we were trying to figure out anything that would stem the flow [of market share to farmed salmon].” They studied opportunities in product development, quality, infra-structure improvement, and govern-ment regulations and legislation.

In 2003, Schactler became concerned about a growing glut of canned salmon. He began working on a plan to change the industry through new markets and program development, which received the enthusiastic go-ahead from then-Governor Frank Murkowski.

Schactler says the subsequent cre-ation of the Alaska Fisheries Market-ing Board by then-US Senator Ted Ste-vens—using his ideas and legislation to create it—was a major contributor to the surge in new product development in the salmon business.

Schactler promoted Alaska canned salmon to domestic and international aid agencies. Canned salmon provides excellent protein, has a long shelf life, doesn’t need potable water or cooking, and is kosher, meeting the dietary re-strictions in some parts of the world. This last year, more than a million cases of canned salmon were sold to domestic and international feeding programs.

“In the world of food aid, it is almost a luxury item, but nutritionally, it is pure rocket fuel,” he says.

“Our Global Food Aid Program has expanded a lot in the last thirteen years,” says Schactler. “[And] I think we have probably expanded commercial

sales around the world because of it.”The theory is that introducing new

customers to canned Alaska wild salm-on can pay dividends in the future.

“There’s a saying,” Schactler says. “A country today that is a food-aid country today will, in the future, be a customer.”

While canned salmon is an excellent food, it is heavy to ship and has grown more expensive as the price of Alaska wild salmon has increased as much as fivefold and quadrupled at retail.

Schactler is among those developing new products for the food aid communi-ty, including a protein powder made from salmon (or other fish). The powder, easy to transport, could take the place of meat in stews or soups. Manufactured from fish heads and frames, the powder is 65 percent to 90 percent protein and can be fortified with trace elements, such as iron.

“The protein powder has been ex-tremely well received so far by those who are eating it,” he says. “People around the

Canning wild Alaska salmon� Courtesy of Alaska Seafood Marketing Institute


world are watching and waiting to see when this is a product they could buy.” The protein—along with canned her-ring—is being tested in pilot projects in Africa. Schactler says both products are proving easy to use and nutritionally rich.

McSalmon This kind of innovation in the wild salmon industry is apparent industry-wide. A good example is Trident Sea-foods’ best-selling salmon burgers.

John Salle, Trident’s vice president of marketing and innovation, says devel-opment of the burger was in direct re-sponse to the flood of farmed fish and the need to find new markets, especial-ly for pink salmon.

“To compete with farmed salmon, you have to put your finished product in a form that’s easy to prepare and convenient for consumers,” Salle says. Studying the market and armed with matching grants from the Alaska Fish-eries Marketing Board, Trident decided to throw itself into producing a high-quality salmon burger.

Previously, Salle explained, the ma-jority of salmon burgers on the market

were created as a way to utilize the less-choice parts of the fish, like trimmings and bellies.

“We started from scratch and asked ourselves if we were going to make a great-tasting salmon burger, what would we do? So, instead of using trim-mings we actually used top-quality whole fillets of both pinks and chum salmon,” he says.

Today, the company uses tens of mil-lions of pounds of Alaska pink and chum salmon in their burgers. The burgers are sold nationwide, including in major store chains like Costco. Tri-dent is now producing an Alaska pol-lock burger as well.

But the company’s innovative push didn’t stop with burgers. In addition to creating “exact weight” portions of pink and keta (another term for chum, based on its scientific name) salmon, Trident began producing a fully-cooked, grill-marked, pink salmon fillet that restau-rant operators can simply thaw and serve in sandwiches, salads, and teriyaki bowls.

“We’ve taken virtually all the work out of serving wild Alaska salmon and provide an exciting new menu option to

restaurants that don’t have the exper-tise or the equipment to cook it,” Salle says. “So even a deli can now serve a poached salmon sandwich—they don’t even need a stove.”

Trident has made other changes to improve Alaska wild salmon’s conve-nience with its recent introduction of a ready-to-eat, individually-packaged cream cheese-filled salmon stick under its popular Louis Kemp brand.

“Full utilization of the resource is the other leg of sustainability and the right thing to do,” Salle says. “Products such as our Alaska Naturals crunchy pet treats and Pure Alaska Omega oil sup-plements for people are utilizing more of what we catch and filling other voids in the marketplace.”

Salle says Trident’s wild Alaska salm-on oil is cold-pressed and extra virgin and is superior to many other fish oil supplements.

Emergency FundingWhile fishermen and processors made profound investments to improve their product, they also received help from both Juneau and Washington, D.C.


Rendering of the water-powered fish carcass grinder designed by Alexandra West.Courtesy of PND Engineers

Alexandra West, staff engineer at PND Engineers, Inc. and University Honors College graduate with a civ-

il engineering degree from the University of Alaska Anchorage (UAA), was awarded US Patent 8,833,682 B2 for designing a water-powered fish carcass grinder aimed at lowering the interactions be-tween fishermen and wildlife.

Inspired by life growing up along the Kenai Peninsula with a father who was the former manager of the Kenai National Wildlife Refuge, West was raised knowing the con-cerns of minimizing human and bear interactions during the summer sockeye salmon runs.

Along the major fishing zones of the Kenai and Russian rivers, fishermen discard fish car-casses in the water that end up downriver, attracting bears and eventually leading to dangerous human-bear interactions. State, federal, and tribal entities have tried to encourage fishermen to use hand-powered grinders, chopping disposable fish parts into small pieces, packing the fish whole, and by completely removing fillet tables along the river.

“Fish and Game currently tells anglers to ‘stop, chop, and throw,’ involving filleting your fish, chopping the carcass into small pieces, and then throwing them into fast-moving water. Chunks still get caught up in eddies and end up on the banks, and it’s a tasty treat for bears,” West says.

As a senior undergraduate thesis project for UAA’s Honors College, West decided on making a disposal system that would grind fish carcasses near the banks of the river using a hydro-pow-ered device connected to a generator.

“It’s a floating, paddle wheel device in the river. The angler would fillet the fish on the table and then throw it down a slide that would send the remains through a grinder encased in a hopper. The de-vice would then grind up the fish and be placed back into the water,” West says.

West conceptually designed and sketched the device in 2011, and UAA Vice Provost for Research and Graduate Studies Dr. Helena Wisniewski approached her to pursue a patent. UAA paid for the initiation fees, attorney fees, and patent upkeep. Af-

ter receiving her patent on Sep-tember 16, 2014, West became the first student to earn a place on UAA’s Patent Wall of Fame.

Although the patent went through in 2014, West is still working with current civil se-nior design and senior me-chanical engineering students at UAA to fine-tune her design with hopes to fabricate a pro-

totype this summer, she says. UAA engi-neering students Brandi Opsahl, Jennifer Baker, and Nathan Harris are fleshing out the design details of materials used, di-mensions, and cost estimates.

Permitting now plays a major role in whether the project will become a real-ity this summer.

“The US Forest Service has a chunk of land, and then right on the edge where we want to put [the fish grinder] the land transfers to the US Fish and Wildlife Service,” West says. “They’re all excited about it, but it just requires coordination, money, permitting, and testing in order to get this up and running.” R

Patented Fish Grinder Designed in Alaska

By Russ Slaten

Russ Slaten is an Associate Editor at Alaska Business Monthly.

West

Now retired from the Alaska Legis-lature, Alan Austerman represented Kodiak in the House of Representatives between 1997 and 2003 and again from 2009 to 2013. For four years in the in-terim, he went to work as Murkowski’s fisheries policy advisor, just about at the low point of Alaska salmon.

“He basically put me in charge and told me to go fix it,” Austerman says.

In Juneau, Murkowski appointed a subcabinet group composed of represen-tatives of various state agencies, includ-ing the Alaska Fish and Game and Com-merce departments. In Washington, Stevens secured $35 million in federal funds to deal with the salmon emergen-cy. Austerman’s group identified an-other $15 million in Alaska Department of Fish and Game funds (not spent ad-ministering the transboundary Pacific Salmon Commission) that was diverted to the emergency marketing effort.

Austerman says more than $7 million was paid directly to fishermen and coastal communities to help “make them whole.” The rest of the money was distributed to those industry stakeholders who wanted to re-tool their operations. The stakehold-ers were asked to put up their own money as well. He estimates the $50 million in emergency funds probably resulted in in-dustry investments of $130 million.

ASMI responded to the emergency by reforming itself. The group’s governing board was restructured, from having more than two dozen seats to having only seven. This move, Austerman says, encouraged the larger seafood compa-nies to send higher level executives to meetings and allowed more effective decision making.

Today, the ASMI board is working on ways to get Alaska wild salmon better rec-ognized in the European market as a sus-tainable product. In April, a large group of Alaska seafood producers who had left the Marine Stewardship Council three years ago decided to rejoin. They hope the certification, along with an ASMI-connected program known as Respon-sible Fisheries Management, will help sell more salmon in Europe by offering buy-ers a wide choice of certified options.

Taste ProfilesJordan also participated in ASMI’s “fish-ermen in the stores” promotion, serving samples of chum salmon to customers in


Dallas, Texas. A lifelong, second-genera-tion fisherman and an active member of fisheries advisory groups, Jordan is clear-ly proud and excited about the changes he has seen in his industry of late.

There has been wide adoption of methods—like bleeding and icing fish at sea—that greatly boost quality. Fisher-men who used to store their fish in dry holds now store their fish in chilled sea-water. Chain-of-custody systems—like computer tracking of fish—ensures that processors can track their production and distribution and quickly identify fish whose handling has been compromised.

“The whole industry is focused on producing a quality fish from the time we catch it until the consumer is put-ting that piece of fish in their mouth,” Jordan says. “Whether we’re freezing [fish] or it’s shipped fresh, we’re learn-ing to do that. The farmed industry has challenged us to improve.”

In places like Sitka during the salm-on crisis there was plenty of acrimony aimed at farmed salmon. A popular

bumper sticker at that time read: Friends Don’t Let Friends Eat Farmed Fish.

But Jordan joins many others in the Alaska fishery industry who avoid criti-cizing farmed salmon. Instead they pre-fer to emphasize the superiority of wild Alaska fish, much the same as producers of free range meats market their fare.

And, much the same as free range meats, wild fish have a firmer texture than fish raised in crowded pens. The Alaska fish are also free of the antibi-otics needed to cope with diseases that can arise from that crowding and of the dyes farmed salmon receive to make their flesh a desirable bright red color.

Jordan says he has signed up for a program called “This Fish” which al-lows home or restaurant chefs to track exactly what boat caught their salmon.

“Europe is leading the way,” Jordan says. “The consumers [there] want to know right where their fish was caught or farmed and by whom.”

Consumers in Europe—and, increas-ingly, in the United States—want to ensure

that their seafood comes from sustainable fisheries. They also want to be sure that processors use all parts of the fish.

Tim Ferleman is the operations di-rector and seafood buyer for Anthony’s Restaurants, a group with twenty-five restaurants in the Puget Sound area, Eastern Washington, and Oregon. An-thony’s serves only wild salmon.

Ferleman echoes Jordan’s comments that the qualities of different fish, feed-ing on the different feed, can make for a distinctive dining experience.

“There are all these different catch meth-ods and species of wild salmon,” Ferleman says. “You’re going to get different eating experiences and flavor profiles. That is what makes wild salmon so much better.”

“We map out all these salmon seasons,” he continues. “I know about July 15, I’m going to start buying troll-caught silver salmon out of Southeast Alaska.” R

Author and journalist Will Swagel is based in Sitka.

Alaska Seafood Marketing Institute releases the Seasonal Harvest Guide to inspire home cooks and foodies: “Sea-food for All Seasons” illustrates the array of Alaska seafood available year-round timed with the opening of Alaska halibut and black cod harvests.

Cou

rtes

y of

Ala

ska

Seaf

ood

Mar

ketin

g In

stitu

te

mobile communications wherever you need itAT&T Remote Mobility Zone – critical communications for dark zones and disaster situationsWhen your organization needs cellular and Internet service and none is available, the AT&T Remote Mobility Zone can get you connected, typically in less than 30 minutes. It’s a highly portable cellular communications site that links to the AT&T cellular network, providing service where you need it most.

att.com/armz 800.955.9556

©2015 AT&T Intellectual Property. All rights reserved, AT&T, the AT&T logo and all other AT&T marks contained herein are trademarks of AT&T Intellectual Property and/or AT&T affiliated companies. All other marks contained herein are the property of their respective owners. This document is not an offer, commitment, representation or warranty by AT&T and is subject to change.


WORKFORCE TRAINING

Alaska Process Industry Career ConsortiumDeveloping the framework to replace an aging workforce

By Mike Bradner

Despite the petroleum industry’s current challenges, much of Alaska’s natural resource-based

economy is doing fairly well, it appears. The state’s six producing mines appear to be profitable and most are expanding, adding resources and new production. Seafood appears to be doing well, with another record-breaking salmon harvest likely in 2015.

Even oil and gas employment remains strong, at least for now, although the cur-rent activity is mostly with projects com-mitted to before crude oil prices plunged in late 2014. Industries that support basic resource industries, like construction and transportation, are also holding their own, if employment statistics are any indication.

This ebb and flow is, however, a com-mon challenge that faces all of these industries. Despite commodity swings, oilfields and mines will continue to pro-duce. There will be needs for service, sup-port, and maintenance.

Since what goes down comes up, even-tually, the prudent operator must be pre-pared for the upswing. The challenge all of Alaska’s traditional “blue-collar” in-dustries now face is that their workforces are aging; skilled workers are retiring and must be replaced.

This is a real problem during a down cycle. Young people may not perceive a future in such fields, and education and training takes years. Low prices may im-pair training budgets and funding for university workforce programs. Right now, with the state budget hit hard by declining oil revenues, the university and the resource industry community is wor-ried about preserving the training infra-structure that has been established.

Training is increasingly needed, too, and industry can’t do it all.

“Seventy eight percent of middle-wage jobs require some kind of certification,” says Cari-Ann Ketterling, acting direc-tor of Alaska Process Industries Career Consortium (APICC). “We want to work with the training providers, including the university, to ensure that the skills

that are currently needed are what is be-ing taught.”

APICC is a consortium of industries formed to help coordinate training in the process technologies.

Identifying Critical SkillsMining, one of the state’s oldest indus-tries, offers a prime example of an in-dustry that could be soon expanding, but yet is already struggling with an aging production workforce and recruitment issues. Mining is not one of the state’s major employers, unlike seafood or tour-ism, but the jobs pay well—$100,000 per year on average, second only to petro-leum—and most mining jobs are steady and year-round, not seasonal, since the state’s large producing mines operate twelve months of the year.

Wages in mining have been growing much faster than wages for the state as a whole, up 22 percent between 2002 and 2011 compared with an 8 percent average wage growth for all Alaska private sector workers.

About 4,600 Alaskans were employed in mining in Alaska in 2013. That number has been increasing gradually in recent years. With several new mining projects being planning and existing mines be-ing expanded, the industry is expected to grow about 2,000 two thousand over the next decade. That need must be coupled with the needed replacements of retiring workers.

“Within the current workforce there is considerable aging of higher skilled em-ployees; for example, 47.1 percent of me-chanics, 51.1 percent of mining materials engineers, and 65.4 percent of mining machine operators are forty-five years of age or older,” according to the Alaska Miners Association’s workforce develop-ment plan.

Many jobs in mining require skills similar to construction, oil and gas sup-port, maritime, and even fisheries in some respects (maintenance in seafood plants, for example). Similar statistics of an aging skilled workforce are seen in all these industries. Fish harvesting can be

included, too, since the average age of a salmon limited-entry permit holder is now fifty.

While healthcare is not a “blue-collar” industry like mining or oil and gas, it provides support to those industries and has become an important part of the state economy.

Although the healthcare workforce has a younger demographic than, say, con-struction, there are critical parts of it that are aging. Many physicians in private practice are approaching retirement, for example, and Alaska already has a short-age of physicians.

Concerned about the trend, in 2011 the mining industry began preparation of a workforce development plan through its industry association, the Alaska Miners Association, and by 2013 had completed an assessment to identify high priority occupations where special skills could be in short supply.

Four basic categories of skills were identified: Heavy equipment operations, including

underground miners; drillers and blasters; haul truck drivers, and equipment operators.

Maintenance technicians, including millwrights, diesel mechanics, and electrical and instrumentation technicians.

Process technology, mainly mill operators.

Engineering, including mining and mechanical engineers, geologists, metallurgists, and skilled support staff like metallurgy, chemical, geological, and environmental laboratory technicians.The seafood and maritime industries

initiated similar efforts to identify criti-cal skills and potential shortages, as did the healthcare industry. The petroleum industry has been seriously looking into the effort for about eighteen years.

Training InvestmentsThe foundation of many of the industry efforts was in the formation in 1998 of


APICC, an initiative led by the petroleum industry and later joined by others like refining companies, Agrium Corporation with its large fertilizer plant near Kenai, mine operators, and utilities.

What these industrial groups had in common was the operation of process facilities, such as oil and gas processing plants, power plants and refineries, and ore processing mills at mines.

“Any industry that takes a raw material and turns it into something else typically uses some form of process control tech-nology to manage flow, temperatures, and pressures. All this is much more automated, and highly technical, than it was thirty years ago when things were more ‘hands-on,’” says Ketterling.

In 1997 and 1998 the petroleum indus-try was concerned with the aging of its existing process technology workforce, with pending retirements and a potential shortage of operators. APICC was formed to provide a mechanism for companies operating processing facilities to work together with training providers like the University of Alaska to establish courses and certification standards for operators.

For the training community it was a chicken-or-egg question. To make the in-vestment in establishing training, infor-mation was needed on what skills were needed and how many workers would be required. Only the industries involved could provide this information, and APICC became the forum where agree-ments could be reached not only on what skills were needed but also skill descrip-tions and how many workers might be needed.

Some of this involved sensitive infor-mation—a company’s estimate of fu-ture plans and human resource needs is usually confidential—but a method was worked out through APICC to compile data in aggregate while maintaining con-fidentiality for individual companies.

This was crucial for the training com-munity to invest to meet the demand for skilled workers.

The results were highly successful. The university established two-year process control Associate Degree programs on three campuses (in Fairbanks, Anchor-age, and Kenai) and many companies stepped forward to provide scholarships and internships, which gave employers a way to spot promising future employees.

The program has continued to this day with about two hundred people enrolled on the three campuses, with about sixty

graduates a year, Ketterling says. About 80 percent are hired by the oil and gas in-dustry, with BP hiring the most.

One part of APICC’s core mission is still to ensure communication between industry and the education and training community so that trainers are able to keep up with changes in industry work practices and needs, Ketterling says.

Aggregation Gains Collaboration

APICC has meanwhile set the paradigm for other industries that similarly are composed of firms and organizations that are often competitors and need a way to collaborate to reach a common goal—in this case, workforce development. While each industry has followed a similar path it has done so in different ways, most of-ten not as formalized as APICC, which is now an independent nonprofit.

The mining industry, for example, works through the human resource com-mittee of the Alaska Miners Association to communicate with the university in training skilled miners: in the past un-derground miners and more recently planning for a new program to train mill operators.

The construction industry has the Alas-ka Construction Education Foundation, which works with schools and Alaska Construction Academies. The healthcare industry has its own informal consortium to work with the university, an initiative largely led by Providence Health & Ser-vices Alaska and Fairbanks Memorial Hospital, which led to a highly successful university program to train nurses.

A recent initiative is to identify sets of common skills demanded by several in-dustries, which can provide opportuni-ties for collaboration in working with the university or other training providers and state agencies like the Department of La-bor and Workforce Development, which administers federal training funds.

APICC was to host a multi-industry meeting in May to identify the cross-skills that are identified common to sev-eral industries, Ketterling says, with a re-port expected to be published in the fall.

The report will provide important in-formation for the principle state entity that guides much of the federal and state funding available for training, the Alaska Workforce Investment Board. The board, composed of industry and state officials, makes recommendations on the alloca-tion of state and federal training funds.


Training Locations Impede Access

For the mining industry, meanwhile, the preparation of a formal workforce plan has been helpful. “The assessment pro-cess [in the plan] identified needs, with training providers contacted to obtain information on current and planned pro-grams,” the plan said.

“Alaskan training and education insti-tutions have a number of programs that can prepare Alaskans for most of the entry-level positions in the various min-ing occupations,” the miners’ association said in the plan.

However, “there are some gaps, both in programs—such as for metallurgists—and in the numbers of graduates from the programs, such as machinists, mechan-ics, and geo-technologists.”

The report emphasized the importance of regional training, however. “The larg-est issue with the current training picture in the state is not availability but access. For many of the priority occupations, training may be offered but at a site that requires relocation by a potential em-ployee,” the miners’ plan said.

“Such relocation can be expensive not only in terms of financial outlay but

also in time away from family and often results in students dropping out of the training before completion. Providing training at multiple locations throughout the state is a more efficient way of meet-ing workforce needs,” the report said.

Developing and maintaining a strong, regionalized system of training in the state is a challenge even in good times, but even more so when times are eco-nomically challenged.

State general funds for regional train-ing centers in King Salmon, Nome, and Kotzebue are sharply cut for the next state fiscal year beginning July 1 to about half the levels provided in the current year. The Department of Labor and Workforce Development is currently working on ways to keep the regional centers operat-ing, along with state job centers in out-lying communities. The training centers have some access to federal funds and certain other state funds, and the labor department is working on ways of shar-ing facilities to keep the job centers open.

Long-Term CommitmentsIn a paradox, the demand for training is actually greater during times of downturn because workers temporarily out of work

frequently seek training to upgrade their skills, to be ready for the next upswing. It is critical, during these times, to maintain the training infrastructure. State and in-dustry officials engaged in workforce de-velopment are now struggling with this.

Another aspect, however, is retention of workers once they are trained, the min-ers association said in its plan. “Securing an adequate workforce is only part of the equation. Equally important is keeping the workforce in place,” the miners’ plan said.

“A positive work environment that respects the culture of the region and training that allows upward movement on a career ladder provide incentives for employees to make a long-term commit-ment to a company or a project,” the as-sociation said in its plan.

All this will take everyone working together. “These action steps stress the need for program alignment across train-ing institutions, collaboration among training partners and industry sectors and regionalization of program delivery,” the miners said. R

Mike Bradner is publisher of the Alaska Legislative Digest.

Enjoy the Alaskan Summer

Let our team act as your Family Office by managing all of the details of your financial picture while helping to build and

preserve your investment portfolio.

Knowing that Cornerstone is working on your behalf

Cornerstone Advisors serves affluent families in Alaska and the Pacific Northwest in all aspects of their financial lives. For over 30 years, we have provided our clients the

time and resources to pursue their passions.

[email protected] | 1-888-762-1442 | www.buildbeyond.com

Discover today how we can serve you:


INSURANCE

Protecting the Fleets in Alaska Waters

The Alaska Marine Highway Sys-tem (AMHS) has been rolling along since 1963, providing pas-

senger and vehicle service to more than thirty communities in Alaska, plus Bellingham, Washington, and Prince Rupert, British Columbia. The AMHS has a fleet of eleven vessels that carry an average 312,000 passengers and ninety-eight thousand vehicles annually.

However, none of this would be possible without the marine insurance the AMHS has in place to protect its vessels, passen-gers, and employees from certain risks associated with running the extensive sys-tem. Primarily, the state carries hull and machinery insurance to cover physical damage to the vessels, as well as protec-tion and indemnity (P&I) coverage for the liability exposures (including pollution).

“The exposure/risk would be too great if [we were] completely self-insured, so having the coverage is critical to the con-tinuous operation of the fleet,” says Gen-eral Manager Captain John Falvey Jr.

Marine policies protect commercial vessels—ships, barges, tugs, fishing boats, factory trawlers, charter boats, and even shipping containers—for insured losses. The loss can include damages caused by machinery, fire, sinking, collision, in-clement weather, and/or a pollution-relat-ed incident like an oil spill. Insurance also provides financial compensation for eligi-

ble maritime crews and other employees who suffer work-related injuries.

Types of Marine Insurance The two main types of policies purchased by marine transportation, commercial fishermen, and other maritime business-es are hull and machinery and P&I, ac-cording to Terry Johnson, a marine advi-sory agent and professor with the Alaska Sea Grant Marine Advisory Program.

Hull and machinery insurance covers the vessel and its attached components, including engines, deck machinery, and electronics. Coverage is based on either the agreed or actual value. And the policy offers protection against “all risk” or “named hazards.”

P&I insurance pays fleet owners if they suffer financial loss due to accidents in-volving or caused by their vessels. Cov-ered incidents can include personal inju-ry, illness to crew, wreck removal, salvage expenses, certain fines and penalties, and litigation expenses. Vessel owners who transport cargo and/or passengers for hire might need additional liability cover-age and/or a cargo policy for equipment and other items not fixed to the boat.

And depending on the circumstances, some maritime businesses also need breach of warranty insurance. This insur-ance pays off a lender in the event a vessel doesn’t have valid coverage due to being in

violation of its policy’s navigation limits, lay-up terms, crewing, or other provisions.

So how much insurance is enough? It boils down to how much the vessel owner can afford to lose. “You’re not just insuring a boat; you’re insuring a busi-ness,” Johnson says. “You’re also insur-ing your future, so take into account all the costs that would be involved if you have a casualty with your boat.”

Technically, hull and machinery in-surance is a function of the vessel’s val-ue, as determined by a survey—which minimizes the chances of under or over insuring. P&I insurance is more subjec-tive, with minimum coverage often dic-tated by the lender. A P&I policy may not be nearly enough to protect all the own-er’s assets, but the idea is to provide a big enough payoff (if the owner is found liable) to buy off a settlement or pay a court-ordered judgement, Johnson says.

Technically not a Legal Requirement

Marine insurance is a practical neces-sity because of the myriad of risks and responsibilities that vessel owners have, according to R. Isaak Hurst, Esq., prin-cipal attorney for International Mari-time Group PLLC—a maritime law firm based in Seattle.

Vessel owners have serious legal obliga-tions toward their employees. Here’s why:

Insurance critical for marine transportation, commercial fishing, and other maritime businesses

By Tracy Barbour

Crowley tug Nachik and barge DBL 165-2 off the coast of Kotzebue. The Nachik is a shallow-draft tug and the DBL 165-2 is a double-hull fuel and freight barge.

Courtesy of Crowley


With respect to crewmembers, or “sea-man” as defined by the courts, if an injury or death is caused by the negligence of a seaman’s employer or its fellow employees, the seaman can recover damages from his employer under the Jones Act (46 U.S.C. § 30104). Damages can include compensa-tion for all past and future losses of income, expenses associated with medical care, compensation for pain and suffering, and disability associated with loss of enjoyment of activities of normal life. “Put differently, a seaman’s remedies are far more liberal than the benefits of a traditional worker’s compensation claim, which is why a vessel owner has such serious legal obligations to care for their employees should they be-come injured,” Hurst says.

Owners also have a legal obligation to provide a seaworthy vessel to seaman as-signed to the vessel. It can be difficult for a vessel owner to disprove he or she didn’t have a duty to provide a seaworthy vessel in the event a crewmember gets injured or killed on the job, according to Hurst. However, if a seaman’s death or injury was caused by “unseaworthiness” of the vessel, remedies similar to those available under the Jones Act could be warranted.

“Indeed, the reality is that seaman, which courts classify as ‘wards of admi-ralty,’ are a protected class of employees under US law,” Hurst says. “And because of the dangers these individuals are ex-posed to on a daily basis and the concur-rent benefits they provide to maritime commerce and national defense, seaman have a longstanding right to be protected under the law and are entitled to liberal interpretation of the concepts of negli-gence to foster their protection.”

That aside, although vessel owners have strict legal obligations to their vessels and crew, there’s no hard-and-fast legal re-quirement for them to have insurance coverage, says Hurst. However, certain federal and state laws indirectly require vessel owners to carry certain amounts of insurance. For example, every seaman who becomes ill or injured during his or her employment—regardless of any fault of the vessel owner or operator—is enti-tled to maintenance, cure, and unearned wages as a matter of right. “Indeed, these are very serious legal obligations imposed on vessel owners, which is why most ves-sel owners take out some form of P&I insurance to cover for their maintenance and cure obligations,” Hurst says.

left Rigging cable, Liberty Project, July 2009

above Doyon Rig 25 sealift at West Dock, August, 2010

next Doyon Rig 25 move to Deadhorse, August 2010

94

above Eni Petroleum, Spy Island, March 2011

top right Deballasting after barge offload, West Dock, August 2011

bottom right Blaze Anderson, roughneck, Parker Drilling Rig 272, February 2013

next Parker Drilling Rig 272 moving crew, February 2013

135

MY FAVORITE SUBJECTS ARE

PEOPLE WORKING. TO ME

IT DOESN’T MATTER IF THEY

ARE EQUIPMENT OPERATORS,

TRUCK DRIVERS, MUD MEN,

DRILLERS, ROUGHNECKS,

GEOLOGISTS, BULL COOKS,

MECHANICS OR COMPANY

PRESIDENTS — IT’S THE

PEOPLE WHO ARE THE MOST

INTERESTING TO ME.

left Pilebuck Gary Pickus, February 2009

10

PICK UP YOUR COPY TODAY!511 W. 41st Ave, Suite 101, Anchorage, AK 99503(907) 258-4704judypatrickphotography.com

Also available in bulk quantities!

A COFFEE TABLE PHOTO BOOK OF ALASKA’S NORTH SLOPE OIL PATCH

AVAILABLE NOW!


Without P&I insurance, a vessel owner is personally assuming the responsibility for exposures (including any maintenance and cure or Jones Act liabilities) that occur on his or her vessel. And this amounts to financial and legal roulette, given the po-tential damages involved, Hurst says.

Covering Alaska’s Marine Needs Marine policies, essentially, allow fleet owners to transfer certain business risks to insurance underwriters. The risks as-sociated with these types of policies are a unique and constantly-evolving area of insurance. So it’s important, Hurst says, for vessel owners to work with a broker who is familiar with marine insurance policies, has access to the domestic ma-rine insurance market for shopping pur-poses, and who is plugged into the Lloyds of London syndicate. However, finding an insurance broker with this maritime expertise in Alaska can be difficult.

Consequently, maritime businesses in Alaska often turn to companies based in the Lower 48, such as USI, for insurance. With regional offices in An-chorage, Northern California, Oregon, Washington, and Idaho, USI provides property casualty insurance, risk man-agement consulting, and other services.

USI’s ONE Advantage process integrates analytics, resources, and enterprise plan-ning tools to customize marine policies with insuring terms and conditions to the specific needs of businesses, according to USI Alaska President Bosco Baldwin. This ensures that clients’ specific risks are iden-tified and covered in the policies. “We have access to a variety of insurance markets in order to arrange the coverage on behalf of our clients,” he says. “Which market is used depends on what they need.”

Baldwin adds that no two marine risks or vessels are the same, and each one has unique risks depending on the type of vessel and the usage. “All policies are written after extensive underwriting with the insurance carriers who quote and confirm the coverage,” he says. “Endorse-ments are written to correct or amend the insuring terms to the individual risks.”

The Alaska market is complicated, giv-en its location, environment, and weath-er, Baldwin says. However, the Alaska and the Northwest region are uniquely tied together. “The marine, transporta-tion, fishing, and environmental indus-tries are interesting examples of how

our economies and communities are intertwined,” Baldwin says. “We sup-port these special connections with our marine insurance practice and service.”

Meeting Their Needs Vessel operators in Alaska are satisfy-ing their insurance needs in a variety of ways. Take the AMHS, for instance. Its fleet of eleven vessels consists of nine passenger roll-on/roll-off vessels and two fast ferry roll-on/roll-off vessels. The AMHS carries ample hull and machinery insurance, along with P&I coverage to handle the inherent risks involved with transporting people, vehicles, and goods. “The state has excess coverage for hull and machinery with a $500,000 self-in-sured retention with Lloyd’s of London,” Falvey says. “The hulls are insured to val-ue. The protection and indemnity cover-age is insured with SKULD-Consolidate with a $500,000 [self-insured retention] and $1,000,000,000 policy limit.”

Crowley, which has been providing ma-rine transportation, logistics, and other services in Alaska since 1953, has a com-prehensive insurance program to cover its global operations. The company owns about 150 vessels worldwide, ranging from tugs, barges, and container vessels to heavy lift vessels, oil spill recovery vessels, and tankers. Its vessel liabilities are insured through entries into the International Group of P&I Clubs, sometimes simply referred to as the “International Group” or “IG,” according to says Laurie Luke, direc-tor of risk management for Crowley.

“All combined, the IG insures 95 percent of the world vessel fleet,” Luke says. “The thirteen clubs which are part of the Inter-national Group are able to offer significant limits of liability due to the combined fi-nancial strength of the mutual funding of the individual members of each Club, bol-stered by the largest reinsurance contracts in the world. The current limits provided are oil pollution, USD 1 billion, and an aggregate of passenger and crew risks of USD 3 billion,” Luke says.

Hull and machinery coverage is also an important component of Crowley’s vessel insurance program. The company insures the values of each vessel, and the combined values are reinsured through-out the world on a subscription reinsur-ance basis. Its insurers and reinsurers are selected from a network of the high-est caliber underwriters. “For Crowley,

financial security and service levels of those reinsurers have priority over pric-ing relative to selection,” Luke says.

Alternative Source on OfferWhen it comes to marine insurance for commercial fishing, vessel owners often secure policies through trade groups and associations. Some examples are Bristol Bay Reserve, Southeast Alaska Fishermen’s Alliance Reserve, and Seine Vessels’ Reserve.

A self-insurance pool is another op-tion for vessel owners wanting to avoid the high cost of traditional insurance. With a pool, members of an organized insurance group collect money in a fund to pay claims and sometimes dividends.

However, insurance pools may not be feasible for everyone. They often require a larger amount of cash up front and have strict membership requirements. In some pools, members can get ex-pelled after having just one claim. “A lot of the small guys who have been kicked out of the pools or who can’t afford the pools are left by the wayside,” Hurst says.

Hurst says he’s noticed vessel owners trending away from using self-insurance pools. This could be attributed, in part, to some of the adjustments carriers in the domestic market are making to meet customers’ budgets and needs, he says.

Terms Are Negotiable Hurst has also noticed that marine poli-cies are becoming more expensive and are consuming a bigger portion of ves-sel owners’ annual budget. “As a result, I feel like a lot of smaller owners are un-derinsuring their boats,” he says.

But insurance policies can often be adjusted by tailoring the terms. “A lot of people don’t realize you can negoti-ate the hull apart from the machinery to lower the costs,” Hurst explains.

Johnson reminds fleet owners that ma-rine insurance premiums are largely ne-gotiable, thanks to controllable factors like the deductible and lay-up period. He also advises owners to discuss options with their broker or agent, to read their policy, and understand what is—and isn’t—cov-ered: “There’s a long history of people who thought they were covered—only to find out there was an exclusion.” R

Tracy Barbour is a former Alaskan.

www.psfinc.com 3800 Centerpoint Drive, Suite 601, Anchorage, Alaska 99503 // 907.562.2225

2233 112th Ave. NE, Bellevue, WA 98004 // 425.709.3600

Commercial Insurance

Employee Benefits

Personal Insurance

Risk Management

Surety

Parker, Smith & Feek’s Private Exchange is a single solution alternative beneficial for both employers and employees. Its integrated data management and extensive selection of optional employee coverages offer significant advantages over other healthcare exchanges.

3 Single Solution 3 Budget Management 3 Optional Coverage Offerings 3 Flexible Plan Design

www.psfinc.com 3800 Centerpoint Drive, Suite 601, Anchorage, Alaska 99503 // 907.562.2225

2233 112th Ave. NE, Bellevue, WA 98004 // 425.709.3600

Commercial Insurance

Employee Benefits

Personal Insurance

Risk Management

Surety

Parker, Smith & Feek’s Private Exchange is a single solution alternative beneficial for both employers and employees. Its integrated data management and extensive selection of optional employee coverages offer significant advantages over other healthcare exchanges.

3 Single Solution 3 Budget Management 3 Optional Coverage Offerings 3 Flexible Plan Design


special section Transportation

Economy, Labor Shortages Big Issues for Trucking Industry Harry McDonald of Saltchuk, Terry Howard of Carlile, Jimmy Boyle of

Weaver Bros., and Aves Thompson, Alaska Trucking Association.

Alaska Business Monthly

Alaska Business Monthly met the first week of April with Alaska transportation industry leaders

to talk about some of the issues facing Alaska, facing the industry, and facing their companies. Saltchuk Managing Director Harry McDonald, Carlile Transportation President Terry Howard, Weaver Bros. Vice President Jimmy Boyle, and Alaska Trucking Association Executive Director Aves Thompson shared industry insights and most of that is in the print edition. The entire discussion appears online and in the expanded digital edition and mobile app.

Alaska Business Monthly: What do you think are some of the issues facing the industry—the key issues?

McDonald: Well I think the biggest is-sue we’re looking at right now is undoubt-edly the economy, because it’s kind of a strange situation at this exact time be-cause right now there’s more work than we’re able to produce. I think we’re backed up and I think the other carriers are too, especially with the North Slope. Well, partly because it’s spring time and there’s ice floes and everybody’s getting out and it’s always busy at this time of year. So, to-day, there’s a lot of work. We feel pretty op-timistic with the oil companies’ work on the Slope—Exxon and Conoco. We were at an oil industry function last night and I think they’re moving ahead with the com-

mitments they made. I know it’s challeng-ing for everybody at these oil prices.

But at the same time we know that on a state level with the budget deficits that we’re looking at there’s going to be some issues to deal with that are more than likely going to impact the economy as a whole. The state budget, of course, get-ting cut is going to impact everybody.

There’s just going to have to be actions over the next year or two to get that spend-ing in line with our income, and my per-sonal opinion, and I’m no expert, is that this oil price could go for a good long while. I’m not optimistic that it’s going back to a hundred [dollars a barrel] anytime soon.

Alaska Business Monthly: Are you talking for years? Or ever?

McDonald: Well, Yes that’s above my expertise level, but I think if you look at the issues and we get the issues resolved with Iran, and we’re already producing 2 million barrels a day more than is getting consumed and Iran will add another mil-lion barrels a day. Well, that doesn’t seem like a good formula for oil prices to rise, but, things could change, and there are people that know a lot more than I, but I think we should be prepared for a long-term price more like what we’re at now.

As far as the industry, my personal opinion, and, Terry [Howard] can kick in too, probably the single biggest issue we’re facing is labor. We have all these

programs for training and really it’s just a matter of not enough bodies coming into the system to replace retirements and attrition. And I think it’s univer-sal. Everybody’s struggling to keep the trucks full of competent drivers.

When we start talking gaslines and things like that there’s not enough la-bor—especially in Alaska—to even think about getting that project done. , maybe we’ll have a major depression in the US that will free up a bunch of labor and maybe from there, I don’t know, but the way it sits today and they’re talking four or five times as many loads a day as we’re moving [now] for several years, that’s go-ing to be a single issue we’re going to have to get addressed to get ready for that.

Howard: I would say the same. If you look at our industry or any of the indus-tries, the craft personnel, that pool is very limited, a lot of your young people aren’t getting into it: whether that be mechan-ics or welders or drivers or warehouse people. We’ve all attended meetings about the gasline, and they anticipate a ramp-up of anywhere between forty-five hundred and five thousand people will be needed just on that project alone. Even at our current levels we’re having trouble with maintaining an influx of people to offset the people that are leaving and then you throw in a big project like that and it’s going to be a draw for all of us. It’s going to be difficult and they’ll probably overcompensate to get those people, so


even if we get to keep our people, they’ll harm the wage structure, for sure; they’ll have to adjust it—upwards—quite a bit.

Boyle: And it’s just not going to get any better. Like both of these guys [Harry and Terry] have said , the guys that are retir-ing that have worked in the last twenty or thirty years, they were all raised on ranch-es and farms. They were all used to using their hands to do the work and the gen-eration of folks that are coming to us now just aren’t used to doing physical type la-bor, they’re more used to sitting in front of a computer screen. I think the interests of those who want to get out and do this type of work—all crafts, not just truck driving, but any kind of manual labor, that interest just isn’t there. Now we’re a nation of users instead of producers and so you have less people that want to get into the industries like truck driving.

McDonald: When we were kids, our dads were [teaching us to drive.] When we were ten years old we were out there driving something—trucks, tug boats, fork lifts. And the economy now, with the labor laws and everything, it’s just the way things are today, and kids don’t get that kind of work experience to where when they’re eighteen they can roll right into a job without much training at all.

Thompson: One of the things follow-ing on that thought here is that from a policy standpoint, the associations—like myself and the Alaska Truckers Associa-tion, and other states’ trucking associa-tion along with the American Trucking Association, they’re all trying to formu-late plans to try to attract younger drivers.

One of the big obstacles is the US DOT’s [federal Department of Transportation] regulation that says you must be twenty-one years old to have an Interstate CDL.

So the question then becomes: What do you do with that young man or woman who gets out of high school and thinks they might like to drive a truck but they can’t drive a truck until they’re twenty one?

We’re trying to develop proposals now that will perhaps create a graduated li-cense, whereas maybe at eighteen you could start with some bunny truck stuff and local delivery, pick-up and delivery, and then in at nineteen you could go into the larger rigs—you could work your way

in to it. But you could get them in a truck without having to keep them in a ware-house job for three or four years because you’re not going to keep them that long.

And then, the other thing that’s go-ing on is all the gadgets in the trucks. Young guys and gals kind of like those.

We can’t make the transition from high school to the twenty-one year re-quirement.

Alaska Business Monthly: Also, I read recently that insurers want drivers to be twenty-three. Is that true for your drivers; do they have to be twenty-three?

McDonald: Our insurance company doesn’t have any hard and fast rule, I think twenty-one is fine, but there may be statistics that show accident rates go down at twenty-three—that would probably be what would drive that.

A lot of that is how you manage your drivers. There is a lot of technology to use to manager your drivers now, as far as speed, driving techniques, braking tech-niques, and also it just depends on how much of that is in use. They have collision avoidance and lane avoidance and some of which works in Alaska and some of which doesn’t. But more and more companies are starting to take advantage of that. Mmaybe that, coupled with some relaxing of federal law, but how it is. I’ve been in-volved with the American Trucking Asso-ciation now for a long time and it’s a slow process to change something at the federal level. Nothing happens overnight.

Here in Alaska you can call the gov-ernor and get something done—right or wrong or indifferent—but on the federal level it’s much more difficult.

Howard: I think of some of the things we’ve had to do to mitigate that. When we were growing up we learned how to drive a manual transmission, right, and it was very commonplace, and now very few people know how to drive a manual trans-mission— Even in the trucks, some of the newest trucks that we’ve been ordering—and I’m sure these other guys, Jimmy’s giv-en it consideration. We’ve switched to auto-matic transmissions in some of our lighter duty trucks to facilitate the transition from inexperienced drivers to get them into the trucks and comfortable with the size of the vehicle and the traffic patterns and so


Want to Sell Your Company?

Matthew Fink907-261-7620 direct907-244-4194 cell907-865-4750 fax

[email protected] Midtown Place, Anchorage, Alaska 99503

• Value Assessment• Consultation• Marketing• Results

25+ Years Experience

Alaska Mergers & Acquisitions is affiliated with Remax Dynamic Properties, Inc.

they’re not focusing on the transmission—they’re focusing on driving. And then we progress them to more complex vehicles; that’s some of the technology we’ve had to take advantage of and thankfully the pric-ing is starting to come down on it.

Ten years ago people had automatic transmission on a truck and it would have been very painful financially and now the pricing is starting to get more reasonable.

We use it as a progression. We’re actu-ally putting [inexperienced new drivers] in smaller trucks, so that they can just be-come familiar with operating a larger piece of equipment or vehicle, and then once we know they are comfortable with that, then we start to progress them out of that.

Alaska Business Monthly: What about labor—labor and the economy, do you agree with that too?

Boyle: Absolutely. The labor piece is 50 percent of what we do; 50 percent of our business is labor and 50 percent is capital expenditures, the infrastructure and stuff. The Lower 48 has been dealing with driver shortage for thirty years ahead of us, and we’ve been dealing with it for the last ten, at least. It used to be that you got a num-ber of potential candidates in the door and you had to do some screening to get the good ones. Right now, you’re just not get-ting people in the door because they’re not looking for a job. The few that are out there are already hired and satisfied with where they’re at. You’re just not getting people through the door looking for jobs.

Alaska Business Monthly: Okay, then, so, how are you going to solve this? Is it solvable at the federal, state, or local level? What is the answer?

McDonald: Well, the State of Alaska has been working on that. The Depart-ment of Labor has had some training and grants with some of the truck driving schools, the two that are up here. They’re both proactive you get a grant and you think you’re doing something and the truck driving school will train six, six guys! Well, that doesn’t even hold us even, why, by the time we get those six in the system between us then, maybe out of six four of them make it—or one—like it or do it. So you get four guys in and six retire.

At any day Carlile could hire ten driv-ers in Fairbanks and not have too many. ANY day—if ten competent guys came through the door, they could go to work. But, we just can’t seem to gain them, ev-ery time for the last five years I’m up there [asking] “How we doing on drivers?” and they’re telling me we have five empty trucks. We just can’t keep up. That’s been kind of the standard, now. I was just on a phone call with a lot of our other com-panies down south and we had one that runs a couple thousand trucks a day and he had forty-eight empty today and that’s what he figured, what he calls 100 per-cent, he says that’s as good as it gets. They have an issue down there too, but the drivers down there have it different. , It’s a lot easier to train a guy to cruise down the freeway than it is to go to Prudhoe Bay or deal with the roads up here. Not only the roads, so much, but also we pull doubles which are a little more complicated.

Driving in Alaska takes a step above—in training and competence.

Alaska Business Monthly: Where does private enterprise fit into the solution?

Boyle: Each of us does the best job, or it’s our intention to do the best job we can, as far as training the drivers that we have. Then sometimes drivers go out by word of mouth and encourage other driv-ers to come to your company and give it a shot. So of course you want to treat them well, give them good wages and benefits, and then hopefully they’ll stay and then go out with word of mouth and interest others. , you’ve got to do the recruiting. Certain companies in the states had to do the recruiting and we didn’t have to for a long time. I think that’s closer and closer to becoming a reality for up here.

McDonald: We’ve had to at Carlile. A couple of years ago, we actually tried to by going out to some towns and setting up little private job fairs just for our company to say, “If you come to Alaska to drive you can basically, (most truck drivers there are gone for a month at a time), you can come to Alaska and drive two on and two off and basically have the same lifestyle, same income.” But even at that, we got a few but not a large amount. The industry needs hundreds right now, probably, I would


say. For everybody, for where you were relaxed, because they’re all working hard.

Thompson: That’s one of the things that’s changed in the last ten years and that’s the relationship between the em-ployer and the drivers. And the middle positions in between—the dispatchers. And what you’ve got to realize is you’ve got to treat your drivers right, and if you’ve got a dispatcher that’s badmouth-ing the drivers, giving the drivers a hard time, those folks aren’t going to stay.

So you teach respect, respect within your own organization, to keep your driv-ers. To teach each other’s their position, and, here’s what you do and how you do it and say please and thank you—some-times you say it in a little harsher terms, but you say it. But other than that, it’s the relationship— it’s the employer-employee relationship ethic that has changed.

Howard: And I would also say that, and Jimmy and Harry have known this for quite some time, obviously, and one of the biggest attributes of our company is that we promote from within. You’re not going to find Mr. and Mrs. Perfect any more that’s going to come to you and has a perfect driving record and wants to work your exact schedule for your exact compensation, so within our organiza-tion and I’m sure Weaver Bros. does it too, we find ourselves recruiting new people from within our own workforce to fill other roles. Helping them get their licenses, helping train them, more like a farm system on a baseball club. You’re not going to go out and steal other peo-ple’s drivers, you’re going to have to grow them yourself, and I think that we’ve been very good at that. And I’ll say one thing that as stiff as the competition gets, we haven’t gone over and poached each other’s drivers. We still have that code of honor that we hold too.

I think the biggest thing with us is re-cruiting and training from our ranks, and then the other thing is: Carlile, along with AT [Alaska Trucking Association] and the other companies, goes to the schools in the community. We are teaching the younger kids about the value of our contri-bution to commerce and the community as far as the jobs and things of that nature and encouraging them to take an interest in these types of positions. So really, it’s about us cultivating our own employees.

Thompson: Let me just say some-thing else. In a couple of weeks we are having our annual meeting and one of the keynote features of that is a trainer, a professional trainer is coming from Outside to talk about recruiting and training, and asking: “Do you have a plan for recruiting?” As Jimmy said earlier we really haven’t had to do a lot of recruiting up until five, ten years ago.

But now you need to know how to do it and you need to know how to develop those kinds of skills within your organiza-tion. And that’s one of the things we can bring to the table—is that kind of training.

McDonald: Innovation-wise, now, the trucks are nice. Tthere’s nothing nicer to drive now than a new Peterbilt or Kenworth. They are first class, they’ve got all the technology. We’re going to electronic logs now, which takes a lot of load off the driver, and no more wor-rying about filling out his private ticket log and worrying about getting audited and ticketed, and now the electronic log takes care of all that. Electronics takes a lot of that risk out from the driver. The company really makes it easier. The communications are good. We can interact with a driver anywhere if they have a problem so they’re not out there by themselves any more like they used to be if they break down or something like that. The comfort in the sleepers, and everything, it’s top notch. If you do get guys that like it, the technology is just extremely good and getting better.

Some of that is doing automatics on a lot of the mid-level trucks, and you guys [Jimmy] have run automatics too for a long time, right, even on your tractors?

Boyle: Yes, we just recently got line haul trucks and the guys like them.

McDonald: In Europe they’re all au-tomatic. Those guys, no one knows what a manual is in a truck over there, but here it’s still coming—it hasn’t really taken over, but it’s starting to. It’s stan-dard in trucks running down south, but here, it’s getting here, the technology is moving pretty fast.

Howard: I think the technology is improved, yes, but isn’t the pricing starting to come down also, right? On the automatic transmissions, automatic


transmissions used to be a very expen-sive option and the technology wasn’t proven for this application. So they are kind of hitting a sweet spot where the technology is getting better and the price is coming down.

McDonald: But I still say the main is-sue is we’ve got to figure out how to get large volumes of people interested in the industry and I think before we build this gas line there’s going to have to be a nationwide influx of drivers to make it happen, I’m sure. And not just drivers, I know the aviation industry has another one of the same problem with pilots. Ev-erybody is scratching for labor.

Boyle: When you have a national shortage you’ve heard in the news of a national shortage of doctors, and other specialized jobs. It’s not like a spigot, you can’t just run on a nozzle and in-crease the number of candidates out there. It takes a while, it takes getting folks into the pipeline. It takes a while.

Howard: We spend a lot of time on military recruitment—people leaving the military. Veterans have the skill sets, they meet the age demographic, they know about structure and schedule and things of that nature, so but as far as any one specific group I think we’d just be happy to get some people in the seat so we don’t really target any one group. McDonald: Alaska is a good place to drive truck from the aspect that you don’t go on long trips usually, the longest we do is a couple days away from home, whereas long haul in the continental US you’re usually gone from home any-where from a week to six weeks. So Alas-ka is a good place to work in that respect because you do get home a lot.

Thompson: Terry mentioned veter-ans. We were able to adopt a law change that allows certain exemptions for veter-ans who have heavy duty driving experi-ence. They are able to, they have to pass the written test for their CDL, but they can waive the skills test, with certain cer-tifications from the military—it has to be recent—but this is a little bit of an advan-tage to attract and recruit veterans and say come on over, we recognize your skills and although then they have the CDL, the employer still has that last bite of the

apple, so to speak, in making the decision whether or not to hire that person.

So when someone walks in the front with a CDL, probably the first thing you want to do before you give them an offer of employment is to give them a driving test.

Take them out and, have your driver trainer take them out and see if they know what they are talking about, if they can drive the truck and if they can then well you move forward from there.

It’s giving, it’s recognizing the veter-ans for what they have done and it’s giv-ing them the opportunity to transition into the private sector workforce.

McDonald: A piece of technology we use for that is we have a driving simula-tor that we’ve had for six or eight years. You can put a guy in there that walks in the door and get a pretty good idea of where a guy’s going to go and what he’s going to do without actually put-ting him in a truck, which creates some risk. If you put a guy you don’t know in the seat of a truck then that creates a lot of risk. You can abate some of that with that piece of technology. We’ve been us-ing that quite a number of years.

Alaska Business Monthly: What happens if, say, ten years from now if all the Baby Boomers are retired and you don’t have enough drivers, what will happen? What will you do?

McDonald: That is a problem that has to get solved between labor, and, what can get done? And I don’t think, personally, I don’t think there’s going to be a lack of work up here.

We were at a function last night with oil companies and they’re moving ahead and there’s going to be a lot going on for the next few years—even without the gasline. The biggest challenge is going to be to figure out how to do the labor.

We’ve had a lot of meetings with these groups planning. There are groups planning on the liquefaction plant and the gasline planning—there are four separate groups—and the amount of work they’re talking about is just mind boggling, even compared to the oil pipeline—that seems like nothing com-pared to what this gasline is going to be. In the end, the labor will determine how fast they can build that gasline.

Alaska Business Monthly: On the economy and state spending, one thing is the road work that needs to be done. Even though much of that is paid for by the feds but goes through the state, some of it is state money.

McDonald: Yes, the state’s going to pay maybe only 10 percent build-up but they still have to maintain it. I don’t know that the Alaska population has really grasped this deficit that’s facing us right now be-cause money’s still flowing and they’re still getting their Permanent Fund Divi-dend. I don’t know that the average guy driving one our trucks really grasps it. We’re talking about running out of mon-ey—not the Permanent Fund—but all the rest of the funds in a couple years. Now they’re talking about the deficit, what’s it up to now, $4.2 billion, and they’re talk-ing about maybe saving $700 million this year, so that gets it down to $3.5 billion—what we thought it was.

I think they’re doing the best they can without putting the economy into a diving spin, but, I don’t know that people have really grasped how serious it really is, because next year there’s go-ing to be changes—taxes or dividends cut or a combination of all those.

Boyle: Yes, absolutely. Another thing, a positive that’s happened since Janu-ary when the price of oil dropped is the price of gas at the gas stations dropped. So there’s that. So the only thing for ev-erybody out there just looking at paying bills day to day, the positive thing they have—that got better.

And we know some of the projects we work on, and we transport to, are getting funded from years past. We know that this summer, they’re going to continue on. But next year, like you said Harry, something’s got to happen because you can’t take a 50 percent cut in your income and still have the same kind of out go you have, and that is what the State is looking at.

McDonald: Somewhere that spend-ing, the fact that the State is not going to be able to spend money, will have an im-pact. We were listening last night to them and they [oil companies] are feeling pretty optimistic about maintaining the projects they have going on line up on the [North] Slope, but that’s still only part of the econ-omy and part of that is that we need to get


off of that and not depend wholly on that. It’s going to be an interesting few years.

Alaska Business Monthly: And there’s a huge world glut of oil that’s not going to get used up very quick, and we’re all continuing to make more, with the fracking and oil sands and all that.

McDonald: That’s another thing they said last night is: “You guys should feel pretty lucky because we haven’t got anything up here really at all, but the oil companies have cut A LOT of people in Texas and North Dakota. So they are feeling the impact much more sig-nificantly—which may help our labor situation, because when all that start-ed happening it kind of impacted and made our labor situation worse. A lot of guys could go to North Dakota and make just as much money as they could driving to Prudhoe Bay so a lot of them that had families down there moved down. So, that might reverse and make it easier to keep some drivers up here.

Alaska Business Monthly: Has the Legislature funded all the projects you wanted funded that were priorities for this year, Legislative Priorities?

Thompson: They haven’t. They haven’t revealed the Capital Budget yet so we don’t know what they’re doing. I think they are going to start working on that today or tomorrow. That’s been a closely held secret about what they’ve been doing. The Capital Budget isn’t going to be much.

McDonald: That’s no secret—they said it in the paper this morning.

I think from our company we’re fo-cused pretty heavily on the oil industry, which impacts the economy. Carlile does a lot of different work retail, too, but if the oil economy goes bad it will impact all of that. We don’t focus so much on the state funded projects per se, and we’re hoping that the offshore stuff they’re working on for the Chukchi Sea is successful this year, because that has a big impact on us—both trucking-wise and our tug boat opera-tions, and even our airplane operations.

Thompson: On our Association priorities we identified under the title

heading “Invest in the National High-way System” ten different projects that are federally funded. We a wanted to be sure that the federal money that came in, to which is applied a small state money match, is used for these projects, rather than taking federal highway dol-lars and building a scenic overlook someplace or a post office or a bike trail or something like that. So that was the focus of our choosing these projects. I think most of these are going to hap-pen, but I don’t know that for sure, but that was the focus of our priority list.

Boyle: That’s a 10 percent investment but that money keeps getting turned over and over and over again because the construc-tion company hires employees, and those employees spend the money at the grocery store and everywhere, so that money just keeps rolling over, so that’s a pretty good return for a smaller investment. So, we haven’t heard if everything got funded but that’s a good bang for your buck if it does.

Thompson: They taught me in Econ 101 that there’s a multiplier of seven, so for every dollar you spend it multiples


seven times in the economy. I don’t know if it is still that high.

McDonald: I noticed that almost all the bond issues passed last night in An-chorage, so it kind of indicates that the populace is willing to step up and pay and it keeps up some economic activity, that’s a lot of money.

Thompson: And there’s a sense of confidence there too.

McDonald: I’m always bullish on Alaska. Most of us have been here almost all our lives and we’ll probably be here no matter what happens—life goes on one way or another, and hopefully it’s as easy on our kids and our grandkids as it was on us, because we’ve had a pretty good life.

Thompson: Yes we have.

Alaska Business Monthly: So, I wonder how to get the Millennials into manual labor? That seems to be the biggest question.

McDonald: That’s true, you always tell your kids: “Go to college.” Oh there’s a fair number of truck drivers driving around that have bachelor’s and master’s degrees. You’d be surprised how many, because guys get in the life and they adapt to it. We have a lot of drivers that make executive type wages driving truck and sometimes that brings people back out of teaching school into driving a truck. We’ve got a number of guys that have teaching de-grees that taught for a while and can make twice as much money driving truck and they go back doing that.

Thompson: Driving a truck is prob-ably more fun than teaching.

McDonald: And on the other side, basically, with a high school education you can make a pretty darn good living driving a truck too, so you don’t have to spend that money and that time going to college, if you’re not inclined to do that. It gives them a little bit of a head start if that’s what they want to do.

Boyle: Well, with that skill set you can go anywhere in the US and have a truck driving job. If you’re good.

McDonald: We have at Saltchuk a program, we were just talking about that yesterday, that is focused on youth development and higher education. We’re really putting some emphasis on the rural education; there’s an aviation school out in Bethel, and there’s a cou-ple of Vo-Tec schools—besides the one in Seward—there’s one in Kotzebue and one in Nome, with AMAZING technol-ogy. There are simulators for Cats and dozers. I toured one of them up there. So they have all the facilities, they just need kids to get interested in that. I toured up there and there’s nobody around. They got these million dollar facilities—mil-lions in facilities, and so really what they need to do is fill those up.

Thompson: Another legislative is-sue is to re-evaluate that whole program because you have these monstrous facili-ties with all this good stuff in it and there are no students, so you have to figure out which ones are working, and feed the good ones, and starve the bad ones. Be-cause there are also a lot of private sector infrastructure available to provide train-ing; Teamsters do, they have their driver training school. Northern Industrial Training out in the Valley does driver training as well as other craft training. I know we’ve worked with Northern In-dustrial Training a couple of times on some grant issues. Harry mentioned the six grants that were funded and then you graduate six students, but that barely fills the gap that you’ve lost the six weeks they’ve been training.

We need to focus on how we can fill the seats in the existing schools so that those seats can then go sit in a truck.

McDonald: And I think besides la-bor and besides the oil industry that is kind of always front and center, there’s the mining industry that is important to the trucking industry and all the transportation industries—the fishing industry is big, the military is a big. So those are most of the drivers.

So all the issues that face those in-dustries are important, so when we’re lobbying the State Legislature, talking to our state legislators, whatever issues are facing them, whether it’s mining or oil or whatever, usually we’re sup-portive of reasonable regulations. You can make reasonable things happen,

not necessarily everything, but reason-able things. That, and a good balance. A good balance between doing it right and still having a good economy.

Alaska Business Monthly: Something else people want to know is what do drivers make?

Boyle: I think that you’ve got some driv-ers that enjoy working forty hours a week, and there are some jobs that fit that, and you’ve got some drivers that enjoy work-ing more than that, I think the typical thing can be $50,000 all the way up to…

McDonald: To $135,000. I was going to say $60,000 for a full-time truck driv-er, from $60,000 to $135,000. I know we’ve got guys that have been above that.

Thompson: And the top end, Susan, is that highly skilled driver that can transport the super heavy stuff.

McDonald: The heavy haul stuff.

Thompson: The heavy haul, the large and heavy loads.

McDonald: A good basic truck driver running Prudhoe Bay is going to be well over $100,000 on the average, if he’s work-ing full time, probably $100,000, $125,000.

Boyle: I just took simple math and twenty-five bucks an hour times two thousand hours, you have someone who wants to work a straight job, that’s $50,000 a year, but you’re right, you’re right there it’s $60,000 right on up for the guys like you said have the skill level and have the desire to work.

McDonald: Yes, they’re working, those guys are working two and a half trips to Prudhoe a week, basically through the year. They’re running 120 trips to Prudhoe a year, so they’re mak-ing about a hundred twenty grand.

Alaska Business Monthly: That’s something people always want to know, then of course, the benefits—full benefits?

McDonald: The benefits are, well I can’t speak for everybody, but I’m pretty sure all the mainline companies... There’s


that he’s advertising Outside—in West-ern states—and he’s paying a signing bonus. He can’t fill the jobs.

Howard: They’re making significant commercial decisions based on wheth-er they can get those type of people or not. Some of your truck dealers are ei-ther opening branches or not opening branches, or closing branches, based on whether they can get mechanics.

I recently came from the crane indus-try and it’s the same way, whether it’s crane operators or mechanics or oilers

or riggers or signal people—it’s all the same—you read any type of trade pub-lication you can get and they talk about the shortage of people.

Alaska Business Monthly: So it sounds like labor is the main thing.

McDonald: Well, the economy is the main thing—We’ve got to have an econ-omy to have a labor shortage. We hope [for the economy]. Having a labor short-age isn’t all bad. It all goes together. R

1740 E. 5th Avenue, Anchorage, AK 99501 • (866) 931-4354 • www.helimaxaviation.com

Unmatched CapabilityFull range ofequipment for loads up to 22,000 lbs.

Alaska Helicopter ServicesBased out of Merrill Field

Passenger service also available

the best health insurance Carlile’s ever had—a great health plan that is very, very, good and the company pays the biggest share of it. They have good 401K matches, they have personal days, and vacation days, and… They have half of their wages, like driving Prudhoe in the winter, over half the wages they get are overtime.

Howard: And I think some of the concern we have is that with this level of competition we have for a finite resource all of us have very competitive wages and benefits and things of that nature and if you throw in a big mega project, even if we don’t lose our employees it’s going to dra-matically alter our compensation I’m sure.

McDonald: Yes, which we’ll be able to handle while they’re building the pipeline.

Howard: Right, yes.

McDonald: But afterwards is when it is going to be tough. Figuring your way out of manage into that big project and get out of it, even if you’re, like I used to own Carlile and now I work for a very large company that owns trucking com-panies and airplanes and tugs and barg-es and ships, but managing your way into that with the capital and the labor and then back out without losing every-thing that you made while it’s going on is going to be the real challenge I think. It’s going to take a lot of planning and a lot of training and a lot of management while it’s happening—to make that work.

Boyle: I think the only other thing I would add is, we’ve talked a lot about drivers, I think we also probably all of us have a shortage of mechanics, not just truck drivers. Probably for every ten to fifteen drivers you also need a mechanic—probably along the same lines as cars—and people working with their hands, their bodies, mechanics are also a shortage. I don’t know if the general public knows that, but there’s plenty of mechanic jobs and the same thing goes as for a truck driver; you can make good money, you can be home ev-ery night, and if you enjoy that kind of work there are plenty of opportunities.

Thompson: One of our members is a truck dealer and he told us that he has six openings for diesel technicians and



Ravn Alaska has had anything but a traditional business history. The company’s 2014 rebranding

delineated clearly for clients and cus-tomers what the company is and how it’s going to move forward providing scheduled and chartered passenger and cargo services throughout Alaska.

The Briefest History Possible Many know parts and pieces of the air-lines that have come together under the Ravn name, but the whole history may be outside of the purview of most.

Taken down to the barest brass tacks, the history is this: Frontier Flying Service was founded in 1950 by retired US Air Force Colonel Richard McIntyre. John Hajdukovich bought Frontier in 1974, and in 2005 Frontier acquired the assets of Cape Smythe Air Services. Hageland Aviation Services was founded by Mike Hageland in 1981. In 2008, Frontier and Hageland combined their services, be-coming wholly owned subsidiaries by parent company HoTH (H-ajdukovich “o” T-weto H-ageland). In 2009 Era Avia-tion was purchased by HoTH.

In 2014, to address some confusion in who was who and what did what, the entire group rebranded.

Era has changed its name to Corvus. Corvus is Ravn Alaska: any plane seen flying with Ravn Alaska on the fuselage is a Corvus plane. Hageland and Frontier are still wholly owned subsidiaries that operate Corvus flights under the name Ravn Connect. Collectively, all three can

be referred to as Ravn Air Group.

Why Ravn?Bob Hajdukovich, CEO of Ravn Alaska, says there were a few factors that led to re-branding making sense. In its early days, Era was one company that operated both helicopters and fixed-wing airplanes. It was owned by Rowan, a drilling company, which decided to sell Era. The two types of services were split; SEACOR purchased the helicopters side and turned it into Era Helicop-ters LLC, while what is now Ravn pur-chased Era Aviation. “There was this natu-ral confusion in the marketplace between people that understood Era since 1968 to be Era: Era is Era is Era. When Era Heli-copters took their company public as Era Group, Inc., they were concerned over the brand name confusion,” Hajdukovich says.

Additionally, people had begun to refer to Frontier and Hageland as Era, which wasn’t accurate. To clear the air, it was determine an entirely new name was necessary.

“The word raven kept coming up on people’s list… and I recalled that the

A Ravn Alaska commuter plane takes off in Anchorage.© Chris Arend Photography

Ravn Alaska’s hangar and offices at Ted Stevens Anchorage International Airport.

© C

hris

Are

nd P

hoto

grap

hy

Ravn AlaskaFlying everywhere,

with anythingBy Tasha Anderson


bird on our tail was actually a raven, but a 1980s version when the style was all hard lines,” Hajdukovich says. “So we picked the word raven, but there were too many raven everythings. We decided to remove the letter ‘E’ because it’s silent, and you can say the word without it.”

Once Ravn Alaska was settled on as the brand name for the air group, Era still needed to be renamed, becoming Corvus (the Latin word for raven). “Why didn’t we name Corvus Ravn Alaska? Hageland and Frontier can’t do business as another company; they can’t do busi-ness as Corvus [being a separate airline] but they can do business as a Ravn Alas-ka carrier,” Hajdukovich explains.

Hajdukovich says that the new name actually provides new opportunities for the company externally and internally. “It’s been really fun to have the employ-ees really kind of coalesce around the image… we can actually have a mascot. You can’t have an Era mascot because no one knows what that would look like. It’d just be abstract letters. We’d have to have three mascots: one is an E, one is an R, one is an A, and they would have to run around together,” he laughs.

In contrast, there’s a lot of symbolism and meaning that can be associated with

a raven. Hajdukovich, who has a deep in-terest in birds, lists many of the attributes the birds have that make them an ideal symbol: they’re highly intelligent, hugely gregarious, have high levels of commu-nication, are family oriented, mate for life, etc. In Alaska, especially, ravens are culturally significant. They’re often pre-sented as tricksters, but even that repu-

tation speaks to being clever and resourceful.

Structure and ServicesRavn Air Group is certainly resourceful. The company’s unique structure is delib-erate, not accidental. “We have three air-lines that have autonomous, independent souls with individual relationships with the FAA, so we deal with a group of in-spectors for each of Hageland and Fron-tier and a group of inspectors for Corvus.”

But, Hajdukovich says, even with sepa-rate airlines, those things that are com-mon across all the airlines don’t need to be duplicated; accounting, payroll, hu-man resources, and other services can be pooled and shared among the three. “We can have one human resources depart-ment process employees for three air-lines. We can have one training depart-ment process training for three airlines.”

Additionally, Ravn Alaska does all of the marketing for the group, a boon for potential customers. “The concept is a one-stop shop. You can just go to Ravn Alaska’s website,” which Hajdukovich says is one of the greatest values that Ravn brings to their customers. In addition, if customers do have an issue or concern, they don’t need to call several different locations. Also, because the companies are pooling resources, when customers do have problems, there’s a larger collec-

tive pool to help with solving them. “In-stead of just waiting for one guy to deal with five hundred phone calls, you have five guys. And as we grow larger, we can have more support for our customers.”

Ravn Air Group also has the huge ben-efit that the infrastructure and equipment brought in by each individual airline can be utilized by all the airlines. “We have these incredible resources all over the state. We have ten hangars throughout

the state of Alaska, more than anyone else, and we basically tuck our airplanes in ev-ery night.” This reduces wear and tear on the planes as well as increases the comfort and safety of employees when performing maintenance or repairs on the aircraft.

It also allows Ravn to provide service to essentially all of Alaska. Hajdukovich says, “It’s this massive area of the state that covers everything except the Aleu-tian chain and the south panhandle… We have eight facilities in Barrow, two large hangars that will house six air-craft; we have a large hangar in Kotze-bue; a Nome hangar; Unalakleet hangar; [and] a massive complex in Bethel, with six buildings, sixty-three employees and sixteen aircraft.” Ravn also has facilities in Aniak, St. Mary’s, Fairbanks, Dead-horse, and Anchorage. Hajdukovich says that Ravn services more than one hundred destinations every day.

“We do a hub and spoke operation,” he says. “The concept of a major air-line versus a regional carrier is major airlines go hub-to-hub and regionals go hub-to-spoke… For us, we’re a self-contained hub and spoke. Our hub-to-hub is Corvus and our hub-to-spoke is Hageland and Frontier Flying, operat-ing as Ravn Connect.”

This type of operation is possible only because of the cross-training pro-vided to each subsidiary. Because each airline is a separate entity to the FAA, their individual processes must be fol-lowed appropriately no matter who is performing them. “We can determine that in Bethel, Hageland needs to turn [a] Corvus [aircraft] when it shows up. So those are Hageland employees that turn the aircraft in Bethel. Corvus trains Hageland employees to turn Cor-vus [planes] as if they were a contractor [and vice versa],” Hajdukovich says.

All of the flights scheduled through Ravn Alaska’s website are technically Corvus flights; however, once a plane is traveling from a hub to a spoke, it is oper-ated by whichever company is most ap-propriate. “Hageland has no scheduled flights; they’re all Corvus flights operated by Hageland,” Hajdukovich explains.

The final result is a comprehensive, well-oiled network operated by several companies, all of which have unique

“The word raven kept coming up on people’s list… and I recalled that the bird on our

tail was actually a raven, but a 1980s version when the style was all hard lines. So

we picked the word raven, but there were too many raven everythings. We decided to remove the letter ‘E’ because it’s silent, and you can say the

word without it.”—Bob Hajdukovich, CEO, Ravn Alaska


C A N

A D

A

U N

I T E DS T A

T E S

U N I T E D

S T A T E SR U S S I A

C A N A D A

U N I T E DS T A T E S

B R I T I S H C O L U M B I A

Y U K O N T E R R I T O R Y

STER

LING

HWY

EG

RO

EG

GLENN

HWY

TOK

HWY

ARD

RICH

EDGERTON

HWY

SON

PARK

SDENALIPAR

K

RD

DENALIHWY

CUT

OFF

HWY

HWY

RICH

ARD

SON

ALASKA

TAYLO

R

HWY

-

HWY

RICH

ARDSON

STE

HWY

KLO

DIKENHWY

HWY

ELLIOT

T

HWY

ESE

JAMES

NO

TL

AD

HWY

ALASKA

HWY

HWY

HAINES

CUTOFF

KLONDIKE

HWY

ALA SKA

HWY

CASSIA

R

HWY

P A C I F I C O C E A N

G U L F

O F A L A S K A

B R I S T O L B A Y

K U S K O K W I M

B A Y

N O R T O N

S O U N D

K O T Z E B U E

S O U N D

O C E A NA R C T I C

Y u k o n

K u s k o k w i m

Ri

ve

r

Ri

ve

r

Y u k o n

Ko

yu

R i v e r

Ri v e r

Yu

ko

n

R i v e r

k uk

R i v e r

R i v e r

No

at

K o b u k

a k

R i v e r

C o l v i l l e

R i v e r

Su

s

Ri v

er

R i v

T a n

it

na

e r

Co

pp

er

a n a

146

60

52

168 166 164 162

54

56

58

160 158 156 154

52

174

152 150

176

148

178180

174 176178

180

62

64

66

68

170172174176178180 156158160162 154164168 166 142144 140146148150152

142144

178

176

140

174

172

138 136

170

134

50

170

174

176

178

172

52

52

54

56

58

136 134

64

66

128132 130

60

126

130132134136138

68

70

AlaskaDepartment of Transportation & Public Facilities

Division of Program Development

Statewide GIS Mapping Section11

10

G H I J

9

8

7

K L

CC

M N

13

DD

O P

EE

Q R

FFGG

12

CC DD EEFF

GG

6

5

4

3

2

GFEDCBA NMLJ KIH VUTSRPO Q

S T

HH

II

U V

JJ

W X

KK

LL

Y

11

II

HH

JJ

KK

12

13

LL

10

9

8

X

5

Y

4

3

Z AA

7

BB

6

X Y ZW

2

1

CENTRAL REGION

C E N T R A L R E G I O N

N O R T H E R N R E G I O N

SOUTHEASTREGION

NORTHERN REGION

PRIBILOFISLANDS

ST MATTHEWISLAND

ISLANDST LAWRENCE

ISLANDNUNIVAK

Fort Yukon (FYU)

Unalaska / Dutch Harbor Apt

Mountain Village (MOU)Pilot Station (PQS)

Atmautluak (ATT)

Kasigluk (KUK)

Kongiganak (KKH)

Napakiak (WNA)

Nunapitchuk (NUP)

Platinum (PTU)

Mekoryuk (MYU)

Kwigillingok (KWK)

Tununak (TNK)

Chefornak (CYF)

Kipnuk (KPN)

Toksook Bay (OOK)

Nightmute (NME)

Newtok (WWT)

Hooper Bay (HPB)

Scammon Bay (SCM)

Chevak (VAK)

Alakanuk (AUK)

Emmonak (EMK)

Savoonga (SVA)

Gambell (GAM)Nome (OME)

Teller (TLA, TER)

Brevig Mission (KTS)

Wales (WAA)

Shishmaref (SHH)

Dillingham (DLG)Togiak (TOG)

Quinhagak (KWN)

Goodnews (GNU)

Akiachak (KKI)

Napaskiak (PKA)

Kwethluk (KWT)

Eek (EEK)

Bethel (BET)

Tuluksak (TLT)

Akiak(AKI)

Kodiak (ADQ)

Anchorage (ANC)

Homer (HOM)

Ruby (RBY)

Stony River No 2 (SRV)

Shageluk (SHX)

Holy Cross (HCR)

Chuathbaluk (CHU)

Kalskag (KLG)

Marshall (MDM,MLL)Saint Mary's (KSM)

Aniak (ANI)

Russian Mission (RSH)

Anvik (ANV)

Saint Michael (SMK)

Kotlik (KOT)

Stebbins (WBB)

Grayling (KGX)

Unalakleet (UNK)

Red Devil (RDV)

Sleetmute (SLQ)

Crooked Creek (CKD)

Buckland (BKC)

Elim (ELI)

White Mountain (WMO)

Shaktoolik (SKK)New Golovin (GLV)

Koyuk (KKA)

Deering (DRG, DEE)

Noorvik (ORV)

Galena (GAL)

Koyukuk (KYU)

Kaltag (KAL)

Nulato (NUL)

Shungnak (SHG)

Selawik (WLK)

Huslia (HSL)

Kobuk (OBU)

Tanana (TAL)

Fairbanks (FAI)

Point Hope (PHO)

Barrow (BRW)

Kotzebue (OTZ)

Kivalina (KVL)

Noatak (WTK)

Ambler (ABL, AFM)Kiana (IAN)

Deadhorse (SCC)

Cordova (CDV)

Kenai (ENA)

Anaktuvuk Pass (AKP)

Nuiqsut (NUI)

Barter Island (BTI)Point Lay (PIZ)

Wainwright (AIN)

Atqasuk (ATK)

Tuntutuliak (WTL)

Red Dog (RDB)

50 25

100

75

150

200

250

300

400

500

StatewideMap

WEATHER & APPROACHAPPROACH ONLYNO WX / NO APPROACH

6,312

3,992

4,500

4,494

7,100

4,3704,589

6,500

4,818

4,800

5,000

11,800

4,000

4,000

4,0004,000

7,249

3,986

3,000

3,992

5,900 4,0003,400

3,000

4,0014,020

3,002

3,320

4,997

3,200

2,990

3,990

2,983

4,499

4,4006,001

3,0003,000

3,4014,000

4,001

5,900

2,999

4,001

4,601

4,0004,400

4,000

4,000 3,400

2,5403,501

3.001

3,3003,220

6,008 3,200

3,620

4,000

2,500

4,820

3,100

WEATHER ONLY

6,0003,1986,400

3,3002,2001,778

3,218

2,420

3,0003,300

3,401

3,196

3,070 3,180

3,0003,248

3,0253,000

3,199

3,230

3,200

2,400

1,835

3,242

4,000

3,300

3,3004,400

6,400

7,550

6,701

7,830

12,400

2,601

7,500

4,100

Palmer (PAQ)6,009

Hub Airport WX APRCH LengthKSM Alakanuk (AUK)KSM Emmonak (EMK)KSM Kotlik (KOT)KSM Marshall (MDM,MLL)KSM Mountain Village (MOU)KSM Pilot Station (PQS)KSM Saint Mary's (KSM)OME Brevig Mission (KTS)OME Elim (ELI)OME Gambell (GAM)OME Koyuk (KKA)OME New Golovin (GLV)OME Nome (OME)OME Savoonga (SVA)OME Shishmaref (SHH)OME Teller (TLA, TER)OME Wales (WAA)OME White Mountain (WMO)OTZ Ambler (ABL, AFM)OTZ Buckland (BKC)OTZ Deering (DRG, DEE)OTZ Kiana (IAN)OTZ Kivalina (KVL)OTZ Kobuk (OBU)OTZ Kotzebue (OTZ)OTZ Noatak (WTK)OTZ Noorvik (ORV)OTZ Point Hope (PHO)OTZ Red Dog (RDB)OTZ Selawik (WLK)OTZ Shungnak (SHG)SCC Barter Island (BTI)SCC Deadhorse (SCC)SCC Nuiqsut (NUI)UNK Saint Michael (SMK)UNK Shaktoolik (SKK)UNK Stebbins (WBB)UNK Unalakleet (UNK)

4,000X X 4,601

X 4,400X X 3,200X X 3,501

2,540X X 6,008X X 2,990X X 3,401X X 4,499X X 3,000X X 4,000X X 6,001X X 4,400X X 4,997X X 2,983X X 3,990X X 3,000X X 3,000X X 3,200X X 3,320X X 3,400X X 3,000

X 4,020X X 5,900X X 3,992X X 4,000X X 3,992

6,312X X 3,002X X 4,001X X 4,818X X 6,500X X 4,589X X 4,001X X 4,001

2,999X X 5,900

Hub AirportANC Anchorage (ANC)ANC Cordova (CDV)ANC Homer (HOM)ANC Kenai (ENA)ANC Kodiak (ADQ)ANC Valdez (VDZ)ANI Aniak (ANI)ANI Anvik (ANV)ANI Crooked Creek (CKD)ANI Grayling (KGX)ANI Holy Cross (HCR)ANI Kalskag (KLG)ANI Red Devil (RDV)ANI Russian Mission (RSH)ANI Shageluk (SHX)ANI Sleetmute (SLQ)ANI Stony River No 2 (SRV)BET Akiachak (KKI) BET Akiak(AKI)BET Atmautluak (ATT)BET Bethel (BET)BET Chefornak (CYF)BET Chevak (VAK)BET Chuathbaluk (CHU)BET Dillingham (DLG)BET Eek (EEK)BET Goodnews (GNU)BET Hooper Bay (HPB)BET Kasigluk (KUK)BET Kipnuk (KPN)BET Kongiganak (KKH)BET Kwethluk (KWT)BET Kwigillingok (KWK)BET Mekoryuk (MYU)BET Napakiak (WNA)BET Napaskiak (PKA)BET Newtok (WWT)BET Nightmute (NME)BET Nunapitchuk (NUP)BET Platinum (PTU)BET Quinhagak (KWN)BET Scammon Bay (SCM)BET Togiak (TOG)BET Toksook Bay (OOK)BET Tuluksak (TLT)BET Tuntutuliak (WTL)BET Tununak (TNK)BRW Atqasuk (ATK)BRW Barrow (BRW)BRW Point Lay (PIZ)BRW Wainwright (AIN)FAI Anaktuvuk Pass (AKP)FAI Fairbanks (FAI)FAI Fort Yukon (FYU)FAI Galena (GAL)FAI Huslia (HSL)FAI Kaltag (KAL)FAI Koyukuk (KYU)FAI Nulato (NUL)FAI Ruby (RBY)

WX APRCH LengthX X 12,400X X 7,500X X 6,701X X 7,830X X 7,550X X 6,500X X 6,000X X 4,000

2,5004,000

X X 4,000X X 3,198

4,820X X 3,620X X 3,400X 3,100

2,6013,300

X 3,1963,000

X X 6,4003,230

X X 3,220X 3,401

X X 6,400X 3,242

3,300X X 3,300

X 3,000X X 3,200

2,400X X 3,199

1,835X X 3,070X X 3,248

X 3,0002,2003,180

X 2,420X X 3,300X X 4,000X X 3,001X X 4,400X X 3,218

3,3003,0251,778

X X 4,370X X 7,100X X 4,500X X 4,494X X 4,800X X 11,800X X 5,000X X 7,249X X 4,000X X 3,986

4,000X 4,000

X X 4,000

Valdez (VDZ)6,500

MA

P: C

ourt

esy

of R

avn

Ala

ska


Tasha Anderson is an Associate Editor for Alaska Business Monthly.

experience well-suited to their particu-lar tasks. “I did the math, and I think we’re collectively 238 years of aviation history in the state of Alaska,” he says.

Just a Little TurbulenceSome of that history, though, naturally led to some head-butting as the compa-nies implemented common practices and structures to function as a single entity. “I think there have been cul-tures built within the organizations throughout those many years; those cultural attributes tend to work against each other… the positive side of culture is experience and the negative side is differences between the cultures that clash,” Hajdukovich says.

“My job is to kind of pry open the minds of the groups and say, ‘Let’s be open to best practices; let’s be open to new ways of doing things; let’s not change for the sake of change, but let’s not say we aren’t changing just because we aren’t changing.’”

The rebranding, Hajdukovich says, has been beneficial in uniting the companies. “No one shared the name Ravn, there-fore you didn’t win, you didn’t win, and you didn’t win. Now we are one common name moving forward, whereas when we were Era Alaska, there was a rem-nant of Era. So did Era buy Frontier and Hageland, or did Hageland buy Frontier? No, it’s a parent/subsidiary relationship. We’ve been able to [move forward] this last twelve months and kind of coalesce.”

Only Moving UpRavn provides a desperately necessary service in Alaska, bringing in goods to areas of the state that have no roads at all or are difficult to reach overland or impossible to reach by sea. It’s a service the company takes seriously; having grown up in Alaska, all of the parts and pieces of Ravn want to see Alaska thrive.

“What we’ve tried to create is some-thing that we recognize has its challenges, but we can also say that we’re stronger than we’ve ever been. Because we’re strong we should be around a long time, and we’ll get it eventually,” Hajdukovich laughs. “If you tell us enough of your advice as a cus-tomer, we’re going to get it.” R

C A N

A D

A

U N

I T E DS T A

T E S

U N I T E D

S T A T E SR U S S I A

C A N A D A

U N I T E DS T A T E S

B R I T I S H C O L U M B I A

Y U K O N T E R R I T O R Y

STER

LING

HWY

EG

RO

EG

GLENN

HWY

TOK

HWY

ARD

RICH

EDGERTON

HWY

SON

PARK

SDENALIPAR

K

RD

DENALIHWY

CUT

OFF

HWY

HWY

RICH

ARD

SON

ALASKA

TAYLO

R

HWY

-

HWY

RICH

ARDSON

STE

HWY

KLO

DIKENHWY

HWY

ELLIOT

T

HWY

ESE

JAMES

NO

TL

AD

HWY

ALASKA

HWY

HWY

HAINES

CUTOFF

KLONDIKE

HWY

ALA SKA

HWY

CASSIA

R

HWY

P A C I F I C O C E A N

G U L F

O F A L A S K A

B R I S T O L B A Y

K U S K O K W I M

B A Y

N O R T O N

S O U N D

K O T Z E B U E

S O U N D

O C E A NA R C T I C

Y u k o n

K u s k o k w i m

Ri

ve

r

Ri

ve

r

Y u k o n

Ko

yu

R i v e r

Ri v e r

Yu

ko

n

R i v e r

k uk

R i v e r

R i v e r

No

at

K o b u k

a k

R i v e r

C o l v i l l e

R i v e r

Su

s

Ri v

er

R i v

T a n

it

na

e r

Co

pp

er

a n a

146

60

52

168 166 164 162

54

56

58

160 158 156 154

52

174

152 150

176

148

178180

174 176178

180

62

64

66

68

170172174176178180 156158160162 154164168 166 142144 140146148150152

142144

178

176

140

174

172

138 136

170

134

50

170

174

176

178

172

52

52

54

56

58

136 134

64

66

128132 130

60

126

130132134136138

68

70

AlaskaDepartment of Transportation & Public Facilities

Division of Program Development

Statewide GIS Mapping Section11

10

G H I J

9

8

7

K L

CC

M N

13

DD

O P

EE

Q R

FFGG

12

CC DD EEFF

GG

6

5

4

3

2

GFEDCBA NMLJ KIH VUTSRPO Q

S T

HH

II

U V

JJ

W X

KK

LL

Y

11

II

HH

JJ

KK

12

13

LL

10

9

8

X

5

Y

4

3

Z AA

7

BB

6

X Y ZW

2

1

CENTRAL REGION

C E N T R A L R E G I O N

N O R T H E R N R E G I O N

SOUTHEASTREGION

NORTHERN REGION

PRIBILOFISLANDS

ST MATTHEWISLAND

ISLANDST LAWRENCE

ISLANDNUNIVAK

Fort Yukon (FYU)

Unalaska / Dutch Harbor Apt

Mountain Village (MOU)Pilot Station (PQS)

Atmautluak (ATT)

Kasigluk (KUK)

Kongiganak (KKH)

Napakiak (WNA)

Nunapitchuk (NUP)

Platinum (PTU)

Mekoryuk (MYU)

Kwigillingok (KWK)

Tununak (TNK)

Chefornak (CYF)

Kipnuk (KPN)

Toksook Bay (OOK)

Nightmute (NME)

Newtok (WWT)

Hooper Bay (HPB)

Scammon Bay (SCM)

Chevak (VAK)

Alakanuk (AUK)

Emmonak (EMK)

Savoonga (SVA)

Gambell (GAM)Nome (OME)

Teller (TLA, TER)

Brevig Mission (KTS)

Wales (WAA)

Shishmaref (SHH)

Dillingham (DLG)Togiak (TOG)

Quinhagak (KWN)

Goodnews (GNU)

Akiachak (KKI)

Napaskiak (PKA)

Kwethluk (KWT)

Eek (EEK)

Bethel (BET)

Tuluksak (TLT)

Akiak(AKI)

Kodiak (ADQ)

Anchorage (ANC)

Homer (HOM)

Ruby (RBY)

Stony River No 2 (SRV)

Shageluk (SHX)

Holy Cross (HCR)

Chuathbaluk (CHU)

Kalskag (KLG)

Marshall (MDM,MLL)Saint Mary's (KSM)

Aniak (ANI)

Russian Mission (RSH)

Anvik (ANV)

Saint Michael (SMK)

Kotlik (KOT)

Stebbins (WBB)

Grayling (KGX)

Unalakleet (UNK)

Red Devil (RDV)

Sleetmute (SLQ)

Crooked Creek (CKD)

Buckland (BKC)

Elim (ELI)

White Mountain (WMO)

Shaktoolik (SKK)New Golovin (GLV)

Koyuk (KKA)

Deering (DRG, DEE)

Noorvik (ORV)

Galena (GAL)

Koyukuk (KYU)

Kaltag (KAL)

Nulato (NUL)

Shungnak (SHG)

Selawik (WLK)

Huslia (HSL)

Kobuk (OBU)

Tanana (TAL)

Fairbanks (FAI)

Point Hope (PHO)

Barrow (BRW)

Kotzebue (OTZ)

Kivalina (KVL)

Noatak (WTK)

Ambler (ABL, AFM)Kiana (IAN)

Deadhorse (SCC)

Cordova (CDV)

Kenai (ENA)

Anaktuvuk Pass (AKP)

Nuiqsut (NUI)

Barter Island (BTI)Point Lay (PIZ)

Wainwright (AIN)

Atqasuk (ATK)

Tuntutuliak (WTL)

Red Dog (RDB)

50 25

100

75

150

200

250

300

400

500

StatewideMap

WEATHER & APPROACHAPPROACH ONLYNO WX / NO APPROACH

6,312

3,992

4,500

4,494

7,100

4,3704,589

6,500

4,818

4,800

5,000

11,800

4,000

4,000

4,0004,000

7,249

3,986

3,000

3,992

5,900 4,0003,400

3,000

4,0014,020

3,002

3,320

4,997

3,200

2,990

3,990

2,983

4,499

4,4006,001

3,0003,000

3,4014,000

4,001

5,900

2,999

4,001

4,601

4,0004,400

4,000

4,000 3,400

2,5403,501

3.001

3,3003,220

6,008 3,200

3,620

4,000

2,500

4,820

3,100

WEATHER ONLY

6,0003,1986,400

3,3002,2001,778

3,218

2,420

3,0003,300

3,401

3,196

3,070 3,180

3,0003,248

3,0253,000

3,199

3,230

3,200

2,400

1,835

3,242

4,000

3,300

3,3004,400

6,400

7,550

6,701

7,830

12,400

2,601

7,500

4,100

Palmer (PAQ)6,009

Hub Airport WX APRCH LengthKSM Alakanuk (AUK)KSM Emmonak (EMK)KSM Kotlik (KOT)KSM Marshall (MDM,MLL)KSM Mountain Village (MOU)KSM Pilot Station (PQS)KSM Saint Mary's (KSM)OME Brevig Mission (KTS)OME Elim (ELI)OME Gambell (GAM)OME Koyuk (KKA)OME New Golovin (GLV)OME Nome (OME)OME Savoonga (SVA)OME Shishmaref (SHH)OME Teller (TLA, TER)OME Wales (WAA)OME White Mountain (WMO)OTZ Ambler (ABL, AFM)OTZ Buckland (BKC)OTZ Deering (DRG, DEE)OTZ Kiana (IAN)OTZ Kivalina (KVL)OTZ Kobuk (OBU)OTZ Kotzebue (OTZ)OTZ Noatak (WTK)OTZ Noorvik (ORV)OTZ Point Hope (PHO)OTZ Red Dog (RDB)OTZ Selawik (WLK)OTZ Shungnak (SHG)SCC Barter Island (BTI)SCC Deadhorse (SCC)SCC Nuiqsut (NUI)UNK Saint Michael (SMK)UNK Shaktoolik (SKK)UNK Stebbins (WBB)UNK Unalakleet (UNK)

4,000X X 4,601

X 4,400X X 3,200X X 3,501

2,540X X 6,008X X 2,990X X 3,401X X 4,499X X 3,000X X 4,000X X 6,001X X 4,400X X 4,997X X 2,983X X 3,990X X 3,000X X 3,000X X 3,200X X 3,320X X 3,400X X 3,000

X 4,020X X 5,900X X 3,992X X 4,000X X 3,992

6,312X X 3,002X X 4,001X X 4,818X X 6,500X X 4,589X X 4,001X X 4,001

2,999X X 5,900

Hub AirportANC Anchorage (ANC)ANC Cordova (CDV)ANC Homer (HOM)ANC Kenai (ENA)ANC Kodiak (ADQ)ANC Valdez (VDZ)ANI Aniak (ANI)ANI Anvik (ANV)ANI Crooked Creek (CKD)ANI Grayling (KGX)ANI Holy Cross (HCR)ANI Kalskag (KLG)ANI Red Devil (RDV)ANI Russian Mission (RSH)ANI Shageluk (SHX)ANI Sleetmute (SLQ)ANI Stony River No 2 (SRV)BET Akiachak (KKI) BET Akiak(AKI)BET Atmautluak (ATT)BET Bethel (BET)BET Chefornak (CYF)BET Chevak (VAK)BET Chuathbaluk (CHU)BET Dillingham (DLG)BET Eek (EEK)BET Goodnews (GNU)BET Hooper Bay (HPB)BET Kasigluk (KUK)BET Kipnuk (KPN)BET Kongiganak (KKH)BET Kwethluk (KWT)BET Kwigillingok (KWK)BET Mekoryuk (MYU)BET Napakiak (WNA)BET Napaskiak (PKA)BET Newtok (WWT)BET Nightmute (NME)BET Nunapitchuk (NUP)BET Platinum (PTU)BET Quinhagak (KWN)BET Scammon Bay (SCM)BET Togiak (TOG)BET Toksook Bay (OOK)BET Tuluksak (TLT)BET Tuntutuliak (WTL)BET Tununak (TNK)BRW Atqasuk (ATK)BRW Barrow (BRW)BRW Point Lay (PIZ)BRW Wainwright (AIN)FAI Anaktuvuk Pass (AKP)FAI Fairbanks (FAI)FAI Fort Yukon (FYU)FAI Galena (GAL)FAI Huslia (HSL)FAI Kaltag (KAL)FAI Koyukuk (KYU)FAI Nulato (NUL)FAI Ruby (RBY)

WX APRCH LengthX X 12,400X X 7,500X X 6,701X X 7,830X X 7,550X X 6,500X X 6,000X X 4,000

2,5004,000

X X 4,000X X 3,198

4,820X X 3,620X X 3,400X 3,100

2,6013,300

X 3,1963,000

X X 6,4003,230

X X 3,220X 3,401

X X 6,400X 3,242

3,300X X 3,300

X 3,000X X 3,200

2,400X X 3,199

1,835X X 3,070X X 3,248

X 3,0002,2003,180

X 2,420X X 3,300X X 4,000X X 3,001X X 4,400X X 3,218

3,3003,0251,778

X X 4,370X X 7,100X X 4,500X X 4,494X X 4,800X X 11,800X X 5,000X X 7,249X X 4,000X X 3,986

4,000X 4,000

X X 4,000

Valdez (VDZ)6,500



It is early afternoon in Brevig Mission on Alaska’s Seward Peninsula and the kids are clamoring for fresh pizza

for dinner. The nearest pizza joint is six-ty-five roadless miles away in Nome, but all it takes is a phone call and a couple hours later a half-Hawaiian, half-rein-deer sausage pizza from Nome’s Airport Pizza is delivered, courtesy of Bering Air’s regularly scheduled flight.

In fact, residents of more than a dozen remote villages from Savoonga to Kotze-bue can order out—way out—and have dinner delivered straight to the airstrip, thanks to Bering Air, a small regional airline based in Nome that serves dozens of communities as well as charter flights to the Russian Far East. It’s just one ex-ample of the way Alaska’s small air carri-ers are woven into the fabric of rural life.

LifelinesIn a state a fifth the size of the Lower 48, with scattered communities far from the road system, airport runways are lifelines, says Lee M. Ryan, vice presi-dent of Ryan Air.

“It’s a very fitting term,” Ryan says. “If you’re down to life and death, the only way to get out is the airport. The abil-ity to feed communities, the ability to connect communities—you don’t think about roads too much when you’re driv-

ing around the city, but you really think about roads when you don’t have them.”

Ryan Air, which in 2013 celebrated its sixtieth anniversary, is a family enterprise that was started by Lee Ryan’s grandfa-ther, Wilfred Ryan Sr., as Unalakleet Air Taxi. Over the decades it grew to become one of Alaska’s key freight carriers, oper-ating out of seven regional hubs with a fleet of Cessna 207s, CASA 212-200s, and a Cessna Caravan 208x. It has more than ninety employees and is Bush Alaska’s largest freight company, Ryan says.

For seventy communities, Ryan Air is the way residents get diapers, pilot bread, batteries, and all the things necessary for life in rural Alaska. They can travel be-tween villages or to Anchorage to visit rel-atives, get medical care, or connect to the rest of the United States and the world.

“People have the ability to live their lives every day,” he says. “They’re able to be themselves, able to keep their cul-ture, keep their traditions, keep their lifestyle, and still be able to reach the Lower 48. Still be connected.

“Our goal is to have everybody who makes their home out in the Bush to be able to live like they were in the city with all the amenities,” Ryan says. Ryan Air’s planes can handle just about anything that fits in the cockpit within weight limits, including cars, as well as more unusual cargo.

“We’ve hauled a walrus before—a live walrus,” he says, recalling an instance

in which the young walrus hauled out on the barges at the port of the Red Dog zinc mine north of Kotzebue and wouldn’t leave. “It ended up going to the [Alaska] SeaLife Center.”

Improving LivesAir freight is not inexpensive, but most rural Alaskans are able to take advan-tage of federally subsidized bypass mail, which allows rural air carriers to transport bulk shipments at parcel post rates without going through USPS. The bypass system helps keep prices down for rural Alaskans and is a major part of business for the carriers themselves.

The smaller carriers frequently work di-rectly with larger carriers such as Alaska Airlines, Northern Air Cargo, Lynden Air Cargo, and Everts Air Cargo, which work out of Anchorage and Fairbanks with larger planes that service the larger hubs.

Everts Air Cargo and Everts Air Alaska is another family-owned airline, established by Robert W. Everts in 1978 in the Interior Alaska village of Eagle as Tatonduk Flying Service. Now under the umbrella of Taton-duk Outfitters Limited, Everts flies freight, bulk fuel, and passengers to twelve major hubs in Alaska. Operations are based in Fairbanks, but scheduled flights are out of Anchorage. The company has 300 employ-ees, 290 in Alaska and 10 in the Lower 48.

Robert Everts’ father, Cliff Everts, began hauling fuel in converted mili-

An Everts Air Cargo DC-6 landing in rural Alaska.

Photo courtesy of Everts Air Cargo

Small Air Carriers Improve Rural LifeSmall Air Carriers Improve Rural Life

By Julie Stricker


tary aircraft, which are still an impor-tant part of the Everts fleet, according to Paul Abad, sales manager for Everts Air Cargo. In fact, Alaska is the only place the twin-engine, propeller-driven Curtiss C-46 Commando and the four-engine Douglas DC-6 are still used.

The planes, which were first produced in 1940 and 1946, respectively, are reli-able workhorses, but aren’t without their quirks.

“They always need parts, so we have someone on staff who searches the world and buys whole planes for the parts,” Abad says. “There is a huge ‘graveyard’ in Fairbanks.”

From the beginning, Everts’ corpo-rate goal has been to improve the lives of those who depend on them, Abad says. . They are always working to iden-tify growing markets, such as Togiak in southwest Alaska, which recently be-gan to receive regular DC-6 flights that can accommodate larger bulk items, reducing shipping costs to the area. In return, Togiak is hoping the increased traffic will result in upgrades to its cur-rent gravel runway, which could lead to future economic growth.

That works directly with Everts’ mis-sion to improve the lives of the people, especially Alaska Natives, who depend on them, Abad says. Everts employees reflect this mission.

“Everts employees are very hard-working Alaska people,” he says. “We are tough and rugged Alaska people—like our planes. Pilots offload the planes in rural Alaska. They are the crew. They are amazing people.”

The cargoes delivered by Everts crews can roughly be distributed into a pie with six pieces: bypass mail, regular mail, small parcels, bulk freight, over-size freight, and hazardous materials.

“Everything that will fit in the cargo door,” Abad says.

“The owners have an entrepreneurial spirit and motivate employees and make them passionate about being in the com-pany,” Abad says. “They all share the same purpose and belief and that is to assist Alaska people, first and foremost.

“There may be better opportunities and better planes, but the employees are there so they can be assisting and helping fellow Alaskans. A lot of employees work herefor decades and decades. It is a unique envi-ronment to work and operate in.”

Unique PartnershipsThat unique environment can lead to some unique partnerships. Although the air carriers are in competition with each other, they also work together to ensure the communities’ needs are met.

For instance, PenAir is Alaska’s larg-est commuter airline. It operates a fleet of forty aircraft, providing scheduled ser-vice to thirty-six communities in south-west Alaska, including Cold Bay, Sand Point, and Dutch Harbor in the Aleutians, which are known for terrible weather.

PenAir has a capacity purchase agree-

ment with Alaska Airlines to fly to those remote communities, says Missy Roberts, vice president of marketing and sales.

“It’s an Alaska Airlines market,” she says. “They market it; they sell it; we use our aircraft and our crew.” PenAir uses a Saab 340B, a thirty-passenger aircraft with a bathroom, to fly into Dutch Har-bor but is purchasing three new Saab 2000s this fall, faster airplanes that can carry forty-five passengers and will shave an hour off the current three-hour trip to the remote island.

Being able to connect residents of

Work ing together to s t rengthen Alaska’s economy and bui ld a br ighter fu ture for the nex t generat ion.

Cal istaCorporation ★ (907) 275-2800

ADVERTISING COMMUNICATIONS CONSTRUCTION ENERGY ENGINEERING ENVIRONMENTAL

EQUIPMENT EXCAVATION FEDERAL CONTRACTING NATURAL RESOURCES TRANSPORTATION

Brice Marine - Wainwright Seawall ConstructionWainwright, Alaska


southwest Alaska to Anchorage is im-portant, Roberts says. Residents are dependent on being able to fly in and out of Anchorage for medical, personal, and corporate reasons.

“It’s a really big deal,” she says of the car-rier’s importance in the villages. “For all of them that we serve, except for two places, there is nobody else flying between them and Anchorage. No road access at all.”

PenAir also has two cargo-only planes that service many of the same communities as their passenger flights. They also have operations in Boston and will be starting operations in Port-land, Oregon, this fall.

Safe LandingsInfrastructure is another key part of the air carrier business in Alaska. The Alaska Department of Transportation and Public Facilities is responsible for maintaining public runways through-out the state. Depending on the com-munity, these can range from the ten thousand-plus feet needed for big jets to short gravel runways on which only the smallest planes can land safely.

One of the reasons Everts still relies on its World War II era planes is that they can safely land and take off from runways of only 3,500 feet. The DC-9 jet requires a runway of 5,900 feet, while the MD-80 requires a 6,000 foot runway, Abad says.

In some communities in Southeast Alaska, there are no runways, which is why Ketchikan-based Taquan Air main-tains a fleet of eight DeHavilland Beaver floatplanes, says general manager Tory Korn.

“Of the communities we serve, only one of them really has an operating runway,” Korn says. Taquan does have an amphibious Cessna Caravan that could land at the Ketchikan airport, but they’ve never needed to do so, he adds.

Taquan provides regular mail and pas-senger service to more than a dozen com-munities in Southeast Alaska. For most of them, Taquan is the only way in or out that doesn’t require a boat. If there is an-other carrier serving a community, such as Metlakatla, Taquan will split the mail delivery with the other carrier, Korn says.

In recent years, a contract with Lyn-den for UPS deliveries has been a main-stay of Taquan’s freight business, thanks to ordering goods off the Internet.

“Everyone is using Amazon Prime

AN ALASKA MINING PROJECT COMMITTED TO:

LOCAL HIRE

RESPONSIBLE DEVELOPMENT

ENVIRONMENTAL INTEGRITY


around the clock like larger carriers such as Alaska Airlines. “We’re operating basi-cally store hours,” he says. “Probably the hardest thing for us is to get deliveries to the stores while they’re open.”

Small air carriers do many things to improve day-to-day lives in rural Alaska. Besides delivering pizza, the carriers will also pick up recyclables from villages. They have transported orphan wildlife, injured eagles, and baby goats. Taquan Air also picked up several abused and neglected dogs from an island community and took them

to the Ketchikan animal shelter, where they were adopted into the community. It’s the little things that can make up for big challenges.

“It’s not easy to run an airline oper-ating in an area the size of the middle United States,” Ryan says. “It’s a huge area with a lot of moving parts, but it’s very rewarding.” R

Julie Stricker is a journalist living near Fairbanks.

now, and you get free shipping on it,” he says. Taquan also will deliver prescrip-tions from the pharmacy, heated toilet seats, construction materials, “any-thing they need we can do as long as it fits into a Beaver.”

The Beavers have a 1,200-pound ca-pacity “that includes people,” he says. “If you have two people and they weigh two hundred pounds each, that only leaves you eight hundred pounds for freight.”

The DeHavilland Beaver was only manufactured for twenty years, from 1947 to 1967. Only 1,652 Beavers were built, according to Taquan Air, 800 of which were purchased by the US mili-tary. It is often considered the “best bush plane ever built” for the rugged conditions in Southeast.

Improvements All AroundIn addition to a rigorous maintenance program, Taquan also earned five-star certification under the voluntary Alaska Medallion Foundation Safety in Aviation Program. In 2008, it was awarded the Medallion Shield. It also adopted FAA’s Capstone Program and became the first floatplane carrier in Alaska to install state-of-the-art glass cockpit avionics navigation equipment throughout its fleet.

“For an airline our size, it’s a real feather in our cap to have that certifica-tion done,” Korn says.

Everts, PenAir, and Ryan also partici-pate in the Medallion Foundation pro-gram, a nonprofit organization that works with carriers to create safety management systems. Ryan says it’s one indication of how the safety culture has changed in ru-ral Alaska in the past four decades.

“My dad started flying in 1970 and it’s totally different between now and back then,” he says. “It was the tail end of the bush pilot days and going into the airline pilot days. He played a big part in that transition.”

The old bush pilot fly-by-the-seat-of-your-pants mentality is long gone, Ryan says. “I would never consider myself a bush pilot. I would consider myself a rural pilot.”

Besides Alaska’s notorious weather, other challenges to running a rural air carrier include connectivity and infra-structure, or lack thereof, Ryan says.

Computer systems have made it easier to connect with communities and stream-line efficiency, but Ryan Air can’t operate



Southeast Alaska Maritime Economy

Grows

Southeast Alaska Maritime Economy

Grows


Transportation

If there’s an anchor to the economy in Southeast Alaska it’s the regional maritime industry, which ranges

from fisheries, water transportation, cruise ship support, the state ferry sys-tem (itself one of the largest marine employers) to, finally, shipbuilding, the new bright spot for the region.

About a fourth of all South-east Alaska wages stem

directly from ocean-related “blue”

jobs, which totaled

8,200 in the region in 2013 and ac-counted for $475 million in wages. This is according to Southeast Conference, the regional economic development association, in its March2015 report, “The Maritime Economy of Southeast Alaska.”

The report relied on data compiled by Rain Coast Data, a Juneau consulting firm.

“We are a maritime economy. It is what marks our identity and what fuels our eco-nomic engine,” said Shelly Wright, execu-tive director of the Southeast Conference.

The ocean is the most dominant feature of Southeast Alaska, the report said. The region is defined as stretching five hun-dred miles from Dixon Entrance near

Ketchikan to Yaku-tat, on the Gulf of Alaska coast north-

west of Juneau and the northern Lynn Ca-nal communities of Haines and Skagway.

The mainland coast is defined, in most places, as a narrow strip of land between mountains and shore. There are 1,100 islands making up the Alex-ander Archipelago in Southeast, which creates a total shoreline of approxi-mately eighteen thousand miles.

Long HistorySoutheast’s maritime tradition dates back ten thousand years, the report notes, and is rooted to the seafaring traditions of the original Tlingit, Hai-da, and Tsimshian peoples of the area. Russians were in the region in the 1700s after furs, and in the late 1800s there was gold mining and seafood process-ing, all dependent on waterborne trade.

The Tlingits in particular used the wealth of the sea to develop sophisticated trade relations and craft skills. They be-came skilled navigators along ocean trade routes using large, ocean-going canoes.

After the American purchase of Alaska from Russia in 1867, it wasn’t long until

the natural beauty of the region came to the nation’s attention along with its

mineral wealth. Conservationist John Muir wrote about the

scenic splendor of the Southeast coast in the

1970s, and by the 1980s

Industries and jobs shift from forest to oceanBy Mike Bradner

Ketchikan Shipyard, now being operated by Vigor Alaska.Courtesy of Vigor Alaska


steamships carrying freight and pas-sengers, among them gold miners, were bringing the first cruise tourists. Today the number of visitors on cruise ships approaches 1 million, which has given rise to new ocean-related tourism busi-nesses like whale watching and sea kay-aking, as well as sports fishing.

Employment GrowthWhat’s striking is how steadily the Southeast maritime sector is growing, according to the information compiled by Rain Coast Data. From 2010 to 2013 maritime-related total wages in South-east grew 24 percent across all com-ponents of the industry, an increase of $74 million in direct wages. Cycles in salmon harvests and earnings explain part of this, but the growth is striking in comparison to 5 percent growth in maritime earnings statewide, or $139 million, during the same period.

Direct employment also increased, up by 13 percent, or eight hundred jobs. “This includes a 49 percent increase in US Coast Guard jobs, a 24 percent in-crease in marine tourism jobs, a 12 per-cent increase in marine transportation jobs, and a 7 percent increase in sea-food sector jobs,” the Southeast Confer-ence said.

The Rain Coast Data report showed seafood processing and fish harvesting jobs increasing to 4,252; an increase in marine jobs related to tourism to 952; US Coast Guard jobs up to 761; marine transportation jobs were up to 450; and marine-related construction jobs were up to 51. Shipbuilding and repair dipped slightly, down 2 percent to 231, but this was prior to work beginning on new state ferries being built in Ketchikan.

Broad gains from 2012 to 2013 were reflected through the data. In 2012 there were 402 firms engaged in ma-rine-related work in Southeast, employ-ing 8,200 and paying $474.4 million in total wages, or $57,860 as an average annual wage, according to the data. Employment in maritime industries increased 12 percent between 2012 and 2013, while wages grew 12 percent.

Public sector maritime employment is big, through the Coast Guard and Alas-ka Marine Highway System, but private sector marine jobs still total 75 percent of the total, according to the Southeast Conference’s maritime report.


Star PerformerIf there is a star performer for South-east’s growing maritime industry, it is in shipbuilding and repair. Ketchikan’s shipyard, long in development and with its ups and downs over the years, has now developed into a well-equipped vessel construction and major main-tenance site. Most recently the Alaska Department of Transportation and Public Facilities has contracted with the shipyard to build two large “Alaska Class” ferries for the Alaska Marine Highway System.

But there are other Southeast com-munities that have developed local shipbuilding, support, and repair cen-ters, particularly Sitka and Wrangell.

In Ketchikan, Vigor Alaska now has about 168 people at work with more being added every week, according to Doug Ward, Vigor Alaska’s develop-ment director.

Much of the new work is on the two “Alaska Class” ferries under construc-tion in the Ketchikan Shipyard, which is operated by Vigor. The two sections for the vessels are built and work has shifted to fabrication of modules for the top sections, which will be built and then stored at the site until the installa-tion, which will come later. American-made specialty steel, a higher-grade steel to ensure the watertight integrity of the hull, has also been ordered.

At the peak of activity, Vigor expects to have about 80 to 100 employees working full-time purely on the two new ferry vessels for four years, as well as about 150 employed in other work the yard will be doing. A workforce of 160 translates to an approximate $10 million annual payroll, Ward says.

Reinvigorating the BaseKetchikan’s success with shipbuilding is the most striking example of how shipbuilding can reinvigorate a com-munity’s industrial base. When the Ketchikan Pulp Mill closed in 1997, well-paying jobs were lost and the in-dustrial base of the community was seemingly wiped out.

Community leaders began working with the idea of expanding ship main-tenance in Ketchikan as a replacement industry as some of the skills of laid-off pulp mill workers corresponded to skills needed in ship repair. Ketchikan is also

well located to provide maintenance on fishing and vessels engaged in marine transportation, so operators don’t have to send their vessels all the way to the Pacific Northwest for annual servicing.

State officials were interested in help-ing. In the 1970s the first nine ferry vessels of the Alaska Marine Highway System fleet were built, but there was no facility in Alaska capable for providing the annual maintenance these large, modern ships needed. The state De-partment of Transportation and Public Facilities stepped in to develop a ship-

yard in Ketchikan to support the ferry fleet and spent $30 million in the 1980s to develop the yard on what was origi-nally a 16-acre site of an abandoned cannery (the yard has now grown to oc-cupy 25.2 acres).

There was already a small ship main-tenance facility in Ketchikan that began operating mainly on a seasonal basis in 1981. Ship repairs were done in winter, including maintenance on state ferry vessels, and employing skilled labor who worked on major maintenance projects on the pulp mill during summer.

SALES@V IGOR INDUSTR IAL .COM

V IGORINDUSTRIAL .COM

• Locations in Seward and Ketchikan• Mobile Support• Competitive Pricing

QUALITY SHIP REPAIR & NEW BUILDSFROM VIGOR ALASKA


Finding SuccessThe shipyard had its problems in the early years. Under an agreement with the state Department of Transporta-tion and Public Facilities and the City of Ketchikan, the site was subleased for operation of the shipyard by private operators. However, each experienced operational and financial difficul-ties and the facility was closed for two years, reopening in 1994 with a new private operator, Alaska Ship and Dry-dock (AS&D). AS&D, locally-owned, straightened out the problems and the shipyard developed a long-term pro-gram for growth.

In 1997 the ownership of the ship-yard was transferred to AIDEA (Alaska Industrial Development and Export Authority), the state’s development fi-nance corporation, which still owns the yard. The AS&D lease continued.

The Alaska Department of Trans-portation and Public Facilities’ focus was mainly on support of the marine highway fleet, but AIDEA’s mandate is larger: to foster economic development. The idea of building ships at the yard was conceived at first as a way to even out the annual work. Winter was the maintenance season for existing ves-sels, but if there were orders to build ships it would keep skilled staff busy year-round.

Over several years the shipyard’s work was expanded to include, in ad-dition to annual ferry vessel overhauls, work on vessels for the US Coast Guard, federal and state research agencies, and large fishing and tourism vessels. The shipyard was still critical to the ferry system, however, and in 2004 the head-quarters of the ferry system was moved from Juneau to Ketchikan so that ferry system managers would be located in the same community as the shipyard.

With privately-owned AS&D as oper-ator and AIDEA as owner, the shipyard was finally a success, growing from 21 employees and $2.4 million in revenues in 1994 to 120 employees and $37 mil-lion in revenues in 2012. In 2012, AS&D was strengthened through its purchase by Vigor Industrial, a major Pacific Northwest shipyard operator. Vigor added Ketchikan to Vigor’s existing six shipyards in the Northwest, retaining AS&D as a Vigor subsidiary with its name changed to Vigor Alaska.

BOYER TOWING, INC.Base Operations in Ketchikan and Seattle

Serving Alaska Since 1953 – Contract Carriage, General Towing, Log Barging, Chip Hauling – Serving All of Alaska to the Beaufort Sea, US West Coast and Mid Pacific Islands – 16 tugs to 4000 HP – 19 barges 120’ to 300’, 15,000 ton capacity

Ketchikan Alaska Office:Ph: 907-225-2090 Fax: 907-225-4468E-mail: [email protected]

Seattle Office:Ph: 206-763-8696 Fax: 206-767-9517E-mail: [email protected]

Boyer Logistics, Inc. – 5 Acre Terminal in Seattle – Heavy Ro-Ro Ramps – Cargo Handling equipment including cranes to 300 tons

© Glenn Aronwits

EASY. AFFORDABLE . EFF IC IENT.

A L A S K A R A I L R O A D

ON TRACKKEEP YOUR BUDGET & SCHEDULE

Alaska Railroad’s Rail/Marine Service is one of the most affordable and efficient ways to transport equipment and supplies. We can ship anywhere in the contiguous U.S. with no transloading, and no headaches.

Visit AlaskaRailroad.com or call 800.321.6518 for more information.


Shipbuilding jobs pay well, too. “Nationally, average annual wages in shipbuilding and repair are 45 percent higher than the average for the private sector economy. Similar earnings ratios are reported in Ketchikan,” according to an industry workforce blueprint, the “Alaska Maritime Workforce Develop-ment Plan,” published in May 2014.

The seafood and marine service in-dustries and the University of Alaska worked together on the report as part of the state’s 2012 Fishing, Seafood and Maritime Initiative.

Maritime MaintenanceKetchikan isn’t the only community benefiting from increased ship main-tenance and repair work. According to a September 2014 report on Alaska’s maritime support sector by the Alaska Department of Commerce and Eco-nomic Development, several coastal communities are moving to develop lo-cal ship maintenance facilities.

One is Wrangell, north of Ketchikan, which is host to a fleet of fishing, rec-reation, and work boats. The recent installation of two hydraulic lifts and

Bow of the longliner F/V Handler under construction at the Ketchikan Ship-yard by Vigor Alaska. (See the digital edition for a series of photos detailing the building of this boat.)

Courtesy of Vigor Alaska



a marine railway at Wrangell’s marine services center have allowed 300-ton vessels to be hauled out and worked on.

Petersburg, near Wrangell, has a large commercial fishing fleet and two hydraulic lifts that can also haul out 300-ton vessels for maintenance. Not to be left out, the smaller community of Hoonah, to the north, has a 220-ton lift.

An example of the benefit of having maintenance work done in the state was a case of a tug from Juneau which had its annual maintenance done in Wrangell: avoiding a trip south to Bellingham or Port Townshend, in Washington state, saved $20,000 in fuel, according to the state commerce department report.

The future looks good, too. “With Alaska state ferries under construc-tion in the state for the first time, a re-bounding tourist sector, and expected increases in 2015 seafood harvests, the outlook for the maritime economy is for continued growth,” the Southeast Conference said.

The demographics of the Alaska fleet, in which many vessels are aging, will mean work for regional ship builders and repair facilities. By 2025, in the Alaska small vessel fleet, of those sixty feet or under, 3,100 vessels will be forty-five years old or older. The smaller Alas-ka ship maintenance facilities will be ideal for work on these smaller vessels.

Today new maritime opportunities are emerging across Alaska, the South-east Conference report said. “Retreating sea ice has increased the accessibility of the Arctic, generating new economic opportunities and an increasing US Coast Guard presence,” the report said. Even though the Arctic is far from Southeast Alaska the region’s maritime support industry as well as the Coast Guard, which has its Alaska headquar-ters in Juneau, will likely be engaged in vessel maintenance and other support work that may eventually develop.

It has been a surprising turnaround for a region that once had a strong in-dustrial base rooted in the forest indus-try, with pulp and saw mills, but is now looking to a bright future in its oldest industry, the ocean. R

MARINE TERMINAL i BARGE TRANSPORTATION BULK LOGISTICS i CARGO OPERATIONS

6701 Fox Avenue, South Seattle, WA 98108Tel: 206-767-6000 Fax: 206-767-6015

email: [email protected]

SSSSSSSSSSSSSSSSSSSSSEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEATTTTTTTTTTTTEATEAEAEATEATEATEAEAEATEAEATEAEAEATEATEATEAEAEATEATTTACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACTACTTTACTACTACTTTACTACACACACACACACACACACACAC MMMMMMMMMMMMMMMMMMARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEMARINEMMMARINEMARINEMARINEMMMARINEMMARINEMMMARINEMARINEMARINEMMMARINEMARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINEARINE SSSSSSSSSSSSSSSSSSERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICESERVICES

www.lynden.com 1-888-596-3361

At Lynden, we understand that plans change but deadlines don’t. That’s why we proudly off er our exclusive Dynamic Routing system. Designed to work around your unique requirements, Dynamic Routing allows you to choose the mode of transportation — air, sea or land — to control the speed of your deliveries so they arrive just as they are needed. With Lynden you only pay for the speed you need!

Only pay for the speed you need... Dynamic Routing!SM

The new Lynden phone app is now available to download!

COMPANY TOP EXECUTIVE FOUNDED/ESTAB. AK WORLDWIDE\AK EMPLOYEES SERVICES

AIR

62 June 2015 | www.akbizmag.com

Company Top Executive Services

ACE Air Cargo5901 Lockheed Ave.Anchorage, AK 99502Phone: 907-334-5100 Fax: 907-245-0243

Mike Bergt, Pres.

[email protected]

19881988

104104

On Demand passenger charters throughout the State of Alaska. Cargo transportationprovider offering scheduled cargo service to 21 locations in Alaska. ACE Logisticsfreight-forwarding and logistics provider. ACE Air Services offers aviation ground-handling for commercial and private carriers.

Ace Delivery & Moving, Inc.PO Box 221389Anchorage, AK 99522-1389Phone: 907-522-6684 Fax: 907-349-4011

Hank Schaub, GM

[email protected]

19941994

1111

Air cargo and express-package services, air courier services, arrangement oftransportation of freight, freight-transportation services, local delivery services, localtrucking with storage and third-party logistics. Residential and office moves. Hot shots,and white glove residential deliveries.

Alaska Air Cargo4700 Old Int'l Airport Rd.Anchorage, AK 99502Phone: 800-225-2752 Fax: 907-266-7808

Marilyn Romano, Reg. VP Alaska

alaskacargo.com

19321932

10,239500

Goldstreak small package express, Petstreak animal express, priority and general airfreight services. Full ULD and charter services also available.

Alaska Air Forwarding4000 W. 50th Ave., Suite 6Anchorage, AK 99502Phone: 907-248-4697 Fax: 907-248-9706

Jeff Dornes, Co-Owner

[email protected]

19691969

304

Air freight, trade shows, shipment consolidations, nationwide purchase orderprocurement service and international shipping.

Alaska Air Taxi LLC4501 Aircraft Dr.Anchorage, AK 99502Phone: 907-243-3944 Fax: 907-248-2993

Jack Barber, Owner

[email protected]

19871987

88

Passenger & Cargo Air Charters - Direct charter flights to your community fromAnchorage. We offer combination flights that move your crew and cargo at the sametime saving you time and money! We provide support services for the oil & gas, mining,and fishing industries, as well as tourism.

Alaska Air Transit2301 Merrill Field Dr.Anchorage, AK 99501Phone: 907-276-5422 Fax: 907-276-5400

Daniel Owen, Pres./Owner/Operator

[email protected]

19841984

1616

Anchorage based air charters, serving Alaska, Canada, and the Lower 48. Aircraftinclude the fast, pressurized, increased weight capacity Pilatus PC-12/47, or our factorynew Grand Caravan EX featuring increased power and an advanced ice protectionsystem, and the proven workhorse Navajo Chieftain.

Alaska Airlines4750 Old Int'l Airport Rd.Anchorage, AK 99502Phone: 907-266-7200 Fax: 907-266-7229

Marilyn Romano, Reg. VP AK

alaskaair.com

19321932

13,8001,750

Alaska Airlines and its sister carrier, Horizon Air, together, provide passenger and cargoservice to more than 100 destinations in Alaska, Canada, Mexico, Hawaii, and the Lower48.

Alaska Cargo ServicePO Box 251Dillingham, AK 99576-0251Phone: 907-842-2400 Fax: 907-842-1540

Bo Darden, Owner 19761976

33

Air cargo and express package services, air transportation nonscheduled, fuel available,local delivery services and air courier services.

Arctic Prism Helicopters1415 N. Local 302 Rd.Palmer, AK 99645Phone: 907-745-5775 Fax: 907-745-5787

David King, Pres.

[email protected]

19981998

0-50-5

Helicopter charter.

Bald Mountain AirPO Box 3134Homer, AK 99603Phone: 907-235-7969 Fax: 907-235-6602

Gary Porter, VP

[email protected]

19931993

1616

Single and multi-engine; 19 passenger, cargo, and fuel delivery; VFR and IFR capable;turbine fleet for reliability; off-airport and arctic operations; flight safety trained crews;services on wheels, floats, and skis; aerial scientific platforms; 100NM+ off shore surveycapability.

Bering Air, Inc.PO Box 1650Nome, AK 99762-1650Phone: 907-443-5464 Fax: 907-443-5919

James Rowe, Pres.

[email protected]

19791979

150150

Air transportation services for scheduled and nonscheduled passenger and cargo.Freight service daily to scheduled destinations. Heavy and oversized cargo charters toall destinations. Air ambulance services, helicopter charter and rental services.

Camai Enterprise LLC5353 W. Rezanof Dr.Kodiak, AK 99615Phone: 907-487-4926 Fax: 907-487-4931

Candace Ellison-Theis, CEO

[email protected]

20002000

22

Authorized agents for Alaska Central Express, Northern Air Cargo, Transnorthern AirCargo, and Everts Air Cargo, with worldwide service.

Commodity Forwarders, Inc.4000 W. 50th, Suite 1Anchorage, AK 99502Phone: 907-243-1144 Fax: 907-243-1149

PJ Cranmer, Reg. Ops Mgr. Pac. NW

[email protected]

20032003

37514

Transporting perishable products worldwide. Provides logistical services for perishableproducts worldwide by providing transportation, documentation, warehouse andconsulting services. Freezer storage in Anchorage.

Deadhorse Aviation CenterPO Box 34006Prudhoe Bay, AK 99734Phone: 907-685-1700 Fax: 907-685-1798

Tim Cudney, Dir.

deadhorseaviationcenter.com

20122012

1010

The DAC is Fairweather, LLC's multimodal aviation facility designed to meet the needsof onshore and offshore oil and gas development on the North Slope. The DAC has 2large hangars, office space, terminal, full-service medical facility, bedrooms, and a fulldining facility.

Desert Air Transport4001 Old Int'l Airport Rd. Unit #9Anchorage, AK 99502Phone: 907-243-4700 Fax: 907-243-4705

Dennis Gladwin, Pres.

[email protected]

20002000

55

We transport cargo directly from Anchorage International Airport to more than 200 ruralcommunities in Alaska.

ALASKA BUSINESS MONTHLY’S

2015 TRANSPORTATION DIRECTORY

CargoCarriers

can transfer payloadsfor more efficient

distribution.

FREE OF REGULATORY RESTRICTIONS.

CARGO TRANSFER

• Liberal cargo transfer rules unique to Alaska

• DOT regulatory exemption means more opportunity

• 24/7/365 air traffic & customs

• Liberal opportunities for online transfers

• ANC & FAI always open; no simultaneous closures

www.AnchorageAirport.com | www.FairbanksAirport.com

The Cargo Transfer Solution – Only in Alaska.


AL

ASK

A B

USI

NE

SS M

ON

TH

LY |

20

15 T

RA

NS

PO

RT

AT

ION

DIR

EC

TO

RY

AIR



DHL Global Forwarding6375 Kulis Dr.Anchorage, AK 99502Phone: 907-243-4301 Fax: 907-677-0900

Mindy Huston, AK Ops

[email protected]

19701970

32,00010

Worldwide freight services featuring total Alaska coverage. Specializing in air cargo,trucking, express services, warehousing, storage solutions, supply chain, and rail freight.

Egli Air HaulPO Box 169King Salmon, AK 99613Phone: 907-246-3554 Fax: 907-246-3654

Sam Egli, Owner

egliair.com

19821982

55

Helicopter and airplane charter, aviation fuel sales, and hanger space rental.

Era Helicopters LLC6160 Carl Brady Dr., Hangar 2Anchorage, AK 99502Phone: 907-550-8600 Fax: 907-550-8608

Elliott Neal, VP AK

erahelicopters.com

19481948

1,000150

Founded in Alaska in 1948, Era not only serves the oil and gas industry in Alaska, butprovides services for state and government business, executive charter services, flight-seeing tours, environmental surveys, utility and construction work.

Everts Air CargoPO Box 61680Fairbanks, AK 99706Phone: 907-450-2300 Fax: 907-450-2320

Robert W. Everts, Pres./CEO

[email protected]

19951995

259249

An Alaskan owned and operated air carrier that provides scheduled freight service to 12rural communities and charter service to anywhere in Alaska with suitable runwayconditions. Cargo charters, HAZMAT, bulk fuel, small package and oversize. Based inAnchorage and Fairbanks.

Express Delivery Service, Inc.701 W. 41st Ave., Unit DAnchorage, AK 99503-6604Phone: 907-562-7333 Fax: 907-561-7281

Ed Hoffman, Pres.

[email protected]

19771977

2020

Air courier services, local and Valley delivery services, special warehousing and storage.Specializing in serving the medical community. Open 24/7/365.

Grant Aviation4451 Aircraft Dr.Anchorage, AK 99502Phone: 888-359-4726 Fax: 907-248-7076

Bruce McGlasson, Pres.

[email protected]

19711971

200200

Scheduled commuter air carrier that provides scheduled passenger, cargo, mail andfreight services to most villages throughout Alaska. Bethel hub air ambulance services,plus 32 aircraft fleet: Cessna 207, 208 Grand Caravans, Piper Chieftain Navajos,Beechcraft 200 King Airs and GippsAero GA8.

Great Circle Flight Services6121 S. Airpark Pl.Anchorage, AK 99502Phone: 907-245-1232 Fax: 907-245-1501

Cathy Porter, Mgr.

[email protected]

20052005

88

GCFS provides personal and attentive concierge style FBO services to private andcharter aircraft traveling to, from, and throughout Alaska. Open 24/7/365.

Homer Expediters990 SeaPlane Ct.Homer, AK 99603Phone: 907-235-5244 Fax: 907-235-5244

Jules Ravin , Owner/Operator 19861986

11

Air cargo and express-package services, local delivery services, freight-transportationand air-forwarding services.

Island Air ExpressPO Box 1174Craig, AK 99921Phone: 888-387-8989 Fax: 888-529-8837

Scott Van Valin, Dir. Ops/Pres.

[email protected]

20082008

2121

Island Air Express operates Cessna 208 and Cessna 206 aircraft throughout SoutheastAlaska Ð Providing the only scheduled IFR service between Craig/ Klawock andKetchikan we deliver the most reliable, on time service available. Exclusive amphib andwheel plane charter service is also available.

Kenai AviationPO Box 46Kenai, AK 99611Phone: 907-283-4124 Fax: 907-283-5267

Robert T Bielefeld, Owner

[email protected]

19611961

77

Air taxi. Charter, Aircraft Maintenance.

Last Frontier Air Ventures Ltd.1415 N. Local 302 Rd.Palmer, AK 99645Phone: 907-745-5701 Fax: 907-745-5711

David King, Pres.

[email protected]

19971997

0-50-5

Mineral exploration, survey, research and development, slung cargo, video and filmprojects, aerial photography, tours, crew transport, heli skiing, short and long termcontracts.

Lynden Air Cargo6441 S. Airpark Pl.Anchorage, AK 99502Phone: 907-243-7248 Fax: 907-257-5124

Rick Zerkel, Pres.

[email protected]

19961996

154154

Charter air cargo service. Scheduled air cargo and express package service.

Lynden International6441 S. Airpark Pl.Anchorage, AK 99502Phone: 907-243-6150 Fax: 907-243-2143

David Richardson, Pres.

[email protected]/lint

19801980

23651

Air cargo and express-package services, nonscheduled and scheduled airtransportation, air courier services, freight transportation services and local deliveryservices.

Lynden Logistics6441 S. Airpark Pl.Anchorage, AK 99502Phone: 907-245-1544 Fax: 907-245-1744

Alex McKallor, Pres.

[email protected]

19841984

103

Arrangement of freight transportation, information management and logistical services.

Lynden Transport, Inc.3027 Rampart Dr.Anchorage, AK 99501Phone: 907-276-4800 Fax: 907-257-5155

Paul Grimaldi, Pres.

[email protected]/ltia/

19541954

291150

Full-service, multi-mode freight transportation to, from and within Alaska.

Maritime Helicopters3520 FAA Rd.Homer, AK 99603Phone: 907-235-7771 Fax: 907-235-7773

Robert Fell, Dir. Ops

[email protected]

19731973

8080

Maritime Helicopters supports Marine, Petroleum & Construction industries as well asState & Federal agencies. We own and operate 206 B/L, 407 Bell Helicopters, BO-105twin engine Eurocopters & a helipad equipped 86' vessel for remote marine operations.Bases in Homer-Fairbanks-Kenai-Kodiak-Valdez.

Northern Air Cargo3900 Old International Airport Rd.Anchorage, AK 99502Phone: 907-243-3331 Fax: 907-249-5191

David W. Karp, Pres./CEO

[email protected]

19561956

300280

Anchorage based Northern Air Cargo is AlaskaÕs largest all-cargo airline. From groceriesand generators to medical supplies and lumber, customers across Alaska, including awide array of industries such as oil & gas, mining, construction, and commercial fishingrely on NACÕs services.

Pathfinder Aviation, Inc.PO Box 375Homer, AK 99603Phone: 907-226-2800 Fax: 907-226-2801

Michael W. Fell, Pres.

[email protected]

20012001

4545

Pathfinder Aviation, Inc. supports Petroleum, Mining, Survey, Film, and various otherindustries utilizing twin-engine Bell 212s & EC-135 & single engine Bell 206 serieshelicopters with OAS-approved pilots and aircraft. They operate field bases throughoutAlaska with a main base in Homer.

COMPANY TOP EXECUTIVE FOUNDED/ESTAB. AK WORLDWIDE\AK EMPLOYEES SERVICES AL

ASK

A B

USIN

ESS M

ON

TH

LY | 2

015

TR

AN

SP

OR

TA

TIO

N D

IRE

CT

OR

YAIR

65June 2015 | www.akbizmag.com


Ravn Alaska4700 Old International Airport Rd.Anchorage, AK 99502Phone: 907-266-8394 Fax: 907-266-8391

Bob Hajdukovich, CEO

[email protected]

19481948

900900

Transportation; Scheduled passenger service, scheduled cargo and charter service.

Ryan Air, Inc.6400 Carl Brady Dr.Anchorage, AK 99502Phone: 907-562-2227 Fax: 907-563-8177

Wilfred "Boyuck" Ryan, Pres.

[email protected]

19531953

100100

From Platinum to Kobuk, from Gambell to Mt. Village, we know the challenges oftransportation in Alaska. For more than 50 years, weÕve developed the skill, perfectedthe processes and implemented the technology required to efficiently move freightacross the Bush.

Security Aviation6121 S. Airpark Pl.Anchorage, AK 99502Phone: 907-248-2677 Fax: 907-248-6911

Stephen "Joe" Kapper, Pres.

[email protected]

19851985

2525

24/7 on-demand air charter. Approved carrier for State and Federal Agencies. Executivetravel, crew changes, and "HOT" cargo.

Ted Stevens Anchorage Int'l AirportPO Box 196960Anchorage, AK 99519-6960Phone: 907-266-2119 Fax: 907-243-0663

John Parrott, Airport Mgr.

[email protected]

19511951

383383

World class cargo airport, largest passenger airport in Alaska and the world's busiestfloat-plane base.

TGI Freight4001 Old International Airport Rd., Unit 7Anchorage, AK 99502Phone: 907-522-3088 Fax: 907-562-6295

Todd Clark, Pres.

[email protected]

19891989

77

Local freight cartage, freight consolidation, logistics and hazardous material services.

TransGroup Worldwide Logistics3501 Postmark Dr.Anchorage, AK 99502Phone: 907-243-4345 Fax: 888-812-6295

Vanessa Keyes, Reg. Dir./AK

[email protected]

20112011

5002

U.S. owned full service freight forwarder and global logistics provider. We providetransportation, warehousing and specialized logistics solutions, coupled with softwaretailored to meet the specific needs of each individual customer - for every link in yoursupply chain. Areas Served: Worldwide.

United Parcel Service6200 Lockheed Ave.Anchorage, AK 99502Phone: 907-249-6242 Fax: 907-249-6240

Scott DePaepe, Ak Div Mgr

ups.com

19071985

435,000483

UPS is a global company with one of the most recognized and admired brands in theworld. We have become the world's largest package delivery company and a leadingglobal provider of specialized transportation and logistics services.

United States Postal Service3720 Barrow St.Anchorage, AK 99599Phone: 800-ASK-USPS

Ron Haberman, District Mgr.

usps.com

19151915

~55,000~1,300

Mailing and delivery of letters, magazines and parcels weighing up to 70 pounds.

Ward Air Inc.8991 Yandukin Dr.Juneau, AK 99801-8086Phone: 907-789-9150 Fax: 907-789-7002

Ed Kiesel, Pres.

[email protected]

19951995

2121

Air transportation nonscheduled.


AL

ASK

A B

USI

NE

SS M

ON

TH

LY |

20

15 T

RA

NS

PO

RT

AT

ION

DIR

EC

TO

RY

AIR




Hank Schaub, GM

[email protected]

19941994

1111


ACE Transport, Inc.7500 Park West CircleAnchorage, AK 99502Phone: 907-229-9647 Fax: 907-245-8930

Henry S. Minich, Pres.

acetransportalaska.com

20032003

11

Heavy hauling of equipment, modules, etc.

AFF Distribution Services5491 Electron Dr. #8Anchorage, AK 99518Phone: 907-563-7094 Fax: 907-563-7012

Jared Lastufka, Ops Mgr.

youtube.com/americanfastfreightamericanfast.com

19881988

106

Third-party warehousing & distribution company; short- & long-term storage; orderprocessing, deliveries, & inventory reports; cold storage, chill to freeze; pick & packindividual orders; through bill of lading & single invoice; bypass mail service. A division ofAmerican Fast Freight, Inc.

Alaska Railroad Corp.PO Box 107500Anchorage, AK 99510-7500Phone: 907-265-2300 Fax: 907-265-2443

Bill O'Leary, Pres./CEO

[email protected]

19141914

600600

Freight rail transportation, passenger rail transportation, and real estate land leasing andpermitting. Employees increase seasonally to 700.

Alaska Terminals, Inc.400 W. 70th Ave., Suite 3Anchorage, AK 99518Phone: 907-349-6657 Fax: 907-349-2045

Todd Halverson, Owner/Pres.

[email protected]

19811981

3535

As the Atlas Van Lines agent for Alaska, we perform local, interstate and internationalmoving services for corporate, government and COD customers.

Alaska Trucking Association3443 Minnesota Dr.Anchorage, AK 99503Phone: 907-276-1149 Fax: 907-274-1946

Aves Thompson, Exec. Dir.

[email protected]

19581958

44

An authoritative voice in trucking; the Alaska Trucking Association provides regulatoryguidance, a bridge between industry and DOT, as well as a voice in Juneau via ourregistered lobbyist. ATA provides DMV services to both members companies and thegeneral public.

Alaska West Express1048 Whitney Rd.Anchorage, AK 99501Phone: 907-339-5100 Fax: 907-339-5117

Scott Hicks, Pres.

[email protected]/lynden.com/awe

19781978

164154

Alaska West Express provides truckload transportation throughout the United States andCanada, specializing in your shipment to and from Alaska, where we are the leader intransporting liquid- and dry-bulk products, hazardous and non-hazardous chemicals andpetroleum products.

Alison's Relocations, Inc.1524 Ship Ave.Anchorage, AK 99501Phone: 907-345-9934 Fax: 907-344-4504

Alison McDaniel, Pres.

[email protected]

19971997

3030

Full service household goods moving and storage company. Providing customizedmoving packages-residential, commercial and industrial offices, national and corporateaccounts. Ocean and Over The Road freight forwarding. Palletized shipments to FullTrailer loads. Worldwide Service.

American Fast Freight, Inc.5025 Van Buren St.Anchorage, AK 99517Phone: 907-248-5548 Fax: 907-243-7353

Ron Moore, AK Sales Mgr.

[email protected]

19841984

350160

Ocean freight forwarding, freight consolidation, full loads, temperature protected, bypassmail and air freight, specialized equipment, heavy haul, project logistics, intra-statetrucking, Alcan express, barge, distribution, military shipments, household goods.

American Fast Freight, Inc.47693 Michelle Ave., Unit 7Soldotna, AK 99669Phone: 907-262-6646 Fax: 907-262-1925



19841984

350160

Ocean freight forwarding, freight consolidation, full loads, short- and long-termwarehousing, temperature protected, bypass mail and air freight, specialized equipment,heavy haul, project logistics, intra-state trucking, Alcan express, barge, distribution,military shipments, household goods.

American Fast Freight, Inc.3501 Lathrop St., Suite LFairbanks, AK 99701Phone: 907-452-7129 Fax: 907-451-7103



19841984

350160

Ocean freight forwarding, freight consolidation of all kinds, full loads, short- and long-term warehousing, temperature protected, bypass mail and air freight, specializedequipment, heavy haul, project logistics, intra-state trucking, ALCAN express, barge,distribution, military shipments, HHG.

American Relocation Services3411 Lathrop St., Suite LFairbanks, AK 99701Phone: 907-456-3097 Fax: 907-456-3098

Damian Naquin, GM


19881988

5550

Commercial/residential relocations, moving and storage, temperature-controlledfacilities, ocean freight forwarding, complete packing and crating services, free detailedestimates, military approved, service in and outside Alaska, certified moving consultants,budget service available.

American Relocation Services2430 Beaver Lake Dr.Kodiak, AK 99615Phone: 907-486-1015 Fax: N/A

Damian Naquin, GM


19881988

6055


American Relocation Services47693 Michelle Ave., Unit 7Soldotna, AK 99669Phone: 907-262-6646 Fax: N/A

Damian Naquin, GM


19881988

5550


American Relocation Services5491 Electron Dr., Unit 1Anchorage, AK 99518Phone: 907-248-2929 Fax: 907-561-4244

Damian Naquin, GM


19881988

155150

Commercial/residential relocation, moving and storage, temperature-controlled facilities,ocean freight forwarding, complete packing and crating services, free detailed estimates,military approved, service in and outside Alaska, certified moving consultants, budgetservice available.

AMS Couriers5001 Arctic Blvd., Unit 2Anchorage, AK 99503Phone: 907-278-2736 Fax: 907-258-4293

Jaime Fink, Managing Shareholder

[email protected]

19641964

1515

Specializes in Route and On-Demand Same-Day Deliveries in Alaska. ProvidesTransportation, Warehousing, and Logistics solutions for the Medical, Legal,Telecommunications, and Financial industries. Open 24/7/365.

Best Rate Express LLCPO Box 39193Lakewood, WA 98496Phone: 253-535-1000 Fax: 253-535-2060

Young Summers, Member

[email protected]

20040

00

Best Rate Express, LLC.: flat, step, vans, reefers and heavy haul. Rail: containers andflat cars. Air: next-day, two-day and deferred service. Marine: steamship and bargeservice.

LAND


YRC Freight2040 E. 79th Ave.Anchorage, AK 99507-2956Phone: 907-344-0099 Fax: 907-344-0939

Roslyn Mitchell, Terminal Mgr.

yrcfreight.com

19241981

32,0004

YRC FreightÕs operations in Alaska, give you an integrated solution for moving LTL andTL freight between key markets using just one carrier from beginning to end. In addition,YRC has comprehensive coverage throughout North America, including cross-border toand from Canada and Mexico.


ASK

A B

USIN

ESS M

ON

TH

LY | 2

015

TR

AN

SP

OR

TA

TIO

N D

IRE

CT

OR

YLAND



Carlile1800 E. First Ave.Anchorage, AK 99501-1833Phone: 907-276-7797 Fax: 907-278-7301

Terry Howard, Pres.

carlile.biz

19801980

650500

Transportation and logistics company offering multi-model trucking as well as projectlogistic services across Alaska and North America.



[email protected]

20032003

37514


CPD Alaska LLC (Crowley)201 Arctic Slope Ave.Anchorage, AK 99518Phone: 907-777-5505 Fax: 907-777-5550

Bob Cox, VP

[email protected]

18921953

5,000500

CPD operates fuel terminals in 22 locations in the Railbelt, western AK and SE AK,providing home heating oil, jet fuel, diesel, gasoline and propane. Our fuel barges makedirect deliveries to over 200 western Alaska communities. Crowley proudly celebratesover 60 years of service to Alaska.

DHL Global Forwarding6375 Kulis Dr.Anchorage, AK 99502Phone: 907-243-4301 Fax: 907-677-0900

Mindy Huston, AK Ops

[email protected]

19701970

32,00010

Worldwide freight services featuring total Alaska coverage. Specializing in air cargo,trucking, express services, warehousing, storage solutions, supply chain, and rail freight.

Express Delivery Service, Inc.701 W. 41st Ave., Unit DAnchorage, AK 99503-6604Phone: 907-562-7333 Fax: 907-561-7281

Ed Hoffman, Pres.

[email protected]

19771977

2020

Air courier services, local and Valley delivery services, special warehousing and storage.Specializing in serving the medical community. Open 24/7/365.

Homer Expediters990 SeaPlane Ct.Homer, AK 99603Phone: 907-235-5244 Fax: 907-235-5244

Jules Ravin , Owner/Operator 19861986

11

Air cargo and express-package services, local delivery services, freight-transportationand air-forwarding services.

Kenworth Alaska2838 Porcupine Dr.Anchorage, AK 99501Phone: 907-279-0602 Fax: 907-258-6639

Marshall Cymbaluk, CEO/Mgr.

[email protected]

19741974

23542

Truck dealer.




19801980

23651




[email protected]

19841984

103



AL

ASK

A B

USI

NE

SS M

ON

TH

LY |

20

15 T

RA

NS

PO

RT

AT

ION

DIR

EC

TO

RY

LAND




Hank Schaub, GM

[email protected]

19941994

1111


Alaska Logistics LLC1101 Port Ave.Seward, AK 99664Phone: 206-767-2555 Fax: 206-767-5222

Allyn Long, Owner/GM

[email protected]

20032003

5535

Scheduled barge service from Seattle to Western and Central Alaska. Provides servicesto receive customers' freight, consolidate, manifest and track from origin to finaldestination. We also provide charters.

Alaska Marine Highway System7995 N. Tongass Hwy.Ketchikan, AK 99901Phone: 800-642-0066 Fax: 907-225-6874

John John Falvey, Captain

[email protected]

19631963

1,1001,100

Providing marine transportation for passengers and vehicles to over 30 Alaska coastalcommunities. No pre-set itineraries. Amenities available include staterooms, dining,movie theatres, and viewing lounges.

Alaska Marine Lines100 Mt. Roberts St., Suite 200Juneau, AK 99801Phone: 907-586-3790 Fax: 907-463-3298

Kevin Anderson, Pres.

[email protected]

19801980

23328

Twice weekly barge service to Southeast Alaska and weekly barge service to CentralAlaska. Charter and nonscheduled barge services.

Alaska Terminals, Inc.400 W. 70th Ave., Suite 3Anchorage, AK 99518Phone: 907-349-6657 Fax: 907-349-2045

Todd Halverson, Owner/Pres.

[email protected]

19811981

3535

As the Atlas Van Lines agent for Alaska, we perform local, interstate and internationalmoving services for corporate, government and COD customers.

PORTS





19541954

291150


Pacific Alaska Freightways, Inc.431 E. 104th Ave.Anchorage, AK 99515Phone: 907-336-2567 Fax: 907-336-1567

Ed Fitzgerald, CEO

[email protected]

19611961

9065

Consolidating, on time delivery service, freight forwarding.

Sourdough Express, Inc.600 Driveways St.Fairbanks, AK 99701Phone: 907-452-1181 Fax: 907-452-3331

Jeff Gregory, Pres./CEO

sourdoughtransfer.comsourdoughexpress.com

18981902

200200

Freight-transportation services, moving and storage services. Steel Connex ContainerSales/Lease.

Span Alaska Transportation, Inc.2040 E. 79th Ave.Anchorage, AK 99501Phone: 253-395-7726 Fax: 253-395-7986

Tom Souply, Pres.

[email protected]

19781978

14080

Freight transportation services to and from Alaska, less-than-truckload and truckload.Steamship and barge service to Railbelt area of Alaska. Barge service to Juneau andSoutheast Alaska. Overnight service from Anchorage to Fairbanks and the KenaiPeninsula.

TGI Freight4001 Old International Airport Rd., Unit 7Anchorage, AK 99502Phone: 907-522-3088 Fax: 907-562-6295

Todd Clark, Pres.

[email protected]

19891989

77

Local freight cartage, freight consolidation, logistics and hazardous material services.

TrailerCraft | Freightliner of Alaska1301 E. 64th Ave.Anchorage, AK 99518-1908Phone: 907-563-3238 Fax: 907-561-4995

Lee McKenzie, Pres./Owner

[email protected]

19691969

5555

Parts, sales and service for trucks, tractors, trailers, transport equipment, snow plowsand sanders.

United Parcel Service6200 Lockheed Ave.Anchorage, AK 99502Phone: 907-249-6242 Fax: 907-249-6240

Scott DePaepe, Ak Div Mgr

ups.com

19071985

435,000483

UPS is a global company with one of the most recognized and admired brands in theworld. We have become the world's largest package delivery company and a leadingglobal provider of specialized transportation and logistics services.

United States Postal Service3720 Barrow St.Anchorage, AK 99599Phone: 800-ASK-USPS Fax: N/A


usps.com

19151915

~55,000~1,300


Waste Management of Alaska, Inc.1519 Ship Ave.Anchorage, AK 99501Phone: 907-274-0477 Fax: 866-491-2008

Mike Holzschuh, Territory Mgr./N.Am.

[email protected]

19691969

~42,7007

Hazardous and nonhazardous waste disposal, project management, complete logisticaloversight, complete US and Canadian manifesting, rail transportation, over-the-roadtransportation, marine transportation, and turnkey remedial services.

Weaver Brothers, Inc.2230 Spar Ave.Anchorage, AK 99501Phone: 907-278-4526 Fax: 907-276-4316

Jim Doyle, Pres.

[email protected]

19621947

135135

Trucking, local drayage, linehaul, dry bulk, liquid bulk, fuel, chemical, hot oil, heavy haul,hazmat and specialty transport as well as Oil Field support.

Western Peterbilt, Inc.2756 Commercial Dr.Anchorage, AK 99501Phone: 907-276-2020 Fax: 907-276-2164

Mitch Hatfield, GM

[email protected]

19871987

40040

Full-service Peterbilt dealership. Offer truck sales, rentals and leasing, and contractmaintenance. Full parts and service department. Additional locations in Fairbanks andPrudhoe Bay.

WestPac Logistics LLC130 Marvin Rd. SE, Suite 204Lacey, WA 98503Phone: 360-491-4452 Fax: N/A

King Hufford, Pres.

[email protected]

20102013

52

We do project logistics, project forwarding, and transportation. We also operate WestPacTransportation and WestPac Terminals; we are a terminal operator at Port MacKenzie.



yrcfreight.com

19241981

32,0004



ASK

A B

USIN

ESS M

ON

TH

LY | 2

015

TR

AN

SP

OR

TA

TIO

N D

IRE

CT

OR

YMARIN

E



Alison's Relocations, Inc.1524 Ship Ave.Anchorage, AK 99501Phone: 907-345-9934 Fax: 907-344-4504

Alison McDaniel, Pres.

[email protected]

19971997

3030

Full service household goods moving and storage company. Providing customizedmoving packages-residential, commercial and industrial offices, national and corporateaccounts. Ocean and Over The Road freight forwarding. Palletized shipments to FullTrailer loads. Worldwide Service.

American Fast Freight, Inc.5025 Van Buren St.Anchorage, AK 99517Phone: 907-248-5548 Fax: 907-243-7353


[email protected]

19841984

350160

Ocean freight forwarding, freight consolidation, full loads, temperature protected, bypassmail and air freight, specialized equipment, heavy haul, project logistics, intra-statetrucking, Alcan express, barge, distribution, military shipments, household goods.

American Fast Freight, Inc.3501 Lathrop St., Suite LFairbanks, AK 99701Phone: 907-452-7129 Fax: 907-451-7103



19841984

350160

Ocean freight forwarding, freight consolidation of all kinds, full loads, short- and long-term warehousing, temperature protected, bypass mail and air freight, specializedequipment, heavy haul, project logistics, intra-state trucking, ALCAN express, barge,distribution, military shipments, HHG.

Arctic Marine SolutionsPO Box 3302Seward, AK 99664Phone: 907-360-2982 Fax: N/A

Jim Hubbard, Pres.

[email protected]

20102010

1010

We provide cargo and personnel transport on the water and over the tundra year round.

Bering Marine Corporation6441 S. Airpark Pl.Anchorage, AK 99502Phone: 907-248-7646 Fax: 907-245-1744

Rick Gray, Pres.

[email protected]

19851985

2626

Bering Marine Corporation provides highly specialized, contracted marine services toreach water-locked villages and other remote Alaska locations. Bering Marine getsbuilding materials, equipment and gravel to some of Alaska's most isolated spots.

Bering Pacific Services Co.7801 Schoon St., Suite BAnchorage, AK 99518Phone: 206-390-3260 Fax: 907-222-7673

Mike Brazier, Mgr.

[email protected]

19972004

54

Barge transportation from Seattle to Western Alaska and between Western Alaskavillages. Gravel and rock supply to most Western Alaska villages. Reliable on timedeliveries at reasonable rates. Our motto is "We do what we say we'll do!"

Best Rate Express LLCPO Box 39193Lakewood, WA 98496Phone: 253-535-1000 Fax: 253-535-2060

Young Summers, Member

[email protected]

20040

00

Best Rate Express, LLC.: flat, step, vans, reefers and heavy haul. Rail: containers andflat cars. Air: next-day, two-day and deferred service. Marine: steamship and bargeservice.

Bowhead Transport Company4025 Delridge Way SW, Suite 160Seattle, WA 98106Phone: 800-347-0049 Fax: 206-957-5261

Jim Dwight, Dir. Business Dev.

[email protected]

19821982

1010

Bowhead provides marine cargo transportation along the North Slope of Alaska. Utilizingspecialized vessels, Bowhead also provides vessel and crew support for offshore oilexploration, development, and production activities.

Carlile1800 E. First Ave.Anchorage, AK 99501-1833Phone: 907-276-7797 Fax: 907-278-7301

Terry Howard, Pres.

carlile.biz

19801980

650500

Transportation and logistics company offering multi-model trucking as well as projectlogistic services across Alaska and North America.

1.800.257.7726 • www.spanalaska.com

Rugged as a BearSTABLE … STURDY … SOLID

With decades of experience serving the Alaska market,Span Alaska’s seasoned team has time-tested

solutions for shipping to the Last Frontier.

SHIPPING TO ALASKA? CALL SPAN ALASKA.


AL

ASK

A B

USI

NE

SS M

ON

TH

LY |

20

15 T

RA

NS

PO

RT

AT

ION

DIR

EC

TO

RY

MARIN

E



Coastal Transportation4025 13th Ave. W.Seattle, WA 98119Phone: 800-544-2580 Fax: 206-283-9121

Jeff Allen, Dir. Marketing

[email protected]

19840

1300

A family owned U.S. flag marine transportation company. Coastal operates six vesselswith scheduled year-round sailings between Seattle and ports throughout WesternAlaska and the Aleutian Islands. Twenty-eight years in Western Alaska provides a levelof expertise that is unmatched.



[email protected]

20032003

37514


Cook Inlet Tug & Barge188 W. Northern Lights Blvd., Suite 1020Anchorage, AK 99503Phone: 907-277-7611 Fax: 907-272-3410

Ben Stevens, GM

[email protected]

19241924

1818

Cook Inlet Tug & Barge is a marine transportation company, specializing in harborservices, with a primary marketing focus on the Port of Anchorage and Cook Inlet.

CPD Alaska LLC (Crowley)201 Arctic Slope Ave.Anchorage, AK 99518Phone: 907-777-5505 Fax: 907-777-5550

Bob Cox, VP

[email protected]

18921953

5,000500

CPD operates fuel terminals in 22 locations in the Railbelt, western AK and SE AK,providing home heating oil, jet fuel, diesel, gasoline and propane. Our fuel barges makedirect deliveries to over 200 western Alaska communities. Crowley proudly celebratesover 60 years of service to Alaska.

Delta Western-Inlet Petroleum420 L St., Suite 101Anchorage, AK 99501Phone: 800-478-2688 Fax: 206-213-0103

Kirk Payne, Pres.

deltawestern.com

19851985

160130

Fuel and lubricant distribution.

Foss Maritime Company188 W. Northern Lights Blvd., Suite 1020Anchorage, AK 99503Phone: 907-782-4950 Fax: 907-782-1185

Gary Faber, Pres. Global Svcs.

[email protected]

18891922

1,5376

Foss offers tug and barge support services, contract towing, offshore support, and oildevelopment project support. We also partner with the energy services arm of the ArcticSlope Regional Corporation to assist with petroleum field production in the North Slopewhile safeguarding the environment.

Harley Marine ServicesPO Box 920086Dutch Harbor, AK 99692Phone: 206-628-0051 Fax: 206-628-0293

Jim Weimer, GM, PCM

[email protected]

19751975

780

Primary business functions include ship assist, general towing and deck cargo transport.

Harvey Gulf International Marine LLC3601 C St., Suite 1378Anchorage, AK 99503Phone: 504-348-2466 Fax: 504-348-8060

Shane J. Guidry, Chairman/CEO

harveygulf.com

20102010

8555

Harvey Gulf International Marine LLC is a marine transportation company thatspecializes in providing offshore supply and multi-purpose support vessels for deepwaterand ultra-deepwater operations.

Horizon Lines LLC1717 Tidewater Rd.Anchorage, AK 99501-1036Phone: 907-274-2671 Fax: 907-263-5043

Marion Davis, SVP & GM AK Division

horizonlines.com

19561964

1,780260

Containership service between Tacoma, WA, and Anchorage, Kodiak, and DutchHarbor, AK. Linehaul trucking to the Alaska Railbelt. Seasonal feeder barge service toBristol Bay and the Pribilof Islands. Connecting carrier service to other water, air, andland carriers.

Kvichak Marine Industries469 NW Bowdoin Pl.Seattle, WA 98107Phone: 206-545-8485 Fax: 206-545-3504

Keith Whittemore, Pres.

[email protected]

19811981

1000

Builder of aluminum commercial workboats.




19801980

23651




[email protected]

19841984

103





19541954

291150


Maritime Helicopters3520 FAA Rd.Homer, AK 99603Phone: 907-235-7771 Fax: 907-235-7773

Robert Fell, Dir. Ops

[email protected]

19731973

8080

Maritime Helicopters supports Marine, Petroleum & Construction industries as well asState & Federal agencies. We own and operate 206 B/L, 407 Bell Helicopters, BO-105twin engine Eurocopters & a helipad equipped 86' vessel for remote marine operations.Bases in Homer-Fairbanks-Kenai-Kodiak-Valdez.

North Star Terminal & Stevedore Co.790 Ocean Dock Rd.Anchorage, AK 99501Phone: 907-263-0120 Fax: 907-272-8927

Jeff Bentz, Pres.

[email protected]

19501950

~50~50

Stevedore, marine logistics and operated crane services. We are also providing state ofthe art driven foundations with our ABI Mobile Ram Machines.

Offshore Systems, Inc.PO Box 920427Dutch Harbor , AK 99692Phone: 907-581-1827 Fax: 907-581-1630

Jared Davis, Dir. AK Ops

offshoresystemsinc.com

19821982

150138

Since 1983, Offshore Systems, Inc. (OSI) has been the premiere fuel and dock facility inWestern Alaska. 1,500 linear feet of dock space, around-the-clock stevedoring services,secure, dry warehousing and cold storage, and material handling equipment.

Offshore Systems, Inc.2410 E. 88th Ave.Anchorage , AK 99507Phone: 800-733-6434 Fax: 907-646-1430

Jared Davis, Dir. AK Ops

offshoresystemsinc.com

19831983

160150

Dock facilities in Nikiski, Dutch Harbor, and Adak servicing the oil and fishing industries.Services include dock space, warehousing, cold storage, stevedoring services, heavyequipment, and fuel.

Olympic Tug and Barge910 SW Spokane St.Seattle, WA 98134Phone: 206-628-0051 Fax: 206-628-0293

Sven Christensen, GM

[email protected]

19871987

22818

Full service maritime corporation. Bunkering, Oil transportation, Ship assist and Generaltowing.


ASK

A B

USIN

ESS M

ON

TH

LY | 2

015

TR

AN

SP

OR

TA

TIO

N D

IRE

CT

OR

YMARIN

E



Pacific Alaska Freightways, Inc.431 E. 104th Ave.Anchorage, AK 99515Phone: 907-336-2567 Fax: 907-336-1567

Ed Fitzgerald, CEO

[email protected]

19611961

9065

Consolidating, on time delivery service, freight forwarding.

Pacific Coast MaritimePO Box 920086Dutch Harbor, AK 99692Phone: 206-628-0051 Fax: 206-628-0293

Jim Weimer, GM

[email protected]

19751975

1211

Pacific Coast Maritime, subsidiary of Harley Marine Services, operates out of DutchHarbor, with a state of the art, 4,000 HP tractor tug and a 240£ x 60' deck bargeequipped with a Manitowoc 4100 Vicon Crane. Primary business functions include shipassist, general towing and deck cargo transport.

Samson Tug & Barge Co.329 Harbor Dr.Sitka, AK 99835Phone: 1800-331-3522 Fax: 907-747-5370

George Baggen, Pres./CEO

[email protected]

19371937

145110

Alaskan owned, we offer the full range of barge freight & cargo hauling services,transporting cargo to Sitka, Cordova, Valdez, Fairbanks, Prudhoe Bay, Seward,Anchorage, Kenai Peninsula, Kodiak, King Cove, Dutch Harbor, Juneau, Ketchikan,Petersburg, Wrangell, Prince of Whales Island & Metlakatla.

Seldovia Bay FerryPO Drawer LSeldovia, AK 99663Phone: 907-234-7898 Fax: 907-226-2230

Crystal Collier, Pres./CEO

[email protected]

20102010

11

Provide daily scheduled transportation between Homer and Seldovia May-September.

Sourdough Express, Inc.600 Driveways St.Fairbanks, AK 99701Phone: 907-452-1181 Fax: 907-452-3331

Jeff Gregory, Pres./CEO

sourdoughtransfer.comsourdoughexpress.com

18981902

200200

Freight-transportation services, moving and storage services. Steel Connex ContainerSales/Lease.

Span Alaska Transportation, Inc.2040 E. 79th Ave.Anchorage, AK 99501Phone: 253-395-7726 Fax: 253-395-7986

Tom Souply, Pres.

[email protected]

19781978

14080

Freight transportation services to and from Alaska, less-than-truckload and truckload.Steamship and barge service to Railbelt area of Alaska. Barge service to Juneau andSoutheast Alaska. Overnight service from Anchorage to Fairbanks and the KenaiPeninsula.

Totem Ocean Trailer Express2511 Tidewater Rd.Anchorage, AK 99501-1044Phone: 907-276-5868 Fax: 907-278-0461

Grace Greene, AK GM

totemocean.com

19751975

14030

Totem Ocean's Roll-on/Roll-off (Ro/Ro) cargo ship operation provides fast, on-timeservice between the Port of Tacoma, Washington and the Port of Anchorage, Alaska.

United States Postal Service3720 Barrow St.Anchorage, AK 99599Phone: 800-ASK-USPS Fax: N/A


usps.com

19151915

~55,000~1,300


Vigor Alaska3801 Tongass Ave.Ketchikan, AK 99901Phone: 907-228-5302 Fax: 907-247-7200

Adam Beck, Pres.

[email protected]

19941994

2,400200

We are the largest most capable marine industrial service company in the AK/PNWRegion focused on shipbuilding and repair. Alaska operations are concentrated inAIDEAÕs Ketchikan Shipyard. Our mobile and multi-skilled workforce travels throughoutAlaska to heavy industrial and offshore projects.


AL

ASK

A B

USI

NE

SS M

ON

TH

LY |

20

15 T

RA

NS

PO

RT

AT

ION

DIR

EC

TO

RY

MARIN

EPORTS



City of CraigPO Box #725Craig, AK 99921Phone: 907-826-3404 Fax: N/A

Michael Peel, Harbormaster

[email protected]

19221907

44

Harbor Department.

City of Whittier HarborPO Box 639Whittier, AK 99693Phone: 907-472-2327 Fax: 907-472-2472

Cole Haddock, Harbormaster

[email protected]

19701970

77

The Whittier Harbor is your Gateway to Prince William Sound. We are an ice-free port,open year round. There are 350 slips for both transient and permanent berth holders, tolengths of 54'. The Whittier Harbor is a full-service establishment that tries to meet theneeds of all boaters.

Hoonah HarborPO Box 360Hoonah, AK 99829Phone: 907-945-3670 Fax: 907-945-3674

Sherry Mills, Harbormaster 19011901

33

We are a small boat harbor, with shore power for most of the 274 stalls, fresh water, atwo-lane launch ramp; a tidal grid; a transient dock with no breakwater; and a 220tonTravelift haulout.

Petersburg Port & Harbor223 Harbor WayPetersburg, AK 99833Phone: 907-772-4688 Fax: 907-772-4687

Glorianne Wollen, Harbormaster

ci.petersburg.ak.us

19101910

88

Petersburg port and harbor.


Vitus Energy LLC113 W. Northern Lights Blvd., Suite 200Anchorage, AK 99503Phone: 907-278-6700 Fax: 907-278-6701

Mark Smith, CEO

[email protected]

20092009

4747

Vitus Marine specializes in meeting the marine transportation and fuel distribution needsof Western Alaska maritime communities. Vitus currently provides fuel and freightdelivery services across Western Alaska.

Waste Management of Alaska, Inc.1519 Ship Ave.Anchorage, AK 99501Phone: 907-274-0477 Fax: 866-491-2008

Mike Holzschuh, Territory Mgr./N.Am.

[email protected]

19691969

~42,7007

Hazardous and nonhazardous waste disposal, project management, complete logisticaloversight, complete US and Canadian manifesting, rail transportation, over-the-roadtransportation, marine transportation, and turnkey remedial services.

Western Towboat Co.617 NW 40th St.Seattle, WA 98107Phone: 206-789-9000 Fax: 206-789-9755

Bob Shrewsbury II, Pres.

[email protected]

1960 Tug and barge operator based in Seattle serving all of Alaska and the Pacific coast with23 tugs and six barges.

WestPac Logistics LLC130 Marvin Rd. SE, Suite 204Lacey, WA 98503Phone: 360-491-4452 Fax: N/A

King Hufford, Pres.

[email protected]

20102013

52

We do project logistics, project forwarding, and transportation. We also operate WestPacTransportation and WestPac Terminals; we are a terminal operator at Port MacKenzie.



yrcfreight.com

19241981

32,0004



ASK

A B

USIN

ESS M

ON

TH

LY | 2

015

TR

AN

SP

OR

TA

TIO

N D

IRE

CT

OR

YPORTS



Port of Anacortes100 Commercial Ave.Anacortes , WA 98221Phone: 360-299-1828 Fax: 360-293-9608

Josh Beaner, Ops Dir.

[email protected]

1926-

31-

Bulk load out of green pet coke, sulfur, gravel, boulders, heavy lifts, docks, piling, bulksteel, and large fish farm tanks.

Port of Anchorage2000 Anchorage Port Rd.Anchorage, AK 99501Phone: 907-343-6200 Fax: 907-277-5636

Steve Ribuffo, Port Dir.

[email protected]

19611961

2525

The Port of Anchorage (POA) provides critical transportation infrastructure not only tothe citizens of Anchorage, but to a majority of the citizens of the State of Alaska bothwithin and beyond the Railbelt.

Port of BellinghamPO Box 1677Bellingham, WA 98227Phone: 360-676-2500 Fax: 360-671-6411

Rob Fix, Exec. Dir.

facebook.com/PortofBellinghamportofbellingham.com

19200

1000

We are the southern terminus for the Alaska Marine Highway System at the BellinghamCruise Terminal.

Port of BethelPO Box 1388Bethel, AK 99559Phone: 907-543-2310 Fax: 907-543-2311

Peter Williams, Port Director

[email protected]

19401959

3-93-9

Operate freight dock and yard, petroleum dock and berths for mooring boats and bargesand a small boat harbor.

Port of Dutch HarborPO Box 610Unalaska, AK 99685Phone: 907-581-1254 Fax: 907-581-2519

Peggy McLaughlin, Port Director

[email protected]

18671867

1010

The Port of Dutch Harbor promotes the growth and health of the community of Unalaskathrough the planning, development, and management of marine related municipalproperties and facilities to provide moorage and other marine services on a self-supporting basis.

Port of Homer4350 Homer Spit Rd.Homer, AK 99603Phone: 907-235-3160 Fax: 907-235-3152

Bryan Hawkins, Dir./Harbormaster

[email protected]/port

19641964

1717

Homer Port & Harbor has 24/7 harbor officers, & includes a small boat harbor with over900 reserved stalls & 700+ linear transient moorage, two deep water ports, a commercialbarge ramp, steel & wood tidal grids, a 5-lane load & launch ramp, & fish dock with eightcranes & ice delivery.

Port of Ketchikan2933 Tongass Ave.Ketchikan, AK 99901Phone: 907-228-5632 Fax: 907-247-3610

Steve Corporon, Port & Harbors Dir.

city.ketchikan.ak.us

18801880

12-5012-50

Ketchikan has four panamax sized cruise ship berths. They are numbered sequentiallyfrom south to north along the downtown waterfront. Each berth also has an adjacentfloat.

Port of King CovePO Box 37King Cove, AK 99612Phone: 907-497-2237 Fax: 907-497-2649

Charles Mack, Harbormaster 19701970

44

Ports and harbors.

Port of Kodiak and Shipyard403 Marine WayKodiak, AK 99615Phone: 907-486-8080 Fax: 977-486-8090

Lon White, Port Director

[email protected]

19581958

1717

Shipyard; 600 ton Marine Travelift, Deep draft Container Terminal.

BUILT FOR

ALASKASERVING ALASKA


AL

ASK

A B

USI

NE

SS M

ON

TH

LY |

20

15 T

RA

NS

PO

RT

AT

ION

DIR

EC

TO

RY

PORTS



Port of NomePO Box 281Nome, AK 99762Phone: 907-443-6619 Fax: 907-443-5473

Lucas Stotts, Harbormaster


19851985

44

Nome is a new staging point for an Emergency Towing System (ETS) for use in theregion.

Port of PelicanPO Box 737Pelican, AK 99832Phone: 907-735-2202 Fax: 907-735-2258

Patricia Phillips, Mayor

[email protected]

19401940

99

The Pelican Harbor is operated by the City of Pelican. The City has 98 berths, whichincludes permanent berthing spaces and transient moorage.

Port of Sand PointSant Point Boat HarborSand Point , AK 99661Phone: 907-383-2331 Fax: 907-383-5611

Richard Kochuten Sr., Harbormaster

[email protected]

19881988

66

We are a fishing community that caters to a local fleet of vessels 32 to 60 feet.

Port of SeattlePO Box 1209Seattle, WA 98111Phone: 206-787-3024 Fax: 206-787-3413

Tay Yoshitani, CEO

portseattle.org/Cargo

1911-

1,700-

Port of Seattle provides: Access to the world's largest ocean carriers; Home port for thecruise industry serving Alaska & Alaska commercial fishing fleet; Local warehousing &cold-storage; Fast intermodal inland connections; Handles containerized, break bulk, ro-ro & project cargo; air cargo hub.

Port of SkagwayPO Box 415Skagway, AK 99840Phone: 907-983-2628 Fax: 907-983-3087

Matthew O'Boyle, Harbormaster

[email protected]

18981898

33

The Skagway Small Boat Harbor is a full service marina with moorage for pleasure andcommercial vessels up to 150 ft. Transient moorage is on a space available, first come,first served basis. There is a waiting list for annual moorage.

Port of TacomaPO Box 1837Tacoma, WA 98401Phone: 253-383-5841 Fax: 253-593-4534

John Wolfe, CEO

facebook.com/portoftacomaportoftacoma.com

19180

2350

The Port of Tacoma is an economic engine for Washington, with activities connected tomore than 43,000 family-wage jobs in Pierce County and 113,000 statewide. A strategicgateway to Asia and Alaska, the Port is also a major center for containers, automobiles,bulk and breakbulk cargo.

Port of ValdezPO Box 307Valdez, AK 99686Phone: 907-835-4564 Fax: 907-835-4479

Diane Kinney, Ports/Harbor Dir.


19011901

44

Port services include a Container Terminal with a 700 ft. floating dock (1,200 ft. withdolphins), 21-acre storage yard, electricity for reefer units, water, and garbage service.The Port has Foreign-Trade Zone #108 with industrial land available for development.Wharf at the Kelsey Dock is 600 ft.

Port of WrangellPO Box 531Wrangell, AK 99929Phone: 907-874-3736 Fax: 907-874-3197

Greg Meissner, Harbormaster

[email protected]@wrangell.com

20082008

66

Ports and harbors.

Seward Boat HarborPO Box 167Seward, AK 99664Phone: 907-224-3138 Fax: 907-224-7187

Mack Funk, Harbormaster

[email protected]/harbor/

19641964

11+11+

We are a full service port with 50-ton and 330-ton Travelifts, a 5000-ton syncrolift, boatrepair yards, potable water and power utilities, hardware stores, grocery stores, artgalleries, restaurants, hotels and many other amenities to meet every need.

crowley.com/social

Crowley.com/ABM | 907.777.5505

BIG MOVE?RIGHTMOVE.

When you have a big move, you cancount on Crowley to deliver solutions.With our Ocean Class tugs — equippedwith 165 tons of bollard pull and dynamicpositioning — Crowley makes critical rigmoves easier and most importantly safer.Equipment like this, combined with ourmore than 60 years experience in Alaskaand the Arctic, uniquely positions Crowleyto handle the biggest, most complexprojects. Next time you have a big move,make the right move — call on Crowley.


FINANCIAL SERVICES

CapEx Funding

Construction crew at ribbon cutting for $20 million, five-mile road and nineteen-acre gravel pad built by AIDEA’s Mustang Road LLC for the Brooks Range Petroleum Company operated Mustang oil development project on the North Slope.

Courtesy of AIDEA

With all the talk out of Juneau this spring about shrinking revenue and budget deficits,

it’s tempting to look in the rearview mirror to see if Chicken Little is about to overtake the car.

And while low oil prices are causing their share of problems on a state level, they’re proving to be a boon to many Alas-kans, bank officials and others say. While they don’t expect a boom year, demand for capital funding is strong across the board in the healthcare, fishing, mining, and tourism industries. Several oil and gas projects on the North Slope are also look-ing strong, such as ExxonMobil’s Point Thomson. Overall oil and gas expendi-tures are expected to be about $3.8 billion, according to a forecast by ISER, the Insti-tute of Social and Economic Research at the University of Alaska Anchorage.

Darren Franz, Alaska regional banking manager for Wells Fargo, says any gloom and doom forecasts are off the mark.

“The real challenge here is how long these $50 [per barrel] prices last,” Franz says. “The economy in Alaska has not been growing by leaps and bounds, but there’s certainly been steady growth.”

“Just look at Arctic Man,” he adds. “I think there were twenty thousand peo-ple out there running around. It’s not depressing out there. They burn more fuel at Arctic Man than you do in your house.”

In fact, Alaska is growing, and de-mand for capital funding has been strong for years, he says.

“We’ve been doing a little over half a billion dollars in new loans every year,” he says. “I think most Alaska business-es are actually quite healthy and re-ally poised for opportunities that come down the pipe. Even the state has $15 billion in their general savings account from a lot of good years. I do think there are tons of things that are going to happen in upcoming years.”

Fishing, Healthcare, TourismThis year, strong demand is coming from the fishing industry as forecasts call for one of the biggest Bristol Bay

Darren Franz, Alaska regional bank-ing manager for Wells Fargo.

Demand is strong across the boardBy Julie Stricker


sockeye salmon harvests in the past twenty years. The Alaska Department of Fish and Game predicts 54 million sock-eye will return to the region this sum-mer. Strong returns are also expected for Kodiak and Southeast Alaska.

“Fishing continues to be strong and we’re continuing to see investment in that area,” Franz says. “Lots of new boats.”

Fishermen are buying Individual Fishing Quotas and processors are ex-panding operations in Naknek, for in-stance, he says. “That had been virtu-ally a ghost town. Now there are several processors there.”

Franz says foreign appetites are re-sponsible for much of the demand.

“A lot more of our fish we’re see-ing going overseas,” he says. “There’s a lot of hungry people in this world and we’re sitting on the edge of one of the world’s biggest fish ponds.”

Healthcare is another growth area. Franz says new medical clinics and doc-tors’ offices are opening or expanding around the state, including the Alaska Native Medical Center in Anchorage, which is building a two hundred-room patient housing facility. Major projects

are also planned for health facilities in Fairbanks, Ketchikan, and the Kenai Peninsula, according to ISER.

“There’s definitely still unmet health-care needs in the state,” he says. “Espe-cially, even in Anchorage, longer-term care facilities for elders. There’s pent up demand for that.”

The lower gasoline prices are also expected to bring more tourists to the state. The low gas prices are a boon to the mining industry, lowering the cost to produce metals and finance explora-tion. Mining overall is expected to be up 19 percent, according to ISER.

Demand for RVs, boats, and other vehicles is strong in both mining and tourism. The housing market is expect-ed to be centered on the booming Mata-nuska-Susitna region, but relatively stagnant elsewhere, according to ISER.

Conservative InvestmentsIn the oil and gas sector, companies are looking at service-related financ-ing, such as equipment maintenance and replacement or the construction of modular living facilities, according to Lori McCaffrey, senior vice president

and commercial banking sales leader for Key Bank in Alaska.

“The low price of oil typically means that the producers have less cash avail-able for new projects,” she says. Invest-ment decisions are made conservatively and are based on long-range oil prices. In the short term, all the projects that

Lori McCaffrey, senior vice president and commercial banking sales leader for Key Bank in Alaska.

Better for business.

Federally insured by NCUA

SOMETIMES RESOURCES ARE EVERYTHING

Get the things you need with local equipment financing.

alaskausa.org/biz


have been accounted for as far as spend-ing tied to state government spending are still going forward.

On exploration, things are “maybe a lit-tle more cautious in that arena, but there are still opportunities there,” she says. Lending requests have remained stable.

As far as financing for natural gas projects, McCaffrey says they’re hear-ing “a lot of discussion around ac-tivities, but as far as financing, they’re minimal at this point.”

Watch and WaitKey Bank is keeping a close eye on what the state government does with its capi-tal budget.

“Everything that has been appropri-ated for this year is fine, specifically for construction,” she says. “This coming year, who knows? Construction spend-ing was expected to be stable and even grow a little bit. Depending on the state government shortfall, we could certain-ly see a negative impact for 2016.

“The unknown for 2016 is commer-cial construction; it’s so tied to the state budget and the state budget is tied to the price of oil and how much is coming in.”

Mt. McKinley Bank in Fairbanks is also keeping a close eye on the Legislature and governor’s office, says David Durham, se-nior vice president and manager of com-mercial and consumer lending.

“We’re really watching what the state does with our budget,” Durham says. “We’re a little concerned because a lot of our contractors do a lot of state work.”

Otherwise, Durham is optimistic about trends in Interior Alaska.

“For this time of year, I think what we’re seeing is pretty good,” he says. “Nothing earth-shattering, but some sol-id folks looking at doing some building.”

2014 was a “pretty phenomenal” year with a lot of commercial refinancing, Durham says. “I’m pretty optimistic this year will also look pretty good. We’re really also looking at the future very cautiously and making sure we stay ahead of that curve.”

Tourism is a growth area, with more hotels adding rooms in the Denali area, he says. The mining industry is strong, with an uptick in demand for new equipment.

Durham says the one hundred-pound gorilla in the room is “trying to find out what the Fed [Federal Reserve] is going to do.” Even if full employment is reached,

GCI Industrial Telecom has proven experience designing for and working in demanding environments. As experts in the field, our aim is to provide innovative full life cycle communications solutions to increase your productivity.


inflation is still an issue. “There’s mo-mentum to move the rates up this year, but we’ll see if that pans out.”

Access to CapitalThe Alaska Industrial Development and Export Authority (AIDEA) is looking at the North Slope for one of its next major projects, according to James Hemsath, di-rector project development and asset man-agement. Even in the development stage, the project is already paying dividends.

In a case of “build it and they will come,” AIDEA, the state’s development financing authority, formed a limited liability corpo-ration, Mustang Road LLC, which com-pleted a five-mile gravel road and nine-teen-acre gravel pad on the North Slope in 2013, the first phase of the Mustang oil development project. AIDEA invested $20 million toward the facility, which is oper-ated by Brooks Range Petroleum Co.

Last winter, ConocoPhillips and Rep-sol used the pad to launch their ice road construction, Hemsath says, “simply because the pad was there and the in-frastructure was there.”

Repsol and other companies are now in discussions to use the pad and

the production facility planned for the site as a hub processing center. AIDEA struck a deal with CES Oil Services Pte. Ltd. to jointly finance and own the Mustang oil and gas facility. AIDEA will invest up to $50 million toward the $225 million facility.

The project is designed to help offset declines in throughput in the trans-Alaska oil pipeline. Exploration drilling at the Mustang prospect showed more than 25 million barrels of potentially recoverable oil.

Other major AIDEA projects include the DeLong Mountain Transporta-tion System at the Red Dog Mine, the Federal Express Aircraft Maintenance Facility in Anchorage, the Ketchikan Shipyard, and the Skagway Ore Termi-nal. It also invests in a variety of other projects through loans. It is authorized to issue bonds to finance infrastructure and construction costs associated with the development of the Bokan-Dotson Ridge Rare Earth Element project.

AIDEA is also continuing to work on the Interior energy project and is keep-ing an eye on potential investments in a drill rig, Agrium; production of ultra-

low sulfur gas; and methanol on the North Slope.

Hemsath is bullish on Alaska’s potential.“Our goal is to provide access to capi-

tal that may not be available to some of these smaller companies or providing capital at a cost that helps make the proj-ect successful in Alaska,” he says. AID-EA can assure that the project is able to weather early bumps and get to the point where smaller companies can maintain jobs and create economic opportunities.

The production facility at the Mus-tang Road location is due to be com-pleted in 2016. When it is, it will be a milestone for Alaska, Hemsath says. It will be the first independent production facility, and if capacity is there, other oil companies can use it as well.

“There’s so much,” Hemsath says. “There are so many opportunities and people are becoming more and more aware of the ability to do business in Alaska and that we’re not hiding out at the end of the world.” R


Better for business.

Federally insured by NCUA

SOMETIMES RESOURCES AREN’T JUST THINGS

Protect them all with customized business insurance.

alaskausa.org/insurance


OIL & GAS

New Age of Air Support to Oil & Gas IndustryUnmanned aviation systems on Alaska’s North Slope

By Julie Stricker

From a distance, what looks like a toy plane is flying a few feet above the tundra alongside the web of

pipelines radiating from BP Alaska’s oil fields on the North Slope. The tiny air-craft flies low and straight, aiming an infrared camera at the pipeline while a group of people monitor it from a near-by gravel pad. When they’re done, the aircraft lands lightly on the ground and is easily held by one person.

This is no hobbyist aircraft. It’s a high-tech Puma AE operated by Cali-fornia-based AeroVironment on one of the first permitted commercial flights of unmanned aircraft systems in the United States.

“This is not a toy you buy in the store,” says Steven Gitlin, AeroViron-ment vice president of marketing strat-egy and communication. “It’s a highly engineered, highly designed piece of technology that is designed to perform to high specifications.”

New Dimension AddedThe high-tech aircraft are adding a new dimension to how BP is working in the North Slope’s sprawling, often inhospita-ble terrain. Besides inspections, they are used for three-dimensional mapping, in-frastructure maintenance, and are being eyed for wildlife management and other tasks. BP contracts with AeroVironment,

which owns and operates the air-craft. The company was founded in 1971 and developed the first

small unmanned aircraft system in the mid-1980s, according to Git-lin. Its unmanned aircraft sys-tems are used around the world. (They are called drones by some, although that’s a term many in the field find derogatory.)

“We believe this technology is really going to enable a lot of customers in a lot of plac-es,” Gitlin says. “It can en-

hance their productivity, enhance their safety, and reduce their costs.”

And while they’ve been used for com-mercial purposes for less than a year—the first commercial flight was June 6, 2014—unmanned aircraft have been put to the test by the Alaska Center for Un-manned Aircraft Systems Integration at the University of Alaska Fairbanks, ac-cording to Director Marty Rogers.

“Alaska is in many ways quite unique from an unmanned aircraft perspec-tive because we have a lot of airspace,” Rogers says. “A lot of the science and re-search work that is going on, especially with the high emphasis on the Arctic right now, Alaska is a great place to do it.

“We have the largest university-based unmanned aircraft program in North America. We have the oldest university-based unmanned aircraft program in North America,” he says. “We’ve been in continual operations for fourteen years, flying very difficult missions. Nobody has any kind of experience like we do flying in the Arctic. We have over one hundred aircraft and we do science and research. We look at things like invasive species, marine mammal research, wildfires. It’s almost sort of an endless list. Environ-mental monitoring. Anything you can

An AeroVironment technician launching a Puma AE for BP on the North Slope.Courtesy of AeroVironment


use manned aviation for, we’ve been able to successfully use unmanned craft.”

Keep Flying—Keep TestingOne secret to their success, Rogers says, is simply to fly as much as possible. That way they can learn from the mistakes they make so clients aren’t making those mistakes.

“Testing is important,” he adds. If an aircraft is to be used in the Arctic, it needs to be tested in the Arctic—over and over and over again.

Unmanned aircraft allow researchers to conduct science and research missions in conditions that fall into the “dull, dirty, dangerous, and denied categories,” Rogers says. Those are such things as twelve hours of flying grids for a mapping mission, fly-ing over forest fires, or to sample ash and gas from an actively erupting volcano.

“An unmanned aircraft can actually go in and do that and not put a human at risk,” Rogers says. The aircraft are proving invaluable in commercial settings, as well.

That’s what caught BP’s interest.“We’re always looking at how we can

do things more efficiently and safer,” says Curt Smith, technology director for BP. “If you don’t have people in-volved, it’s always safer.”

With BP, AeroVironment is using two different aircraft, a rotorcraft and the Puma AE. The Puma weighs 13.5 pounds and has an eight-foot wingspan. It is battery powered and is designed to land on the ground or in the water. It was the first small unmanned aircraft system to receive FAA approval for commercial uses in the United States, as part of BP Alaska’s operations.

“It has been proven in many tens of thousands of operating hours in the military to be reliable, safe, and effec-tive,” Gitlin says.

The Puma is capable of tasks that manned aircraft simply cannot do, as well as routine tasks that could pose risks to people, such as leaning out of a moving helicopter to inspect power lines, Smith says.

“It allows us to do things we couldn’t do before,” Smith says. “To inspect the flare stacks where they burn off the gas, the way you do it now, you shut it off and then you inspect it, mostly with binocu-lars because you can’t climb up there.”

But using a rotorcraft type of un-manned system (like a mini-helicopter with multiple small rotors), BP is able to

An AeroVironment Puma AE on the ground at Prudhoe Bay.Courtesy of AeroVironment

UNMATCHED SUPP ORT ON THE SLOPEFairweather’s Deadhorse Aviation Center (DAC) is strategically designed to provide North Slope operators with a safe and efficient aviation command center to manage onshore and offshore exploration and production activities. Offering secure access to the airport, roads and ocean, DAC provides the infrastructure needed to meet the toughest challenges. Plans are underway for a major expansion with many build-to-suit options. This level of support, service and reliability is unsurpassed on the North Slope.

Managed by Fairweather, LLC301 Calista Court • Anchorage, AK 99518Phone: 907-346-3247 • Fax: (907) 349-1920www.fairweather.comwww.facebook.com/fairweatherllc

DAC West• 21,000-square-foot hangar with private

apron and 23-acre lay-down yard• Medical clinic with ambulance service and

medevac staging• 11,000 square feet of office space,

24 bedrooms and dining facility• Passenger terminal for fixed-wing and

rotor operations

DAC East• 12,000-square-foot hangar and

4,000-square-foot office/passenger terminal

DAC Expansion Plan• 13-acre cargo and logistics facility with

taxiway access• 28,000-square-foot hangar designed to

accommodate C-130s and 737s• Additional offices, sleeping quarters,

warehouse space• Plans to develop an additional eight acres

of lay-down yard

Deadhorse Aviation Center is wholly owned by Offshore Support Services, LLC (an Edison Chouest Company), Fairweather, LLC and the Kaktovik Iñupiat Corporation.


take pictures of a flare from just a few feet away, even while it’s still burning. Not shutting down the stack allows the craft to gather more information and no people are endangered, Smith says.

“If you see anything that needs to be fixed, unless it’s an emergency, of course, then you can order the parts and then shut it down when it’s time to fix it,” he says.

Mapping ChangesMapping is another important task for the aircraft, Smith says. “Knowing where things are on the ground and knowing how they change over time is important.”

Using photos and LIDAR, a technology similar to radar that uses light to measure distance, BP can create three-dimension-

al pictures of pipelines, roads, and even gravel pits and be able to see even tiny changes. For instance, Smith says, the gravel for the roads comes from a state pit. BP needs to stay within the boundaries of its permit and calculate how much gravel is removed as well as figure out where to place pumps to keep water out.

Using the LIDAR mapping system to calculate volume, “it’s pretty easy to take a 3D image of the pit and then come back a month later and take an-other picture and then subtract one from the other,” Smith says.

Gitlin says AeroVironment’s system takes the LIDAR’s three-dimensional points of information and uploads them into a custom cloud-based data

processing system they have developed that creates 3D maps.

“At the end of the day, we deliver to BP much better quality information than they’ve been able to get before,” he says. “It can ensure that their gravel roads are in conformance with their standards, that they can understand the effects of the en-vironment on their pipelines. It gives them an overall picture of the infrastructure and the environment they operate in.”

“Inspections are really a no-brainer with these things,” Smith says. Depend-ing on the mission, the aircraft can hold high-resolution still cameras, LIDAR, or infrared cameras to look for heat anom-alies. Drones are being used in other countries to inspect such things as the insides of oil tankers, refinery towers, and offshore oil platforms.

Improvements Increase UseAs the technology improves, so do the possible applications, Gitlin says. Com-puters can do more with less, process-ing power keeps increasing, battery life has improved, and cameras and other components are smaller, lighter, and more powerful than ever.

“It can ensure that their gravel roads are in conformance with their standards, that they can understand the effects of the environment on their pipelines. It gives them an overall picture of the infrastructure and the environment they operate in. Inspections are really a no-brainer with these things.”

—Curt Smith Technology Director, BP


In the past couple of years, autopi-lot technology has improved tremen-dously, Rogers says. Better batteries allow longer flight times and heavier payloads as well as better command of the aircraft. “The amount of human intervention is less and less and less and you’re letting the computer do the work,” he says. “There’s huge benefit in that because you’re allowing a certain amount of repeatability… At the same time, the ground crew still has the abil-ity to manually override the program and land the aircraft if necessary.”

Mapping roads and other infrastruc-ture is one important area for BP. Even tiny imperfections in the grade can cause problems and cost money, Smith says. “The well pads have to be within an eighth of an inch of level, so there’s some really precision engineering going on,” he says.

The LIDAR can highlight specific ar-eas that need work, so crews can fix those without having to redo the entire roadbed, as they had to do in the past, Smith says. The road graders are GPS-guided, with a display that shows the driver the exact cen-ter of the road. The blade goes up and down according to a computer-guided system to

keep the road to exact specifications. That can save significant time and money.

“A drill rig on a bad road may only go a half-a-mile an hour,” Smith says. “On a good road, it may be able to do two miles per hour.”

That doesn’t seem like a big increase, but considering it costs thousands upon

thousands of dollars an hour to move a drill rig from one spot to another, quar-tering the time it takes saves enormous amounts of money.

“From an economic standpoint, un-manned aircraft make sense,” UAF’s Rogers says. “However, there is nothing unmanned about unmanned aircraft.”

Courtesy of AeroVironment

BP contracts with AeroVironment, which owns and operates the Puma AE, to use the unmanned aerial system technology at Prudhoe Bay and else-where on the North Slope.

Engineering l Fabrication & Construction l Pipeline Construction l Marine Services Operations & Maintenance l Response Operations l Quality, Health, Safety, Environmental & Training Regulatory & Technical Services l Exploration, Drilling Support & Geosciences l Bakken Support

What’s Up?What’s Up?

Dock.

The big news around here – ASRC Energy Services Marine Support is now providing marine services in Cook Inlet. Our newly refurbished Rig Tenders Marine Terminal is fully equipped to deliver a wide range of specialized services to the Kenai Peninsula’s oil and gas industry. In Alaska, only one company puts it all together – AES.

Engineering l

www.asrcenergy.com

white globe and text

Quality, Health, Safety, Environmental & TrainingQuality, Health, Safety, Environmental & Training

white globe and text


Gitlin agrees. A team of highly trained technicians launch and oversee every flight. Most are from a military back-ground, so they are well-suited to achieve their mission objectives despite the chal-lenges of the many regulations and un-predictable weather on the North Slope.

Permit BacklogOne drawback is the permitting sys-tem, or rather the lack of an established permitting system, for the use of un-manned aircraft in commercial opera-tions. AeroVironment must get a permit from the FAA, called a section 333, for every mission it wants to do. The result is a huge backlog of permit requests.

BP and AeroVironment have been working closely with the FAA to estab-lish and streamline such a system.

“The big problem is the FAA doesn’t re-ally have a rulebook,” Smith says. “They’ve been working with us to kind of get things approved using the manned [aircraft] rulebook. They’ve been helping us by looking at creative ways to do things.”

While it can sometimes take months under the current system for the FAA to grant a permit, when there’s an emer-

gency, such as a search and rescue, it’s a different story, Rogers says.

“We’ve had emergency COAs [certifi-cate of authorization] in less than half an hour,” he says. “When it comes to real urgent need to respond to a situa-tion, the FAA has been amazing.”

Rogers notes that BP, as the leader in the use of unmanned aircraft, is also helping the industry as a whole.

“Industry has a way of pursuing its own private interests, but what I’ve seen on the whole is that industry un-derstands that what benefits one ben-efits all typically, and they really want to move this thing forward,” he says.

Beyond Line of SightAt UAF, Rogers and his team are look-ing to expand what unmanned aircraft can be used for in Alaska. Now, com-mercial activity is strictly limited to line of sight. “You’ve got to be able to see that aircraft and all the airspace around that aircraft at all times,” he says.

“The holy grail for unmanned air-craft work is what we call a ‘beyond line of sight’ missions,” he says. The goal is to be able to use unmanned aircraft on

long-range missions to look at oil and gas infrastructure or fly over the path of a tornado or tsunami to assess damage. Search and rescue is a great application for unmanned situations but only with beyond line of sight capability.

“You may be in a situation where you might not be able to get a manned aircraft out there because of visibility or weather conditions, but you could launch an unmanned aircraft basically immediately,” he says.

Interest in UAF’s program has grown exponentially in the past couple of years, and Rogers finds himself in great de-mand for conferences all over the globe. However, for all his enthusiasm and en-ergy for unmanned aircraft and its fu-ture, he wants to make sure people know the drones aren’t going to take over.

“It’s a machine,” Rogers says. “It is not a replacement for manned avia-tion. It complements manned aviation. It does not replace manned aviation. I think that’s important.” R


We Will Help You Safely Navigate the Process Safety Path Ahead

The road that takes you from where you are to more eff ecti ve management of regulatory process safety requirements can be a daunti ng task. aeSoluti ons is a complete supplier of performance-based process safety engineering and automati on soluti ons to help you navigate down that path of OSHA/EPA/BESSE compliance.

We are committ ed to helping our customers execute, monitor, and sustain the process safety lifecycle in their faciliti es with proven methods and tools.

If you have concerns or questi ons on the health of your process safety lifecycle call our Alaska offi ce or visit our website.

aesolns.com | 907-865-5992

Anne TompkinsSenior Advertising Account Manager

(907) 257-2910 [email protected]

(907) 276-4373 • Toll Free (800) 770-4373 akbizmag.com

GET NOTICED!Reaching a statewide

business audience in Alaska’s leading

business publication gets results!

I will work with you to plan an ad campaign that offers marketplace

visibility and fits your budget.


OIL & GAS

Shell’s planning for its summer 2015 Chukchi Sea exploration drilling involves an extensive logistics exercise involving

as many at twenty-nine vessels, including two large mobile offshore drilling structures, the drillship Noble Discoverer, and the semi-sub-mersible Polar Pioneer. The other twenty-sev-en vessels will be engaged in support activity.

The U.S. Bureau of Ocean Energy Man-agement gave tentative approval to Shell’s exploration plan April 11.

A major concern for Shell, however, is keeping the vessels and crews safe from ha-rassment by Greenpeace, an environmental organization that has said it will attempt to disrupt the company’s exploration activities. Six Greenpeace activists boarded a Shell-chartered vessel in the mid-Pacific this spring but quit the ship as it approached US waters.

A restraining order against Greenpeace has been issued by a US District Court in Anchorage, but Shell is still wary.

One of Shell’s drill vessels is the Noble Dis-coverer, owned by Noble Drilling Co., which conducted drilling for Shell in the Chukchi Sea and drilled a partially-complete explora-tion well, which was planned. The Discoverer encountered engine problems late in the sea-son and has undergone extensive refitting.

The other drill vessel is the Polar Pioneer, owned by Transocean Ltd., a harsh-weath-er offshore rig that has spent several years drilling in the Norwegian Arctic.

High Seas BanditsEarlier this year both the Noble Discoverer and the Polar Pioneer underwent opera-tions “shakedowns” in Southeast Asia be-fore being brought to North America. Both vessels left Malaysia in March for Puget Sound, with the Polar Pioneer loaded atop the Blue Marlin, a large “heavy-lift” ship.

An event that occurred during the Blue Marlin’s transit was its boarding by six Green-

peace activists in mid-ocean, when the ves-sel and rig were about seven hundred miles northwest of Hawaii. The activists climbed up into the Polar Pioneer and remained there until the Blue Marlin approached US ter-ritorial waters. Greenpeace’s people, includ-ing one employee of the organization along with five volunteers, left the rig just before a US District Court in Anchorage had issued a Temporary Restraining Order against the environmental organization.

Prior to sailing for the Arctic, many of the vessels supporting the drilling underwent conversions and installation of equipment spe-cific to the Arctic drilling mission. The crews underwent training also, and prior to sailing many of the vessels took on supplies and fuel.

Arctic Support FleetOnce in the Arctic, both drilling vessels will be supported by a small fleet of sup-port ships. Shell described the operation in affidavits submitted to the federal court for the injunction hearing:

The schedule calls for the Polar Pioneer, Noble Discoverer, and the supporting ves-sels to pass through the Bering Strait about July 1 and then onward to the “Burger” prospect in the Chukchi Sea as soon as

weather and ice conditions allow. Explora-tion should continue through October 31.

“These vessels will be used for ice man-agement, anchor handling, refueling, resup-ply, water sample connection, and oil spill response in the unlikely event it is neces-sary. The vessels Tor Viking, Aiviq, and Ross Chouest will be engaged in anchor handling and deployment, while the Harvey Explorer will be performing monitoring of drilling fluids that are discharged,” according to Shell’s affidavit filed with the federal court.

Two vessels, the Nordica and Fennica, will be available for ice management.

Oil spill response vessels, with several attendant workboats, containment boom, and recovery equipment, will be in the project area when drilling into subsurface liquid hydrocarbon-bearing formations. These will include the Nanuq, Arctic En-deavor, Klamath, and Arctic Challenger, which will be immediately available to per-form oil spill response and containment.

These vessels will either be close to the rigs as necessitated by their response time or in Kotzebue Sound. The Arctic Containment System is intended to be located in Kotzebue Sound throughout the drilling season.

Aviation operations, based in Anchorage

Safety ZonesUS Coast Guard Shell Requested Exclusion ZonesExisting Regulations Vessels In Motion Drill Vessels500 Meters 1,000 meter 1,500 meters547 yards 1,093 yards 1,640 yards0.27 nautical miles 0.54 nautical miles 0.81 nautical miles0.31 miles 0.62 miles 0.93 miles

Shell’s Noble Discoverer�

© Shell

Keeping vessels, crews, and the ocean safe By Mike Bradner

Shell’s Extensive Arctic LogisticsShell’s Extensive Arctic Logistics


and Dutch Harbor and the two Arctic com-munities closest to the exploration, Barrow and Wainwright, will support the drilling, in-cluding transport of personnel to the various vessels along with resupply and other logistics support including search and rescue, if needed.

Safety ZonesAt the Burger prospect, the anchoring of the Noble Discoverer and Polar Pioneer will require the placement of a carefully coor-dinated and planned anchoring system involving eight anchors weighing fifteen tons each in a circular formation around each drillship, at about a 1,000 meter ra-dius. Anchors for the Noble Discoverer, the drillship, will be pre-positioned prior to the drillship’s arrival. The semi-submersible Polar Pioneer is carrying its own anchors.

Placement of the anchors and chain will be an intricate operation. Chain extending back to the position of the drillship will also be in-stalled, along with an intermediate buoy to aid the connection of the lengths of chain. Once the chains are in place the buoy will be sub-merged to allow safe passage of vessels for the connection and disconnection of the chains and anchors or for an emergency recovery.

The distance of the anchors and the length of the anchor chains is a major reason why Shell has asked the US District Court for a larger safety, or exclusion, zone of 1,500 meters around the drillships than can be provided by the US Coast Guard in the 500-meter safety zones it can establish under its regulations.

If only the Coast Guard’s 500-meter safety zone were to apply in the Arctic, Greenpeace vessels will be able to navigate between the anchors and the drillships, creating safety problems, Shell’s attorneys said in federal District Court hearings. “The process of an-choring all eight preset anchors is conducted in two stages and involves highly trained personnel handling very large, heavy-duty equipment according to a specific set of pro-tocols and safety procedures,” Shell said in its affidavit filed in the court hearing.

“It is absolutely essential that this process is carried out free of outside interference and crew distractions,” Shell said in its affidavit.

“It is also essential that all the preset equipment is not interfered with prior to the drillship’s or MOU [Mobile Offshore Unit] arrival and during the course of drill-ing operations. Any such interference or distractions pose unacceptable, significant, and substantial safety risks,” Shell said.

Ice ManagementDuring drilling the support vessels will be moving constantly within and outside the perimeter of the anchoring system to insure the integrity of the system and to confirm that the drillship and MOU are secured throughout the drilling operation. Support

WM Energy ServicesWaste Management Energy Services offers a variety of remediation support services and solutions including on-site and off-site water and solids management, materials tracking and reporting along with permitting and compliance assistance.

• Bulk Soil Remediation

• U.S. and Canadian Manifesting

• Hazardous and Non-Hazardous Waste Disposal

• Waste Reuse and Recycling

• Web-Based Waste Compliance Tracking

• Embedded Materials Management Support

• Turnkey Remedial Services

• ISO Certification Consulting

A Complete SolutionsProvider for Alaska’s Remediation Industry

ALASKA CONTACTS:

Bill HickeyOperations Support Manager Pacific Northwest & Alaska 360-270-0430

Mike HolzschuhSenior Territory Manager North America206-423-4955

Brenda SheetsProject Manager Alaska(206) 437-7690

1519 Ship Avenue Anchorage, AK 99501

Toll-free 866-402-1671

www.thinkgreen.com


‘Realizing the Promise’ of Alaska’s Arctic OCS

The offshore Alaska Arctic contains huge poten-tial oil and gas resources that will be needed because, in the long run, the present boom in

shale oil production will not be sustained. Moreover, the technology exists today to access much of this resource potential, based on decades of experience in the petroleum industry with Arctic offshore drill-ing. These are two conclusions in “Arctic Potential: Realizing the Promise of U.S. Arctic Oil and Gas Re-sources,” a major study released in late March of Arc-tic offshore potential and technology problems by the NPC (National Petroleum Council), a prestigious US industry and government advisory body.

However, the study also notes that there are significant challenges created by the Arctic envi-ronment, such as remoteness and high costs, and economic problems created for industry because of short drilling seasons due to the presence of ice. More flexibility in government rules can offset some of these problems, the study authors found.

Another key recommendation of the report is that public confidence in the industry’s ability to contain and clean up Arctic spills must be boosted. To do this, the study recommends continued re-search, including field demonstrations, on spill cleanup procedures like in-situ burning of spilled oil, and that government agencies join industry in that research.

426 Billion Barrels Overall, the Arctic is estimated to hold 426 billion barrels of oil equivalent (the combined energy value of both oil and natural gas), of yet-to-be discovered conventional hydrocarbon resources. This represents 26 percent of the remaining global undiscovered conventional resource potential, ac-cording to the NPC report. About 30 percent of this is estimated to be in liquids, such as crude oil.

While Russia dominates this resource potential in natural gas, the United States (meaning Alaska) and Russia are about equal in expected liquid hydrocarbon potential. The Alaska Arctic is estimated to hold 34 bil-lion barrels of liquid resources while Russia is estimated to hold 36 billion barrels of liquids. Russia’s potential gas resources are huge, however, at 260 billion barrels-of-oil equivalent compared with 60 billion barrels-of-oil equivalent for the United States. In the report, the NPC notes the potential of Canada, Greenland, and Norway are dwarfed by the United States and Russia.

Arctic Difference A key finding of the NPC is that the Arctic environ-ment, while challenging, is generally well under-stood: “The Arctic environment has been studied for many years by industry, government, and aca-demia, and much is known about the physical, bio-logical, and human environments.”

NPC report shares key findings and recommendationsBy Mike Bradner

EQUIPMENT RENTAL/PROJECT SUPPORT COMPANY SUPPORTING THE NORTH SLOPE & COOK INLET HEATERS, GENERATORS, VEHICLES, MANLIFTS, LIGHT PLANTS CAMPS & CAMP SERVICES FULL PROJECT LOGISTICS SERVICES & STAFFING

Magtec Alaska, LLC(907) 598-6930Marcus Guidry, Prudhoe [email protected]

Christopher Zoda, Kenai(907) 394-6305 [email protected]

TOTAL PROJECT SUPPORT



vessels will also be involved in ice manage-ment to protect the drill vessels and anchor-ing systems from any encroaching ice.

“Were ice allowed to build up against the hull of the drillship or the columns of the MODU [Mobile Offshore Drilling Unit], it could be forced off its anchors, or in a worst-case scenario, damage to the drill-ship or MODU could result,” Shell said.

In addition to procedures to prevent ice build-up against drilling vessels, Shell will have plans in place for safe suspension of drilling and moving to a nearby location until the ice hazard has passed.

“These emergency procedures involve multiple large vessels moving around in close proximity to each other and sea ice and include an operation where anchor wires are released from anchor chains,” Shell said.

In operating conditions like these it is very important to keep organizations like Green-peace at a safe distance, which in its affidavits, Shell asked for the 1,500-meter safety zones for the drill vessels and 1,000-meter safety zones for most of the vessels when under tow or en-gaged in towing. Safety zones of 1,000 meters were also requested for two resupply tankers that will be engaged for the drilling season. R

Besides supplying domestic oil, development of Arctic resources would benefit the nation in other ways, such as enhanced national security through the presence of infrastructure in the re-gion that industrial development could create. For example, navigational aids in the Bering Straits re-gion would be created, along with ports and com-munications facilities.

Many of the challenges of the Arctic are similar to other oil and gas production areas, and expe-rience and technologies from those areas can be applied to Arctic development, with an exception.

“For example,” the report noted, “the design prac-tices, technologies, and safety systems for deep wa-ter and subarctic regions are adaptable to the Arctic. Logistical challenges associated with long distances and lack of infrastructure are similar to recent proj-ects in Africa and Papua New Guinea. The key char-acteristic that distinguishes the Arctic from other oil and gas production areas is the presence of ice. The ice environment varies substantially throughout the Arctic depending on the season and location.”

Ice does pose challenges, and many of those relate to water depths and the technologies that would be employed. Most of the potential of the Alaska Arctic lies in water depths of less than one hundred meters, though, and the report states, “Developments in ice-prone water depths less than about one hundred meters are amenable to well-established technology of structures resting on the sea-floor, or bottom-founded.”

Time to Ramp UpThe exploration and development of US Arctic resources needs to begin now if the region is to be able to provide new oil and gas supplies in the 2030s and 2040s, when domestic production from other regions, including onshore Alaska, is expected to be declining and domestic shale oil The surge of domestic production due to shale oil will have run its course by then, according to the NPC report.

Between 2008 and 2014 domestic production increased from 5 million bbl/d to 8.5 million bbl/d, according to the Energy Information Administra-tion, and that federal agency expects 7.7 million bbl/d by 2019 and 7.5 million bbl/d by 2024. In nine years—2024— the nation may only will be produc-ing only 49 percent of its oil requirements domes-tically, down from 57 percent in 2014.

That is a “base case” that assumes not only de-clines in Lower 48 shale oil and conventional oil production but also a continued drop of Alaska onshore oil from its current level of about 0.5 mil-lion bbl/d to about 0.3 million bbl/d.

In a more optimistic scenario Alaska production increases to 1 million bbl/d by 2024 and brings US oil self-sufficiency to 85 percent. However, the NPC warns, “these new sources of crude oil pro-duction in the 2030s and 2040s will only be avail-able if new offshore exploration drilling can ramp up in Alaska during this decade.” R


special section Building Alaska

Summer in Alaska is a time to build, and this year is no different. Con-struction contractors are building

roads, bridges, and many buildings and will continue through the fall and, for some builders, even through the winter. A sampling of projects finds work un-derway throughout the state.

Northern AlaskaStage 1 of the Kotzebue Airport and Safety Area Improvements continues this year. The project began in October 2013 and ADOT&PF officials expect it to be complete by August. General contractor Brice Incorporated, a wholly-owned sub-sidiary of Calista Corporation, says thirty-five workers will be employed at peak con-struction for this $30 million project.

Brice is also contracted through ADOT&PF to reconstruct a thirteen mile stretch of the Dalton Highway, from milepost 401 to 414 near Deadhorse on the North Slope. The $26 million project expects to see fifty workers at peak con-struction. Slated to be complete in August 2016, Brice says it will raise the grade, re-place all culverts, and resurface the road.

The Deadhorse Airport will see im-provements one step at a time as Brice installs a foundation pad, piles, and a passive refrigerated foundation system in preparation for building equipment bays, a sand storage bay, and upgrades to the existing Airport Rescue and Firefighter Facility and Snow Removal Equipment Storage Building. The $2 million contract will see fifteen workers

at peak construction and is expected to last a month, beginning this month with completion in July, according to Brice.

InteriorThe University of Alaska Fairbanks (UAF) Engineering Facility project began in April 2013 by general contractor Davis Constructors. The $118.1 million project is a six floor, 119,000-square-foot building with renovations to 23,000 square feet of the adjacent Duckering Building. Davis completed exterior construction in April and quickly proceeded with mechanical, electrical, and plumbing work, but UAF has not yet announced a completion date. ECI Hyer was the architect; AMC Engi-neers was the mechanical and electrical contractor; PDC, Inc. handled structural and civil engineering; and NBBJ was the project planner. UAF expects eighty con-tractor employees at peak construction.The US Army Corps of Engineers con-tracted Tunista Construction to build a 13,163-square-foot Company Operations Facility for the Aviation Task Force Phase 3B at Fort Wainwright. The facility will

house an administrative module, a readi-ness module, and an enclosed hardstand facility. The building will be fit for office and warehouse space, Tunista says. The $9.5 million contract includes construc-tion of water, steam, condensate, sewer, and power for the entire facility. The project began in April 2014 and will be complete in October. Tunista expects 122 workers at peak construction including subcontractors.

The US Army Corps of Engineers contract to design and construct the Mechanical-Electrical Building on Fort Greely, Missile Field 1, was awarded to Watterson Construction for $44.3 mil-lion. Watterson began the foundations in April and expects to complete the project by spring 2016. Watterson says it expects eighty workers at peak employment.

General contractor Westmark Con-struction began building the Koyukuk Health Clinic in Koyukuk, nearly three hundred miles west of Fairbanks in May 2014. The Denali Commission funded 80 percent of the $2.8 million City of Koyu-kuk project. The 1,580-square-foot facility

Statewide Construction Project RoundupThousands working on projects worth billionsBy Russ Slaten

Brice Incorporated continues work on the Kotzebue Airport and Safety Area Improvements project it began in October 2013. The company brought in aggre-gates for the work last June and expects to complete the project by this August.

Phot

os b

y D

erek

Gilb

erts

on/B

rice

Inc�


was ready for occupancy in February, but the Denali Commission anticipates com-pletion of the remaining items by July.

Western AlaskaIn the Western city of Emmonak ten miles from the Bering Sea, the Denali Commission provided more than $1.8 million to upgrade about three miles of the Emmonak Road surface. Anchorage-based Bering Pacific Construction was awarded the contract in November 2012, began the bulk of the work in 2014, and expects to finish the job this year, ac-cording to the Denali Commission.

STG Incorporated, a wholly-owned subsidiary of Calista Corporation, began construction on the Emmonak Power Plant in May. Owned by the Alaska Vil-lage Electric Cooperative, the Emmonak Power Plant will be 2,496 square feet. STG estimates about twelve workers at peak employment and expects to com-plete the project in July 2016.

Through the Association of Village Council Presidents, Brice Marine, a wholly-owned subsidiary of Calista Corporation, is upgrading community streets in Chevak near Hooper Bay. The $3 million contract began in June and is expected to be complete in July. Brice Marine says it will employ ten workers at peak construction.

Ekwok Village Council awarded STG Incorporated the contract to complete the Ekwok Landfill Bridge project. Spanning approximately 115 feet, the project began in March and is expected to be complete in September 2016. The workforce is made up of four to six skilled field employees and up to four Ekwok-based employees, according to STG. This is part of a $5.88 million project for a new landfill with a road and bridge for the village to access it.

The Denali Commission funded a $2.6 million project for Delta Junction-based Carpenter Contracting, Inc. to com-plete a 2,400-foot-long board road (about 19,200 square feet) in Tununak. The con-tract was awarded in June 2014, and the project for the Native Village of Tununak is expected to be complete by October, ac-cording to the Denali Commission.

KodiakOn Kodiak Island, Watterson Construc-tion began site, utility, and building improvements to the existing Kodiak High School in May 2013. At 720 Mill


Bay Road in Kodiak, work encompasses about seventy-seven thousand square feet of new construction, including a four-story tower, commons, and other new construction, according to Watter-son. Additionally, about ninety thousand square feet of selective demolition and renovation to existing construction will continue in the Kodiak Island Borough school. Site work includes replacement of existing utilities, parking and driveway improvements, landscaping, site light-ing, and other improvements. Work also includes heating control and metering for the adjacent existing swimming pool and Gerald C. Wilson Auditorium. The total project is worth about $80.5 million, with $63 million of that contracted to Watterson. Peak employment is expected to reach seventy workers, and completion is slated for this December.

Also on the island, the Kodiak Na-tional Wildlife Refuge granted a $2.03 million contract to Anchorage-based Tunista Construction to build a Kodiak National Wildlife Replacement Triplex in September 2013. The project includes one single-story unit and two two-story units. Tunista Construction, a wholly-owned subsidiary of Calista Corpora-tion, expects peak employment at forty-six workers and completion by July.

Aleutians Akutan, more than 750 miles southwest of Anchorage in the Aleutians East Bor-ough, is seeing dock improvements this year. The Akutan City Dock Improve-ment project was awarded to Turnagain Marine Construction Corporation in October 2014. The $1.21 million project will allow Turnagain Marine to recon-struct various portions of the existing city dock in Akutan to better accom-modate Alaska Marine Highway System ferries and other use. Construction was anticipated to begin in spring.

Cold Bay, farther up the Aleutian Chain and still part of the Aleutians East Borough, will also undergo dock improve-ments this year. Turnagain Marine was awarded the Cold Bay Dock Improve-ments project in October 2014. The $1.32 million project will restore the existing fender system and other deteriorated components. The Cold Bay dock services Alaska Marine Highway System ferries and other shipping and freight users. Con-struction is anticipated to begin in fall.

Southeast The City and Borough of Sitka, along with general contractor Barnard Con-struction Inc. and construction manager McMillen Jacobs Associates, officially dedicated the newly expanded Blue Lake Dam in May. The City of Sitka relies on two hydroelectric power plants to supply nearly all of its electricity. In recent years, Sitka has experienced load growth due to rising oil prices and increased demand for more affordable hydro powered electric heat. The expansion project raised the dam by eighty-three feet, increasing Blue Lake’s production by 50 percent and pro-viding 27 percent more electricity for Sit-ka. Along with expansion, the dam has a new intake, surge shaft, and powerhouse.

First National Bank Alaska’s new Ju-neau Regional Branch is under construc-tion. Located at the corner of 10th Street and Glacier Avenue in the downtown area of Alaska’s capital city, the branch is set to open this fall. First National says the Ju-neau Regional Branch will provide access to the only drive-up lane and 24/7 drive-up ATM in the capital city’s downtown area. It will have on-site parking, online account access at the lobby’s customer ser-vice kiosk, and more privacy when using safe deposit boxes in a special room.

The Brotherhood Bridge Replace-ment project in Juneau moved into its second phase this spring and summer with completion scheduled for fall. The $30 million project will accommodate two lanes of traffic in each direction over the bridge and add both a multi-use path on the upstream side and a sidewalk on the downstream side.

Juneau-based Secon, owned by Colas-ka, Inc., continues its work on the North Douglas Pavement Rehabilitation and Roundabout to Fish Creek Road project. After completing the pavement overlay and guard rail installation on North Douglas Highway in October 2014, Sec-on returns this summer to complete the unfinished driveways. In late summer Secon will install a new membrane and overlay for the Lawson Creek Bridge.

Fritz Cove Road in Juneau along Auke Bay is undergoing rehabilitation and repairs this year. The $3.1 million contract with Secon will widen the road, install new guardrails, rehabili-tate the existing grade, and install new pavement. ADOT&PF expects the proj-ect to be complete by the end of July.

The Mendenhall Dust Control Project will allow Secon to install new sub base and asphalt pavement on thirteen City and Borough Juneau residential streets in order to control dust. The $1.7 million project is expected to be finished in August.

On Prince of Wales Island, the Hyda-burg Highway Pavement Rehabilita-tion will be underway. Under the $11.9 million contract, Haines-based South-east Road Builders plans to install new culverts and bridge railings, correct super elevation on curves, and install a chip seal surface over the twenty-two-mile road. ADOT&PF expects the proj-ect to be complete in August 2016.

Seattle-based Western Marine Con-struction has been stockpiling material, and the offsite fabrication of marine struc-tures is underway for the Haines Ferry Terminal. The $15 million project is scheduled for completion in summer 2016.

The Annette Bay Ferry Terminal Im-provements project was awarded to West-ern Dock and Bridge LLC in December 2014. The $782,000 project will provide a new mooring dolphin at the Annette Bay ferry terminal facility in order to better ac-commodate use by the Inter-Island Ferry Authority ferry system vessels as well as the Alaska Marine Highway System. Con-struction started in spring of this year.

SouthcentralDrivers traveling between Anchorage and Eagle River will notice the Glenn Highway Capacity Improvements project. Managed by ADOT&PF (Alaska Department of Transportation and Pub-lic Facilities), the $42.5 million project broke ground in September 2014 and is scheduled to be complete in the fall. Design-build contractor Kiewit Infra-structure West Co., along with sub-contractor HDR Alaska, will undergo improvements to the north and south-bound lanes of the Glenn Highway be-tween the Hiland Drive interchange and the Artillery Road interchange in Eagle River to improve driving conditions, ac-cording to ADOT&PF Central Region.

A road project in the Anchorage area includes one that the Municipality of Anchorage awarded Roger Hickel Contracting the 48th Avenue and A Street extension and upgrade project. The $3 million contract will see six to twelve workers on site, according to Roger Hickel Contracting. The project


began July 2014 and is expected to be complete in August.

Construction continues on the $38 million West Dowling Road project as ADOT&PF works with Granite Con-struction to extend Dowling Road west from C Street to Minnesota Drive. West Dowling Road is scheduled to open to traffic in October and is scheduled to be complete in June 2016.

In Girdwood, Davis Constructors was awarded the $2.4 million bid to make improvements to Olympic Moun-tain Loop near Alyeska Resort through ADOT&PF. This federally-funded proj-ect will rehabilitate and pave Olympic Circle from Arlberg Avenue to the con-necting end at Arlberg Avenue in Gird-wood. The project also includes striping and drainage improvements.

Numerous other road improvement projects are in progress throughout the streets of the Municipality.

Also in Anchorage, the city is see-ing many new buildings and improve-ments, including healthcare centers, schools, and the facilities that keep the city running smoothly.

On the Alaska Native Health Campus, the two-story Southcentral Founda-tion Therapy Center is seeing progress. Anchorage-based Watterson Construc-tion began building the center in August 2014 and expects to complete it in January 2016. Located at 4085 Tudor Centre Drive, the facility is made up of a therapy center and space for training, public programs, and offices. The large therapy room on the

building’s first floor can seat two hundred people. A new parking lot with irrigation and landscaping completes the site work. Watterson says the 60,061-square-foot building cost nearly $24.6 million and will employ about seventy workers.

The Asplund Wastewater Treatment Facility on Hutson Drive near Ted Stevens Anchorage International Airport is under-going a $7.7 million building demolition and renovation. Roger Hickel Contract-ing began the Anchorage Water & Waste-water Utility project in August 2014 with expected completion in October. Roger Hickel Contracting says peak employment reached twenty-five workers. Subcontrac-tors for the project are GV Jones & Associ-ates, Electric Power Systems, HDR Alaska, PM&E Services, Reid-Middleton, RSA En-gineering, and UMIAQ.

Downtown WorkIn Downtown Anchorage, the Anchorage 5th Avenue Mall will see changes. Simon Properties contracted Anchorage-based Cornerstone General Contractors to up-grade mall restrooms. The project began this month and ends in October. Corner-stone is also contracted by lululemon ath-letica—the Vancouver, BC retailer known for yoga style athletic apparel—to build the interior space of the store. The project began in April, and Simon Properties says it will be completed in the summer.

The building located on 609 F Street undergoing significant renovations is now known as Williwaw. As of May, Benchmark Construction had made

significant progress on the project. Inte-rior demolition and abatement was com-pleted. Structural refit, including instal-lation of new steel beams and columns was completed, according to Pfeffer Development. A new elevator and stair tower was constructed. The old exterior canopy was removed and exterior site preparation continued for entry stairs, patio, and handicap ramping. The new entertainment venue will house Steam-Dot coffee and the Blues Central bar and music venue. The project, near the corner of Sixth Avenue and F Street, is scheduled for completion this month.

EasyPark parking garages are un-dergoing renovations in Anchorage. Concrete & Masonry was awarded the contract, and will be coordinating with Gunnar Malm & Associates, Inc. and Anchorage-based engineering firm BBFM Engineers, Inc. for facility struc-tural improvements this summer. Phase 1 work at 7th and G Street, 6th and H Street, and 5th and B Street parking ga-rages began in May and are expected to be complete in August. The work consists of garage sealant removal and replace-ment, crack repairs, concrete repair, traffic membrane repair, application of silane water-repellant, and line striping.

The Delta Western Bulk Fuel Facility near the Port of Anchorage will under-go civil site work by general contractor Roger Hickel Contracting. With ten to fifteen workers on site, Roger Hickel Contracting began in April and expects to complete the project in October.

At 1300 Ocean Dock Road near the Port of Anchorage, the Anchorage Sand & Gravel ABI Cement Loading Facil-ity began to see concrete foundation work in April. General contractor Roger Hickel Contracting conducted civil site and foundation work, with employment between twelve to twenty-four workers at a time. Roger Hickel Contracting says the facility is expected to be complete in October. Engineers involved in the proj-ect were Franklin & Associates, Fergus-son & Associates, and DOWL.

The Kings Landing at Ship Creek Phase II project was awarded to Davis Constructors and Engineers, Inc. for $1.9 million. According to the Munici-pality of Anchorage, the project consists of a 7,000 square-foot plaza with decora-tive paving and 3,100 square feet of con-crete pavers; concrete walls with a wood-

For the fifty thousand cars traveling the Glenn Highway every day, a new bridge over Eagle River, a different alignment, and another lane are parts of the project between the Hiland Drive and Artillery Road interchanges.

Phot

o co

urte

sy o

f Ala

ska

DO

T&PF


en boardwalk; restroom building; 15,000 square-foot asphalt parking lot; and elec-trical and landscaping work.

Around TownMilepost 1 to 3.5 of the Chester Creek Trail in Anchorage will see improvements this summer. Davis Constructors was award-ed $1.4 million to improve 3.5 miles of the main trail corridor from Arctic Boulevard tunnel to Nichols Street and to repair spurs along the trail. The project began in May and is expected to last until October, ac-cording to the Municipality of Anchorage.

The University of Alaska Anchorage (UAA) Wells Fargo Sports Complex will see improvements this year. Davis Con-structors was awarded the $6.6 million contract that incorporates replacing the existing ice plant and ice rink; refurbishing the existing air handler unit; fire alarm sys-tem upgrades; electrical system upgrades; and remodel of interior offices, locker rooms, and fitness spaces. Construction began in May and will be complete in mid-September, according to UAA.

Construction of the UAA Engineer-ing and Industry Building at the cor-ner of Providence Drive and Spirit Drive

is expected to be completed in the fall, according to UAA. Neeser Construc-tion, Inc. is the general contractor on the $78.3 million project.

The UAA Health Campus Pedestrian Bridge over Providence Drive connecting the Engineering and Industry Building with the Health Sciences building will be completed by the end of the month. Nees-er Construction, Inc. was the general contractor for the $6.1 million project.

The UAA School of Engineering four-story, 485-space parking struc-ture is under construction at the corner of Mallard Drive and UAA Drive. The $23 million project will be completed in the fall and opened to parking in Au-gust 2016. Neeser Construction, Inc. is the general contractor for the post-ten-sioned concrete parking garage project.

The Anchorage Fire Department broke ground on two new Anchorage fire stations, Fire Station 3 in Airport Heights in May and Fire Station 9 in South An-chorage this month. The new Fire Station 3 will enable faster response times, addi-tional privacy, and improved living areas for firefighters and additional space for ap-paratus and storage. SR Bales Construc-

tion is the general contractor and the station was designed by Burkhart Croft Architects. Station 3 upgrades are funded by an appropriation from the Alaska State Legislature, and supplemented with fund-ing from a municipal bond.

School SamplerThe Anchorage School District is seeing many changes this year to area-wide schools.

In East Anchorage, the Airport Heights Elementary School addition and remodel, spanning about sixty-five thousand square feet, began in May. The addition and remodel includes hazard-ous materials abatement, structural up-grades, new roof and upgraded exterior finishes, new mechanical and electrical systems, demolition of a portion of the ex-isting school, and the addition for a new kitchen, library, and music areas. Watter-son says peak employment will be at fifty workers for the $16.7 million contract.

Construction of the secured exterior con-struction area and upgrade to the technol-ogy lab at Begich Middle School began this month, according to the Anchorage School District. Cornerstone expects to complete this $527,000 contract in October.

A $1.9 million contract will see civil site upgrades at Wonder Park El-ementary in East Anchorage. General contractor Roger Hickel Contracting began the project in May, and will com-plete it three months later in August. Workers ranged between six to twelve workers during the life of the project, according to Roger Hickel Contracting.

The $678,000 contract to remodel and upgrade the exterior of Bayshore Elemen-tary in Anchorage will be completed by Roger Hickel Contracting. Designed by RIM Architects, the renovations will see twelve workers at peak construction. The Anchorage School District project began in May and is slated to be finished in August.

The new Rilke Schule German School of Arts and Science building, located on East 64th Avenue near Burlwood Street, had seen great progress since Criterion General began in February. In May foun-dation footings and slab on grade had been formed, poured, and stripped; steel erection began; and framing, mechanical, electrical, and plumbing had also proceed-ed. Pfeffer Development says the school is on schedule to open in September.

West High School and Romig Mid-


dle School are seeing improvements through a $15 million contract with Cornerstone General Contractors. The project will improve one classroom and add three additional classrooms to Romig Middle School and connect a twelve-classroom, two-story building to West High School. The Anchorage School District project began September 2014 and will be complete in December.

The Girdwood K-8 School addition and remodel began in May 2014. The $18.5 million contract awarded to Watterson Construction will cover about sixty-five thousand square feet. Work on the addi-tion is nearing completion with site work and the remodel of a portion of the exist-ing school scheduled this summer, and the project slated to be finished in August. Watterson says more than forty workers are currently employed to this project.

Outside AnchorageOutside of the Municipality of Anchor-age, projects totaling hundreds of mil-lions of dollars in new construction and improvements are occurring through-out the Southcentral region.

Highway improvements are happen-ing all along the Railbelt this year, but the Parks Highway will see major improve-ments this season. Parks Highway Re-construction Phase I, from milepost 43.5 to 44.5, between Lucus Road and Church Road in Wasilla, will see a $16 million improvement in lighting and pedestrian pathways. QAP Construction began in spring 2014 and will wrap up this year, according to ADOT&PF Central Region.

Parks Highway Reconstruction Phase II, from milepost 44.5 to 48.8, between Church Road and Pittman Road, will up-grade from a two lane road to a four lane divided highway with at-grade intersec-tions spaced every half mile. For this $40 million to $50 million project, existing frontage roads and pedestrian pathways will be improved, lighting will be installed, and a bridge over the Alaska Railroad will be installed. The project began in 2015, but ADOT&PF Central Region says it will see the bulk of the construction in 2016.

In Wasilla, Cornerstone General Contractors was awarded the contract to build the new Wasilla Public Library. The twenty-four-thousand-square-foot building will be located at the corner of Swanson Avenue and Crusey Street near Wasilla Middle School. Cornerstone be-

gan the $15 million project in April and the City of Wasilla expects the project to be complete in June 2016.

The Matanuska-Susitna Borough broke ground on Iditarod Elemen-tary and Dena’ina Elementary in May. Iditarod Elementary is a fifty-five-thousand-square-foot school that will replace an old building. The construc-tion site of the $25.2 million project is a quarter mile north of the existing school on Wasilla-Fishhook off the corner of Wasilla-Fishhook and Carpenter Circle. Architects are McCool Carlson Green and builders are Collins Construction.

Dena’ina Elementary is a forty-four-thousand-square-foot school on the cam-pus of the new Joe Redington Sr., Jr./Sr. High School. The site of the $26.5 million project is off Knik Goose Bay Road at mile 10. Architects are Bettisworth North Ar-chitects and builders are F-E Contracting.

Additionally, Joe Redington Sr., Jr./Sr. High School is set to be completed by August, and a thirty-three-thou-sand-square-foot addition to the Mat-Su Career and Technical High School is set to be completed by the fall, ac-cording to the Mat-Su Borough.

In Sutton, Chickaloon Village Tradi-tional Council broke ground on its new health and wellness building in April. The building’s name Ahtnahwt’aene’ Nay’dini’aa den means “Ahtna People Chickaloon Place.” Located at 21117 East Myers Avenue, the new facility will house the community health center and the council’s health department. The two-story, 8,100-square-foot building is designed to maximize energy efficien-cy. It is built with solar panels, a well-insulated structure, and heat recovery ventilators. Construction is slated for completion by December, according to Southcentral Foundation.

One of many projects on the Kenai Peninsula is the Homer City Dock Im-provement. It was awarded to Turnagain Marine Construction Corporation on February 3. This $1.22 million project managed by ADOT&PF will reconstruct the fender system and provide a covered pedestrian walkway for ferry passengers. ADOT&PF Southcoast Region says con-struction is anticipated in fall. R

Russ Slaten is an Associate Editor at Alaska Business Monthly.



Reaching Alaska’s Resources

Heavy construction projects within natural resource sectorsBy Kirsten Swann

Furie Operating Alaska began horizontal directional drilling from the onshore facility in Nikiski on the Kenai Peninsula this spring.

Alaska is a state built on natural resources, from oil and gas to mining, fish, and forests.

They provide tens of thousands of jobs and a multibillion-dollar economic impact. Natural resources are also the driving force behind most of the civil heavy construction projects taking place throughout the state this year.

Major construction on natural re-source developments is set to take place from the far north to Southcentral and beyond. The work involves dozens of companies large and small: home-grown Alaska firms and Lower 48-based corporations with worldwide reach—and nearly everything in between.

All told, the heavy construction work set to take place in Alaska’s natural resource sectors this year totals billions of dollars in project costs and progresses several long-awaited developments—particularly within Alaska’s oil and gas industry.

North SlopeOn the North Slope, construction is under-way at CD-5, an Alpine satellite field under

development by ConocoPhillips Alaska. The company says it plans on spending upwards of $1 billion to drill and develop the site and employed an estimated seven hundred people during peak construction.

In late March, the corporation also announced that it would be moving for-ward with construction at the Kuparuk viscous oil development 1H NEWS, the largest investment in viscous oil at Ku-paruk in more than ten years.

The work is expected to add approxi-mately eight thousand barrels of oil per day gross at peak production, and the project is expected to employ around 150 people during peak construction, according to ConocoPhillips.

The construction work includes add-ing a 9.3-acre extension to the existing Drill Site 1H and installing surface fa-cilities to support four new production and fifteen injection wells, according to the company, and construction is ex-pected to continue through 2016. First oil is anticipated in early 2017.

Construction work continues on new-build rigs Doyon 142 and Nabors

CDR3, according to the corporation, and Drill Site 2S is also on schedule and should have first production by the end of this year. Work is also moving for-ward at Greater Mooses Tooth 1.

But the North Slope is hardly the only big construction zone when it comes to major resource development projects: Plenty of work is set to take place in Cook Inlet this year, too. Hil-corp planned construction of a 2.8-acre gravel pad and access road within its Ninilchik unit to drill up to two gas exploration wells targeting areas un-reachable by a current pad, according to the Alaska Division of Oil and Gas.

Kenai PeninsulaFurie Operating Alaska LLC is also preparing to complete a few major con-struction milestones before beginning production from the Kitchen Lights Unit later this year.

The company’s unitized leases sit in the center of Cook Inlet off the north-western coast of the Kenai Peninsula, and Furie plans on installing a sixteen-

Courtesy of Furie Operating Alaska


mile subsea pipeline and monopod, in addition to its new onshore gas process-ing facility in Nikiski.

“It’ll be a busy year,” says Bruce Webb, Furie’s senior vice president.

Dependent on Cook Inlet ice and weather conditions, he says the construc-tion season kicked off in mid to late April.

The process begins with horizontal-directional drilling (HDD), which starts from the onshore facility in Nikiski and travels through the bluff and under the tidal flats, emerging on the seabed floor about three thousand feet away from the bluff. This way, Webb says, the company is able to drill underneath the AKORN fiber optic line and avoid dam-aging one of the main connections be-tween Alaska and the Lower 48.

The horizontal directional drill-ing builds on an eight-inch pilot hole drilled by Mears Group, Inc. last year.

Mears—part of a national network of companies that operate under the um-brella of Quanta Services, Inc., a Hous-ton-based Fortune 500 Company—is a leader in horizontal directional drilling. Its services span everything from oil and gas projects to electrical, water, and wastewater projects, according to the company, and its reputation has been built over many years of professional construction and engineering work.

“Changing regulations, safety, and quality standards and environmental concerns” are a consistent challenge when it comes to pipeline projects, according to Mears, so the company works with a team of in-house logistics and field personnel, steering technicians, engineers, and proj-ect managers. Its fleet of drilling rigs and support equipment is capable of complet-ing projects with a pipe diameter of up to sixty inches, with continuous lengths of more than eleven thousand feet.

For the Furie project, Webb says, the company will expand the pilot hole to twelve inches, then sixteen inches then, finally, twenty-four inches in diameter. Once the hole is complete, plans call for a sixteen-inch casing to house the de-velopment’s ten-inch pipeline.

Webb says the process involves mul-tiple passes and the help of the Spartan 151 jack-up rig, which drilled several exploration wells in the Kitchen Lights Unit in years past. This time around, the rig will be set up at the HDD’s off-shore exit point, and Webb says it will

As the trusted industry leader in scaffolding, insulation and coatings, we deliver cost-effective and highly efficient solutions for Alaska’s resource

development industries.

SMART safety practices, SMART planning methodologies, SMART process discipline and SMART technology advancements ensure safe, seamless

delivery and the lowest total installed cost - The Smart Waytm.

Safway.com (907) 349-3720

WE SET THE STANDARDS OF SAFETY.

AND WE’RE TAKING THEM TO NEW HEIGHTS.

1040 O’Malley RoadAnchorage, AK 99515

(888) 349-3133(907) 349-3333

AN

CH

OR

AG

E SAND AND GRAVEL CO

., INC

.

find us on Facebook

www.anchsand.com

Building Alaska’s Future with Alaskan Products

Building Alaska’s Future with Alaskan Products


be used to assist in the process by pull-ing from offshore while drilling activi-ties take place simultaneously onshore.

Using the jack-up rig makes the whole thing “a lot safer,” Webb says, and the process is estimated to take place over a fairly quick two- to four-week span.

The massive rig isn’t the only piece of heavy equipment used to put the unit into production, though. Furie’s se-nior vice president says the company is working with the MV Svenja, a 12,975-ton heavy-lift vessel owned by the Hamburg-based SAL Heavy Lift.

The massive ship is equipped with a Kongsberg Dynamic Positioning I System, which means it has the abil-ity to work in water of any depth and is completely self-propelled, according to SAL. The Svenja doesn’t require tug assistance and can rapidly respond to changes in weather conditions or op-erational requirements. There’s “no risk of mooring lines or anchors damaging seabed hardware,” according to SAL.

The vessel also boasts two cranes with a one thousand ton safe working load each. After Furie’s production monopod arrives by Crowley barge from Seattle, Webb says, the Svenja is tasked with lifting the monopod off the barge and placing it over the Kitchen Lights Unit #3 discovery well, drilled in 2013. The heavy-lift vessel is the project’s main construction component, he says.

“It was here last year for about two weeks, and then when we looked at the schedule we realized it was getting too close to winter and we might not be able to make it,” says Webb.

At that point the project was post-poned, he says, and Furie now expects to place the monopod sometime in ear-ly May, depending on ice and logistics. It’s a major milestone.

“Setting the platform is the most techni-cal aspect of the whole project,” Webb says.

To accomplish the feat, the heavy-lift vessel must remain perfectly still. Furie’s senior vice president says it will employ a twelve-point anchoring sys-tem to brace the boat against Cook In-let’s notorious tides and currents. Webb says the Svenja is also responsible for lifting the monopod’s support struc-ture, its main deck, and its helideck.

While installing the monopod may be the most technically challenging piece of the project, there’s another major com-

The Alaska Rubber Group is

proud to support the people and industries

whose’ pioneering spirit built

Alaska.

people and industries whose’ pioneering

spirit built Alaska.

Alas

ka S

tate

Lib

rary

Will

iam

Bar

quis

t Pho

togr

aph

Colle

ctio

n, P

164-

20

Alaska Rubber& RIGGING SUPPLY

Alaska Rubber Group

www.alaskarubber.com • Toll Free: 800-478-7600

Proud to be Employee Owned.

Member of:

Associated Wire Rope Fabricators

& RIGGING SUPPLY AK: ANCHORAGE • FAIRBANKS • KENAI • WASILLAWA: EVERETT • PASCO • SEATTLE • SPOKANE • TACOMA

SANDVIK EQUIPMENT — READY TO DIG ROCK, ROADS, PIPELINES, MINES & MORE!

Now Alaska Dealer for Sandvik Construction & Mining Equipment

1229 Richardson Hwy.Delta Junction, AK 99737

(907) 895-5053

deltaindustrial.com

3458 Truck St. Fairbanks, AK 99709

(907) 452-5053

DELTA RENTAL SERVICES, LLC


ponent: The sixteen-mile subsea pipeline running between the platform and the place where the HDD pipe emerges.

The long pipeline will be built from segments of pipe stashed at Point MacKenzie over the winter months, Webb says. Construction involves a special lay barge equipped with weld-ing stations, x-ray stations, pipe coating stations, and a tensioner, which keeps the pipe tight throughout the process.

Like the Svenja, the pipe lay barge also has its own anchoring arrangement. Un-like the Svenja, though, the lay barge is constantly moving, Webb says, so the an-chors must move along with it. The whole thing employs winches and a leap-frog anchor system to move smoothly through the water as the pipeline is assembled and installed beneath the surface.

Once the pipeline is complete at the location where the HDD line emerges, Webb says, the two pipelines will be joined together and eventually hook up to the onshore facility in Nikiski.

Next come the pressure tests, then commissioning—flowing gas through the pipeline and facilities to ensure everything operates smoothly and ac-

cording to plan. That all-important step is scheduled to take place in August or September, Webb says, putting the en-tire project on track to sell gas to mar-ket by September or October.

Besides the heavy equipment—the Svenja and the lay barge—the success of Furie’s Cook Inlet construction projects depends on an array of other resources.

Webb says his company is working with approximately fourteen engineers from around the globe, including engi-neers from Ireland, Canada, Norway, Ger-many, and Australia. There are engineers to oversee anchor handling and mooring and engineers to handle HDD operation: others focus specifically on the pipeline and installation aspects, while still other

engineers work on tying back the Kitchen Lights Unit #3 well as the first producer.

There are also a number of contrac-tors, besides Crowley, who’ve worked with Furie on the giant construction project, Webb says. For general con-struction services, the project turned to CONAM Construction Co.

A company with deep Alaska roots, CONAM began work in 1984 as an open shop contractor to Alaska’s oil patch. Like Mears, CONAM also operates un-der Quanta Services, Inc. after being purchased by the international corpo-ration in 2009. Headquartered in An-chorage, CONAM runs field offices and equipment yards in Deadhorse and Ke-nai, according to the company. Its shops

“We try to hire as many local businesses and entities as we can. It’s better for the state and better for the economy. The Kitchen Lights Unit development is the only development Furie has, so we’re an Alaskan company.”

—Bruce Webb Senior Vice President, Furie

Anywhere you need it. Any season of the year.

Our crews have decades of experience, and the skilled manpower to take on any task.

With our tundra-approved vehicles, we can get your drill rig and project materials to any remote location, and build ice pads and ice roads. And our range of logistics support – hauling fuel and freight – has been broadened with the addition of our new marine services division.

From start to finish, we are a partner who can deliver what you need.

Where the road ends…

Our Work Begins

tundra transport • rig moves • rig support • remote camps • ice roads • ice pads • well site trailer units • marine services

cruzconstruct.comMain Office (907) 746-3144North Slope (907) 659-2866


provide Ford Cummins and Peterbilt equipment repairs and warranty servic-es, and both the Kenai and Deadhorse locations maintain heavy duty equip-ment fleets for work on a number of large construction projects. Equipment includes cranes, loaders, sidebooms, ex-cavators, drill rigs, trenchers, welding trucks, tractors and trailers, and other support items, according to CONAM.

McLane Consulting, Inc. out of Sol-dotna provided land engineering for the Furie project’s well, septic system, roads, and pad.

Jacobs Engineering provided environ-mental permitting services prior to con-struction, Webb says—an invaluable ser-vice when considering the litany of permits required to construct an offshore structure in the middle of Cook Inlet. Michael L. Foster & Associates provided a third-party engineering review for the state fire mar-shal’s permit, according to Furie.

“We try to hire as many local business-es and entities as we can,” Webb says. “It’s better for the state and better for the economy. The Kitchen Lights Unit devel-opment is the only development Furie

has, so we’re an Alaskan company.”The monopod itself is a huge piece

of equipment manufactured in Corpus Christi. It’s a state-of-the-art design, Webb says, built with an emphasis on safety.

Everything is automated and capable of operating unmanned: The platform has a satellite with a direct microwave connection to the onshore facility, and the platform’s control panel is acces-sible from Nikiski, as well as offices in Houston or Anchorage. The platform’s helipad is outfitted with heat tracers to melt away snow and ice and allow for a helicopter to land in inclement winter conditions, Webb says.

Furie’s senior vice president says the company plans on having people work aboard the platform for the first few months of operation. Eventually they’ll scale back to part-time, working on the onshore facility and traveling out to the platform a couple times a week.

After it is up and running smoothly for the first year, Webb says, Furie may opt to let the platform go unmanned.

The most challenging part of the whole construction project is the seasonal na-ture of Cook Inlet, he says: “Dealing with Mother Nature and the ice and the high winds and the high seas.”

Point ThomsonAt the opposite end of the state, in equally unique conditions, ExxonMo-bil is moving forward with construc-tion at Point Thomson, which holds an estimated 8 trillion feet of natural gas and associated condensate.

Kim Jordan, the corporation’s Alaska public and government affairs coordi-nator, listed several construction mile-stones set to take place at the North Slope development this year.

They include installing and maintain-ing the ice road out to the development, located sixty miles east of Prudhoe Bay and sixty miles west of Kaktovik, mo-bilizing the drill rig and beginning to drill at the development’s Central Pad. The West Gathering Line and Central Pad’s piping and underground utilities will be installed, as well as the founda-tions for Point Thomson’s processing facilities. Truckable and sealift modules are also set to be installed this season, according to ExxonMobil.

“Key activities during winter 2015 are drilling and preparing for the installa-


tion of the large processing facilities in summer 2015. The total weight of the processing facilities is about ten thou-sand tons,” Jordan writes in an email. “Once the modules are in place, we will complete the hookup and commission-ing and be ready to produce through the West Pad Well in 2016.”

The initial production system is scheduled for startup in 2016, according to a statement released by Exxon in mid-March. It’s designed to produce up to ten thousand barrels of natural gas conden-sate daily, with two injection wells work-ing in tandem with a production well to cycle up to 200 million cubic feet of nat-ural gas through the onsite production facility every day. A twenty-two-mile pipeline will connect Point Thomson gas to the Trans Alaska Pipeline System.

Well over two thirds of the compa-nies contracted to work on the project are based in Alaska, according to Exx-onMobil, and eight hundred people work on-site to contribute to the suc-cess of the project.

Together, ExxonMobil and working interest owners have invested more than $2.6 billion in the development of

Point Thomson, according to the cor-poration, with about 70 percent of that total spent in Alaska.

Developing Point Thomson relies on the work done by a wide variety of companies. Approximately ninety-two companies are involved with the proj-ect, according to Jordan, including Wor-leyParsons, Fluor, PRL Logistics, Alu-tiiq, ASRC Energy Services, and Alaska Frontier Constructors, Inc. (AFC).

Active in Alaska’s natural resource sector since the 1970s, AFC has played a key part in development projects across multiple industries.

Experience in remote site and Arctic construction technology has helped the company build a reputation for complet-ing projects on time and within budget, and AFC’s services include everything from ice road, bridge, and dock construc-tion to heavy haul trucking, large scale earthwork, gravel quarry development, island construction, slope protection fab-rication and installation, and subsea pipe-line trench excavation and backfill.

“The AFC team has developed and perfected numerous innovative off-shore construction techniques in sup-

port of the oil and gas industry and has been instrumental in the construction of many Alaskan and Russian mines,” the company writes.

Projects have included heavy civil construction work at the Oooguruk, Nikaitchuq, and Liberty fields, accord-ing to AFC: Now, that portfolio will en-compass Point Thomson, too.

According to the 2015 “Alaska’s Con-struction Spending Forecast: Annual Report for the Construction Industry Progress Fund and the Associated Gen-eral Contractors of Alaska” written by Scott Goldsmith and Pamela Cravez of the Institute of Social and Economic Research, University of Alaska Anchor-age, oil and gas development make up the vast bulk of civil construction proj-ect spending within the state’s natural resource sectors. At an estimated $3.8 billion, no other industry comes close.

By comparison, construction at Alas-ka’s mines is expected to total around $210 million this year. R

Kirsten Swann is a freelance journalist based in Anchorage.

➲ 16' x 20' packages with expandable options

➲ Flexible designs and various finishes

VISIT SPENARD BUILDERS SUPPLY TODAY! ALASKA'S CHOICE FOR BUILDING MATERIALS AND HOME IMPROVEMENTS. FOR A LOCATION NEAR YOU, LOG ONTO WWW.SBSALASKA.COM.

*Offers of financing for qualified consumers only, subject to credit approval. Please see Terms & Conditions for program specific disclosures.

12 MONTHS NO INTEREST. NO PAYMENTS.

Now at SBS!

BUILD IT in aWEEKEND

Easy to Ship, Easy to Build

RECREATIONAL CABIN



Partners in Safety Include OSHA and Insurance Agents

According to the Bureau of Labor Statistics, 12 people will die as a result of occupationally related

injuries at work today. Another estimat-ed 137 people will die as a result of oc-cupationally induced illnesses including cancers and respiratory diseases on this same day. This latter number, derived from inferential metrics, is the best esti-mate produced in collaboration with the National Institutes of Health and is prob-ably underestimated; there is no con-sistent method to count these fatalities because it is difficult to provide a causal relationship after, in many cases, a pro-foundly long time between exposure, in-cubation, and the outcome of illness.

The good news is that occupationally related fatality rates have been declin-ing in the United States for decades now. According to the US Department of La-bor, in 1970, we could expect 38 worker deaths per day compared to the 12 we have now. The rates of worker injury and illnesses are also down from 10.9 inci-dents per 100 workers in 1972 compared to 3.4 per 100 workers in 2011.

Today’s US workforce is healthier, more informed, and arguably safer than any other time in US history. However, the rapid development of technology often times outpaces business’s ability to “keep up” with the times and plan for the safety of the workforce. Public health agencies, scientists, and sheer experience continue to refine what is known about chemicals and occupa-tional exposures in the environment, further refining protective methods and procedures designed to protect the workforce. The changing exposure lim-its, new OSHA regulation, and indus-try standards are almost too much for the business owner to keep up with at times, and that sentiment is heard of-

ten and loudly. The good news is, no one has to go it alone. The bad news is that the necessary partners in this endeavor may be the very people businesses are hesitant to deal with, OSHA (Occupa-tional Safety and Health Administra-tion) and insurance agents.

OSHAOSHA is the federal agency tasked in the enforcement of the federal regula-tions affectionately known as 29 CFR 1910 (General Industry) and 1926 (Con-struction). This modest federal agency had a budget of a little over $535 million in 2013 and 2,200 inspectors, according to OSHA’s website. While OSHA regu-lations are “the law of the land,” and OSHA is charged with the enforcement of these safety regulations, the federal agency does have the ability to grant this authority to states. Alaska is one of the states that has taken on this re-sponsibility. In order for states to spon-sor their own programs, they must be at least as effective as the federal plans and have regulations that are at least as prudent as the federal regulations.

Alaska’s OSHA (AKOSH) plan was initially approved on July 31, 1973, with subsequent and final approval on September 26, 1984. According to the Alaska State Plan webpage, AKOSH has incorporated the federal OSHA regu-lations by reference and are therefore identical with the following exceptions: Alaska has adopted some specific lan-guage dealing with petroleum refin-ing and drilling production as well as providing specific long shoring details. However, the AKOSH does more than just administer to the regulations; they provide services in both the enforce-ment of regulations and the in the pre-vention of occupational injuries.

There are two divisions within the AKOSH system. According to Krystyna Markiewicz, chief of Consultation and Training for AKOSH, “the Enforce-ment Division [is] responsible for the field audits, compliance audits, and incident investigations in the field.” She continues, “the Consultation and Training Division offers no cost train-ing and consultative services to small to medium sized Alaskan businesses, especially targeting high hazard indus-tries.” The Consultation and Training Division acts on between three hun-dred and four hundred consultations with Alaska businesses each year and provides training to approximately two thousand personnel through their pro-grams. There are approximately eleven enforcement officers in the state com-prising five industrial hygienists and six safety specialists. The Consultation and Training Division has eleven con-sultants and one trainer who travel to businesses upon notification in order to identify and assist in the implementa-tion of an OSHA compliant safety and health program.

In order to engage the AKOSH con-sultant services, companies must fill out a Consultation and Training Servic-es request form. When filling out this document, there are options to choose from including full site/program as-sessments and limited assessments that may focus on specific subjects like fall protection. Other services provided by the AKOSH Consultation and Training Division include program authorship using “safety writer” software; indus-trial hygiene monitoring; training in-cluding OSHA specific courses (e.g., 10 hour construction); industry specific training (e.g., seafood); and audits and walkthroughs.

By Brian McKay


Interestingly enough, when a compa-ny is engaging the services of the Con-sultation and Training Division, they are exempt from scheduled inspec-tions from the Enforcement division, home of the “OSHA Inspector.” The two divisions are separate entities under the same roof, and they share a com-mon mission: “to work in partnership with Alaskan employers and workers towards the elimination of workplace injuries, illnesses, and deaths and to as-sist employers in complying with state and federal regulations relating to oc-cupational safety and health,” accord-ing to the AKOSH Strategic Plan for 2014-2018. However, they do not share information about their activities. It’s kind of like the old saying, “what hap-pens in Vegas, stays in Vegas,” although in this case, what happens in Consulta-tion and Training, stays in Consulta-tion and Training.

The important thing is that if a com-pany is struggling with their expecta-tions or delivery of a safe working envi-ronment for their employees, they have a partner in the OSHA regulating office that can help them come up to compli-ance. They will not be penalized during the consultation and training process, but they don’t necessarily get a free ride either. There is an expectation that cor-rective measures will be adopted within that company during the consultation process and that any life threatening is-sues are corrected immediately.

Alaska NIOSHThe National Institute of Occupational Safety and Health (NIOSH) has a pres-ence in Alaska through the Western States Division-Alaska, formerly known as the Alaska Pacific Office. Under the direction of Dr. Jennifer Lincoln, this of-fice is responsible for addressing the high rates of occupational injury and fatal-ity in Alaska. NIOSH facilitates focused research programs and a collaborative effort between industry, government, and other safety interest groups. These collaborative efforts have led to industry wide improvements including increased effectiveness—and use—of personal floatation devices for fisherman and the deployment of target industry campaigns designed to subtly influence the adoption of important safety and health initiatives. One of the most successful campaigns


targets the commercial fishing indus-try and is called “Live to be Salty.” This multimedia campaign introduces Angus Iverson, a salty sea dog with a fast wit and short temper when it comes to shortcuts in safety and health on the job.

NIOSH has also had a strong pres-ence in aviation safety and “continues to develop successful interventions while working with the aviation industry and governmental agencies,” according to Mary O’Connor with the Aviation Safe-ty Program. “NIOSH has worked with industry to develop interventions in he-licopter logging in the 1990s and we are currently working on a pilot fatigue pre-vention training tool. We are commit-ted to making improvements in aviation safety in Alaska,” O’Connor says.

The “Live to be Salty” campaign (live-tobesalty.org) and other collaborative efforts between business and industry are making a difference in Alaska. Since the opening of the Alaska NIOSH office in 1991, there has been a 63 percent decrease in occupational fatalities in Alaska. NIOSH, of course, cannot take all the credit for this dramatic decrease, but their role in the collaboration and bringing the message home to industry cannot be underestimated either.

Business and industry’s role in this partnership can be enhanced through collaborative research and other oppor-tunities.

Take a look at the NIOSH website (cdc.gov/niosh/contact/im-alaska.html) and get involved in the discus-sion. The people at NIOSH would love to hear about problems in the field, questions about their work, and any other occupationally related questions. The website is full of information and resources including research and in-jury prevention interventions, so check them out—use the some of the most cutting edge and successful safety in-terventions available and “be salty.”

Workers’ CompCompanies have a wide range of insur-ance needs depending on what they own and what services they offer. One specif-ic type of insurance that every company with employees must have is workers’ compensation (workers’ comp). De-pending on the industry and number of employees, workers’ comp insurance is often a very large annual expense that

is begrudgingly paid as a “cost of do-ing business.” But the comprehensive service doesn’t necessarily have to end when the check is cashed; many work-ers’ comp insurers provide additional services to their customers in the form of loss control. After all, it is in their best interest to keep injury rates down just as much as it is in the best interest of the company and the employees.

Typical loss control programs may offer a wide range of services focused on workplace injury and illness pre-vention. It is almost always much more expensive to treat an injury or illness than it is to prevent those injuries or illnesses. Some of the resources a loss control department might bring to bear in helping a business include:

Hazard assessment: A “cold eyes” review from a loss control expert is an option. They can walk through the workplace and help identify issues that may be “lost in the background” or which need follow up. If there appears to be an opportunity for improvement, recommendations are made to the company.

Industrial hygiene surveys: This may include evaluating exposures such as noise, welding fume, dust (total and respirable), ergonomic, vibration, and chemical exposures.

Training: Various trainings can be offered that might include OSHA 10-Hour courses or smaller more specific topics provided during a tailgate meeting. There are typically online resources such as PowerPoint presentations, videos, and articles that may be downloaded.

On-going consultative services: Depending on a variety of factors, a Loss Control consultant may establish a relationship with the insured company to establish a long term plan for injury prevention program improvement.

Safety management audits: Beyond identifying specific hazards and controls, a safety management audit evaluates the process by which a safety program is managed. When completed, a report is generated to the insured company outlining opportunities for improvement.

Accident investigation: Investigating why an injury or illness occurred and

identifying the root cause is critical in preventing future injuries of the same type. This goes well beyond simply blaming the injured employee for “not paying attention.”

Loss analysis: An in-depth analysis of past injuries can identify trends and help focus injury prevention efforts.

The services listed above are not all-inclusive and may vary from carrier to carrier. The least expensive policies probably offer limited additional servic-es while the more expensive (i.e., expan-sive) policies will offer more complete health and safety packages. It is impor-tant that each company with a workers’ comp policy understand what services are available to them and to use those services to their fullest advantage.

ConclusionOccupational injury, illness, and fatal-ity continue to be a burden on modern society. Monumental effort has gone into the development of a suite of in-jury intervention methods used both in the field and at the desk. Despite these efforts, people continue to get hurt at work. New methods for injury control are constantly being developed and tried in the field. These efforts are not always easily accessible to the small business owner or small manufacturing plant. That is why it is important to le-verage the existing resources out there: the people who develop, analyze, and study risk and occupational health on a daily basis. These people can be found at the federal level through OSHA and NIOSH and can even be as close as your insurance agent. R

Brian McKay has a post graduate degree in Public Health and is a Certified Safety Professional (CSP) and Certified

Industrial Hygienist (CIH). McKay is the Director of Quality, Health, Safety, and the Environment for Fairweather, LLC. Contact him at 907-270-6804 or [email protected].

– P A I D A D V E R T I S E M E N T –

Design that reflects Alaska’s unique Design that reflects Alaska’s unique Design that reflects Alaska’s unique environment and peopleenvironment and peopleenvironment and people

For Bettisworth North, respond-ing to Alaska’s diversity is cen-tral to good design. Bettisworth

North provides architecture, planning, landscape architecture, interior design, and energy services statewide. With of-�ces in Anchorage and Fairbanks, this 36-person design �rm’s mission is to be community builders for Alaska.

Focused on each community’s dis-tinct environmental features, Bettis-worth North helps clients e�ectively use landscape architecture to enhance the functionality and appearance of architecture, streets, parks, and trails. �e �rm also uses site planning to cre-ate exterior spaces that people can enjoy year-round. Bettisworth North careful-ly considers Arctic design and seasonal issues like winter city design, snow stor-age and clearing, way�nding, stormwa-ter drainage, and vehicular and pedes-trian circulation.

�e �rm also uses green infrastruc-ture such as native plants and other natural elements to enhance the land-scape and provide onsite stormwa-ter management. “We are passionate about our work and �nd satisfaction in projects that use green infrastructure, native plants, and creativity—while we meet the client’s vision and budget,” says Principal and Senior Landscape Architect Mark Kimerer.

Incorporating Landscape into Building Design

To integrate landscape architecture into the building design process, clients should include landscape architects as early as possible to help cultivate and solidify their vision. “We work with our architects to extend the function and aesthetics of a building’s interior into the site and landscape,” Kimerer says.

Bettisworth North also gives close consideration to building and site op-erations and maintenance. “We start by asking questions about the initial

cost versus the long-term maintenance costs,” says Marketing Director Leah Boltz. “We help clients invest, set goals, and design on the front end to maxi-mize the program and save on opera-tions and maintenance costs over the life of the facility.”

Communication is essential to meeting clients’ goals. Bettisworth North’s landscape architects ask a lot of questions and conduct a lot of re-search, starting with a site analysis. �ey use 3D and 4D modeling to ex-amine solar orientation, predominant wind direction, time, plant commu-nities, soil types, access, views, and adjacent structures—which in�uence building placement and performance. “It creates a basis for conversation with the owner and the rest of the de-sign team,” Kimerer says. “It helps the design team create opportunities and constraints for the project overall.”

Integrative Approach to Design Bettisworth North maintains a collab-orative design process that results in highly functional, regional- and culture-speci�c solutions. A prime example is the Chief Andrew Isaac Health Center in Fairbanks. It features south-facing

walls to optimize natural light, a visual connection to open landscape areas, and native plants. “It was a very integrated design,” Boltz says. “�e building seems like it has grown up out of the land.”

�e project earned a 2013 Healthcare Design Magazine silver award for land-scape architecture and LEED Gold cer-ti�cation, among other accolades.

Bettisworth North also designs vari-ous commercial, academic, civic, and in-dustrial projects, including schools, visi-tor centers, housing, healthcare facilities, o�ce buildings, sports facilities, and street reconstruction and improvement. �e company’s expertise also encom-passes way�nding signage, trail and outdoor recreation design, and inclu-sive playground design. Regardless of the project scope, Bettisworth North is committed to designing solutions that are appropriate and responsive to Alas-ka’s unique and diverse environments.

Roy Rountree, President2600 Denali St., Ste. 710 Anchorage, Alaska 99503907-561-5780bettisworthnorth.com

Pbusiness

rofileBettisworth North

Kevi

n Sm

ith P

hoto

grap

hy



Trusses on the Tundra

It’s cold and windy outside, a typical March day in Bethel, Alaska. The snowpack is thin on the windswept

tundra. But it’s warm and cozy inside two new homes on Chief Eddie Hoff-man Highway, heated only by construc-tion lights. The Association of Village Council Presidents (AVCP) is building the super-efficient duplexes to house stu-dents for its popular aviation school. The homes are made from integrated trusses that connect the roof, walls and floor joists into single units that are tipped up like the ribs of a whale, a clean, simple design for the extremes of the tundra.

Cold Climate Housing Research Center-designed energy-efficient Bethel duplexes under construction earlier this year in February.

Left: Integrated trusses before enclosure at the Bethel duplexes. Above: Integrated truss system can be sized to needs.C

ourt

esy

of C

CH

RC

Courtesy of CCHRC

Courtesy of CCHRC

By Molly Rettig, Cold Climate Housing Research Center

Sustainable Housing Technologies in Southwest Alaska


Yuut Yaqungviat, Yup’ik for “Where people get their wings,” trains local pi-lots for the region, which has the third busiest airport in Alaska. Single-engine turboprops, small bush planes, and cargo aircraft connect dozens of remote villages to just a couple of urban hubs. Air travel is a way of life on the Yukon Kuskokwim River Delta, where forty-eight small villages are spread across an area the size of Oregon with no roads and few centralized services.

Southwest Alaska has been occupied by Yup’ik Eskimo for thousands of years, yet communities have struggled to adapt as the region has rapidly modernized over the past fifty years, shifting from a sub-sistence lifestyle to a cash economy, from seasonal shelters to modern housing and energy. “The Yukon Kuskokwim region has the lowest per capita income, the high-est unemployment, the highest suicide rate. We don’t have tourism. We don’t have

oil. We don’t have forestry. We have a rich culture,” says Mike Hoffman, executive vice president for AVCP, a nonprofit tribal organization in Bethel. It was a blow to the region when high operating costs forced the aviation school to close last year. Stu-dents couldn’t afford to spend $1,000 a month on energy on top of tuition.

AVCP hired the Cold Climate Housing Research Center (CCHRC) to design new energy-efficient duplexes for students to help the school reduce its energy bur-den and re-open its doors. CCHRC is a research center based in Fairbanks that develops and tests sustainable housing solutions for the north.

Bethel is one of the most challeng-ing places to build in Alaska. Sitting in one of the largest deltas in the world, where the Yukon and Kuskokwim rivers empty into the Bering Sea, it is a treeless tundra exposed to wind-driven rain and coastal storms. The soil is constantly

shifting, with a high water table and a deep active layer that freezes in the win-ter and turns to mush in the summer.

Most housing in the region was im-ported from the Lower 48 and has succumbed to moisture, mold, and structural damage over the past few decades. Many are now rotting from the inside out. The average household in Bethel spends $6,500 a year on ener-gy, more than three times the national average, thanks to leaky housing and imported heating oil that runs $6.50 a gallon. Nearly half the homes in the region are overcrowded, with three or more generations often packed into three-bedroom homes.

CCHRC designers worked with AVCP and the community to come up with a

Bethel duplex designed for aviation school.

Cou

rtes

y of

CC

HRC

Ice fishing on the Kuskokwim is a tradition dating back thousands of

years for area residents.Courtesy of AVCP

See the interactive annual report and find more info about the integrated truss and other

cold climate innovations at cchrc.org. Videos available at https://www.youtube.com/user/ColdClimateHousing


design that fit the climate and culture of the region. The prefabricated trusses are built in a factory and shipped in full house-shaped pieces. The units are set and braced two feet apart in a straight line for the full length of the home.

There are several benefits of this de-sign. First, the truss system is easy to build, even for an unskilled crew—five of the six workers in Bethel had no car-pentry experience. The prebuilt trusses can be assembled in a single day, rather than a week it would take to stick-frame a home. This saves precious time during the short building season of Alaska and allows crews to get out of the elements quickly. A faster build means lower cost,

Moisture damage

Cou

rtes

y of

CC

HRC

Courtesy of CCHRC

Yukon-Kuskokwim region�


Alaska'sTrenchless TechnologyEngineering Specialists- Cured In Place PipeLining- Horizontal DirectionalDrilling- Pipe Inspection- Sliplining

www.stephlengineering.com

Juneau Airport Slipline

Integrated trusses being raised by construction workers in Atmautluak without heavy equipment.

Cou

rtes

y of

CC

HRC

freeing up money for additional housing. The truss system also lends itself to

super-efficient construction, as the depth of the walls, roof, and floors can be scaled to accommodate more insulation. The Bethel homes are filled with nine inches of polyurethane spray foam for an R-val-ue of approximately 50, more than twice a conventional 2x6 framed wall. In addi-tion, each piece of the truss is comprised of an inner and outer chord with webbing in between, which largely cuts down on conductive heat loss. The trusses can be assembled without heavy equipment, which is scarce in the Bush. “The com-ponents are light, and the trusses can be tipped up by four men,” says Jack Hébert, CEO of the research center.

Because spray foam is vapor imper-meable, this design solves the moisture problems that are endemic to the Bethel region, preventing interior vapor from leaking into the walls and condensing on cold surfaces.

The integrated truss design is part of a larger effort to build a local construc-


Molly Rettig is a freelance writer and communications director at the Cold Climate Housing Research Center in Fairbanks.

tion industry in Bethel, developing a lumber mill upriver and a truss plant in Bethel. Lumber would be sent down the Kuskokwim by barge in the summer and ice roads in the winter, keeping jobs and money in the region. “We’re looking at producing a million board feet of white spruce on the Kuskokwim, so we can build and manufacture our own trusses,” Hoffman says.

Nearly four thousand new homes are needed in the Bethel region alone to alleviate overcrowding and replace ag-ing buildings. The integrated truss de-sign is just one of a suite of approaches that addresses the need for affordable housing in rural Alaska. In the Yukon Kuskokwim Delta, AVCP and its part-ners are using technology and local knowledge to make housing work for the people. R

A white spruce lumber mill upriver from Bethel.

Courtesy of AVCP


Business-Class Hotels in AlaskaAlaska is well known as a world-

class travel destination. The state’s natural beauty and out-

door adventures draw tens of thousands of visitors every year, and tourism is a major economic driver for communi-ties across the state.

But it’s not all for tourists. For those traveling on business, Alaska offers a wide variety of accommodations and amenities that continue to blur the lines between work and play.

There are rooms that reflect the state’s frontier spirit and meeting facili-ties on par with anything that might be found in the Lower 48. Business travel-ers can find everything from upgraded

sound systems in renovated conference halls to hotels that offer Alaska Airlines miles with every stay.

Southeast SuitesIn Juneau, Aspen Suites Hotel Gen-eral Manager Stephanie Weitman says guests are rewarded with 250 airline miles for every visit: a nice perk for fre-quent flyers whose business keeps them on the move.

Less than five years old, Juneau’s As-pen Suites is one of the newest hotels in town and offers a twenty-four-hour fit-ness center, laundry facilities, and free Wi-Fi. Weitman says every room comes with a kitchenette—complete with a two-burner cook top—a large sized table, and a forty-inch flat-screen television.

For business trips lasting more than just a day or two, the hotel’s home-like ac-commodations are especially convenient.

The Juneau Aspen Suites also boasts meeting space that fits up to seventy people and a board room that can fit ten people—complimentary for groups and “used quite a bit,” Weitman says.

But picking a place to stay often in-volves considerations besides just room size, price, or internet speeds. For many guests, safety is also a priority.

At the Juneau Aspen Suites, the building is locked and inaccessible to non-guests between midnight and 6 a.m., according to the hotel’s manager. There are no late checkouts, she says, and that provides the hotel with an ad-ditional level of safety.

VISITOR INDUSTRY

Comfort, convenience, and unbeatable views

By Kirsten Swann

The Anchorage Sheraton has nearly twenty-five thousand square feet of meeting space.

Courtesy of Anchorage Sheraton


“One of the things I like about our property is how secure it is,” Weitman says. “It’s the most secure facility I’ve worked in, just because we’ve set those standards.”

She says the hotel chain plans on opening a fifth Alaska location in Haines this summer. Its other hotels are found in Kenai, Soldotna, and An-chorage.

Anchorage AccommodationsThe largest city in Alaska, Anchorage has no shortage of accommodations for people traveling on business, whether that involves a short commute and an overnight stay or an exhausting flight and many days at a hotel.

Business travelers can find accommo-dations throughout the municipality, but hotels are primarily concentrated in midtown and downtown. They offer close proximities to Anchorage’s main commercial centers, quick drives to Ted Stevens Anchorage International Air-port, and a wide variety of restaurant options and leisure opportunities—be-cause business travel doesn’t have to be all work and no play.

A few Anchorage hotel options stand out from the crowd.

When it comes to business, the An-chorage Sheraton has one major ad-vantage: nearly twenty-five thousand square feet of meeting space.

“Outside the Dena’ina and Egan Cen-ter, I’ve got more meeting space than any other place in the state,” says Mi-chael Jesperson, the hotel’s assistant di-rector of sales and marketing.

Most of that meeting space can be found on the hotel’s second floor, with some boardrooms and other facilities on the third floor. The Howard Rock ballroom can fit more than 650 people for a banquet function, Jesperson says.

The space means the hotel can handle almost any type of meeting, he says. It currently hosts several convention-type events every year, where an organiza-tion uses all of the hotel’s meeting space and then rents the meeting space room to its own vendors.

All of the Sheraton’s meeting spaces were renovated in 2011 and 2012, end-ing with the Ptarmigan Bar on the first floor. Jesperson says all of the beds and chairs in the hotel’s 370 guest rooms

were replaced in December 2014. The Summit Room, another meeting space located on the hotel’s 15th floor, is scheduled for another renovation fol-lowing this year’s spring meeting sea-son, he says.

The Sheraton has a full service spa, The Ice Spa, located at the very top of the building on the 16th floor. The hotel also boasts a world-class fitness facility, with sweeping panoramic views over downtown Anchorage. Mount Susitna sits in the distance, giving visitors the perfect place to unwind on a treadmill

Juneau’s Aspen Suites Hotel meeting rooms are busy with business travelers.

Courtesy of Aspen Suites Hotel

UAA professors are smart. It’s obvious in the classroom and the lab. But their knowledge and savvy is evident when it comes to planning meetings too.

Four UAA professors have combined to bring half a dozen meetings to Anchorage:

• Emergence in Chemical Systems Conference (4 consecutive years)

• IEEE Nanotechnology Materials and Devices Conference

• International Society for the Study of the Origin of Life and Astrobiology Society

Leaders in their fields and champions in Anchorage, we give them high marks for their hard work.

CONGRATULATIONS TO DR. JERZY MASELKO, PROFESSORS SAIF ZAHIR, ADRIANO CALVACANTI AND MARTIN CENEK, VISIT ANCHORAGE MEETING CHAMPIONS!

ARE YOU A MEMBER OF AN ASSOCIATION? CONTACT VISIT ANCHORAGE TO BRING YOUR GROUP TO TOWN: [email protected] | 907.257.2349

MEETINGS PAY IN ANCHORAGE

Combined estimated economic impact of all six meetings:

$1,672,239


and watch the sunset after a day full of meetings. The view is so picturesque, the facility has been ranked by CNN as one of the top ten hotel fitness center views on earth.

“The first time they did it, we didn’t even know they’d been here,” Jesperson says. “If you go up to our workout facil-ity on the 15th floor and look out, you’re looking out over the city and Cook In-let. It doesn’t get a whole lot better than that.”

The location offers other perks, too. While the hotel sits well within the boundaries of Downtown Anchorage, it’s a few blocks removed from the hus-tle and bustle of the main town center. Guests can reach the Egan Center or the Dena’ina Center within fifteen minutes or the Fifth Avenue Mall within ten minutes, but they won’t be awakened by noisy traffic or nightlife late in the evening.

Another perk for business travelers with rental cars—the Sheraton has over 570 parking spaces, more than any oth-er downtown Anchorage hotel.

If travelers are looking for a room outside the main city center, but still just minutes away from the city’s main commercial districts, one choice in par-ticular combines historic Alaska charm with modern amenities in a one-of-a-kind location.

The Millennium Alaska Hotel, locat-ed just a stone’s throw from Ted Stevens Anchorage International Airport on the shore of scenic Lake Hood, is another choice for business travelers looking for convenience combined with Alaska flair. While it’s one of the city’s older hotels, it recently invested hundreds of thousands of dollars renovating its guest rooms and conference center.

From queen size beds in every guest room to the hotel’s distinctive lodge-like atmosphere, the Millennium is un-like other Anchorage hotels.

The hotel’s three meeting rooms can fit anywhere from 25 to 280 people, ac-cording to General Manager Carol Fra-ser, and the newly renovated Spenard Conference Room was outfitted with a state-of-the-art audio/visual system. The entire renovation project took three months and $750,000, Fraser says.

For those looking for a less traditional meeting locale, the hotel is also home to a restaurant and bar with up-close-and-


personal views of the largest sea plane base in the state. Live entertainment ev-ery night of the week and “some of the coldest Alaskan Amber in Anchorage” helps tired business travelers relax after a long day of work, the hotel’s general manager says.

“The Millennium is the most unique hotel in Anchorage,” Fraser says. “The location is great for business travelers who need to be close to the airport or even those who have to zip to the Kenai Peninsula.”

Other DestinationsIf the Kenai is your destination of choice there are plenty of business-class hotel choices there, too.

The Kenai Airport Hotel—named for its close proximity to the city’s air travel hub—offers everything from a fully stocked business center to early check-in and late check-out to accom-modate different schedules. At the Ke-nai Quality Inn, also centrally located in the heart of town, business guests can take advantage of two meeting rooms that can accommodate as many as 250 people.

Traveling north to the Golden Heart City? Fairbanks is home to a wide vari-ety of accommodations for Alaska busi-ness travelers.

The Fairbanks Princess Riverside Lodge sits on the banks of the scenic Chena River and puts a premium on connectivity: Guests can access high-speed wireless internet anywhere on the property, allowing business travel-ers to work online from the comfort of their rooms, the riverside deck, or the hotel’s numerous meeting rooms.

Three full-service meeting rooms are capable of hosting group meetings or events, according to the hotel, and oth-er transformable spaces offer amenities ranging from a fireplace and food-ser-vice area to a built-in media center.

An overhead projector, slide projec-tor, podium and microphone, amplifier, LCD projector, wireless microphone, and risers are also available, according to the hotel.

Just down the river, Pike’s Waterfront Lodge features similar river views and a suite of services to suit any business needs.

Several different meeting spaces can accommodate everything from small

board meetings with a dozen or so at-tendees to large gatherings of one hun-dred people or more. The hotel rents audio visual equipment along with its meeting rooms, and guests have ac-cess to in-room phones and projectors, among other basic items.

Even farther north, the recently re-built Top of the World Hotel is Barrow’s largest and newest place to stay.

It offers two room types as well as ADA-accessible accommodations and four different event spaces—the largest of which can fit up to forty-three oc-cupants, according to the hotel. Audio visual equipment, catering options, and wireless internet round out the hotel’s offerings.

One thing’s for certain: From the Southeast to the North Slope, while traveling Alaska on business, there are plenty of places to find a warm, com-fortable bed, Wi-Fi, a conference room, and a killer view. R

Kirsten Swann is a freelance journalist based in Anchorage.

Be inspired by the light of the Aurora Borealis. Renew your energy under the Midnight Sun. Experience the warmth of Fairbanks—Alaska’s Golden Heart—and the gateway to Denali, Interior and Arctic Alaska. Call 1-877-551-1728 x3765 for your free Meeting Planner Guide.Explore your Alaskan meeting opportunities at meetfairbanks.com.

McDowell GroupSusan Bell re-joined McDowell Group following five years with the State of Alaska as Commissioner of the Department of Commerce, Community, and Economic Development. Bell previously worked with the Alaska-based research and con-sulting firm.

First National Bank Alaska

First National Bank Alaska and its Board of Directors announced a variety of promotions and appoint-ments.

Doug Longacre will lead the bank’s com-mercial lending opera-tions after being named Executive Vice President. Longacre has forty years’ banking experience and has successfully worked in every aspect of lending in the bank.

Vice President Karl Heinz was named the Regional Branch Manager in charge of the Glennallen, Kenai, Kodiak, and Valdez branches and will work out of the Kenai Branch. Heinz previously managed branches in Glennallen, Haines, and Eagle River.

First National hired Loan Officer Jason Feeken and appointed him Assistant Vice President. With more than ten years of experience in Alaska’s financial industry, Feeken will work out of Anchorage’s Corporate Headquarters.

Jennifer Matthews moved from the Wasilla Branch after being promoted to Cash Management Services Specialist in Anchorage. Matthews will work with customers to formulate the best solu-tions to meet their business banking needs.

Diane McKee is the new Parkway Branch Manager after the board promoted her to take charge of the East Anchorage branch. McKee has worked in banking for more than seventeen years, including the last five in Deposit Services.

StantecJack DiMarchi, CPG, joined Stantec as its Alaska mining Sector Leader based in Fairbanks. With more than twenty-five years of industry expe-rience, DiMarchi will develop Alaska-specific mining opportunities, while expanding the firm’s regional and North American wide capabilities. He is a Colorado State University graduate.

Northrim Bank

Northrim Bank announced the hiring of Bradley Leathers, Branch Manager for Northrim’s Sitka Branch, and the promotion of Leary David, Branch Manager for the bank’s Huffman Branch.

Leathers began his banking career in 2007 with Wells Fargo in Ketchikan as Assistant to the District President and was most recently Branch Manager for Wells Fargo in Skagway. Leathers has a bachelor’s

degree in economics from Vanderbilt University.David has worked at Northrim Bank since

2006, where he started as a Teller at the Midtown Financial Center. He has been a Personal Banker, Branch Specialist, Branch Supervisor, and Assistant Manager during his time at Northrim. David holds a degree in Marketing Management from San Beda College, Philippines.

Ahtna, Inc.David O’Donnell joined the Ahtna team as President of Ahtna Construction & Primary Products Corporation, or AC&PPC, based out of the Ahtna Anchorage office. He brings to Ahtna twenty-five years of experience in in various types of heavy and civil construction. O’Donnell was Vice President and General Manager over civil construction for the Bristol Alliance of Companies for the last ten years.

R&M Consultants, Inc.

R&M is pleased to announce the addition of Chris Black, PE, and Jenna Germer to its Anchorage office team.

Black joined R&M’s Engineering Department as a Project Engineer and brings more than twenty-two years of construction and civil engineering experience to the firm. Black has a BS in Civil Engineering from the University of Alaska Anchorage.

Germer joined R&M’s Environmental Group as an Environmental Specialist and previously worked as a Geologist Technician on the North Slope. Germer has a BS in Geology from the University of Alaska Anchorage.

International Tower Hill MinesInternational Tower Hill Mines appointed Karl L. Hanneman as Chief Operating Officer. He’s been

RIGHT MOVES Compiled by Russ Slaten


Germer

David

DiMarchi

Heinz

Matthews

McKee

Black

Leathers

Longacre

Feeken

OHMY!

with the company five years and assembled the Alaska team and served as the Livengood Gold Project Manager. Hanneman has more than thirty years’ Alaska-based mining industry experience, including with the Red Dog and Pogo mines.

Davis Wright Tremaine LLPPatr ic ia Ve cera , an e x p e r i e n ce d l a b o r/employment lawyer, joined the Anchorage office of Davis Wright Tremaine LLP as Counsel. She joins Davis Wright Tremaine after spending f i f teen years at the Anchorage-based firm of Turner & Mede, P.C. Vecera earned her BS from Chapman College and her JD from Gonzaga University School of Law.

Huna Totem CorporationJoe Jacobson joined Huna Totem Corporation as Vice President of Business Development. He was recently Director of the State of Alaska Division of Economic Development and pre-viously International Program Director at the Alaska Seafood Marketing Institute. Jacobson holds a bachelor’s degree in outdoor studies from Alaska Pacific University and a master’s degree in international relations from the City College of New York.

Anchorage Chamber of CommerceThe Anchorage Chamber of Commerce board of d i rec tors appointed Bruce Bustamante as President. Over the past few years he has been Visit Anchorage President a n d C EO, P r i n c e s s Cruises Vice President of Community and Public Affairs, and most recently

Visitor and Convention Bureau Interim Director for Lincoln City, Oregon.

Ukpeaġvik Iñupiat Corporation

Greg Solomon joins UIC as its new Marketing and Communications Manager. Solomon has over twenty years of experience in the adver-tising and marketing fields and fifteen years in the IT industry. He attended the Interlochen Arts Academy in Michigan, the University of Texas at San Antonio, the University of Alaska Anchorage, and the University of the Incarnate Word in Texas.

Roger Wilson joins UIC Oil & Gas Support as General Manager. Wilson’s career spans twenty-six years in North Slope materials management and logistics, including seventeen years in man-agement positions. He also brings strong safety culture and environmental stewardship. Wilson is a life-long Alaskan.

Clyde Cossette joins UIC Design, Plan, Build as Health, Safety, Environment, and Training Manager. Most recently he’s worked at Kuparuk as a General Foreman managing seventy employees. Cossette holds a bachelor’s in business man-agement from the College of St. Scholastica in Minnesota and has earned a number of health and safety certifications the last thirty years.

Rachel Kenshalo joins UIC Design, Plan, Build as Director of Marketing and Communications.

She was most recently Operations Director at Northwest Strategies. She brings fifteen years of experience in communications and marketing and ten years in freelance writing. Kenshalo is a life-long Alaskan and a graduate of the University of Alaska.

Alaska Center for the Performing Arts

Anne Garrett has been appointed as the new Director of Development and Marketing at the Alaska Center for the Performing Arts. Garrett brings more than twenty years of experience and earned her Bachelor of Arts in Fine Arts from Saint Olaf College. In Seattle, she earned her Master of Arts in Teaching from City University and graduated from The Film School.

Salamatof Native Association, Inc.

Christopher Monfor is the new President and Chief Executive Officer of Salamatof Nat ive Association, Inc. Monfor was the Area Sales Manager for NC Machinery’s CAT Rental Store Division. Monfor received a BA in marketing, history, and criminology from the University of Portland.

AIDEAThe AIDEA (Alaska Industrial Development and Export Authority) Board appointed John Springsteen as Executive Director. He served as AIDEA Infrastructure Development Officer since February 2014 and was previously the National Director in the Houston, Texas, office of Grant Thornton LLP. Springsteen earned his bachelor’s from the Massachusetts Institute of Technology and holds an MBA from the Kellogg Graduate School of Management, Northwestern University. R

RIGHT MOVES Compiled by Russ Slaten


Wilson

Kenshalo

VeceraGarrett

Monfor

Jacobson

Bustamante

Solomon

Cossette

®WWW.NAC.AERO • (800) 727-2141 •

INSIDE ALASKA BUSINESS Compiled by Russ Slaten


Alaska AirlinesAlaska Airlines will continue flying

jet service to five Southeast Alas-ka communities for at least another two years. The federal Department of Transportation has awarded Alaska Airlines the contract to continue flying to Cordova, Gustavus, Yakutat, Peters-burg, and Wrangell as part of the Es-sential Air Service program. Under the renewed Essential Air Service agree-ment, Alaska Airlines will operate daily flights to Cordova, Yakutat, Petersburg, and Wrangell and daily seasonal flights to Gustavus during the peak summer travel seasons from June 7 to August 22, 2015, and June 5 to August 20, 2016. The airline also provides twice-weekly Essential Air Service between Anchor-age and Adak, Alaska.

Fairweather, LLCFairweather LLC, an affiliate of the

Edison Chouest Offshore group of companies, held a grand reopening of its Fairweather Deadhorse Medical Clinic located at the Deadhorse Avia-tion Center on Alaska’s North Slope. Providing a wide range of member-based medical and occupational health care services to support both onshore and offshore operations, the clinic is available to the public regardless of employer affiliation. Medical services include primary and acute care, emer-gency medicine, advanced cardiac life support, and ambulance services, along with a fully stocked pharmacy prescrib-ing medications. The clinic also offers an onsite lab and X-ray department. Occupational health services include audiograms, respirator fit tests, spi-

rometry, vision screening, and drug/alcohol testing, plus the convenience of completing full HAZWOPER exams in a single office visit.

Alaska Power & Telephone

Alaska Power & Telephone, or AP&T, plans expansion of data bandwidth

capacity in the Upper Lynn Canal re-gion of Alaska via placement of new fiber optic undersea cable facilities in Southeast Alaska this year. The planned eighty-six mile cable-route will origi-nate in Skagway, landing in the com-munity of Haines before terminating at Lena Point near Juneau, Alaska. In tan-dem with AP&T’s more than three hun-dred-mile terrestrial Southeast Alaska Microwave Network, the new undersea fiber route is expected to exponentially expand AP&T’s bandwidth assets and positioning as a strategic partner in the rapidly expanding Alaska data trans-port and wireless markets segments.

Summit Fund LLCThe Alaska Industrial Development

and Export Authority, or AIDEA, Board approved a loan participation for a newly constructed retail project in Wasilla. The loan, to Summit Fund LLC, is for $2,295,000, 90 percent of a $2,550,000 loan brought to AIDEA by Wells Fargo Bank. Wells Fargo origi-nated the loan and is participating with $255,000. The purpose of this loan is for long-term financing of a new, single-story retail building located at 1801 East Palmer-Wasilla Highway. The 11,400-square-foot building is fully

leased to PETCO. The project created fifty new construction jobs and twelve new permanent positions.

FedExThe Alaska Industrial Development

and Export Authority, or AIDEA, announced in April that it completed an early extension to its ground lease at Ted Stevens Anchorage International Airport and executed a new lease with FedEx for their continued use of the Maintenance, Repair, and Overhaul Fa-cility at the airport. This new lease with FedEx goes through 2023, with options to extend to 2043. AIDEA owns the hangar, one of the largest buildings in Alaska. The facility can accommodate a wide-body aircraft, such as a Boeing 747. The new lease includes up to $4 mil-lion of maintenance and refurbishment for the facility, including new boilers, updated fire suppression systems, and replacement of the main hangar door, expected to begin this summer.

Blood Bank of AlaskaBlood Bank of Alaska has opened a

new community blood center in Wasilla to serve Mat-Su Valley blood donors. The center is located at 1301 Seward Meridian Parkway. In 2009 the previous Wasilla center was closed and Valley donors began donating in An-chorage or at mobile drives. The board of directors approved the opening of the center in November 2014 to better serve the community. Mat-Su Regional Medi-cal Center is one of the many hospitals supplied with blood and blood products by the blood bank’s volunteer donors. Blood Bank of Alaska will continue to

620B East Whitney Road I Anchorage, AK 99501

Pacific Pile & Marine has a robust fleet of marine equipment including our recent

addition of a 600-Ton 4600 Ringer.

From critical lifts to platform support, PPM is sufficiently resourced to deliver a wide range

of construction services.www.pacificpile.com I (907) 276-3878www.pacificpile.com I (907) 276-3873

Your Project, Our Responsibility. 24/7 Service



host some mobile drives in the Valley, but will use the center to provide a more consistent donation option for donors.

Anchorage 5th Avenue Mall

Anchorage 5th Avenue Mall will open three new stores this sum-

mer. Vancouver, BC-based lululemon athletica is slated to open its first large store in an approximately 3,200-square-foot space on Level 2 later this summer. Known for its yoga-inspired athletic apparel, the brand focuses creating components for both men and women to live longer, healthier, fun lives, spe-cializing in making technical athletic apparel for yoga, running, and many more sweaty pursuits. Shoppers can expect additional activity this season when Journeys relocates from Level 1 to Level 3, next to Aerie, to make room for sister store, Journeys Kidz. This will be the brand’s first store in Alaska. Fi-nally, Bath & Body Works opened its first Alaska store on Level 2 of the 5th Avenue Mall, across from the future lu-lulemon store, in May.

Alaskan Brewing Company

Alaskan Brewing Company began shipping cans to all seventeen

states of distribution in April and add-ed another product to their existing can selection in Alaska. The introduction of cans to the rest of the Alaskan prod-uct lineup could prove an important step in the growth of Alaskan Brew-ing’s footprint. In addition to Alaska,

Alaskan Amber and Freeride APA in twelve-ounce cans are on the shelves in Arizona, California, Colorado, Idaho, Michigan, Minnesota, Montana, Ne-vada, New Mexico, North Dakota, Ore-gon, South Dakota, Texas, Washington, Wisconsin, and Wyoming. Alaskan Brewing installed a new state-of-the-art canning line in April 2014 that em-phasized the importance of the quality of the beer. They first began packaging Alaskan Amber and Freeride APA for sale in Alaska only. After a very suc-cessful in-state run, Alaskan Brewing is now offering those two varieties to the rest of their markets. Additionally, Alaskan Brewing began canning Icy Bay IPA in April, with immediate sale of that variety available in Alaska only.

Corporate Travel Management

Corporate Travel Management an-nounced the sale of Explore Part-

ners LLC, known as Explore Tours. The current Explore Tours staff moved to the new owner with the sale. However, the Explore Tours office will continue to be located at CTM’s Anchorage office, allowing a continued close relationship between CTM and Explore Tours for years to come.

Foss Maritime The first of three Arctic Class tugs

being built at the Foss Rainier, Or-egon, shipyard was christened in April. The vessel, the Michele Foss, will see its first assignment on an oil field sealift this summer from South Korea to the Alaska Arctic. The vessel’s namesake

is Michele Seaver, one of the three sis-ters who are primary shareholders of Saltchuk, the parent company of Foss Maritime.

The Michele Foss is ice class D0. This means the hulls are designed specifi-cally for polar waters and are reinforced to maneuver in ice. The vessel com-plies with the requirements in the ABS Guide for Building and Classing Vessels Intended to Operate in Polar Waters, including ABS A1 standards, SOLAS, and Green Passport. The Michele Foss includes a Caterpillar C280-8 main engine, which complies with the high-est federal environmental standards; a Nautican propulsion system; and Rein-tjes reduction gears. Markey Machin-ery supplied the tow winch. The tug has a bollard pull of 221,000 pounds.

Coeur Mining, Inc.Coeur Mining, Inc. updated and re-

scoped its mine plan and released a preliminary economic assessment for its Kensington gold mine located in Southeast Alaska in April. The new mine plan reflects the recent discovery of the high-grade Jualin zone and in-dicates higher overall production and significantly higher cash flows due to the contribution of higher-grade mate-rial from three nearby zones. The Jualin zone, located approximately 8,250 feet from current mining activities, contin-ues to expand based on ongoing drilling and contains an average gold grade over three times the average reserve grade of 0.185 oz/ton. Annual gold production between 2015 and 2020 at Kensington is expected to average approximately 128,000 ounces and costs applicable to sales are expected to average $820 per

620B East Whitney Road I Anchorage, AK 99501

Pacific Pile & Marine has a robust fleet of marine equipment including our recent

addition of a 600-Ton 4600 Ringer.

From critical lifts to platform support, PPM is sufficiently resourced to deliver a wide range

of construction services.www.pacificpile.com I (907) 276-3878www.pacificpile.com I (907) 276-3873

Your Project, Our Responsibility. 24/7 Service



gold ounce. Production in 2014 was 117,823 ounces as costs applicable to sales averaged $951 per gold ounce.

Alaska CommunicationsAlaska Communications has en-

hanced Voice over Internet service for Alaska businesses with its new high-definition voice capability. The new HD capability increases sound clarity to provide a better call experience for sub-scribers using the Voice over Internet phone product.

Nome Offshore MiningThe Alaska Division of Economic

Development’s Nome Suction Dredge Study has concluded that off-shore mining has financially benefited the City of Nome and its residents and will continue to play role in the region’s future. The study analyzed the impact of the offshore mining industry’s effect on the city’s economy, infrastructure, and public services. The study identifies benefits and challenges that can be bal-anced by the community and industry for regional economic growth. Specifi-cally, the report recommends that the City of Nome work to upgrade and add infrastructure. The report also recom-mends that the mining industry work to minimize operational hazards and to ensure Nome’s public spaces are read-ily accessible to all residents. The study asserts that resource depletion in Nome will eventually lessen recreational in-terest in the offshore public mining ar-eas, but the economically viable placer gold found in large offshore lease tracts will most likely sustain a long-term commercial mining industry.

Pier 1 ImportsPier 1 Imports opened its newest

Alaska store in April. This is the sec-ond Pier 1 Imports in Anchorage and third location in Alaska. Located at the Tikahtnu Commons shopping center at 1124 N. Muldoon Road, the new An-chorage store features Pier 1 Imports’ New Store Concept. Pier 1 Imports has one store in South Anchorage and one store in Fairbanks, which also features the new store concept. The store boasts 7,496 square feet of total retail square footage and employed between twenty-five to thirty associates to support the new store opening.

GCIGCI is partnering with wireless

technology and services company Ericsson to bring advanced, high-speed fixed and mobile connections to Alaska’s North Slope. GCI began con-struction and installation of its new ad-vanced, high-speed wireless data net-work. The network will include a total of nine sites spanning from Kuparuk to Point Thomson, stretching more than 3,738 square miles, an area larger than the size of Delaware and Rhode Island combined. The new network will use LTE technology with data download speeds in excess of thirty megabits per second. This high-speed connectivity will support advancing oil field data re-quirements and improve overall oilfield operations. This project is a continu-ation of GCI’s build out of high-speed mobile service across Alaska. In addi-tion to North Slope, GCI already pro-vides LTE to Anchorage, Fairbanks, and Juneau and later this year will be

turning up LTE service for the Mata-nuska Valley and Kenai Peninsula.

Alaska USA Federal Credit Union

Alaska USA Federal Credit Union se-lected FIS, a global leader in bank-

ing and payments technology as well as consulting and outsourcing solutions, as its partner for several strategic pay-ment initiatives, including EMV adop-tion and better leveraging customer data to increase the effectiveness of its customer touch points through ana-lytic reporting. The new deal includes EMV card personalization, debit card processing, ATM driving, fraud man-agement services, and NYCE Network access, all while extending the bank’s existing credit card processing rela-tionship provided by Card Services for Credit Unions. Alaska USA also extend-ed its relationship using FIS’ ScoreCard Rewards loyalty program.

WCP/Frontier PaperTom Groves, CEO/President of WCP

Solutions of Kent, Washington, and Gregory Wilcox, owner of Frontier Pa-per of Anchorage, merged WCP’s Alaska distribution facility and Frontier Paper to form a new business, WCP/Frontier Paper.

Although both companies operate in the same industry, the combination WCP and Frontier Paper brings togeth-er a high level of expertise in different market segments that complement the customer base of each.

The new company is operating as WCP/Frontier Paper. R

620B East Whitney Road I Anchorage, AK 99501www.pacificpile.com I (907) 276-3873www.pacificpile.com I (907) 276-3873Dutch Harbor - Unalaska, Alaska

• General Contracting• Marine Infrastructure• Design Build


June

n Animal Behavior Society Annual ConferenceJune 10-14—Anchorage: The Animal Behavior Society was founded in 1964 to promote the study of animal behavior in the broadest sense, including studies using descriptive and experimental methods under natural and controlled conditions. animalbehaviorsociety.org

n SouthcentralFoundation2015NukaSystemofCareConferenceJune 15-19—Southcentral Foundation Ahklun Mountains Building, Anchorage: The conference describes the entire healthcare system created, managed, and owned by Alaska Native people, with workshops and break-out sessions, evening networking, and a cultural reception. southcentralfoundation.com

n InternationalConferenceonSolid-StateSensors,Actuators,andMicrosystemsJune 21-25—Dena’ina Center, Anchorage: The world’s premiere conference in MEMS sensors, actuators and integrated micro and nano systems. transducers2015.org

July

n RockyMountainMineralLawInstituteJuly 16-18—Dena’ina Center, Anchorage: The Rocky Mountain Mineral Law Foundation (RMMLF) is a collaborative educational non-profit or-ganization dedicated to the scholarly and practical study of the law and regulations relating to mining, oil and gas, water, public lands, energy, environmental protection, and other related areas. rmmlf.org

n Alaska Business WeekJuly 18-25—Alaska Pacific University, Anchorage: Alaska Business Week is a one-week summer program teaching the basic principles of private sector business to Alaskan high school students. alaskachamber.com

n Alaska Snow SymposiumJuly 23—Dena’ina Center, Anchorage: A one-day trade show for the snow and ice management industry brought to Alaska by the Snow-fighters Institute. This year’s conference will include special educa-tional conferences targeting snow contractors, property managers, and municipalities, plus “Lunch and Learn” round table discussions. alaskasnowsymposium.com

n Annual Strategic Lending ConferenceJuly 23-26—Anchorage: One of the CU Conferences, which educates the Credit Union Community, this conference provides information such as generating loans across all age groups and what types of loans can increase earnings. cuconferences.com

August

n 2015 Alaska Chapter of ASA Annual ConferenceAugust 25-27—Alaska Pacific University, Anchorage: The meeting fea-tures a workshop on Generalized Additive Models by Dr. Simon Wood (University of Bath, UK). community.amstat.org/alaskachapter

September

n Alaska Oil & Gas CongressSeptember 14-17—Marriott, Anchorage: CI Energy Group’s 11th an-nual Alaska Oil & Gas Congress will feature a focused pre-conference Summit Day, the Two-Day Conference, and a post-conference seminar. alaskaoilandgascongress.com

n Chapman Conference on Magnetospheric DynamicsSeptember 20-25—Fairbanks: Scientific objectives of the proposed CCEMD include magnetic storms, auroral and magnetospheric sub-storms, dayside and tail magnetic reconnections, and new results of the MMS mission. gi.alaska.edu/2015ChapmanConference

n Alaska State HR ConferenceSeptember 24-25—Hilton Anchorage, Anchorage: Meet more than two hundred human resources professionals, office managers and administrators, directors, and adult educators representing both public and private industry. This event will bring professionals from around the state to learn more about their responsibilities as HR Professionals. alaska.shrm.org

n ArcticEnergySummitSeptember 28-30—UAF Campus, Fairbanks: The Institute of the North’s 2015 Arctic Energy Summit is a multi-disciplinary event ad-dresses energy extraction, production, and transmission in the Arctic as it relates to oil and gas exploration and production, remote heat and rural power, and the business of clean energy. institutenorth.org

n Alaska Fire ConferenceSeptember 28-October 3—Seward: Includes training, workshops, lectures, and a firefighter competition. The 2015 theme is “Passing the Torch.” alaskafireconference.com

n Alaska Business Monthly’s Top 49ers LuncheonSeptember 30—Dena’ina Center, Anchorage: Come honor the top Alaska-owned companies, ranked by revenue, at the annual luncheon. Contact: Melinda Schwab [email protected], akbizmag.com

October

n AlaskaRecreation&ParkAssociationConferenceOctober 1-10—Land’s End, Homer: Celebrate the 40th Anniversary of the Alaska Recreation & Park Association as well as participate in the organization’s annual conference. alaskarpa.org

n IEDC Annual ConferenceOctober 4-7—Anchorage: The annual conference of the International Economic Development Council. Join economic developers from around the world to discuss the most important issues in economic development today: “Foundational Transformations: Creating Future Growth & Prosperity.” iedcevents.org

n AlaskaTravelIndustryAssociationConvention&TradeShowOctober 5-8—Juneau: The 2015 “In Your Wildest Dreams” ATIA convention is for Alaska’s tourism industry leaders with delegates from tour operators, wholesalers, Alaska vendors, destination marketing organizations and elected officials. alaskatia.org

n All-Alaska Medical ConferenceOctober 8-10—Anchorage: A continuing medical education conference put on by the Alaska Academy of Physicians Assistants, providing up to 25 CMEs. akapa.org

n AlaskaCoalitiononHousingandHomelessnessConferenceOctober 12-14—Anchorage: Events include keynote speakers and training sessions. alaskahousing-homeless.org/conference

n AAHPA Annual ConferenceOctober 12-16—Anchorage: This is the annual conference of the Alaska Association of Harbormasters & Port Administrators. alaskaharbors.org

n Alaska Chamber Policy Forum and ConferenceOctober 13-14—Fairbanks: Open to the public, the Alaska Chamber’s Annual Conference is the state’s premier business conference. Tradi-tionally held in the fall, the Conference draws 200-225 attendees and features keynote speakers, panel discussions and breakout sessions on issues of statewide concern to Alaska business. alaskachamber.com

n AlaskaFederationofNativesAnnualConventionOctober 15-17—Dena’ina Center, Anchorage: Annual gathering of Alaska Native peoples to discuss current news and events on a state, national and international level. nativefederation.org

n Alaska Math and Science ConferenceOctober 23-25—Sitka: Biennial conference for teachers of math and science of all grade levels. This year’s theme is “Navigating the Tides of Change.” amsc2015.org

n NWPPA/APAAlaskaElectricUtilityConferenceOctober 26-29—Dena’ina Center, Anchorage: The conference provides a mix of education and networking, along with more than seventy exhibit booths. It also provides ample opportunities to learn about the latest best practices, innovations, and technology concerning utilities. nwppa.org

November

n Associated General Contractors of Alaska Annual ConferenceNovember 11-14—AGC of Alaska is a non-profit construction trade association dedicated to improving the professional standards of the construction industry. agcak.org

AGENDA Compiled By Tasha Anderson

122 Alaska Business Monthly | August 2014 www.akbizmag.com

By Tasha Anderson

DINING

Bridge

ALASKA THIS MONTH

For a uniquely Alaska dining experience, the Bridge Seafood Restaurant reopened its seasonal doors May 26 and will remain open through August 31. The

Bridge was purchased in 2011 by its current owners, Chefs Al Levinsohn and Patrick Hoogerhyde, both have “made Alaska home” and have had extensive culinary careers in the Pacific Northwest and Alaska.

Located at 221 W. Ship Creek Avenue, the restaurant is “a bridge over an active hatchery fed salmon stream, where you can see people catching the same species of salmon that you’re having for dinner,” Hoogerhyde says.

All of the seafood served at the Bridge is 100 percent Alas-ka-caught seafood, including the popular halibut, king salm-on, and king crab. In fact, Hoogerhyde says, the restaurant’s short open season is specifically correlated to the fresh salm-on season from May to August. In addition to local seafood, 80 percent of the produce served in the restaurant is sourced from the Mat-Su Valley, and all the food is “100 percent hand crafted,” he says.

“Our ‘starter bar’ is our signature; it comes with every en-trée and is all you can eat,” Hoogerhyde says. It includes Ber-ing Sea tanner crab, Matanuska potato salad, summer green salad, pineapple coleslaw, roasted beet salad, watermelon salad with fresh mint, and Alaska smoked salmon and pasta salad.

Hoogerhyde says, “Our company’s philosophy and culture is built on hospitality—we want guests to experience Alas-ka’s seafood and service like it should be.”

bridgeseafood.com R

The Bridge Seafood Restaurant�Photo by Tasha Anderson/Alaska Business Monthly

www.akbizmag.com August 2014 | Alaska Business Monthly 123

By Tasha Anderson

TRAVEL

Chickenstock

ALASKA THIS MONTH

“How many people can say they did the Chicken Dance in Chicken, Alaska, at Chickenstock?” asks Josea Busby, Chickenstock Music Festival event

coordinator. Well, last year approximately seven hundred people, and Busby says she anticipates nearly one thousand guests this year as Chickenstock continues to grow.

Busby, while attending a bluegrass concert in 2007, fell in love with the genre. She spoke with some of the bluegrass musicians, pitching the idea for a bluegrass music festival in Chicken.

“I don’t think they thought I was serious until after we all arrived home from Nome and I started bugging them every chance I got,” she says.

It paid off, as the event that had one band for one night in its first year has grown into a two-day event with fifteen groups performing. This year’s honored guest is Carl Hoff-man, “who was recently recognized by the Alaska State Legislature as ‘Father of Alaskan Bluegrass’ and has been involved with Chickenstock since its inception,” Busby says.

In addition to live music there’s balloon tying, unicycles, stilts, juggling, and other live entertainment. One tradition that has evolved at Chickenstock is the official Chicken Dance, “led by four human sized chickens, one human sized egg, and one human sized deviled egg,” she says, with four “Chicken-ettes” singing the words to the song on stage. “It is so much fun and we really try to get everyone up for the Chicken Dance—kids, moms, dads, teens, grandmas, grandpas, etc.”

Mike and Lou Busby, who own and operate Chicken Gold Camp & Outpost, donate their grounds for the event each year. Because of that, the event is able to offer free dry camp-ing with a two-day pass purchase ($45). Chickenstock is June 12 and 13 this year.

“Our musicians, event flock, and festival attendees all mingle as if it were an annual family get together; the week-end is good clean friendly family fun,” Busby says.

facebook.com/pages/Chickenstock-Music- Festival/354189617933639 R

Chicken-stock is not to be missed.© Mike Busby / Courtesy of Chickenstock

124 Alaska Business Monthly | August 2014 www.akbizmag.com

ANCHORAGE6 Alaska Paddle Fun DayThe Alaska Paddle Fun Day is a free event for the general public to learn about paddle sports including sea kayaking, stand up paddle boarding, canoeing, and pack rafting. Open to all ages and abilities. Demo boats will be available to paddle. Presentations and demon-strations will include cold water safety, rescues, trip planning, Leave No Trace camping, equipment, and more. Goose Lake, 10 a.m. to 4 p.m. aksks.org

6 Potter Marsh Discover DayThis family-friendly event brings you nature-related games and prizes, invertebrate sampling, birding stations along the boardwalk, captive birds from the Bird Treatment and Learning Center, educational animals from the Alaska Zoo, kid-friendly archery range, fly and spin casting practice, and more. Potter Marsh Boardwalk and Anchorage Coastal Wildlife Refuge, 11 a.m. to 4 p.m. adfg.alaska.gov

6-7 & 13-14 Three Barons Renaissance FairThis annual fair boasts a range of activities, including singing with pirates, performances by belly dancers, swordplay demonstrations and battles, and local food and arts vendors. Tozier Sled Dog Track, Noon to 8 p.m. daily. 3barons.org

9 100+ Women Who Care AnchorageMembers of the 100+ Women Who Care Anchorage meet four times a year for one hour. At the meeting, a charity is selected and each woman present instantly writes a check for $100 to the charity, raising $10,000 or more quarterly for Anchorage-based nonprofits or Anchorage branches of national charities. This is the third meeting for the group, which met for the first time December 2014. Millennium Alaskan Hotel Anchorage, 5:30 registration, 6 p.m. to 7 p.m. 100wwcanchorage.org

20 Downtown Summer Solstice Festival and Hero GamesAlaskans celebrate the longest day of the year in Town Square and sur-rounding streets with tons of events packed into one sweet celebration. Live musical performances keep downtown hopping until the sun goes down, a tall order on a day with twenty-two hours of functional day-light. Events include the Hero Games, a friendly competition between Alaska’s first responders charging through obstacle courses, bucket brigades, and different relays and the Children’s Rainbow Factory, which includes puppet shows, a kayak pool, and giant sandbox. Fourth Avenue and Town Square, Noon to 6 p.m. anchoragedowntown.org

20 Mayor’s Midnight Sun Marathon & Half MarathonNearly four thousand runners and walkers will travel to run the scenic trails of Anchorage at the annual summertime Mayor’s Marathon and Half Marathon. The event also has a four-person marathon relay, 5-miler, and Youth Cup. mayorsmarathon.com

FAIRBANKS13 Fairbanks Summer Folk FestivalThis festival is a day of free live folk, bluegrass, blues, jazz, and Celtic music. Pioneer Park 1 p.m. alaskasbest.com/fairbanksfolkfest

19-21 Great Alaskan FoodstockThe entry fee to this event is $5 or five cans of food. All profits are donated to the Fairbanks Rescue Mission. Activities include a beer garden, dancing, volleyball, horseshoes, arts and crafts, and food vendors. The musicians and organizers all volunteer their time, and local individuals and businesses donate items for a Saturday night auction. Howling Dog Saloon. greatalaskanfoodstock.com

21 Midnight Sun FestivalThis is Fairbanks’ celebration of one of the longest days of the year, featuring live music, good food, and exciting vendors. downtown-fairbanks.com

21 Midnight Sun Baseball GameTaking place for more than one hundred years, this game is played by the Alaska Goldpanners at 10:30 p.m. without any artificial light. Growden Memorial Park. goldpanners.pointstreaksites.com/view/goldpanner

GIRDWOOD6-7 Fiddlehead Music FestivalThis is a celebration of the fiddlehead fern season and summer music in the mountains. The family-oriented outdoors event features live music, local arts and crafts booths, beer and wine garden, and activities for kids. Alyeska Resort, Noon to 8 p.m. alyeskaresort.com

JUNEAU13-14 Juneau Symphony Summer Pops ConcertThis concert explores music that spans the classical repertoire to the world of fantasy. Selections will be from familiar film scores, such as “Fellowship of the Ring” and “Sorcerer’s Apprentice,” and Lisa Ibias will move audience members with John Williams’ heart-wrenching theme from Schindler’s List. Two incredibly talented 2014 Youth Solo Competition winners, Tezah Haddock and James Cheng, will be features playing works by Vivaldi and Haydn. Juneau Symphony, Saturday 8 p.m. and Sunday 4 p.m. juneausymphony.org

PALMER12-14 Colony DaysThis is a festival in honor of the 1935 Colonists who started the Mat-Su farming community. Events include a car rally, craft fairs, horse-drawn wagon rides, farmer’s market, kids’ games, carnival rides, bike rodeo, parade, and live entertainment. Downtown Palmer. palmerchamber.org

27 Alaska Scottish Highland GamesThis family friendly activity will feature amateur Highland Athletes, piping, drumming, and dancing competitions, as well as live music, vendors, food, and a Scotch tasting. Alaska State Fairgrounds. alas-kascottish.org

SITKA3-28 Sitka Summer Music FestivalThe festival week runs Tuesday through Sunday. In general, a festival week has the following events: Café concert, Bach’s lunch, evening concerts, and at least one special event; many of the concerts are free to the public. ssmf.alaskaclassics.org

VALDEZ27 Kite & Summer Solstice FestivalCome celebrate the Summer Solstice with kite building, big kite flying, music, and more. This is a fundraiser event for the Valdez Convention & Visitors Bureau. valdezalaska.org

EVENTS CALENDAR Compiled by Tasha Anderson

Alaskans serving Alaskans.Oxford is proud to be the only gold refiner and bullion dealer to maintain two locations in Alaska for more than 30 years.

BUY : SELL : TRADE• ANCHORAGE • FAIRBANKS • NOME• NEW YORK

1.800.693.6740www.oxfordmetals.com


Market Squares For Information About Advertising in Market Squares Call (907) 276-4373 or Toll Free (800) 770-4373

(907) 276-4373 • Toll Free (800) 770-4373

akbizmag.com

Bill Morris Advertising Account Manager

Office (907) [email protected]

Call me so we can discuss improvingyour marketing goals.

We deliver.Advertisers rely on our print and online visibility to reach as

many potential clients as possible statewide.

Let Us Help You Get Ready For Summer!

Embroidery

Screen Printing

Graphic Design

Promotional Items

-since 1981-

stellar-designs.com

C

M

Y

CM

MY

CY

CMY

K

AK Business Ad-Homer&HMT_raster.pdf 1 6/5/2014 1:26:56 PM

SIGN UP SIGN UP SIGN UP TO BE A TO BE A TO BE A

ERERERERERERERERERERERERERERERERERERERERERERERERERERER444444 ERERERERERERERERER444444999999999444944494449444444944494449444999999ERERER9ERERER9ERERER9ERERERERERER9ERERER9ERERER9ERERER999444944494449444444444TOPTO

PTO

PTO

PTO

PTO

PTO

PTO

PTO

P444TOP444TOP444TOP444444TOP444TOP444TOP444444TOP444TOP444TOP444444TOP444TOP444TOP444TOPTO

PTO

PTO

PTO

PTO

P444TOP444TOP444TOP444444TOP444TOP444TOP444TOPTO

PTO

PTO

PTO

PTO

PTO

PTO

PTO

PTO

PTO

PTO

P444TOP444TOP444TOP444TOPTO

PTO

PTO

PTO

PTO

PTO

PTO

PTO


PTO

PTO

PTO

PTO

PTO

PTO

PTO

PTO

PTO

PTO

PTO

PTO

PTO


PTO

PTO

PTO

PTO

PTO

PTO

PTO

PTO

PTO

PTO

P444TOP444TOP444TOP444444TOP444TOP444TOP444TOPTO

PTO

PTO

PTO

PTO

PTO

PTO

PTO

PTO

PTO

PTO

P444TOP444TOP444TOP444444TOP444TOP444TOP444444TOP444TOP444TOP444TOPTO

PTO

PTO

PTO

PTO

PTO

PTO

PTO


PTO

PTO

PTO

PTO

P444TOP444TOP444TOP444

Sign up todayfor a survey!

Go toakbizmag.com/Top49er

or call

276-4373 to have a survey emailed to

your company

Top 49er Awards Luncheon 9/30/2015

Are YouHeadquartered in Alaska?

At least 51% Alaskan owned?

Willing to disclose

Number of employees?

Gross Annual Revenues?* ABM uses the IRS definition for Gross Receipts as the ABM criteria for Gross Annual Revenues. *Gross receipts are the total amounts the organization received from all sources during its annual accounting period, without subtracting any costs or expenses. Internal Revenue Service

Free app no matter which device you have. Digital edition

also. To subscribe visit akbizmag.com

or call 907-276-4373


This year marks Anchorage’s 100th birthday, and the city has come a long way from its start as a shabby tent city of railroad construction workers.

The State of Alaska Department of Labor and Workforce Development website is home to official US Census Bureau research dating as far back as 1880 for Alaska as a territory, and, after statehood in 1959, as a state. Anchorage makes its first appearance as a census-recognized place in 1920, when no more than the population for “Anchorage town” was recorded (1,850 at the time).

The population climbed steadily through the 1930s and ‘40s and then ballooned between 1950 and 1960, following the successful statehood movement. Although the state of Alaska as a whole at times saw drastic differences between the percent of its male and female residents, this much-mythologized trend never really impacted Anchorage very much. The greatest gender disparity is seen in 1930, and it decreased to near-parity by the time Alaska became a state.

Data for the early years is spotty at best, but the census reports are a treasure trove for those wishing to understand Alaska’s early history and social circumstances better. For example, in 1939, the Census Bureau released a report en-titled “Census of Business: 1939, Alaska, Hawaii and Puerto Rico” that provides a snapshot into the city’s early economy. At the time, there were eighty retail establishments in An-chorage, thirty-two service providers, fifteen hotels, and four wholesalers. Most were sole proprietorships or em-ployed fewer than a half-dozen employees. Total recorded operating receipts for all Anchorage businesses that year were $3,350,109. Clearly, Anchorage’s business community has come a long way since then.

Although Anchorage’s economy is very different from other urban areas in the United States, the Consumer Price Index for urban consumers as tracked for Anchorage and other US cities shows that inflation has affected the city in a pattern that very closely mirrors other cities. Anchorage workers have fared considerably better than their counter-parts in the Lower 48, at least as gauged by the state’s mini-mum wage, and with recent legislation that approved addi-tional increases in wages in 2015 and 2016, there is reason to believe Anchorage workers will continue to gain some ground. R

Alaska Trends, an outline of significant statewide statistics, is provided by the University of Alaska Center for Economic Development.

ALASKA TRENDS By Amy Miller

ALASKA TRENDS HAS BEEN BROUGHT TO YOU THIS MONTH COURTESY OF AMERICAN MARINE/PENCO

Anchorage: Then and Now

ANCHORAGE OFFICE6000 A Street, Anchorage, Alaska 99518

(907) 562-5420

www.amarinecorp.com www.penco.org

Alaska I California I Hawaii

AMERICAN MARINE• Marine Construction/Dredging• Subsea Cable Installation & Maintenance• Commercial Diving• Platform & Pipeline Construction, Installation, Repair & Decommissioning• Underwater Certified Welding• Marine Salvage• NDT Services• ROV Services• Vessel Support Services

PENCO• Environmental Response/Containment• Site Support Technicians/Maintenance • Waste Management/Environmental Monitoring• Tank Cleaning/Inspection• Petroleum Facility Maintenance & Repair• Logistics Support• 24-Hour Response

DEADHORSE OFFICEPouch 340079, Prudhoe Bay, AK 99734

(907) 659-9010



SOURCE: US Census Bureau Decennial Census

SOURCE: US Department of Labor, Bureau of Labor Statistics


GENERALPersonal Income—Alaska US $ 4thQ14 39,218 38,879 37,179 5.48%Personal Income—United States US $ 4thQ14 14,941,804 14,792,775 14,251,060 4.85%Consumer Prices—Anchorage 1982-1984 = 100 2ndH14 216.83 214.78 213.91 1.37%Consumer Prices—United States 1982-1984 = 100 2ndH14 237.09 236.38 233.55 1.52%Bankruptcies Alaska Total Number Filed February 28 16 28 0.00% Anchorage Total Number Filed February 17 14 15 11.76% Fairbanks Total Number Filed February 8 2 4 50.00%

EMPLOYMENTAlaska Thousands February 334.86 336.57 334.32 0.16%Anchorage & Mat-Su Thousands February 190.35 192.60 187.29 1.63%Fairbanks Thousands February 43.41 43.29 42.39 2.41%Southeast Thousands February 32.41 32.37 33.88 -4.34%Gulf Coast Thousands February 34.51 34.87 35.86 -3.76%Sectorial Distribution—AlaskaTotal Nonfarm Thousands February 326.70 323.00 322.30 1.37% Goods Producing Thousands February 44.60 43.60 45.50 -1.98% Services Providing Thousands February 282.10 279.40 276.80 1.91% Mining and Logging Thousands February 17.30 17.20 17.20 0.58% Mining Thousands February 17.20 17.10 17.00 1.18% Oil & Gas Thousands February 14.80 14.70 14.20 4.23% Construction Thousands February 14.80 15.10 14.20 4.23% Manufacturing Thousands February 12.50 11.30 14.10 -11.35% Seafood Processing Thousands February 8.80 7.40 10.50 -16.19% Trade/Transportation/Utilities Thousands February 62.30 62.60 60.80 2.47% Wholesale Trade Thousands February 6.20 6.10 6.40 -3.13% Retail Trade Thousands February 35.70 36.10 34.90 2.29% Food & Beverage Stores Thousands February 6.10 6.00 6.40 -4.69% General Merchandise Stores Thousands February 9.60 9.80 9.70 -1.03% Trans/Warehouse/Utilities Thousands February 20.40 20.40 19.50 4.62% Air Transportation Thousands February 5.50 5.60 5.50 0.00% Information Thousands February 6.30 6.20 6.20 1.61% Telecommunications Thousands February 4.30 4.20 4.10 4.88% Financial Activities Thousands February 12.00 11.90 11.70 2.56% Professional & Business Svcs Thousands February 28.20 28.10 28.10 0.36% Educational & Health Services Thousands February 47.40 47.20 47.50 -0.21% Health Care Thousands February 34.10 34.10 33.70 1.19% Leisure & Hospitality Thousands February 30.20 29.90 28.60 5.59% Accommodation Thousands February 7.90 7.80 5.90 33.90% Food Svcs & Drinking Places Thousands February 18.30 18.30 18.60 -1.61% Other Services Thousands February 11.60 11.60 11.10 4.50% Government Thousands February 84.10 81.90 81.70 2.94% Federal Government Thousands February 14.20 14.20 14.50 -2.07% State Government Thousands February 27.40 26.30 26.60 3.01% State Education Thousands February 8.60 8.20 8.60 0.00% Local Government Thousands February 42.50 41.40 41.70 1.92% Local Education Thousands February 24.50 23.50 23.80 2.94% Tribal Government Thousands February 3.40 3.40 3.50 -2.86%Labor Force Alaska Thousands February 362.85 362.29 362.57 0.08% Anchorage & Mat-Su Thousands February 203.34 204.66 200.20 1.57% Fairbanks Thousands February 46.41 46.15 45.45 2.11% Southeast Thousands February 35.59 35.33 37.24 -4.43% Gulf Coast Thousands February 38.04 38.15 39.38 -3.40%Unemployment Rate Alaska Percent February 7.6 7.1 7.8 -2.56% Anchorage & Mat-Su Percent February 6.4 5.9 6.4 0.00% Fairbanks Percent February 6.5 6.2 6.7 -2.99%

Year Over Year

Change

YearAgo

Period

Previous ReportPeriod

(revised)Latest Report

PeriodPeriodUnitsIndicator



Southeast Percent February 8.9 8.4 9.0 -1.11% Gulf Coast Percent February 9.3 9.3 9.0 3.33%United States Percent February 5.5 5.7 7.0 -21.43%

PETROLEUM/MININGCrude Oil Production—Alaska Millions of Barrels February 13.82 15.65 14.42 -4.16%Natural Gas Field Production—Alaska Billions of Cubic Ft. February 7.77 8.79 7.64 1.70%ANS West Coast Average Spot Price $ per Barrel February 53.85 48.87 106.3 -49.34%Hughes Rig Count Alaska Active Rigs February 10 10 13 -23.08% United States Active Rigs February 1348 1683 1769 -23.80%Gold Prices $ Per Troy Oz. February 1229.15 1250.59 1300.97 -5.52%Silver Prices $ Per Troy Oz. February 16.84 17.10 20.83 -19.16%Zinc Prices Per Pound February 2.10 2.11 2.04 2.94%

REAL ESTATEAnchorage Building Permit Valuations Total Millions of $ 32.38 34.20 61.70 -47.52% Residential Millions of $ 7.15 7.77 8.53 -16.18% Commercial Millions of $ 18.42 14.74 28.84 -36.13%Deeds of Trust Recorded Anchorage—Recording District Total Deeds February 674 604 467*GeoNorth 44.33% Fairbanks—Recording District Total Deeds February 169 134 135 25.19%

VISITOR INDUSTRYTotal Air Passenger Traffic—Anchorage Thousands February 311.30 343.28 299.94 3.79%Total Air Passenger Traffic—Fairbanks Thousands February 67.03 72.20 71.27 -5.95%

ALASKA PERMANENT FUNDEquity Millions of $ February 53587.40 52358.40 48585.80 10.29%Assets Millions of $ February 54604.40 53396.30 49180.60 11.03%Net Income Millions of $ February 247.90 161.10 204.00 21.52%Net Income—Year to Date Millions of $ February 1198.50 -32.80 -725.40 265.22%Marketable Debt Securities Millions of $ February -83.20 196.10 72.90 -214.13%Real Estate Investments Millions of $ February -19.70 142.80 82.40 -123.91%Preferred and Common Stock Millions of $ February 1055.40 -244.60 -857.40 223.09%

BANKING (excludes interstate branches)Total Bank Assets—Alaska Millions of $ 4thQ14 3,994.74 5,781.68 5,394.16 -25.94% Cash & Balances Due Millions of $ 4thQ14 207.48 299.37 141.17 46.97% Securities Millions of $ 4thQ14 154.35 146.66 143.34 7.68% Net Loans and Leases Millions of $ 4thQ14 2,313.63 2,742.89 2,543.77 -9.05% Other Real Estate Owned Millions of $ 4thQ14 10.57 18.01 17.58 -39.87%Total Liabilities Millions of $ 4thQ14 3,506.48 5,002.29 4,656.83 -24.70% Total Bank Deposits—Alaska Millions of $ 4thQ14 3,340.30 4,346.55 4,046.21 -17.45% Noninterest-bearing deposits Millions of $ 4thQ14 1,000.84 1,830.26 1,623.39 -38.35% Interest- bearing deposits Millions of $ 4thQ14 2,327.83 2,516.30 2,422.82 -3.92%

FOREIGN TRADEValue of the Dollar In Japanese Yen Yen February 118.65 118.49 102.13 16.18% In Canadian Dollars Canadian $ February 1.25 1.20 1.11 12.61% In British Pounds Pounds February 0.65 0.66 0.60 8.33% In European Monetary Unit Euro February 0.88 0.86 0.73 20.55% In Chinese Yuan Yuan February 6.15 6.14 6.11 0.65%

Notes:1. Source of Anchorage Deeds of trust (GeoNorth) is cited in the data field.2. Banking data has been updated to include Alaska State Banks and Alaska’s sole federally chartered, Alaska-based bank, First National Bank Alaska

Year Over Year

Change

YearAgo

Period

Previous ReportPeriod

(revised)Latest Report

PeriodPeriodUnitsIndicator



Advanced Physical Therapy of Alaska .................................................31

AE Solutions Alaska LLC .........................84Alaska Air Cargo - Alaska Airlines ...........9Alaska Aviation Heritage Museum ..... 122Alaska Logistics ......................................... 72Alaska Mergers & Acquisitions LLC .... 40Alaska Railroad .......................................... 58Alaska Rubber ............................................98Alaska Sleep Doctor ..................................21Alaska Spine Institute ...............................21Alaska Traffic Company ...........................41Alaska USA Federal Credit Union ..........77Alaska USA Insurance Brokers ...............79Alyeska Resort ............................................ 15American Marine/Penco ....................... 126Anchorage Sand & Gravel ........................97Arctic Office Products ..............................27ASRC Energy .............................................. 83AT&T ............................................................. 29Bering Air Inc� ...........................................123Bettisworth North ..................................105Bowhead Transport Co� LLC ...................59Boyer Towing ............................................. 58Builders Choice ........................................103

Business Insurance Associates Inc� .......35C&R Pipe and Steel Inc� ..........................125Calista Corp� ................................................51Carlile Transportation Systems .... 25, 131Chris Arend Photography .....................130CIRI Alaska Tourism .................................114Construction Machinery Industrial .........2Cook Inlet Tug & Barge Inc� .....................56Cornerstone Advisors ...............................33Crowley Alaska Inc� ...................................75Cruz Construction Inc. ............................. 99Delta Rental Services ...............................98Diamond Airport Parking ...................... 110Donlin Gold ..................................................52EDC Inc� ....................................................100Everts Air Cargo -

Tatonduk Outfitters ............................53Explore Fairbanks..................................... 115Fairweather LLC .........................................81First National Bank Alaska ........................5GCI ........................................................78, 132Granite Construction ................................95Great Originals Inc� ....................................52Helimax Aviation ........................................45HDL Hattenburg Dilley & Linnell .......... 87

Holmes Weddle & Barcott.......................19Homer Marine Trades Assoc� ...............125Horizon Lines ..............................................74Island Air Express .................................... 122Judy Patrick Photography ........................35Landye Bennett Blumstein LLP ..............19Lynden Inc� ...................................................61Magtec Energy ...........................................88N C Machinery ...........................................111Northern Air Cargo .........................116, 117Northrim Bank ............................................ 11NPC Energy Services ................................32Olgoonik Corp� ...........................................89Olympic Tug & Barge .............................. 60Oxford Assaying & Refining Inc� ......... 124Pacific Alaska Freightways Inc� ..............39Pacific Coast Maritime ........................... 60Pacific Pile & Marine .............118, 119, 120Parker Smith & Feek ..................................37PenAir ............................................................65Personnel Plus ..........................................123Plans Room .............................................. 108Princess Lodges ........................................114ProComm .....................................................56Ravn Alaska.................................................. 13

RSA Engineering Inc� ..............................109Ryan Air ........................................................71Safway Group Holding LLC .....................97SeaTac Marine Service ............................ 60Shoreside Petroleum/Petro Marine ......43 Span Alaska Transportation Inc� ........... 69Spenard Builders Supply .......................101STEELFAB ................................................... 94Stellar Designs Inc�...................................125Stephl Engineering LLC..........................109Ted Stevens International Airport .........63Totem Ocean Trailer Express ..................73Trailercraft Inc/Freightliner of AK .........67TriJet Precision ..........................................82Turnagain Marine Construction .........100UIC Commercial Services ....................... 78Ukpeagvik Inupiat Corporation ............. 85Vigor Alaska .................................................57Visit Anchorage ........................................ 113Washington Crane & Hoist .....................23Waste Management ................................. 87Wealth Strategies of Alaska .................... 17XTO Energy Inc� ...........................................3Yukon Equipment Inc. ...............................91

A D V E R T I S E R S I N D E X

Documents

Alaska Business Monthly June 2015